Sortilin Is a Putative Postendocytic Receptor ofThyroglobulin

Roberta Botta, Simonetta Lisi, Aldo Pinchera, Franco Giorgi, Claudio Marcocci,Anna Rita Taddei, Anna Maria Fausto, Nunzia Bernardini, Chiara Ippolito, Letizia Mattii,Luca Persani, Tiziana de Filippis, Davide Calebiro, Peder Madsen, Claus Munck Petersen,and Michele Marino

Departments of Endocrinology and Metabolism (R.B., S.L., A.P., C.M., M.M), Neuroscience (F.G), and HumanMorphology and Applied Biology (N.B., C.I.), University of Pisa, 56124 Pisa, Italy; Department of Environmental Science(A.R.T., A.M.F), University of the Tuscia, 01100 Viterbo, Italy; Department of Medical Sciences and Laboratory ofExperimental Endocrinology (L.P., D.C.), University of Milan and Istituto di Ricovero e Cura a Carattere ScientificoIstituto Auxologico Italiano, 20095 Cusano Milanino, Italy; and MIND Center, Institute of Medical Biochemistry (P.M.,C.M.P.), Aarhus University, D-8000 Aarhus, Denmark

The Vps10p family member sortilin is involved in various cell processes, including protein traffick-ing. Here we found that sortilin is expressed in thyroid epithelial cells (thyrocytes) in a TSH-de-pendent manner, that the hormone precursor thyroglobulin (Tg) is a high-affinity sortilin ligand,and that binding to sortilin occurs after Tg endocytosis, resulting in Tg recycling. Sortilin was foundto be expressed intracellularly in thyrocytes, as observed in mouse, human, and rat thyroid as wellas in FRTL-5 cells. Sortilin expression was demonstrated to be TSH dependent, both in FRTL-5 cellsand in mice treated with methimazole and perchlorate. Plasmon resonance binding assays showedthat Tg binds to sortilin in a concentration-dependent manner and with high affinity, with Kd

values that paralleled the hormone content of Tg. In addition, we found that Tg and sortilininteract in vivo and in cultured cells, as observed by immunoprecipitation, in mouse thyroid extractsand in COS-7 cells transiently cotransfected with sortilin and Tg. After incubation of FRTL-5 cellswith exogenous, labeled Tg, sortilin and Tg interacted intracellularly, presumably within the en-docytic pathway, as observed by immunofluorescence and immunoelectron microscopy, the lattertechnique showing some degree of Tg recycling. This was confirmed in FRTL-5 cells in which Tgrecycling was reduced by silencing of the sortilin gene and in CHO cells transfected with sortilin inwhich recycling was increased. Our findings provide a novel pathway of Tg trafficking and a novelfunction of sortilin in the thyroid gland, the functional impact of which remains to be established.(Endocrinology 150: 509–518, 2009)

Sortilin is an approximately 100-kDa member of the Vps10pdomain protein family (1, 2), which comprises SorLA (�250

kDa) (3, 4) and SorCS1, -2, and -3 (�130 kDa) (5–7). The hall-mark of the family is a Vps10p domain at the N terminus, whichin sortilin makes up the entire luminal receptor (1, 2). The struc-ture of Vps10p proteins is characterized by a transmembranesegment and a short cytoplasmic tail, with motifs for interactionwith cytosolic adaptor molecules (1, 2). Functional sorting sites(dileucines, acidic clusters, tyrosine-based motifs) involved in

endocytosis and intracellular trafficking, have been establishedin all Vps10p members (8–10). The structural heterogeneity ofthe cytoplasmic tail suggests differential and/or alternative func-tions of Vps10p proteins, which is being progressively unveiledespecially for sortilin. Thus, sortilin is capable of mediating en-docytosis of ligands if expressed on the membrane (11), but it canalso transport proteins from the Golgi to late endosomes whenexpressed in the Golgi (8, 12), its most abundant and usual lo-cation (13).

ISSN Print 0013-7227 ISSN Online 1945-7170Printed in U.S.A.Copyright © 2009 by The Endocrine Societydoi: 10.1210/en.2008-0953 Received June 27, 2008. Accepted July 28, 2008.First Published Online August 7, 2008

Abbreviations: FT4, Free T4; hTg, human Tg; HRP, horseradish peroxidase; RAP, recep-tor-associated protein; rTg, rat Tg; Tg, thyroglobulin; TRITC, tetramethylrhodamineisothiocyanate.

T H Y R O I D - T R H - T S H

Endocrinology, January 2009, 150(1):509–518 endo.endojournals.org 509

Sortilin shares at least two ligands with the low-density li-poprotein receptor family member megalin, namely lipoproteinlipase (11) and the receptor-associated protein (RAP) (2). In thethyroid, megalin serves as a high-affinity endocytic receptor forthyroglobulin (Tg) (14–16), which led us to the hypothesis thatbecause of similarities between sortilin and megalin, Tg may bea sortilin ligand. The relevance of the issue stems from the factthat although some pathways of Tg trafficking in thyroid epi-thelial cells (thyrocytes) have been characterized, others proba-bly remain to be elucidated. Tg is the precursor of thyroid hor-mones, and its intrathyroidal metabolism is central in thyroidhormone synthesis and secretion (17). Tg is synthesized by thy-rocytes and secreted into the lumen of thyroid follicles, where itundergoes hormone formation by coupling of its tyrosyl residueswith iodide (17). Hormone-rich Tg molecules can either proceedfurther into the follicle, where they arrange into aggregates thatform the colloid, or they can undergo proteolytic cleavage, re-sulting in hormone release (17). To some extent, Tg degradationtakes place within the follicle through the action of extracellularproteases (18), but the main route of hormone release is lysoso-mal degradation, which occurs after micropinocytosis of Tg bythyrocytes (19–21). It is generally believed that fluid phase up-take is the main route of Tg micropinocytosis leading to lysoso-mal degradation, but endocytic receptors for Tg located at theapical membrane of thyrocytes also exist, and some have beencharacterized (22). In most instances, Tg internalized by recep-tors is thought to undergo intracellular fates other than lysoso-mal degradation, either recycling (23) or transcytosis (24, 25). Inthe recycling pathway, internalized Tg is transported to the Golgiand then resecreted back into the colloid. The responsible recep-tor has not been identified, and the process is thought to serve forpoorly glycosylated Tg to undergo completion of glycosylationwithin the Golgi (26). Transcytosis, a route through which Tg istransported from the follicle to the bloodstream (24, 25), is me-diated by megalin and involves preferentially hormone-poor Tgmolecules (15, 16, 27). By preventing hormone-poor Tg to enterthe lysosomal pathway and compete with hormone-rich Tg fordegradation, transcytosis renders hormone release more effec-tive (16, 28). It is unknown how targeting of Tg toward thevarious intracellular postendocytic pathways occurs and whichmolecules are involved.

Here we investigated sortilin expression in thyrocytes aswell as its possible interactions with Tg. Our findings showthat sortilin is expressed in thyrocytes in a TSH-dependentmanner and that Tg is a high-affinity sortilin ligand, withinteractions occurring after Tg endocytosis and resulting in Tgrecycling.

Materials and Methods

MaterialsRat Tg (rTg) was purified from frozen rat thyroids (Pel-Freeze Bio-

logicals, Rogers, AR); human Tg (hTg) was purified from Graves’ diseasepatients’ thyroids, obtained at surgery upon informed consent; 5Tg waspurified from FRTL-5 cell supernatants, as described (15, 16). The T3

content of the Tg preparations was measured using a T3 assay from MPBiomedicals (Orangeburg, NY).

The extracellular domain of sortilin (soluble sortilin) was purified asdescribed (29). Two rabbit polyclonal antisortilin antibodies were de-scribed previously (30). Mouse monoclonal antisortilin was generated byimmunization of mice with purified sortilin-Vps10p domain. SolubleSorCS3 and RAP were purified as described (31, 32). Tg was labeled withbiotin using EZ-Link Sulfo-NHS-LC-Biotin (Pierce, Rockford, IL). hTgwas labeled with 20-nm gold particles as described (33). Neurotensin,protein A beads, rabbit IgG, and p-nitrophenyl-phosphate were fromSigma (Sigma, St. Louis, MO). Rabbit anti-Tg was from Axell (Westbury,NY). Rabbit anti-glyceraldehyde-3-phosphate-dehydrogenase (GAPDH),fluorescein isothiocyanate-antirabbit IgG and tetramethylrhodamineisothiocyanate (TRITC)-antimouse IgG were from Santa Cruz Biotech-nology (Santa Cruz, CA). TRITC-streptavidin was from Pierce. Horse-radish peroxidase (HRP)-antirabbit IgG was from Bio-Rad (Hercules,CA). HRP-streptavidin and alkaline phosphatase-antirabbit IgG werefrom Amersham (Freiburg, Germany).

Normal human thyroid tissue was obtained from the contralateralnormal thyroid lobe of patients who underwent thyroidectomy for thy-roid cancer upon informed consent. Rat brain and testicles were fromPel-Freeze Biologicals.

Experimental animals and related proceduresTwelve C57BL6 female mice were purchased from Jackson Labora-

tories (Bar Harbor, ME). Six mice were treated with methimazole(Sigma) and sodium perchlorate as described (34). Mice were killed andthe thyroids were harvested and stored at �80 C or fixed in parafor-maldehyde, dehydrated, and embedded in paraffin. Animal care, treat-ment, and killing procedures were in accordance with institutional guide-lines. Animal studies were approved by the local review board.

Histology and immunohistochemistryFive-micrometer sections from paraffin-embedded specimens were

deparaffinized, rehydrated, and subjected to hematoxylin and eosinstaining or to immunohistochemistry, using rabbit antisortilin (130 �g/ml)or rabbit anti-Tg (1:100), as described (35).

Serum assays in miceFree T4 (FT4) was measured by equilibrium dialysis immunoassay (Ni-

chols, San Juan Capistrano, CA). TSH was measured as described (36).

Cell cultures and related proceduresFRTL-5 cells (American Type Culture Collection. Rockville, MD)

were cultured as described (37), in Coon’s F12 medium containing 5%newborn calf serum and six hormones including bovine TSH (Sigma),1 mU/ml. Cells were also cultured for 24–72 h in medium lacking TSH,or containing TSH at various concentrations. Cells were membrane la-beled with EZ-Link Sulfo-NHS-LC-Biotin, according to the manufac-turer’s instructions, after which membranes were prepared and subjectedto immunoprecipitation with antisortilin followed by Western blottingwith HRP-streptavidin.

Sortilin in FRTL-5 cells was silenced by transient transfection withthe following sense mRNA sequence: 5�-CCCGUCUACUUCAC-CGGGCUGGCUU-3�. The following scrambled sortilin sequence wasused as a control: 5�-CCCUCCAUUACCCGGCGGUGUGCUU-3�.Transfections were performed using Lipofectamine 2000 (Invitrogen,Carlsbad, CA). Expression of sortilin after transfection was determinedby RT-PCR as follows. RNA samples were isolated using the Trizolreagent (Invitrogen). Single-stranded cDNA was synthesized from 1 �gtotal RNA using the SuperScript First-Strand Synthesis System (Invitro-gen) for RT-PCR. The following PCR primers were designed with Prim-er3 software (38): forward CAGACAGACCTCCCCTTTCA and re-verse AATTCTTGGACACCCACAGG. PCR was performed with SYBRGreen PCR Master Mix (Applied Biosystems, Foster City, CA). Thereaction conditions were 2 min at 50 C (one cycle), 10 min at 95 C (onecycle), 15 sec at 95 C, and 1 min at 60 C (50 cycles). Gene-specific PCRproducts were continuously measured with ABI PRISM 7900 sequence

510 Botta et al. Sortilin in the Thyroid Endocrinology, January 2009, 150(1):509–518

detection system (Applied Biosystems). Samples were normalized usinga housekeeping gene (�-actin). In addition, sortilin protein was measuredin cell extracts by Western blotting as reported below.

COS-7 cells (American Type Culture Collection) were cultured inDMEM containing 10% fetal bovine serum. COS-7 cells were transientlytransfected using the diethylaminoethyl-dextran method (39) with eitherone or more of the following cDNAs: 1) a previously described full-lengthsortilin cDNA cloned into a pcDNA3 expression vector (30) and/or 2) apreviously described (40) bovine Tg cDNA, cloned into pCB6, kindlyprovided by Dr. Peter Arvan (University of Michigan, Ann Arbor, MI).

As a control cDNA for cotransfection experiments, we used humanMC4, cloned into pcDNA3 (41). In certain experiments in which COS-7cells had been transfected with Tg or cotransfected with Tg plus sortilin,after transfection, cells were cultured for 48 h in medium containingTg-free human serum in place of fetal bovine serum. Then, supernatantswere collected and cell extracts were prepared for Tg detection by West-ern blotting.

CHO cells (American Type Culture Collection) were cultured inHam’s F12 medium containing 10% fetal bovine serum. CHO cells werestably transfected with full-length sortilin using Lipofectamine 2000.

Preparation of cell and tissue extractsCells detached from plates with EDTA were incubated

on ice in lysis buffer (1% Triton X-100, 1% deoxycholatein H2O). Samples were spun for 10 min at 10,000 � g,pellets were discarded, and supernatants collected. Tissuesamples were washed, minced, and homogenized. Sampleswere incubated in lysis buffer [50 mM Tris (pH 8.6), 0.5 M

NaCl, 10% Triton X-100, 0.01% deoxycholate, 20 mM

EDTA, 0.2% NaN3, and 10% protease inhibitor cocktailsolution (Roche Diagnostics, Mannehim, Germany)] andspun for 30 min at 10,000 � g. Supernatants were collectedand briefly sonicated. Protein concentrations were mea-sured with the Bradford method.

Immunofluorescence stainingImmunofluorescence was performed as described (42),

using FTRL-5 cells. The following primary antibodies wereused: 1) mouse antisortilin (20 �g/ml) and 2) rabbit anti-sortilin (0.88 mg/ml). The following secondary antibodieswere used: 1) fluorescein isothiocyanate-antirabbit IgG (1:500) and 2) TRITC-antimouse IgG (1:100). In experimentsin which biotin-labeled Tg was used, the second incubationwas performed with TRITC-streptavidin (1:2000). Cellsincubated with secondary antibodies alone were used ascontrols. Staining was assessed using an Eclipse 80i fluo-rescence microscope (Nikon, Chiyoda-ku, Tokyo, Japan).

Immunoelectron microscopyFRTL-5 cells were cultured until confluence on high-

density large-pore (3 �m) filters in cell culture inserts (Bec-ton Dickinson, Mountain View, CA). In certain experi-ments, cells were incubated at 37 C with gold-labeled Tg(50 �g/ml in serum-free medium containing 5 mM CaCl2,0.5 mM MgCl2, and 0.5% BSA). Cells were fixed with 4%paraformaldehyde, 0.5% glutaraldehyde in 50 mM phos-phate buffer (pH 7.2), rinsed in the same buffer, and de-hydrated with ethanol. Then, cells were embedded in Lon-don resin white methacrylate resin, gradually raised inabsolute ethanol from 30–100%, placed in gelatin, andallowed to polymerize with benzoyl peroxide. Ultrathinsections were prepared. For immunogold staining, cellswere blocked with nickel grids. Sections were incubatedwith rabbit antihuman Tg (1:200) or with rabbit antisor-tilin (1:1000). Grids were washed and incubated with10-nm gold-labeled goat antirabbit IgG (British BioCell In-ternational, Cardiff, UK). Grids were washed, and sectionswere stained with uranyl acetate. Sections were analyzedwith a Jeol JEM EX II transmission electron microscope(JEOL Ltd., Tokyo, Japan). Sections incubated with thesecondary antibody alone were used as a control.

Immunoprecipitation experimentsImmunoprecipitation experiments were performed as

described (43), using rabbit antisortilin (650 �g) or, as acontrol, normal rabbit IgG.

FIG. 1. Expression of sortilin in thyroid epithelial cells. A, Sortilin and Tg expressionby immunohistochemistry in mouse thyroid sections. Sortilin (upper panel) isdetected intracellularly (black arrows). Tg (lower panel) is mainly concentrated inthe follicle lumen (black arrows), but in isolated cells, intracellular staining is seen(green arrows). B, Immunofluorescence staining in FRTL-5 cells, using polyclonal(upper panel) or monoclonal (lower panel) antisortilin antibodies. Sortilin is mainlyconcentrated in the perinuclear area (white arrows). C, Immunoelectron microscopyin FRTL-5 cells. Sortilin is seen mainly in cytoplasmic vesicles (black arrows), near theupper (left panel) and lower membrane (right panel). D, Western blotting forsortilin in thyroid extracts and in extracts from FRTL-5 cells. Rat brain and testicleextracts were used as positive controls. Arrows indicate the bands corresponding tosortilin. E, Immunoprecipitation with antisortilin antibodies of FRTL-5 cell extracts(lane 1) after membrane labeling with biotin, detected by Western blotting withHRP-conjugated streptavidin. Rat testicle extract (lane 2) was used as a positivecontrol. Arrow indicates the band corresponding to sortilin.

Endocrinology, January 2009, 150(1):509–518 endo.endojournals.org 511

Western blottingWestern blotting experiments were performed as described (44),

using 1) rabbit antisortilin (88 �g/ml), 2) rabbit anti-GAPDH (1:200),3) rabbit anti-Tg (1:2500) followed by HRP-antirabbit IgG (1:3000),or 4) HRP-streptavidin (1:3000). Band density was measured withImageJ (National Institutes of Health, Bethesda, MD).

Biosensor binding assaysAssays were performed using a BIAcore 3000 instrument (GE

Healthcare Europe GmbH, Uppsala, Sweden), as described (1), with10 –30 �g/ml soluble sortilin or soluble SorCS3 (immobilized pro-teins, 60 – 80 fmol/mm2). Tg (0.01–5 �M) was injected alone or in thepresence of RAP or neurotensin. The signal was expressed in relativeresponse units (difference between immobilized protein flow cell andcorresponding control cell activated and blocked without protein).

The BIAevaluation 3.1 software was used to determine kineticparameters.

Cell recycling assaysCells were cultured in 24-well plates until 80–100% confluence.

Cells were incubated at 37 C with unlabeled hTg or BSA (250 �g/ml) inbinding buffer (Coon’s F12 medium, 5 mM CaCl2, 0.5 mM MgCl2, and0.5% BSA) to allow internalization. After 2 h, cells were washed withice-cold binding buffer and incubated for 2 h at 37 C with binding bufferto allow release of internalized Tg, which was measured by ELISA. Re-sults were normalized for the amount of proteins in cell extracts, whichwas measured in cell lysates.

ELISATo measure unlabeled Tg, wells were coated overnight at 4 C with

samples to be tested, blocked, and incubated for 1 hat room temperature with rabbit anti-Tg (1:500)followed by alkaline phosphatase-antirabbit IgGand p-nitrophenyl-phosphate. Absorbance was de-termined at 405 nm, and the amounts of Tg weredetermined using a standard curve obtained by coat-ing microtiter wells with unlabeled hTg.

Data presentation and statisticsExperiments with mouse tissue sections, ex-

tracts, and sera were performed in at least six mousepairs. All the remaining experiments were per-formed at least three times. In all experiments, eitherthe same sample volumes or the same amount ofprotein extracts were used for comparisons. Whenappropriate, statistical analyses by Mann-WhitneyU test were performed using Stat-View (SAS Insti-tute Inc., Cary, NC). Unless otherwise specified, re-sults are presented as mean � SD.

Results

Expression of sortilin in thyroidepithelial cells

As shown in Fig. 1A (upper panel), sortilinwas detected by immunohistochemistry inmouse thyroid sections. Staining was observedwithin the cytoplasm of thyrocytes, being insome cells spotted more intensely in the pe-rinuclear area. No clear membrane stainingwas seen. Staining for sortilin was distinctfrom Tg staining (Fig. 1A, lower panel), whichwas concentrated in the extracellular com-partment, namely in the follicle lumen, al-though in isolated cells, there was some intra-cellular staining representing either nascent orendocytosed Tg molecules.

Sortilin was found to be expressed byFRTL-5 cells under standard culture condi-tions, namely in a medium containing 1mU/ml TSH (Fig. 1B), and staining was ob-served exclusively intracellularly. To investi-gate sortilin expression further, we performedimmunoelectron microscopy experiments inFRTL-5 cells cultured on permeable filters.Under these conditions, FRTL-5 cells have

FIG. 2. Expression of sortilin in thyroid epithelial cells is TSH dependent. A–F, Mice treated withmethimazole and sodium perchlorate. A, FT4 and TSH serum levels; B, hematoxylin and eosinstaining of thyroid sections; C, immunohistochemistry for sortilin in thyroid sections, showingincreased intracellular staining in thyrocytes in mice treated with methimazole andperchlorate; D, Western blotting for sortilin in thyroid extracts; E, pixel densities of the bandsin Western blotting experiments; F, normalization of the density of the sortilin band forGAPDH; G–I, FRTL-5 cells; G, Western blotting for sortilin in extracts from cells cultured fordifferent time periods (24–48 h) in media containing various concentrations of TSH, asindicated; H, Western blotting for sortilin and for GAPDH in extracts from cells cultured fordifferent time periods (0–48 h) in media containing 0.5 mU/ml TSH; I, immunofluorescencestaining with an antisortilin antibody in cells cultured for 24 h in medium lacking TSH orcontaining 1 mU/ml TSH.

512 Botta et al. Sortilin in the Thyroid Endocrinology, January 2009, 150(1):509–518

been reported not to be polarized (45, 46), although in otherstudies (15, 16), some features of polarity were observed, namelyexpression of megalin and presence of microvilli and coated pitsexclusively on the upper membrane (15). Immunoelectron mi-croscopy confirmed an almost exclusive intracellular localiza-tion of sortilin (Fig. 1C). Thus, sortilin was seen especially in theproximity of both the upper (Fig. 1C, left panel) and the lower(Fig. 1C, right panel) membrane. Nevertheless, although in verylow amounts, some sortilin was observed also on the cellmembrane.

Bands immunoreactive with antisortilin were observed in hu-man, mouse, and rat thyroid extracts as well as in extracts fromFRTL-5 cells (Fig. 1D). Bands migrated at about 100 kDa, theknown molecular mass of sortilin (2). Bands of similar mass were

found in positive control tissues, namely rat brain or testicle (Fig.1D). Although sortilin migrated as a single band in mouse andhuman thyroid extracts and in FRTL-5 extracts, as it did in therat brain, it resolved into two separate bands in rat thyroid ex-tracts, as it did in the rat testicle. In addition, the sortilin band wasslightly slower in human thyroid extracts. Presumably, the find-ings reflect either the presence of differently glycosylated formsof sortilin, resulting in two separate bands, or a different degreeof glycosylation of sortilin, resulting in a slower band.

Immunostaining experiments showed that sortilin expressionon the cell membrane of thyrocytes is either absent or negligible.To investigate this issue further, FRTL-5 cells were surface la-beled with biotin, after which membranes were subjected to im-munoprecipitation with antisortilin. No biotin-labeled bands

were precipitated by antisortilin antibody(Fig. 1E), confirming that expression of sorti-lin on the cell membrane, if any, is minimal.

Expression of sortilin in thyroidepithelial cells is TSH dependent

Expression of virtually all proteins in-volved in thyroid function is regulated by TSH(47). We investigated whether also sortilin un-dergoes this type of regulation, both in amouse model and in FRTL-5 cells. We firststudied the effects of TSH on sortilin expres-sion in mice treated with methimazole andperchlorate, which, especially if used incombination, are potent inhibitors of thy-roid hormone synthesis (34), leading to hy-pothyroidism and increased TSH secretion,which makes it a suitable model to study pro-tein expression in response to TSH (34). Aftertreatment of mice for 5 d, there was a reduc-tion of serum FT4 and a marked increase ofserum TSH (Fig. 2A). The typical morpholog-ical and histological changes induced by TSHwere observed (48). Gross examination of thethyroid gland revealed a slight enlargementand engorgement compared with untreatedmice (not shown). At histology (Fig. 2B), therewas hypertrophy of thyrocytes, reducedamounts of colloid, and reduced size of folli-cles, indicating massive colloid reabsorption.Staining of thyrocytes with antisortilin wasmarkedly increased in mice treated with me-thimazole and perchlorate compared withuntreated mice (Fig. 2C), and similar resultswere obtained by Western blotting in thy-roid extracts (Fig. 2, D–F). Normalization ofthe density of the sortilin band using thehousekeeping protein GAPDH (42) con-firmed the findings (Fig. 2F).

We then investigated the same issue inFRTL-5 cells. Cells were cultured either in me-dia containing various concentrations of TSHor in medium lacking TSH, for various time

FIG. 3. Binding of Tg to sortilin by surface plasmon resonance. A, T3 content of the Tgpreparations used (rTg, hTg, and 5Tg); B, binding of the three Tg preparations to immobilizedsortilin; C, dose dependence of hTg binding to sortilin; D, inhibition of binding of the three Tgpreparations to sortilin by neurotensin (NT); E, inhibition of hTg binding to sortilin by RAP; F,lack of inhibition of binding of hTg to sortilin by EDTA; G–H, effect of various pH values onbinding of rTg (G) and hTg (H) to sortilin.

Endocrinology, January 2009, 150(1):509–518 endo.endojournals.org 513

intervals. As shown in Fig. 2G by Western blotting, TSH up-regulated sortilin in a dose-dependent manner. The effect wasseen starting at relatively low concentrations of TSH (0.25 mU/ml), peaked at 0.5 mU/ml, and decreased at 1.0 mU/ml, with abell-shape curve. Normalization for GAPDH confirmed the find-ings. To investigate the kinetics of TSH effects, cells were cul-tured for various time intervals with 0.5 mU/ml TSH. Sortilinexpression started to increase only 8 h after exposure to TSH(Fig. 2H), suggesting that only prolonged stimulation with TSHhas an effect. Again, normalization for GAPDH confirmed thefindings. The effect of TSH was also observed by immunofluo-rescence in FRTL-5 cells cultured for 24 h in medium lackingTSH or containing 1 mU/ml TSH (Fig. 2I).

Tg is a sortilin ligandWe investigated whether Tg is a sortilin ligand, using surface

plasmon resonance binding assays. We used a purified, solublepreparation of sortilin (30) and three purified Tg preparations,namely rTg, hTg, and 5Tg. The three preparations had a differenthormone (T3) content (Fig. 3A). Thus, rTg was highly hormo-nogenic, whereas hTg and 5Tg had a lower T3 content. This wasexpected based on the knowledge that rTg was purified from thethyroids of untreated rats, that hTg was purified from the thy-roids of Graves’ patients given methimazole (a potent inhibitorof hormone formation within Tg) (49), and that FRTL-5 cells arenot capable of forming hormone residues within the Tg theysynthesize (50). All of the three Tg preparations bound to im-mobilized sortilin in a concentration-dependent manner andwith high affinity (Fig 3B), as indicated by the following mean Kd

values: rTg, approximately 1 nM; hTg, approximately 3 nM; and5Tg, approximately 30 nM. The apparent different extent ofbinding between the Tg preparations reflects the different con-centrations used (rTg, 25 nM; hTg, 100 nM; 5Tg, 100 nM). Nobinding to SorCSC3, another member of the Vps10p family (5),was observed (not shown). An example of the dose-dependent,high-affinity pattern of binding is shown in Fig. 3C for hTg.Similar results, with different Kd values, were obtained also forrTg and 5Tg (not shown). Binding of the Tg preparations wasinhibited, if not abolished, by the sortilin ligand neurotensin (Fig.

3D). In addition, binding was almost abolished by RAP, asshown for hTg in Fig. 3E. Because RAP binds to both sortilin (2)and Tg (43), we could not establish to what extent inhibition wasdue to RAP binding to sortilin, to Tg, or to both. Binding of Tgto sortilin was not affected by EDTA, indicating it is not calciumdependent (Fig. 3F). Binding was inhibited only at pH values of5.5 or below (Fig. 3, G and H), suggesting that probably thecomplex Tg-sortilin is stable in a relatively acidic environmentwith pH values of at least 6.0.

To study whether Tg and sortilin interact in cultured cells andin vivo, we performed coimmunoprecipitation experimentsupon protein cross-linking in COS-7 cells transiently cotrans-fected with sortilin and Tg as well as in mouse thyroid extracts.Expression of sortilin and Tg in transfected COS-7 cells wasdemonstrated by Western blotting (Fig. 4A). Levels of expressionof Tg and sortilin were similar regardless of whether they werecotransfected together or each of them was cotransfected with anunrelated gene (MC4). An antisortilin antibody precipitated330-kDa Tg in COS-7 cells cotransfected with sortilin and Tg,whereas it did not in COS-7 cells transfected with sortilin or Tgplus MC4 (Fig 4B). Normal rabbit IgG, used as a control, did notprecipitate Tg. The results indicate that Tg and sortilin interactin cultured cells. We performed similar coimmunoprecipitationexperiments in mouse thyroid extracts. As shown in Fig. 4C, theantisortilin antibody, unlike normal rabbit IgG, precipitated in-tact Tg in thyroid extracts, therefore demonstrating that Tg andsortilin interact in vivo.

Sortilin-Tg interactions result in Tg recyclingTo investigate the possible functional role of sortilin-Tg

interactions in thyrocytes, we studied Tg secretion into the cellmedium of COS-7 cells transfected as reported above. Theamount of Tg found in the medium by Western blotting didnot differ between COS-7 cells cotransfected with Tg andsortilin and COS-7 cells cotransfected with Tg and MC4 (Fig5A). Despite the apparent greater intensity of the Tg bands inCOS-7 cells cotransfected with Tg and sortilin, a similar pro-portion of total Tg (Tg within extracts plus Tg in the medium)was found in the media of cells cotransfected with Tg and

MC4 (41.2%) or cotransfected with Tg andsortilin (40.4%) (Fig. 5B).

In view of the findings reported above,which seem to indicate that it is unlikely thatTg and sortilin interact in the biosyntheticpathway, we considered the possibility thatthey may interact in the endocytic pathwayupon Tg internalization. Therefore, we per-formed experiments aimed at studyingwhether Tg and sortilin colocalize intracellu-larly upon Tg endocytosis. As shown in Fig.5C by immunofluorescence, after incubationof FRTL-5 cells with biotin-labeled Tg at 37 Cfor various time intervals, Tg could be seenintracellularly as early as 15 min after it wasapplied to cells, indicating it had been inter-nalized. Tg staining increased progressivelywith time, and at 2 h, Tg colocalized largely

FIG. 4. Sortilin-Tg interaction in cultured cells and in vivo. A, Western blotting for Tg (upperpanel) and sortilin (lower panel) in extracts from COS-7 cells cotransfected with sortilin andMC4, Tg and MC4, or Tg and sortilin; B, coimmunoprecipitation of Tg with an antisortilinantibody in extracts from COS-7 cells cotransfected with sortilin and MC4, Tg and MC4, or Tgand sortilin; C, coimmunoprecipitation of Tg with an antisortilin antibody in mouse thyroidextracts. Normal rabbit IgG were used as a control.

514 Botta et al. Sortilin in the Thyroid Endocrinology, January 2009, 150(1):509–518

with sortilin in the perinuclear area. Similar results were ob-tained by immunoelectron microscopy, which was performedusing FRTL-5 cells on filters after incubation at 37 C with gold-labeled Tg. Thus, 4 h after Tg was applied to cells, it could be seentogether with sortilin in large endocytic vesicles (Fig. 5D, leftpanel). In addition, vesicles containing Tg and sortilin were seenalso extracellularly near the upper membrane (Fig. 5C, rightpanel), suggesting that, upon internalization, Tg may undergorecycling with its release together with sortilin from the uppermembrane into the extracellular space.

To investigate this possibility, we performed recycling assaysusing FRTL-5 and CHO cells. Sortilin was silenced in FRTL-5cells and stably transfected in CHO cells. As shown in Fig. 6, A

and B, in FRTL-5 cells, sortilin mRNA wasfound to decrease by approximately 86, 60,and 90% at 24, 48, and 72 h after transfection,respectively, as observed by RT-PCR (Fig. 6A).In addition, as shown in Fig. 6B, an approxi-mately 50% reduction of sortilin protein wasobserved by Western blotting (mean pixel den-sity: cells transfected with scrambled sortilinRNA, 124.9 pixels/cm2; cells transfected withsilenced sortilin RNA, 62.1 pixels/cm2) in cellextracts collected at 48 h, the time at which theexperiments reported below were performed.CHO cells were found to express sortilin uponstable transfection, as detected in extracts byWesternblotting(Fig.6C).Tgrecyclingcouldbedetected both in FRTL-5 and CHO cells (Fig.6D).Silencingofsortilin inFRTL-5cells resultedin an approximately 45% reduction of Tg recy-cling, In agreement with these findings, trans-fection of CHO cells with sortilin resulted in anapproximately 50% increase of Tg recycling.

Discussion

We provide evidence for a possible function ofsortilin in the thyroid gland, namely binding ofTg after its endocytosis, followed by Tg recy-cling. Sortilin was found to be expressed bythyrocytes, as shown in vivo and in culturedthyroid cells. By immunostaining techniques,sortilin was found to be concentrated mainlyintracellularly, as observed in mouse thyroidsections and FRTL-5 cells, whereas expressionon the cell membrane was negligible. Thus, noclear sortilin staining was seen on the thyro-cyte membrane in mouse thyroid sections, andonly small amounts of sortilin were seen byimmunoelectron microscopy on FRTL-5membranes. In addition, membrane expres-sion of sortilin could not be demonstrated inFRTL-5 cells by immunoprecipitation withantisortilin after membrane labeling with bi-otin or by immunofluorescence. Expression of

sortilin in thyrocytes was found to be TSH dependent, which isindirect evidence for a possible thyroid-specific role of sortilin,because it occurs for virtually all proteins involved in thyroidfunction (47). Thus, sortilin expression in mice increased dra-matically when they were treated with methimazole and per-chlorate as a means to enhance TSH levels (34). In addition,sortilin in FRTL-5 cells was found to be up-regulated by TSH ina time- and dose-dependent and saturable manner. In FRTL-5cells, sortilin showed a relatively slow response to TSH stimu-lation, suggesting a regulation possibly mediated through thephosphatidiylinositol-Ca2� cascade (51).

Sortilin was found to interact with Tg. Thus, three Tg prep-arations bound to sortilin as observed by plasmon resonance.

FIG. 5. Sortilin and Tg interact in the endocytic pathway. A, Western blotting for sortilin in extractsand media from COS-7 cells cotransfected with Tg and MC4 or Tg and sortilin; B, pixel densities ofthe bands in Western blotting experiments; C, immunofluorescence staining for sortilin and Tg inFRTL-5 cells after incubation with biotin-labeled hTg at 37 C, showing that at 2 h, Tg colocalizeslargely with sortilin in the perinuclear area; D, immunoelectron microscopy in FRTL-5 cells afterincubation with gold-labeled Tg at 37 C. Gold-labeled Tg (large particles) colocalizes with sortilin(small particles) within a large endosomal vesicle (left panel, arrows). Gold-labeled Tg and sortilincolocalize also extracellularly, near the apical membrane, within a vesicle (right panel, arrow).

Endocrinology, January 2009, 150(1):509–518 endo.endojournals.org 515

Binding affinities paralleled the hormone content of the Tg prep-arations, suggesting that sortilin binds especially to hormono-genic Tg molecules. Kd values ranged approximately from 1–30nM, indicating very high to moderately high binding affinity.Interestingly, binding was found to be relatively resistant to lowpH but not to be calcium dependent. In addition, binding wasspecific, as demonstrated by its dose dependence, by the inhibi-tion with a specific sortilin ligand (neurotensin) and with a ligandcommon to both sortilin and Tg (RAP), by the absence of inhi-bition by control proteins, and by the absence of Tg binding toSorCS3, another member of the Vps10p family.

The finding that Tg-sortilin interactions are relatively resis-tant to low pH and that in thyroid cells, sortilin is mainly ex-pressed intracellularly led us to the hypothesis that a putativephysiological interaction between sortilin and Tg may occur atthat level. The hypothesis that sortilin and Tg interact during thebiosynthetic pathway was discarded because Tg secretion intothe cell medium of COS-7 cells transfected with Tg was notaffected by cotransfection with sortilin. We therefore investi-gated whether Tg-sortilin interactions may occur upon Tg en-docytosis and found that this is likely the case. Thus, after in-cubation of FRTL-5 cells with exogenous biotin-labeled Tg,endocytosed Tg colocalized with sortilin in the perinuclear area,as seen by immunofluorescence. In addition, internalized gold-labeled Tg was seen by electron microscopy in large endocyticvesicles where also sortilin was present. The finding that Tg par-ticles were also present extracellularly in vesicles containing sor-

tilin, in the proximity of the upper cell mem-brane, led us to the hypothesis that afterintracellular binding to sortilin, Tg may un-dergo recycling, which was confirmed by ex-periments in which release of Tg into the me-dium after endocytosis of exogenous Tg wasreduced by sortilin silencing in FRTL-5 cellsand increased by transfection with sortilin inCHO cells.

Recycling of Tg was originally described byKostrouch et al. (23). The process seems toinvolve Tg molecules with a poor degree ofglycosylation that upon endocytosis are redi-rected to the Golgi for further glycosylationand then resecreted into the follicle. Recyclingis thought to occur after receptor-mediated en-docytosis of Tg, although the responsible re-ceptor is yet to be identified with certainty(22). The finding that sortilin affects Tg recy-cling suggests that sortilin may provide a tar-geting signal leading to this pathway after Tgendocytosis. Whether this ultimately results inTg glycosylation within the Golgi was not es-tablished here and will be the subject of addi-tional studies.

The functional impact of Tg recycling viasortilin remains to be investigated. The idealway to study it would be in animal models,namely in sortilin knockout mice, which willbe the aim of future studies. There are, how-

ever, some results of the present study that make a putative func-tional role of sortilin in vivo not so obvious. If sortilin wererequired for Tg recycling in vivo, it would be expected to enhancethyroid function, namely thyroid hormone release, because re-cycling should involve hormone- and sugar-poor Tg molecules.However, we found that hormone-rich Tg (rTg), rather thanhormone-poor Tg (hTg and 5Tg), have the greatest affinity forsortilin binding. In addition, given the very high affinity of Tg-sortilin interactions, one would expect permanent saturationof sortilin binding sites in view of the very high Tg concentrationswithin the thyroid. Considering that sortilin has a greater affinityfor hormone-rich Tg, there should be no binding sites availablefor hormone-poor Tg and recycling via sortilin may not occurunder physiological conditions. These considerations raise ma-jor questions on the possible role of sortilin in vivo, which, how-ever, should be extended to recycling in general because, to ourknowledge, no data are available on the actual functional role ofthis process. Further studies are needed to answer these impor-tant questions.

Acknowledgments

Address all correspondence and requests for reprints to: Michele MarinoM.D., Department of Endocrinology, University of Pisa, Via Paradisa 2,56124, Pisa, Italy. E-mail: m.marino@endoc.med.unipi.it.

This work was supported by a grant from Ministero dell’Istruzione,dell’Universita e della Ricerca Scientifica (MIUR) (2004068078 to M.M.).

FIG. 6. Sortilin-Tg interactions result in Tg recycling. A, Measurement of sortilin mRNA by RT-PCR in FRTL-5 cells, either untransfected or transiently transfected with a sortilin silencing RNAor with a scrambled sortilin RNA at different time points after transfection; B, Western blottingfor sortilin in FRTL-5 cell extracts upon transfection with a sortilin silencing RNA or with ascrambled sortilin RNA; C, Western blotting for sortilin in media (lanes 1) and extracts (lanes 2)from CHO cells stably transfected with a sortilin cDNA or with pcDNA3; D, recycling assays,using unlabeled hTg, in FRTL-5 (either untransfected or 48 h after transient transfection with asortilin silencing RNA or with a scrambled sortilin RNA) and CHO cells (stably transfected with asortilin cDNA or with pcDNA3).

516 Botta et al. Sortilin in the Thyroid Endocrinology, January 2009, 150(1):509–518

Disclosure Statement: The authors have nothing to declare.

References

1. Westergaard UB, Sorensen ES, Hermey G, Nielsen MS, Nykjaer A, Kirkegaard K,Jacobsen C, Gliemann J, Madsen P, Petersen CM 2004 Functional organiza-tion of the sortilin Vps10p domain. J Biol Chem 279:50221–50229

2. Petersen CM, Nielsen MS, Nykjaer A, Jacobsen L, Tommerup N, RasmussenHH, Roigaard H, Gliemann J, Madsen P, Moestrup SK 1997 Molecularidentification of a novel candidate sorting receptor purified from humanbrain by receptor-associated protein affinity chromatography. J Biol Chem272:3599 –3605

3. Jacobsen L, Madsen P, Moestrup SK, Lund AH, Tommerup N, Nykjaer A,Sottrup-Jensen L, Gliemann J, Petersen CM 1996 Molecular characterizationof a novel human hybrid-type receptor that binds the �2-macroglobulin re-ceptor-associated protein. J Biol Chem 271:31379–31383

4. Yamazaki H, Bujo H, Kusunoki J, Seimiya K, Kanaki T, Morisaki N, SchneiderWJ, Saito Y 1996 Elements of neural adhesion molecules and a yeast vacuolarprotein sorting receptor are present in a novel mammalian low density lipopro-tein receptor family member. J Biol Chem 271:24761–24768

5. Hermey G, Riedel IB, Hampe W, Schaller HC, Hermans-Borgmeyer I 1999Identification and characterization of SorCS, a third member of a novel re-ceptor family. Biochem Biophys Res Commun 266:347–351

6. Kikuno R, Nagase T, Ishikawa K, Hirosawa M, Miyajima N, Tanaka A,Kotani H, Nomura N, Ohara O 1999 Prediction of the coding sequences ofunidentified human genes. XIV. The complete sequences of 100 new cDNAclones from brain which code for large proteins in vitro. DNA Res 6:197–205

7. Nagase T, Kikuno R, Ishikawa KI, Hirosawa M, Ohara O 2000 Prediction ofthe coding sequences of unidentified human genes. XVI. The complete se-quences of 150 new cDNA clones from brain which code for large proteins invitro. DNA Res 7:65–73

8. Nielsen MS, Madsen P, Christensen EI, Nykjaer A, Gliemann J, Kasper D,Pohlmann R, Petersen CM 2001 The sortilin cytoplasmic tail conveys Golgi-endosome transport and binds the VHS domain of the GGA2 sorting protein.EMBO J 20:2180–2190

9. Jacobsen L, Madsen P, Nielsen MS, Geraerts WP, Gliemann J, Smit AB,Petersen CM 2002 The sorLA cytoplasmic domain interacts with GGA1and -2 and defines minimum requirements for GGA binding. FEBS Lett511:155–158

10. Nielsen MS, Gustafsen C, Madsen P, Nyengaard JR, Hermey G, Bakke O,Mari M, Schu P, Pohlmann R, Dennes A, Petersen CM 2007 Sorting by thecytoplasmic domain of the amyloid precursor protein binding receptor SorLA.Mol Cell Biol 27:6842–6851

11. Nielsen MS, Jacobsen C, Olivecrona G, Gliemann J, Petersen CM 1999 Sor-tilin/neurotensin receptor-3 binds and mediates degradation of lipoproteinlipase. J Biol Chem 274:8832–8836

12. Lefrancois S, Zeng J, Hassan AJ, Canuel M, Morales CR 2003 The lysosomaltrafficking of sphingolipid activator proteins (SAPs) is mediated by sortilin.EMBO J 22:6430–6437

13. Jacobsen L, Madsen P, Jacobsen C, Nielsen MS, Gliemann J, Petersen CM2001 Activation and functional characterization of the mosaic receptor SorLA/LR11. J Biol Chem 276:22788–22796

14. Marino M, Friedlander JA, McCluskey RT, Andrews D 1999 Identification ofa heparin-binding region of rat thyroglobulin involved in megalin binding.J Biol Chem 274:30377–30386

15. Marino M, Zheng G, Chiovato L, Pinchera A, Brown D, Andrews D,McCluskey RT 2000 Role of megalin (gp330) in transcytosis of thyroglobulinby thyroid cells. A novel function in the control of thyroid hormone release.J Biol Chem 275:7125–7137

16. Lisi S, Pinchera A, McCluskey RT, Willnow TE, Refetoff S, Marcocci C, VittiP, Menconi F, Grasso L, Luchetti F, Collins AB, Marino M 2003 Preferentialmegalin-mediated transcytosis of low-hormonogenic thyroglobulin: a controlmechanism for thyroid hormone release. Proc Natl Acad Sci USA 100:14858–14863

17. Arvan P, Jeso BD 2005 Thyroglobulin: structure, function and biosynthe-sis. In: Braverman LE, Utiger RD, eds. Werner and Ingbar’s the thyroid: afundamental and clinical text. Philadelphia: Lippincott Williams &Wilkins; 77–95

18. Brix K, Linke M, Tepel C, Herzog V 2001 Cysteine proteinases mediate ex-tracellular prohormone processing in the thyroid. Biol Chem 382:717–725

19. Seljelid R, Reith A, Nakken KF 1970 The early phase of endocytosis in ratthyroid follicle cells. Lab Invest 23:595–605

20. Bernier-Valentin F, Kostrouch Z, Rabilloud R, Munari-Silem Y, Rousset B

1990 Coated vesicles from thyroid cells carry iodinated thyroglobulin mole-cules. First indication for an internalization of the thyroid prohormone via amechanism of receptor-mediated endocytosis. J Biol Chem 265:17373–17380

21. Kostrouch Z, Munari-Silem Y, Rajas F, Bernier-Valentin F, Rousset B 1991Thyroglobulin internalized by thyrocytes passes through early and late endo-somes. Endocrinology 129:2202–2211

22. Marino M, McCluskey RT 2000 Role of thyroglobulin endocytic pathways inthe control of thyroid hormone release. Am J Physiol Cell Physiol 279:C1295–C1306

23. Kostrouch Z, Bernier-Valentin F, Munari-Silem Y, Rajas F, Rabilloud R,Rousset B 1993 Thyroglobulin molecules internalized by thyrocytes are sortedin early endosomes and partially recycled back to the follicular lumen. Endo-crinology 132:2645–2653

24. Herzog V 1983 Transcytosis in thyroid follicle cells. J Cell Biol 97:607–61725. Romagnoli P, Herzog V 1991 Transcytosis in thyroid follicle cells: regulation

and implications for thyroglobulin transport. Exp Cell Res 194:202–20926. Miquelis R, Courageot J, Jacq A, Blanck O, Perrin C, Bastiani P 1993 Intra-

cellular routing of GLcNAc-bearing molecules in thyrocytes: selective recy-cling through the Golgi apparatus. J Cell Biol 123:1695–1706

27. Marino M, Lisi S, Pinchera A, Chiovato L, McCluskey RT 2003 Targeting ofthyroglobulin to transcytosis following megalin-mediated endocytosis: evi-dence for a preferential pH-independent pathway. J Endocrinol Invest 26:222–229

28. Lisi S, Segnani C, Mattii L, Botta R, Marcocci C, Dolfi A, McCluskey RT,Pinchera A, Bernardini N, Marino M 2005 Thyroid dysfunction in megalindeficient mice. Mol Cell Endocrinol 236:43–47

29. Tauris J, Ellgaard L, Jacobsen C, Nielsen MS, Madsen P, Thogersen HC,Gliemann J, Petersen CM, Moestrup SK 1998 The carboxy-terminal domainof the receptor-associated protein binds to the Vps10p domain of sortilin. FEBSLett 429:27–30

30. Munck Petersen C, Nielsen MS, Jacobsen C, Tauris J, Jacobsen L, GliemannJ, Moestrup SK, Madsen P 1999 Propeptide cleavage conditions sortilin/neu-rotensin receptor-3 for ligand binding. EMBO J 18:595–604

31. Westergaard UB, Kirkegaard K, Sorensen ES, Jacobsen C, Nielsen MS,Petersen CM, Madsen P 2005 SorCS3 does not require propeptide cleavage tobind nerve growth factor. FEBS Lett 579:1172–1176

32. Ellgaard L, Holtet TL, Nielsen PR, Etzerodt M, Gliemann J, Thogersen HC1997 Dissection of the domain architecture of the �2macroglobulin-receptor-associated protein. Eur J Biochem 244:544–551

33. Oliver C 1999 Preparation of colloidal gold. Methods Mol Biol 115:327–33034. Modric T, Rajkumar K, Murphy LJ 1999 Thyroid gland function and growth

in IGF binding protein-1 transgenic mice. Eur J Endocrinol 141:149–15935. Bernardini N, Bianchi F, Dolfi A 1999 Laminin and �1 integrin distribution

in the early stages of human kidney development. Nephron 81:289–29536. Pohlenz J, Maqueem A, Cua K, Weiss RE, Van Sande J, Refetoff S 1999

Improved radioimmunoassay for measurement of mouse thyrotropin in serum:strain differences in thyrotropin concentration and thyrotroph sensitivity tothyroid hormone. Thyroid 9:1265–1271

37. Ambesi-Impiombato FS, Parks LA, Coon HG 1980 Culture of hormone-de-pendent functional epithelial cells from rat thyroids. Proc Natl Acad Sci USA77:3455–3459

38. Rozen S, Skaletsky H 2000 Primer3 on the WWW for general users and forbiologist programmers. Methods Mol Biol 132:365–386

39. Chiovato L, Vitti P, Lombardi A, Lopez G, Santini F, Macchia E, Fenzi GF,Mammoli C, Battiato S, Pinchera A 1987 Detection and characterization ofautoantibodies blocking the TSH-dependent cAMP production using FRTL-5cells. J Endocrinol Invest 10:383–388

40. Muresan Z, Arvan P 1997 Thyroglobulin transport along the secretory path-way. Investigation of the role of molecular chaperone, GRP94, in proteinexport from the endoplasmic reticulum. J Biol Chem 272:26095–26102

41. Santini F, Maffei M, Ceccarini G, Pelosini C, Scartabelli G, Rosellini V, ChielliniC, Marsili A, Lisi S, Tonacchera M, Agretti P, Chiovato L, Mammoli C, Vitti P,Pinchera A 2004 Genetic screening for melanocortin-4 receptor mutations in acohort of Italian obese patients: description and functional characterization of anovel mutation. J Clin Endocrinol Metab 89:904–908

42. Botta R, Lisi S, Pinchera A, Segnani C, Cianferotti L, Altea MA, Menconi F,Mattii L, Corsini GU, Marcocci C, Dolfi A, Bernardini N, Marino M 2006TSH-Dependent expression of the LDL receptor-associated protein (RAP) inthyroid epithelial cells. Thyroid 16:1097–1104

43. Marino M, Chiovato L, Lisi S, Pinchera A, McCluskey RT 2001 Binding of thelow density lipoprotein receptor-associated protein (RAP) to thyroglobulin(Tg): putative role of RAP in the Tg secretory pathway. Mol Endocrinol 15:1829–1837

Endocrinology, January 2009, 150(1):509–518 endo.endojournals.org 517

44. Lisi S, Botta R, Pinchera A, Collins AB, Refetoff S, Arvan P, Bu G, Grasso L,Marshansky V, Bechoua S, Hurtado-Lorenzo A, Marcocci C, Brown D,McCluskey RT, Marino M 2006 Defective thyroglobulin storage in LDLreceptor-associated protein-deficient mice. Am J Physiol Cell Physiol 290:C1160 –C1167

45. Zurzolo C, Gentile R, Mascia A, Garbi C, Polistina C, Aloj L, AvvedimentoVE, Nitsch L 1991 The polarized epithelial phenotype is dominant in hy-brids between polarized and unpolarized rat thyroid cell lines. J Cell Sci98(Pt 1):65–73

46. Nitsch L, Garbi C, Gentile R, Mascia A, Polistina C, Vergani G, Zurzolo C1989 FRTL-5 cell ultrastructure in the presence and absence of continuousTSH stimulation. In: Ambesi-Impiombato FS, Perild H, eds. FRTL-5 Today.1st ed. Amsterdam: Elsevier Science Publishers; 73–76

47. Spaulding SW 2005 Biological actions of thyrotropin. In: Braverman LE, Uti-

ger RD, eds. Werner and Ingbar’s the thyroid: a fundamental and clinical text.Philadelphia: Lippincott Williams & Wilkins; 183–197

48. Baloch ZW, LiVolsi VA 2005 Pathology. In: Braverman LE, Utiger RD, eds.Werner and Ingbar’s the thyroid: a fundamental and clinical text. Philadelphia:Lippincott Williams & Wilkins; 422–449

49. Cooper DS 2000 Treatment of thyrotoxicosis. In: Braverman LE, Utiger RD,eds. Werner and Ingbar’s the thyroid: a fundamental and clinical text. Phila-delphia: Lippincott Williams & Wilkins; 691–718

50. Weiss SJ, Philp NJ, Grollman EF 1984 Iodide transport in a continuous line ofcultured cells from rat thyroid. Endocrinology 114:1090–1098

51. Corvilain B, Laurent E, Lecomte M, Vansande J, Dumont JE 1994 Role of thecyclic adenosine 3�,5�-monophosphate and the phosphatidylinositol-Ca2�

cascades in mediating the effects of thyrotropin and iodide on hormone synthesisand secretion in human thyroid slices. J Clin Endocrinol Metab 79:152–159

518 Botta et al. Sortilin in the Thyroid Endocrinology, January 2009, 150(1):509–518