Putative-farnesoic acid O-methyltransferase (FAMeT) in medfly reproduction

A r t i c l e

PUTATIVE-FARNESOIC ACIDO-METHYLTRANSFERASE (FAMeT)IN MEDFLY REPRODUCTION

Laura Vannini, Silvia Ciolfi, Romano Dallai,and Francesco FratiDepartment of Evolutionary Biology, University of Siena, Siena, Italy

Klaus H. Hoffmann and Martina Meyering-VosDepartment of Animal Ecology I, University of Bayreuth, Bayreuth,Germany

A gene potentially involved in juvenile hormone (JH) biosynthesis waspreviously identified in Ceratitis capitata as the putative-farnesoic acidO-methyltransferase (FAMeT). Since JH is involved in insect repro-duction, we silenced the putative-FAMeTexpression by RNA interferencein Ceratitis capitata to evaluate its implication in egg production.FAMeT gene expression was knocked down in females and males aftereclosion and in 1- and 2-day-old females. Treated specimens were left tomate with each other or with untreated partners to evaluate the extent ofeach sex influencing egg production. Gene silencing was investigated byReal-Time PCR. Results unambiguously showed that FAMeT has ameasurable role on the fertility of both medfly sexes. �C 2010 WileyPeriodicals, Inc.

Keywords: medfly; juvenile hormone; Real-Time PCR; RNA interference

INTRODUCTION

Farnesoic acid O-methyltransferase (FAMeT) catalyzes the methylation of farnesoicacid (FA) to methyl farnesoate (MF) in one of the insect juvenile hormone (JH)biosynthetic pathways (Feyereisen et al., 1981; Hui et al., 2010). The main enzymeknown to be involved in methylation of FA is the juvenile hormone acidO-methyltransferase (JHAMT) in Diptera (Niwa et al., 2008; Mayoral et al., 2009),

Grant sponsor: MIUR; Grant number: PRIN 2006–2008; Grant sponsor: University of Siena.Correspondence to: Dr. Laura Vannini, Department of Evolutionary Biology, University of Siena, via A.Moro 2, 53100, Siena, Italy. E-mail: [email protected]

ARCHIVES OF INSECT BIOCHEMISTRY AND PHYSIOLOGY, Vol. 75, No. 2, 92–106 (2010)

Published online in Wiley Online Library (wileyonlinelibrary.com).

& 2010 Wiley Periodicals, Inc. DOI: 10.1002/arch.20382

whereas the role of FAMeT is still almost unknown. Ceratitis capitata Wiedemann(Diptera, Tephritidae), also referred to as the Mediterranean fruit fly or the medfly, isone of the most relevant agricultural pests in the Mediterranean area, parts of Centraland South America, and tropical Africa (Malacrida et al., 2006) where this species mayinfest over 250 host species among fruits, nuts, and vegetables (Liquido, 1991).Insecticide treatments and the sterile insect technique (SIT) are the most widely usedmethods against this pest despite the limitations of these approaches (Peck andMcQuate, 2000; Rossi and Rainaldi, 2000; Karalliedde et al., 2001; Bisset, 2002;Robinson, 2002; Enkerlin, 2005; Magana et al., 2007). A transcript referred to asputative-FAMeT is known in C. capitata (GenBank accession no. EU596457), which hasa pre-imaginal life expression profile consistent with the JH titers in Holometabola,and this led to the assumption that this gene is involved in JH biosynthesis (Vanniniet al., 2010). Juvenile hormone has a central role in the growth, development, andreproduction of arthropods since it is involved in many physiological processes, such asmoulting and metamorphosis, oogenesis and embryogenesis (Belles et al., 2005). Anyinterference in JH biosynthesis, using JH agonists or antagonists, produces anomalousdevelopment or disorders on reproduction of the target species. Thus, JH biosynthesisis a potential target for strategies in insect pest control (Hoffmann and Lorenz, 1998;Tunaz and Uygun, 2004).

In light of the previous study that hypothesized the role of medfly putative-FAMeTin JH biosynthesis (Vannini et al., 2010) and considering the role of JH inreproduction, we examined the extent to which the putative-FAMeT is involved inmedfly egg production through RNA interference (RNAi), an RNA-mediated genesilencing. RNAi is a conserved mechanism in eukaryotes allowing the knockdown ofgenes to investigate their functions in vivo in a highly specific way (Fire et al., 1998;Agrawal et al., 2003; Mello and Conte, 2004). Injection of long double-stranded RNA(dsRNA) fragments into the insects’ body cavity can silence endogenous genetranscripts carrying identical sequences (Amdam et al., 2003; Goto et al., 2003;Meister and Tuschl, 2004; Meyering-Vos and Muller, 2007; Griebler et al., 2008;Tomoyasu et al., 2008). First, we established the number of laid eggs daily over the twoweeks following eclosion and then we injected specific dsRNA for medfly putative-FAMeT (dsFAMeT) in recently emerged males and females, and in 1- and 2-day-oldfemales. Successively, gene knockdown was investigated by quantitative Real-TimePCR (qRT-PCR). The results indirectly assessed the effective role of the putative-FAMeT in JH biosynthesis as already hypothesized in Vannini et al. (2010) andunambiguously showed that putative-FAMeT is highly involved in medfly eggproduction and oviposition, suggesting a role in male and female fertility for thisgene. The interest of this work lies in the fact that the post-transcriptional FAMeTsilencing may be a powerful instrument in controlling the worldwide pest C. capitatasince it allows high species-specific interference with reproduction.

MATERIALS AND METHODS

Medfly Rearing

Ceratitis capitata flies were reared in standard laboratory conditions following Rabossiet al. (1991). In order to determine the daily number of eggs produced, emergingadults were isolated 12 h after eclosion and kept in plastic cages (12.5� 6�6 cm)

Medfly Putative-FAMeT Silencing � 93

Archives of Insect Biochemistry and Physiology

closed with gauze through which eggs were laid. Eight cages containing four femalesand four males were prepared for each experiment and the number of eggs laid percage was monitored for 14 days, given that during the first two weeks of female adultlife there is the largest egg production.

The average daily number of eggs produced was calculated as the number of eggsproduced daily in each cage divided by the number of females that survived up to thatday and the obtained values were averaged. The amount of eggs produced by virginfemales was also established in experimental cages where males were not introduced.

Sampling, RNA Extraction, and Reverse Transcriptase-Polymerase Chain Reaction(RT-PCR)

To investigate the putative-FAMeT mRNA expression level in adult females, pools ofsix females (approximately 50 mg) were collected and prepared for two-step qRT-PCRanalysis. Independent pools were made with females after eclosion and with females ateach age from day 1 to 14. To inspect the FAMeT transcription rate in females treatedafter eclosion and on day 1 (for treatment details see below), pools of six females, 1-, 2-,3-, 5-, and 9-day-old, were collected. Three replicates of each sample were carried out.

Each batch of samples was frozen in liquid nitrogen and subsequentlyhomogenized using a Polytron homogenizer (Kinematica AG, Lucerne, Switzerland).Total RNA was extracted from six individuals (50 mg) as described in Chomczynskiand Sacchi (1987). For each sample, 1mg of total RNA was used to make Oligo(dT)cDNA using M-MLV Reverse Transcript RNase H minus, Point Mutant (Promega,Madison, WI), according to the manufacturer’s instructions.

dsRNA Synthesis

To obtain a dsRNA corresponding to most of the coding region of the C. capitataputative-FAMeT (GenBank accession no. EU596457), cDNA was made as describedabove and two species-specific primers elongated by the T7 promoter tail at their 50

end (Table 1) were used in the following amplification. PCR conditions were: 951C for1 min, 521C for 1 min, 721C for 1 min, for 35 cycles. PCR amplification was performedin a total reaction volume of 25 ml containing 1 ml of cDNA, 1 mM dNTPs, 1� PCRreaction buffer (Fermentas, Canada, Burlington), 2.5 mM Mg21, 1 mM each of the

Table 1. Designed Primers Used in qRT-PCR and in RNAi Experiments�

qRT-PCR

Gene Name Sequence 50-30 Amplicon length E(%) S

b-tub Cc_TUB_FW TCGTCGAATGGATTCCAAAT 195 bp 95,5 �3,435Cc_TUB_RV TTTCATCCATACCTTCGCCTG

FAMeT Cc_FAMeT_FW CAGCGAACTACCACCCTTTG 165 bp 99,5 �3,333Cc_FAMeT_RV TCATGTTTATTCACCTCCTCACC

RNAi

Species Name Sequence 50-30

C. capitata T7_FAMeT_FW TAATACGACTCACTATAGGGAAATGGCTGAACACCACTGGGT7_FAMeT_RV TAATACGACTCACTATAGGGCCTCATAATTGGTCAGTGTCACCTCC

G. bimaculats T7GbSKf10 TAATACGACTCACTATAGGGAAGCGCCCCTGCACTCGCAT7GbSKr10 TAATACGACTCACTATAGGGACTGCCTCTTGCTCATCTCGC

�E 5 efficiency; S 5 slope.

94 � Archives of Insect Biochemistry and Physiology, October 2010


forward and reverse primers, and 1U of recombinant Taq DNA polymerase(Fermentas). The PCR product was gel purified (GFX PCR DNA and Gel BandPurification kit, Amersham, Piscataway, NJ), cloned in a pGEM-T easy vector(Promega), and clones were sequenced in both directions to confirm specificity. Oneclone identified as FAMeT was used as a template in a second PCR in the sameconditions with the same primers. The PCR product was gel purified (GFX PCR DNAand Gel Band Purification kit, Amersham) and 1mg (Z170 ng/ml) was used in an invitro transcription (MEGAscript High Yield Transcription Kit, Ambion, Austin, TX)following the manufacturer’s specifications to make a C. capitata putative-FAMeTdsRNA, namely dsFAMeT. Lithium chloride precipitation was carried out to purify theproduct of the transcription reaction adding 15 ml of nuclease-free water and 30 ml ofLiCl Precipitation Solution (Ambion). The reaction was chilled overnight at �701C andcentrifuged at 41C for 15 min at maximum speed on a microcentrifuge to pellet theRNA. The pellet was rinsed with 1 ml 70% ethanol and resuspended in 50 ml ofnuclease-free water (not DEPC-treated). Double-strand RNA was denatured for 5 minat 951C and annealed at room temperature overnight. Quantification of the dsRNAwas done spectrophotometrically (A 5 260 nm) and the absence of incompletetranscript products was checked by running 200 ng of the sample in a 1.5% agarosegel in 1� TBE (in DEPC water). The Mediterranean field cricket Gryllus bimaculatus(Orthopteroidea; Gryllidae) sulfakinin gene (SK, GenBank accession no. AM403493)was amplified with the primers reported in Table 1 and processed in the same way toobtain dsRNA (dsSK).

Injections

The dsFAMeT obtained by in vitro transcription was diluted in the injection buffer(0.1 M phosphate buffer pH 6.8, 10 mM KCl) to obtain concentrations ranging from0.3 to 2.5 mg/ml. Injections were performed introducing 1 ml of this solution with a 10-mlHamilton syringe (Hamilton AG, Bonaduz, Switzerland) equipped with a 40-gaugeneedle into the intersegmental membrane between the ventral thoracic segments.

The optimal concentration of dsRNA to be injected was determined on the basis ofa preliminary series of injections (0.3, 0.5, 0.75, 1, 1.5, 2, 2.5 mg of dsFAMeT). Eggsproduced by females injected with various concentrations of dsFAMeT were counteddaily for 7 days and since 1.5 mg of dsFAMeT had the most severe effect on dailyoviposition rate (data not shown), this was the amount chosen for subsequent injectionsperformed in a final volume of 1 ml.

Injections were performed in males and females after eclosion (recently emerged)since they tolerated the treatment well (Table 2). Thereafter, injected females were matedwith non-injected males and injected males were mated with non-injected females; inaddition, treated males were allowed to mate with treated females. Females 1 and 2 daysold also were treated to verify with a delayed injection possible effects on oviposition.

The transcript corresponding to a G. bimaculatus SK gene fragment (dsSK) wasinjected into males and females after eclosion as non-specific dsRNA, which was usedas a control.

Quantitative Real-Time PCR

FAMeT expression was evaluated in adult females, both injected and non-injected withspecific (dsFAMeT) and non-specific (dsSK) dsRNA by qRT-PCR in a 7500 Real-TimePCR System (Applied Biosystems, Carslbad, CA). b-tubulin (b-tub) was chosen to



normalize the expression values of the gene (Vannini et al., 2010). Primers weredesigned through a Beacon Designer 2.06 (Premier Biosoft International, Palo Alto, CA)using medfly b-tub and FAMeT sequences available in GenBank (accession nos.EU665678 and EU596457, respectively). Special attention was given to the annealingtemperature, base composition and 30-stability (for primers details see Table 1).

Each reaction was run in triplicate and no-template negative controls were added.Each reaction contained 0.8 ml of cDNA (about 32 ng), 0.6 ml of each primer (10 mM,Invitrogen, Carlsbad, CA), 10 ml of 2X iQ SYBR Green Supermix with Rox (Biorad,Hercules, CA) and RNase/DNase-free sterile water for a total volume of 20 ml. After aninitial incubation at 951C for 1 min, the thermal profile consisted of 40 cycles ofdenaturation at 951C for 10 sec and annealing/polymerization at 601C for 30 sec. Tocontrol the specificity of each amplification, a melting curve analysis was performedincreasing the temperature by 0.51C every 10 sec from 561 to 951C. Dissociation curveanalysis produced a single melting peak for each of the two genes, demonstratingspecificity in the amplification. An internal standard curve based on five serial dilutions(1:10) was constructed for both genes in each plate. Standards were the samefragments cloned in the pGEM-T easy vector (Promega) and assayed in qRT-PCR. Theinitial concentration of the clones was 20.5 ng/ml for FAMeT and 83 ng/ml for b-tub. Therelative expression level of putative-FAMeT was determined relative to the b-tubtranscript by the DDCt method (Pfaffl, 2001). DDCt values have been reported asnormalized expression values (n.e.v.).

Statistical Data Analysis

Data relative to the daily egg production were reported as mean7SEM and data relativeto putative-FAMeT transcriptional rate were reported as mean7SD One-way analysis ofvariance (ANOVA) was conducted to test for treatment differences in egg productionand putative-FAMeT expression, considering a significance level of Po0.05. Beforerunning ANOVA, the assumptions of normality and homogeneity of variance werechecked, respectively, by Shapiro-Wilk’s test and Levene’s test. Data were log(x11)transformed when assumptions were not tenable. Statistical analyses were performedusing the R statistical software version 2.9.2 (R Development Core Team, 2009).

Table 2. Survival Percentage of Females and Males Over the Two Weeks After Eclosion�

Age (days)

Survival% of Status 1 2 3 4 5 6 7 8 9 10 11 12 13 14

Females NI 96,8 96,8 96,8 96,8 96,8 96,8 96,8 96,8 96,8 93,7 93,7 93,7 93,7 93,7I_dsSK_AE 100 100 100 100 87,5 81,2 81,2 80,6 78,1 78,1 75 75 71,9 71,9I_dsFAMeT_AE 100 100 93,8 93,8 90,6 87,5 87,5 84,4 84,4 81,3 59,4 46,9 40,6 40,6I_dsFAMeT_1D 100 100 81,2 78,1 71,9 68,8 68,8 68,8 68,8 68,8 56,4 56,4 43,8 40,6I_dsFAMeT_2D 100 100 100 87,5 78,1 78,1 78,1 78,1 78,1 78,1 59,4 59,4 56,2 53,1

Males NI 100 100 100 100 100 100 100 96,8 96,8 96,8 96,8 96,8 96,8 96,8I_dsSK_AE 100 96,8 93,8 93,8 93,8 90,6 90,6 90,6 90,6 90,6 90,6 90,6 87,5 87,5I_dsFAMeT_AE 100 96,8 96,8 96,8 90,6 90,6 90,6 90,6 90,6 87,5 78,1 50 43,8 43,8

�NI: non-injected; I_dsSK_AE: injected with dsSK after eclosion; I_dsFAMeT_AE: injected with dsFAMeT aftereclosion; I_dsFAMeT_1D: injected with dsFAMeT at day 1 of adult life; I_dsFAMeT_2D: injected with dsFAMeT atday 2. Grey boxes underline the sharp decrease in survival percentage of individuals injected with dsFAMeT. n 5 32.



RESULTS

Oviposition by Mated and Unmated Females

On day 3, mated females started consistent oviposition and reached a maximum rateon day 5. Egg laying decreased sharply from day 6 to day 10. Oviposition rateup-surged again on day 11 and finally decreased on day 13 (Fig. 1).

Egg production rate of C. capitata virgin females was drastically lower compared tomated females (Fig. 1). Virgin females started egg production on day 3 as in matedfemales, but they reached the oviposition peak one day earlier. Also, the second peak inthe oviposition rate on day 9 occurred two days earlier than in mated females (Fig. 1).The down-regulation of egg laying in virgin females was particularly evident in thefirst 8 days of the oviposition period.

FAMeT Silencing and Oviposition Rate

Controls. Gryllus bimaculatus dsSK was injected in medfly females and males aftereclosion as a control. This unspecific control dsRNA seemed to have little effect on theoviposition rate compared to that of untreated flies (Fig. 2). There was a 13.1%reduction of laid eggs in injected females mated with untreated males and a 14.9%reduction in untreated females mated with injected males. In addition, males seemedto tolerate unspecific dsRNA injection better than females with a death rate reductionof 9.4% compared to 21.9% of females over the first 10 days (Table 2).

dsFAMeT Injection in Females After Eclosion

Females were injected after eclosion with 1.5 mg of dsFAMeT according to preliminaryexperiments performed to determine the amount of dsFAMeT that down-regulatesoviposition rate most (data not shown).

The egg-laying profile in treated females was similar to that of untreated femaleswith two peaks in the oviposition rate, the first on day 5 and a smaller one on day 11.However, after injection, female fecundity was clearly reduced as a consistent decreasein the number of laid eggs was observed (Fig. 3A). The effect of dsFAMeT injectionseemed to be stronger in the first 7 days. Untreated females started consistent

Figure 1. Oviposition of non-injected females mated with non-injected males (dark grey) compared to egglaying of non-injected virgin females (light-grey). Means7SEM, n 5 32.



oviposition on day 3, but there was little production on day 2 as well. Oviposition intreated females was delayed, starting on day 3 and never reached the levels detected inuntreated specimens.

The amount of eggs laid by treated females over the entire 14-day observationperiod was in total 57.2% compared to the controls and 59.6% on day 5, the ovipositionpeak in untreated females.

dsFAMeT Injection in Males After Eclosion

Injections were also performed in males after eclosion under the same conditions usedfor females. Males were then mated with non-injected females and the daily ovipositionrate was established.

Injections of dsFAMeT in males led to a reduction of female fecundity, whichseemed to be strongest from day 5 to 9 (Fig. 3B). The first peak in oviposition rateoccurred one day earlier with respect to non-injected females (day 4). From day 10 to 14,the amount of laid eggs produced was comparable to that of non-injected females matedwith non-injected males. The amount of laid eggs over the 14 days was 55.8%, apercentage similar to the effect observed in treated females, but the oviposition ratedropped by 50.5% compared to that of treated females on day 5.

Mating of Males and Females Injected With dsFAMeT

The daily oviposition rate was drastically reduced when females after eclosion weremated with males treated with the same dose of dsFAMeT (1.5 mg) (Fig. 3C). On thefirst few days after treatment, the number of laid eggs declined sharply butup-surged again after day 5. Considering the oviposition rate of non-treated females,fecundity was significantly compromised until day 9 when egg production peaked intreated animals. The number of laid eggs was slightly reduced with respect tonon-treated females on the last day. Treated females produced 26% of total eggs laidby untreated flies over the 14 days, whereas the treated fly oviposition rate decreasedto 22% on day 5.

Figure 2. Daily laid eggs of females non-injected (~NI) mated with males non-injected (#NI) against:females injected with dsSK (~I) mated with males non-injected; females non-injected mated with malesinjected with dsSK (#I). Means7SEM, n 5 32.



dsFAMeT Injection in 1- and 2-Day-Old Females

Injections of dsFAMeT were also performed in 1- and 2-day-old females in an attemptto obtain better silencing of the oviposition peak on day 5.

Injections on the first day of adult life seemed to be more effective than injectionsin flies after eclosion, whereas injections on the second day had little effect (Fig. 4).Survival percentage was lower in females injected at day 1 and 2 than in females

Figure 3. Daily laid eggs. ~NI: females non-injected; #NI: males non-injected; ~I: females injected with1.5mg of dsFAMeT; #I: males injected with 1.5mg of dsFAMeT. Means7SEM, n 5 32.



injected after eclosion (Table 2) indicating that flies were more sensitive to the simpleinjection after the first few hours of adult life, especially in 1-day-old females; for thisreason we focused on flies injected after eclosion.

To exclude the fact that the slight effect observed in the oviposition rate of femalesinjected at day 2 was due to the amount of dsFAMeTused, a smaller and bigger dose ofdsRNA (1 and 2 mg) was injected. The result showed that changing quantities also haslittle effect on fecundity in these females (data not shown).

Putative-FAMeT Expression in Untreated Flies

A main target of this study was to quantify the putative-FAMeT mRNA production inthe first 2 weeks of female life and to evaluate whether silencing of FAMeTcan compromise the oviposition rate by qRT-PCR. As shown in Figure 5, this

Figure 4. Daily laid eggs of non-injected females (~NI) mated with non-injected males (#NI) against:injected females at day 1 (~I_1D) and injected females at day 2 (~I_2D) mated with non-injected males.Means7SEM, n 5 32.

Figure 5. Relative transcript levels of the putative-FAMeT in whole body of untreated females of C. capitata.Values have been normalized following the DDCt method (Pfaffl, 2001). Mean7SD, n 5 3.



O-methyltransferase transcript was at the minimum level in 13-day-old females (20.55n.e.v.) and had two peaks of expression. The higher peak was at the second day ofadult life (56.24 n.e.v.) and the other at days 9 and 10 of adult life (48.23 and 47.01n.e.v.). Between these two stages, there was a decrease in putative-FAMeT expressionlevel with the lowest expression in 5-day-old females (25.43 n.e.v.).

Putative-FAMeT Expression in Treated Flies

FAMeT expression was evaluated by qRT-PCR in females injected with dsFAMeT aftereclosion and at day 1 in order to evaluate the occurrence of gene silencing. To excludeany possible unspecific interference of dsRNA injection with gene transcription,FAMeT expression was detected also in females injected with dsSK after eclosion. Noconsistent reduction of FAMeT transcriptional levels was observed on the injectionfollowing day which otherwise seemed to be highly reduced (66.5%) two days afterinjection in females treated after eclosion. RNA silencing seemed to be effective untilday 9. Females treated at day 1 soon showed a lower FAMeT transcription rate, whichremained low throughout. Injection of dsSK had little effect on the FAMeT expressionlevel (Fig. 6).

DISCUSSION

Putative-FAMeT titers seem to be regulated at different times in adult females. SinceFAMeT has been suggested as to be involved in JH biosynthesis, we correlated itsexpression profile with the only known JH titers in the medfly reported by Moshitzkyet al. (2003). We speculate that the first FAMeTexpression peak could be related to theJH peak and that it is likely that the increase of JH between days 3 to 6 is correlated tothe high amount of eggs laid between day 3 to 7. Due to this consideration, a future

Figure 6. Putative-FAMeT expression in untreated females against treated females. Dark grey: untreated;black: unspecific control; light grey: injected after eclosion with dsFAMeT; white: injected 1-day-old withdsFAMeT. Values have been normalized following the DDCt method (Pfaffl, 2001). Mean7SD, n 5 3,ANOVA 5 Po0.05.



study addressed to establish whether JH titers in the medfly are influenced by FAMeTsilencing should be encouraged.

Transcript levels of putative-FAMeT were drastically reduced after injection ofdsFAMeT in females after eclosion and in 1-day-old females, whereas injection of dsSKdid not seem to affect the FAMeT transcriptional rate (Fig. 6) suggesting a specific andsystemic effect of RNAi. However, dsFAMeT injections did not allow completesilencing of the gene since a little expression was found in treated flies. Althoughcomplete gene silencing was demonstrated in honeybees (Farooqui et al., 2004), theincomplete silencing of target genes by RNAi has been reported in other species (Gotoet al., 2003; Meyering-Vos et al., 2006). Gene silencing in medflies was effective for along time after treatment and was even able to interfere with the second geneexpression peak (Fig. 6).

Injections of dsFAMeTwere shown to interfere with egg production in females andfertility in males (Fig. 3). A drastic reduction in the number of laid eggs occurred wheninjected males and females were mated, with an overall effect comparable to the sum ofthe effects detected when individuals of both sexes were mated with a non-treatedpartner. Males and females seemed poorly sensitive to simple injections of 1.5 mg ofdouble-strand RNA (in this case G. bimaculatus dsSK) (Fig. 2) pointing out a slightaspecific effect on the observed fertility (13.1% for females and 14.9 % for males), butcould not completely explain the profound effect observed when the same amount ofspecific dsFAMeT was injected. This evidence suggests a significant role for FAMeT onthe fertility of both medfly sexes and inevitably leads to an indirect correlation with therole of JH in insects, in the light of the previous observations on FAMeT in JHbiosynthesis, reported in Vannini et al. (2010), and considering that JH is involved inseveral aspects of fertility in both sexes in insects. The relation between JH and theputative-FAMeT genes isolated so far in insects is unclear. The gene is only knownin the dipterans Drosophila melanogaster (GeneBank accession no. CG10527) andC. capitata (GeneBank accession no. EU596457), and in the hymenopteran Meliponascutellaris (Genebank accession nos.: CAM35481, isoform 1; CAM35482, isoform 2).The Drosophila putative-FAMeT protein cannot convert FA to MF (Burtenshaw et al.,2008). In Melipona, where two isoforms exist, only the expression of isoform 2transcript seems to be negatively modulated by topical application of JH-III to larvae(Vieira et al., 2008). The putative-FAMeT transcript isolated in C. capitata shows a lowsimilarity with both these sequences and the only evidence of its role in JH biosynthesisis that its pre-imaginal expression profile may be related to JH titers in Holometabola(Vannini et al., 2010). The influence of JH in egg maturation in insects varies fromspecies to species: vitellogenin synthesis by fat body, separation of a new follicle fromthe germarium, previtellogenic growth of the oocytes, and vitellogenesis. Stimulationof vitellogenin synthesis by JH occurs in all major taxa examined so far, fromapterygotes to Diptera, and is one of the major and best-known roles of JH in insectreproduction (Nijhout, 1994; Wyatt and Davey, 1996; Handler, 1997; Belles, 1998;Borst et al., 2000; Pellissier Scott et al., 2004; Simonet et al., 2004; Corona et al., 2007;Dong et al., 2009). JH controls male accessory gland secretion and consequently affectsfemale reproduction, since sperm fluid substances may modulate JH synthesis infemales after mating (Hartfelder, 2000) and, in turn, vitellogenin synthesis rate. The‘‘sex peptide’’ identified in such secretion in D. melanogaster has been directlycorrelated with several post-copulatory changes in female behaviour such as mate-rejection and oviposition behaviour in mated females (Schmidt et al., 1993). Thesevere effects on the reproductive cycle of the medfly caused by FAMeT interference



can be related to the function of JH, which is involved in various reproductivemechanisms such as egg maturation in females and secretion of accessory glandsin males, other than several post-mating behaviours in females. The decrease inC. capitata egg production by untreated females mated with treated males (Fig. 3B)showed a profile similar to that of virgin females (Fig. 1) suggesting that matingtriggers several mechanisms that had been severely compromised by FAMeT silencingin males.

FAMeT dsRNA injected in 2-day-old females had a weaker effect on theoviposition rate compared to that observed with dsFAMeT injections in youngerfemales (Fig. 4). We cannot exclude that treating flies at the peak of gene expressionleads to incomplete depletion of the protein in the tissues causing little effect onoviposition, which is probably controlled at this stage of female adult life. Earlysuppression of FAMeT expression seems to be necessary for interfering with thefunction of the enzyme.

A secondary effect of RNAi was the decrease in survival rate in dsFAMeT-treatedindividuals (Table 2). Females and males injected after eclosion as well as femalesinjected at day 1 and day 2 showed a consistent increase in death rate from day 11 (thisdecrease is not evident in samples treated with control dsRNA). In the light of thisfinding, we propose a potential role of Ceratitis putative-FAMeT on some traitscorrelated with longevity.

The present study points out the effect of FAMeT silencing in adult medflies, andthe extent to which it affects offspring, reducing female and male reproductivecapabilities by 44.2 and 42.8%, respectively. When males and females, both treated,were left to mate, fertility decreased by 74% and such data may have importantimplications for planning control strategies based on the reduction of the reproductivesuccess of this pest. Post-transcriptional FAMeTsilencing, therefore, may be a powerfulinstrument in controlling the medfly.

ACKNOWLEDGMENTS

We thank Marion Preiss (Department of Animal Ecology I of Bayreuth) for technicalassistance and Dr. Mauro Taormina (Department of Evolutionary Biology of Siena) forstatistical analysis of data. The work was supported by the University of Siena (P.A.R.).All experiments described in this work have been performed in compliance with thecurrent laws in Italy.

LITERATURE CITED

Agrawal N, Dasaradhi PVN, Mohmmed A, Malhotra P, Bhatnagar RK, Mukherjee SK. 2003.RNA interference: biology, mechanism, and applications. Microbiol Mol Biol Rev 67:657–685.

Amdam GV, Simoes ZL, Guidugli KR, Norberg K, Omholt SW. 2003. Disruption of vitellogeningene function in adult honeybees by intra-abdominal injection of double-stranded RNA.BMC Biotechnol 3:1–8.

Belles W. 1998. Endocrine effectors in insect vitellogenesis. In: Coast GM, Webster SG, editors.Recent Advances in Arthropod Endocrinology. Cambridge: Cambridge University Press.p 71–90.

Belles X, Martin D, Piulachs M-D. 2005. The mevalonate pathway and the synthesis of juvenilehormone in insects. Annu Rev Entomol 50:81–199.



Bisset JA. 2002. Correct use of insecticides: management of resistance. Rev Cubana Med Trop54:202–219.

Borst DW, Eskew MR, Wagner SJ, Shores K, Hunter J, Luker L, Hatle JD, Hecht LB. 2000.Quantification of juvenile hormone III, vitellogenin, and vitellogenin-mRNA during theoviposition cycle of the lubber grasshopper. Insect Biochem Mol Biol 30:813–819.

Burtenshaw SM, Su PP, Zhang JR, Tobe SS, Dayton L, Bendena WG. 2008. A putative farnesoicacid O-methyltransferase (FAMeT) orthologue in Drosophila melanogaster (CG10527):relationship to juvenile hormone biosynthesis? Peptides 29:242–251.

Chomczynski P, Sacchi N. 1987. Single-step method of RNA isolation by acid guanidiniumthiocyanate-phenol-chloroform extraction. Anal Biochem 162:156–159.

Corona M, Velarde RA, Remolina S, Moran-Lauter A, Wang Y, Hughes KA, Robinson GE. 2007.Vitellogenin, juvenile hormone, insulin signaling, and queen honey bee longevity. Proc NatlAcad Sci USA 104:7128–7133.

Dong SZ, Ye GY, Guo JY, Hu C. 2009. Roles of ecdysteroid and juvenile hormone invitellogenesis in an endoparasitic wasp, Pteromalus puparum (Hymenoptera: Pteromalidae).Gen Comp Endocrinol 160:102–108.

Enkerlin WR. 2005. Impact of fruit fly control programmes using the sterile insect technique.In: Dyck VA, Hendrichs J, Robinson AS, editors. Sterile insect technique: principles andpractice in area-wide integrated pest management. Dordrecht: Springer. p 651–676.

Farooqui T, Vaessin H, Smith BH. 2004. Octopamine receptors in the honeybee (Apis mellifera)brain and their disruption by RNA-mediated interference. J Insect Physiol 50:701–713.

Feyereisen R, Pratt GE, Hamnett AF. 1981. Enzymatic synthesis of juvenile hormone in locustcorpora allata: evidence for a microsomal cytochrome P-450 linked methyl farnesoateepoxidase. Eur J Biochem 118:231–238.

Fire A, Xu S, Montgomery MK, Kostas SA, Driver SE, Mello CC. 1998. Potent andspecific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature391:806–811.

Goto A, Blandin S, Royet J, Reichhart J-M, Levashina EA. 2003. Silencing of Toll pathwaycomponents by direct injection of double-stranded RNA into Drosophila adult flies. NucleicAcids Res 31:6619–6623.

Griebler M, Westerlund SA, Hoffmann KH, Meyering-Vos M. 2008. RNA interference with theallotoregulating neuropeptide genes from the fall armyworm Spodoptera frugiperda and itseffects on the JH titer in the hemolymph. J Insect Physiol 54:997–1007.

Handler AM. 1997. Developmental regulation of yolk protein gene expression in Anastrephasuspense. Arch Insect Biochem Physiol 36:25–35.

Hartfelder K. 2000. Insect juvenile hormone: from ‘‘status quo’’ to high society. Braz J Med BiolRes 33:157–177.

Hoffmann KH, Lorenz MW. 1998. Recent advances in hormones in insect pest control.Phytoparasitica 26:1–8.

Hui JHL, Hayward A, Bendena WG, Takahashi T, Tobe SS. 2010. Evolution and functionaldivergence of enzymes involved in sesquiterpenoid hormone biosynthesis in crustaceansand insects. Peptides 31:451–455.

Karalliedde L, Eddleston M, Murray V. 2001. The global picture of organophosphate insecticidepoisoning. In: Karalliedde L, Feldman S, Henry J, Marrs T, editors. Organophosphates andhealth. London: Imperial College Press. p 431–471.

Liquido NJ. 1991. Effect of ripeness and location of papaya fruits on the parasitization rates ofOriental fruit fly and melon fly (Diptera: Tephritidae) by braconid (Hymenoptera)parasitoids. Environ Entomol 20:1732–1736.

Magana C, Hernandez-Crespo P, Ortego F, Castanera P. 2007. Resistance to malathion in fieldpopulations of Ceratitis capitata. J Econ Entomol 100:1836–1843.



Malacrida AR, Gomulski LM, Bonizzoni M, Bertin S, Gasperi G, Guglielmino GR. 2006.Globalization and fruitfly invasion and expansion: the medfly paradigm. Genetica 131:1–9.

Mayoral JG, Nouzova M, Yoshiyama M, Shinoda T, Hernandez-Martinez S, Dolghih E, Turjanski AG,Roitberg AE, Priestap H, Perez M, Mackenzie L, Li Y, Noriega FG. 2009. Molecular andfunctional characterization of a juvenile hormone acid methyltransferase in the corpora allata ofmosquitoes. Insect Biochem Mol Biol 39:31–37.

Meister G, Tuschl T. 2004. Mechanisms of gene silencing by double-stranded RNA. Nature431:343–349.

Mello CC, Conte Jr D. 2004. Revealing the world of RNA interference. Nature 431:338–342.

Meyering-Vos M, Muuller A. 2007. Structure of the sulfakinin cDNA and gene expression fromthe Mediterrranean field cricket Gryllus bimaculatus. Insect Mol Biol 16:445–454.

Meyering-Vos M, Merz S, Sertkol M, Hoffmann KH. 2006. Functional analysis of the allatostatin-A type gene in the cricket Gryllus bimaculatus and the armyworm Spodoptera frugiperda. InsectBiochem Mol Biol 36:492–504.

Moshitzky P, Gilbert LI, Applebaum SW. 2003. Biosynthetic maturation of the corpus allatum ofthe female adult medfly, Ceratitis capitata, and its putative control. J Insect Physiol49:603–609.

Nijhout HF. 1994. The endocrine control of molting and metamorphosis. In: Insect Hormones.New Jersey: Princeton University Press. p 89–141.

Niwa R, Niimi T, Honda N, Yoshiyama M, Itoyama K, Kataoka H, Shinoda T. 2008. Juvenilehormone acid O-methyltransferase in Drosophila melanogaster. Insect Biochem Mol Biol38:714–720.

Peck SL, McQuate GT. 2000. Field tests of environmentally friendly malathion replacements tosuppress wild Mediterranean fruit fly (Diptera: Tephritidae) populations. J Econ Entomol93:280–289.

Pellissier Scott M, Panaitof SC, Carleton KL. 2004. Quantification of vitellogenin-mRNA duringmaturation and breeding of a burying beetle. J Insect Physiol 51:323–331.

Pfaffl MW. 2001. A new mathematic model for relative quantification in real-time RT-PCR.Nucleic Acids Res 29:2004–2007.

R Development Core Team. 2009. R: A language and environment for Statistical Computing. RFoundation for Statistical Computing, Vienna, Austria. URL: http://www.R-Project.org

Rabossi A, Boccaccio GL, Wappner P, Quesada-Allue LA. 1991. Morphogenesis and cuticularmarkers during the larval-pupal transformation of the medfly Ceratitis capitata. Entomol ExpAppl 60:135–141.

Robinson AS. 2002. Genetic sexing strains in medfly, Ceratitis capitata, sterile insect techniquefield programmes. Genetica 116:5–13.

Rossi E, Rainaldi G. 2000. Induction of Malathion resistance in CCE/CC128 cell line ofMediterranean fruit fly (Ceratitis capitata (Wied.)) (Diptera: Tephritidae). Cytotechnology 34:11–15.

Schmidt T, Choffat Y, Klauser S, Kubli E. 1993. The Drosophila melanogaster sex peptide: amolecular analysis of structure-function relationships. J Insect Physiol 39:361–368.

Simonet G, Poels J, Claeys I, Van Loy T, Franssens V, De Loof A, Vanden Broeck J. 2004.Neuroendocrinological and molecular aspects of insect reproduction. J Neuroendocrinol16:649–659.

Tomoyasu Y, Miller SC, Tomita S, Schoppmeier M, Grossmann D, Bucher G. 2008. Exploringsystemic RNA interference in insects: a genome-wide survey for RNAi genes in Tribolium.Genome Biol 9:R10.

Tunaz H, Uygun N. 2004. Insect growth regulators for insect pest control. Turk J Agric For28:377–387.



Vannini L, Ciolfi S, Spinsanti G, Panti C, Frati F, Dallai R. 2010. The putative-farnesoic acidO-methyltransferase (FAMeT) gene of Ceratitis capitata: characterization and pre-imaginallife expression. Arch Insect Biochem Physiol 73:106–117.

Vieira CU, Bonetti AM, Simoes ZLP, Maranhao AQ, Costa CS, Costa MCR, Siquieroli AC,Nunes FM. 2008. Farnesoic acid O-methyltransferase (FAMeT) isoforms: conserved traitsand gene expression patterns related to caste differentiation in the stingless bee, Meliponascutellaris. Arch Insect Biochem Physiol 67:97–106.

Wyatt GR, Davey KG. 1996. Cellular and molecular actions of juvenile hormone II. Roles ofjuvenile hormones in adult insects. Adv in Insect Physiol 24:213–274.



Putative-farnesoic acid O-methyltransferase (FAMeT) in medfly reproduction

Documents

Transcript of Putative-farnesoic acid O-methyltransferase (FAMeT) in medfly reproduction