Phage-displayed Antibody Libraries of SyntheticHeavy Chain Complementarity Determining Regions

Sachdev S. Sidhu*, Bing Li, Yvonne Chen, Frederic A. FellouseCharles Eigenbrot and Germaine Fuh*

Department of ProteinEngineering, Genentech Inc.1 DNA Way, Mailstop 27South San FranciscoCA 94080, USA

A structure-based approach was used to design libraries of syntheticheavy chain complementarity determining regions (CDRs). The CDRlibraries were displayed as either monovalent or bivalent single-chainvariable fragments (scFvs) with a single heavy chain variable domainscaffold and a fixed light chain variable domain. Using the structure ofa parent antibody as a guide, we restricted library diversity to CDRpositions with significant exposure to solvent. We introduced diversitywith tailored degenerate codons that ideally only encoded for aminoacids commonly observed in natural antibody CDRs. With these designprinciples, we reasoned that we would produce libraries of diversesolvent-exposed surfaces displayed on stable scaffolds with minimalstructural perturbations. The libraries were sorted against a panel of pro-teins and yielded multiple unique binding clones against all six antigenstested. The bivalent library yielded numerous unique sequences, whilethe monovalent library yielded fewer unique clones. Selected scFvs wereconverted to the Fab format, and the purified Fab proteins retained highaffinity for antigen. The results support the view that synthetic heavychain diversity alone may be sufficient for the generation of high-affinityantibodies from phage-displayed libraries; thus, it may be possible to dis-pense with the light chain altogether, as is the case in natural camelidimmunoglobulins.

q 2004 Elsevier Ltd. All rights reserved.

Keywords: phage display; protein engineering; combinatorial mutagenesis;antibody library*Corresponding authors

Introduction

Monoclonal antibodies (mAbs) are invaluabletools in biological research and have also proveneffective as drugs.1 While conventional hybridomatechnologies still dominate as sources of antibody

reagents, phage display offers an attractive alterna-tive for the production of mAbs, particularly fortherapeutic uses, which benefit from the use ofhuman proteins.2 – 4 Phage display presents anti-body fragments on bacteriophage particles thatalso contain the encoding DNA. Binding selectionscan be used to enrich for clones that bind to anti-gens of interest and protein sequences can bedecoded from the DNA.

A particularly promising branch of antibodyphage display involves the construction of anti-body libraries with “synthetic” diversity; that is,diversity introduced with synthetic DNA and site-directed mutagenesis. Synthetic approaches offergreat potential for high-precision antibody engi-neering, because defined scaffolds can be usedand diversity can be tailored in a site-specificmanner. Thus, with synthetic libraries of sufficientquality and diversity, antibodies can be engineeredto recognize antigens solely through interactions

0022-2836/$ - see front matter q 2004 Elsevier Ltd. All rights reserved.

E-mail addresses of the corresponding authors:sidhu@gene.com; gml@gene.com

Abbreviations used: BSA, bovine serum albumin;CDR, complementarity determining region; CDR-Hn,(where n ¼ 1, 2, or 3), heavy chain CDR 1, 2, or 3; CDR-L3, light chain CDR 3; P3-C, C-terminal domain of theM13 bacteriophage gene-3 minor coat protein; ELISA,enzyme-linked immunosorbent assay; Fab, antigen-binding fragment; Ig, immunoglobulin; mAb,monoclonal antibody; mVEGF, murine vascularendothelial growth factor; scFv, single-chain variablefragment; PBS, phosphate-buffered saline; TMB,tetramethylbenzidine; VH, domain, heavy chain variabledomain; VL, domain, light chain variable domain.

doi:10.1016/j.jmb.2004.02.050 J. Mol. Biol. (2004) 338, 299–310

involving designed complementarity determiningregions (CDRs).

The third heavy chain CDR (CDR-H3) plays adominant role in antigen recognition,5 – 7 and thesimplest synthetic antibody repertoires have reliedon CDR-H3 libraries displayed on one or moreheavy chain variable (VH) domain scaffolds com-bined with one or several light chain variable (VL)domains.8 – 12 Recognizing that high-affinity anti-bodies utilize elements in addition to CDR-H3,Knappik et al. developed a more complex librarythat used multiple VH and VL domain scaffoldswith synthetic diversity in both CDR-H3 and thethird light chain CDR (CDR-L3).13 The diversity ofCDR-H3 and CDR-L3 has been further augmentedby introducing synthetic diversity into additionalCDRs.14,15

We have focused our attention on synthetic anti-body libraries, which utilize all three heavy chainCDRs in the context of a single VH domain scaffoldand a fixed VL domain. We believe that suchlibraries will be particularly advantageous for anti-body engineering efforts. The full potential of theheavy chain CDRs can be exploited in a simple VH

module that can be readily reformatted for affinitymaturation or protein production. The use of asingle, well-characterized scaffold also facilitatesstructured-based library design. Here, we report

the development and application of libraries ofthis type.

Results

Library design and construction

We chose the anti-ErbB2 antibody humanized4D5 (version 8) as the scaffold for presentation ofour synthetic heavy chain libraries. The antigen-binding fragment of humanized 4D5 (Fab4D5) iswell expressed in Escherichia coli and has been dis-played previously on bacteriophage.14 In addition,the high-resolution structure of the humanized4D5 variable fragment (Fv4D5) is available,16 asare the structures of several other humanizedFabs which use essentially the same framework todisplay different CDRs.17 – 20 To simplify the phage-displayed scaffold, we converted the heterodimericFab4D5 into a monomeric single-chain variablefragment (scFv4D5) consisting of the VL domainfused to the VH domain via a linker sequence thatcontained an epitope tag (gD-tag).

The scFv4D5 was fused to the C-terminaldomain of the M13 gene-3 minor coat protein(P3-C), and the entire cassette was inserted into aphagemid. Co-infection of E. coli with the display

Figure 1. Heavy chain CDR residues selected for diversification in phage-displayed libraries. (a) The backbones ofthe humanized 4D5 VH and VL domains are shown as grey or pink tubes, respectively. The side-chains of CDR residuesincluded in the library diversification strategy are shown, and the residues are colored yellow (CDR-H1), green(CDR-H2) or blue (CDR-H3). b, CPK representation of a. Residues are numbered according to the nomenclaturedescribed by Kabat et al.52 This Figure was generated with Insight II (Accelrys, San Diego) using coordinates for thecrystal structure of free Fv4D5 (PDB entry 1FVC).16

300 Synthetic Antibody Libraries

phagemid and a helper phage resulted in the dis-play of monomeric scFv4D5 on the surfaces ofM13 bacteriophage particles, as evidenced by thespecific capture of phage particles with immobi-lized ErbB2 antigen or an anti-gD-tag antibody(results not shown). We also constructed a phage-mid designed to display bivalent scFv4D5 byinserting a dimerization domain (consisting of anIgG1 hinge region and a homodimerizing leucinezipper) between the scFv and P3-C. Similar dimeri-zation domains have been used to display bivalentFabs on phage21 and to produce bivalent scFvproteins.22 In these previous applications, bivalentbinding produced an avidity effect that increased

the apparent binding affinities for immobilizedantigens, and we reasoned that avidity effectswould also improve the recovery of rare or low-affinity bivalent scFv clones from phage-displayedlibraries.

We examined the structure of Fv4D5 to identifyheavy chain CDR residues that would be suitablesites for supporting library diversity. We wantedto include a large number of variable sites to gener-ate highly diverse populations of scFvs presentinglarge, contiguous surfaces for potential antigen-binding contacts. However, we decided to excludehighly buried residues that may be required forstructural integrity. We also excluded positions

Figure 2. Natural and synthetic diversity of CDR-H1 and CDR-H2. The percentage of solvent accessibility of eachresidue in the structure of Fab4D5 was calculated using the computer program XSAE.53 The natural diversity was cal-culated from the alignment of approximately 3500 human heavy chain sequences in the Kabat database23 (http://www.kabatdatabase.com). At each position, the most prevalent residues are shown in rank order, with the fraction ofnatural sequences represented by each residue type shown below (e.g. Thr occurs in 54% of the sequences at position28). Synthetic diversity was introduced with tailored degenerate codons designed to encode a large proportion of thenatural residue types (bold text) while minimizing the introduction of extra residues infrequently observed in naturalantibodies. (e.g. The WMY codon encodes for Tyr, Ser, Asn, and Thr; only Thr is infrequently observed at position 32in the Kabat database). The broken line separates residues in CDR-H1 from those in CDR-H2.

Synthetic Antibody Libraries 301

where the side-chains pointed away from theantigen-binding site, because we reasoned thatside-chains at these positions would be unlikely tomake contacts with antigen.

In CDR-H1, site 29 was excluded from thediversification scheme because Ile29 is completelyburied in the Fv4D5 structure (Figures 1 and 2).In contrast, the residues at sites 28, 30, 31 and 33are significantly solvent-exposed and these siteswere selected for variation. While Thr32 is almostcompletely buried, the Thr side-chain is quite rareat this position amongst human antibodies, andthus, we decided to introduce limited diversity atthis site. CDR-H2 consists of a b-hairpin turn andthe succeeding b-strand; as a result, some of theresidues in this region are buried. Thus, positions51, 52a and 57 were not varied; position 55 wasalso excluded because Gly55 favors the CDR-H2b-turn conformation. The remaining six sites (50,52, 53, 54, 56 and 58) were included in the diversifi-cation scheme, as the residues at these positions aresignificantly solvent-exposed and the side-chainspoint into the antigen-binding site (Figure 1).CDR-H3 is quite flexible in the Fv4D5 structure,and therefore, we decided to randomize a contigu-ous stretch of residues within the central regionof the loop. As we were unsure of the appropriateN and C-terminal boundaries for CDR-H3,we designed four similar but slightly differentdiversification strategies for this loop (see below).

Having selected the sites for inclusion in thelibrary, we next designed tailored diversitiesbiased in favor of residue types commonlyobserved at each position in natural human anti-bodies. We analyzed the Kabat database23 andtabulated the percentage of occurrence of eachnatural amino acid at each CDR position withinapproximately 3500 human antibody sequences.In CDR-H1 and CDR-H2, the natural diversity ateach position was highly biased to favor only asubset of residues, and thus, at any given position,essentially all of the natural sequence diversity(.90%) could be accounted for by as few as fouror at most 11 residues (Figure 2). To effectivelymimic the natural diversity, we designed tailoreddegenerate codons for each site, with eachdegenerate codon chosen to encode as much ofthe natural diversity as possible without encodinga significant number of uncommon, extra residues.

In CDR-H3, there was some bias towards certainresidue types, but all 20 natural amino acid resi-dues occurred to a significant extent, and there

was very little position-specific bias within thecentral portion of the loop. We chose to diversifyCDR-H3 mainly with DVK codons, which encodefor 12 amino acid residues but exclude mostaliphatic side-chains; we reasoned that this codonchoice would produce hydrophilic CDR-H3 loopsand thus reduce the potential for non-specifichydrophobic interactions. However, we designeddifferent oligonucleotides to allow for differentdegrees of variation at the ends of the loop (Figure3). Oligonucleotide H3-1 was designed to fix theN-terminal residues at positions 95 and 96. In con-trast, oligonucleotide H3-3 was designed to fix theC-terminal residue at position 100a and an NNKcodon was used at position 100, as this position isburied in the Fv4D5 structure and the NNK codonencodes for more hydrophobic residues than doesthe DVK codon. Oligonucleotide H3-4 was iden-tical with H3-3, except that an additional DVKcodon was inserted to allow for some lengthvariation in the loop. Finally, oligonucleotide H3-2was designed to allow for variation at both the Nand C-terminal ends of CDR-H3.

Oligonucleotide-directed mutagenesis was usedto introduce simultaneously the designed degener-ate codons into all three heavy chain CDRs (seeMaterials and Methods). We constructed twolibraries that were identical in terms of thedesigned diversity but differed in the display for-mat. Lib-scFv (2.1 £ 1010 functional members) wasdesigned to display monovalent scFv moietiesfused directly to P3-C. In contrast, Lib-scFv2

(1.4 £ 1010 functional members) was designed todisplay bivalent scFv moieties by virtue of thedimerization domain inserted between the scFvand P3-C. As shown in Figure 1b, the residueschosen for diversification form a large, contiguouspatch on the surface of Fv4D5, and we expectedthat library members would each display a surfaceof similar size.

To characterize the actual diversity of the naıvelibraries, we cycled Lib-scFv2 through two roundsof binding selection against an antibody thatbound to the gD-tag epitope that linked the VL

and VH domains. This served as a crude selectionfor stable scFv, as unstable proteins were likely tobe proteolytically degraded and removed from thephage surface.24 – 26 Following selection, approxi-mately 100 unique clones were sequenced to deter-mine the amino acid composition of the naıveCDRs prior to selection against antigens. Thediversity of CDR-H1 and CDR-H2 was essentially

Figure 3. Synthetic diversity ofCDR-H3. The amino acid sequenceand numbering of humanized 4D5CDR-H3 is shown. The degeneratecodons introduced by the fourmutagenic oligonucleotides usedfor library construction are shown

below. Dashes indicate positions that were fixed as the wild-type. The NNK degenerate codon contains 32 codonsthat encode for all 20 natural amino acid residues. The DVK degenerate codon contains 18 codons that encode for 12amino acid residues (Ala, Arg, Asn, Asp, Cys, Gly, Glu, Lys, Ser, Thr, Trp and Tyr).

302 Synthetic Antibody Libraries

as expected; the designed amino acid typesoccurred at the randomized positions and veryfew undesigned mutations were observed (Table1). However, there was some bias for particularamino acid residues at particular positions. Whilemuch of the bias could be explained by the factthat the degenerate codons did not always encodefor an equal distribution of amino acid types,some biases were likely due to a genuine selectionfor or against particular sequences (e.g. the paucityof Tyr at position 33). Within CDR-H3, an essen-tially random distribution of the designed aminoacid types was observed (data not shown). Weclustered the CDR-H3 sequences on the basis ofthe oligonucleotide from which they were derivedand found that sequences derived from H3-4 wereunder-represented, while those derived from H3-2were over-represented. While these biases mayreflect structural constraints (e.g. a selectionagainst the longer loops encoded by H3-4), wenote that the oligonucleotides were incorporatedinto the library as a pool and thus differences inDNA annealing may also account for the bias.Taken together, these results indicate that theprocedures for library design and constructionwere successful, as all of the regions targeted forrandomization were highly diverse.

Our constructed libraries contained .1010 mem-bers, and thus ranked amongst the largest phage-displayed antibody libraries reported.27 – 29 How-ever, it is worth noting that this diversity repre-sents only a miniscule sampling of the theoreticaldiversity possible for 18 fully randomized sites inan antibody scaffold (1820 ¼ ,1025). By tailoringthe degenerate codons to mimic natural diversity,we limited the theoretical diversity to ,1016 combi-nations of approximately 8 £ 103 CDR-H1s,1.7 £ 104 CDR-H2s and 108 CDR-H3s. This strategyprovides two important benefits. Firstly, thenumber of misfolded or aggregation-prone clonesshould be significantly reduced, since the diversityat each CDR position was tailored to resemblesequences commonly found in natural antibodies.

Secondly, the hierarchy of CDR diversities wasthe same as that in the natural repertoire, withCDR-H3 being most diverse, followed by CDR-H2and CDR-H1. Thus, we believe that our strategymakes effective use of the combinatorial diversitiesachievable with phage display; we targeted thoseregions of the antibody scaffold best adapted tosupport sequence variations, and we did so in amanner that mirrored the variation patternsobserved in the natural immune repertoire.

Library sorting

The monovalent and bivalent libraries werecycled separately through rounds of binding selec-tions against six protein antigens. Following threerounds of selection, individual clones were assayedfor antigen-specific binding by phage enzyme-linked immunosorbent assays (ELISAs); specificbinding clones were defined as those that exhibitedELISA signals at least tenfold higher on antigen-coated plates in comparison with signals on platescoated with bovine serum albumin (BSA). Bothlibraries were successful in generating specificbinders against all six proteins, and the percentageof specific binders ranged from 4% to 70%(Table 2). Sequence analysis of binding clonesgenerated against four antigens revealed diversepopulations containing dozens or even hundredsof unique scFv sequences. Against most antigens(five out of six), Lib-scFv2 yielded higher percen-tages of specific binders and a greater diversity ofunique sequences than did Lib-scFv, and theseresults were consistent with an avidity effectwhich increased the recovery of scFvs from thebivalent Lib-scFv2 in comparison with the mono-valent Lib-scFv. In no case did the monovalentand bivalent libraries yield identical clones.

In total, Table 2 represents the sequences of 562unique scFvs isolated against four protein anti-gens. Thus, our single scaffold supported a diverserange of CDR sequences that gave rise to diverse

Table 1. Naıve diversity in CDR-H1 and CDR-H2

Position Percentage of amino acid type

C P V L I F Y W M G A S T N Q D E K R H28 34 35 3230 25 18 10 13 7 12 7 2 731 31 16 8 11 8 12 7 2 532 16 54 18 1233 6 2 6 29 24 21 8 4 1*50 6 19 7 17 6 16 17 7 652 23 20 30 7 7 1254 11 17 15 20 5 13 8 1155 7 14 33 13 7 12 10 557 1* 14 1* 25 26 9 7 6 7 359 11 31 29 7 11 10

The amino acid distribution was determined from the alignment of 107 sequences and the data were used to determine the percen-tage of occurrence of each amino acid type at each randomized position. Only three sequences (asterisks) were not encoded by thedegenerate codons used in the library design. The bold text indicates amino acid types for which the degenerate codon at a particularposition contained two unique codons (e.g. the DMK codon used at position 55 contained two codons each for Ala, Ser and Thr andone codon each for Tyr, Asn, Asp, Glu and Lys).

Synthetic Antibody Libraries 303

binding specificities. A significant advantage of asingle scaffold library is that hundreds or eventhousands of clones can be precisely aligned toreveal functionally relevant similarities or differ-ences amongst populations. We found that manyunique clones isolated against a particular antigencould be clustered on the basis of CDR sequencehomology, suggesting that they recognized com-mon epitopes (data not shown). In addition, wewere able to cluster sequences on the basis of theoligonucleotide from which CDR-H3 was derived,and thus, we could look for trends in the usage ofparticular CDR-H3 designs against a given antigen.Figure 4 shows that all four CDR-H3 designs wereused in scFvs selected against all four antigens,but there were some biases that may be significant.For example, CDR-H3 sequences derived fromoligonucleotide H3-4 were scarce in the naıve

library, but the longer loops encoded by this designmay be favored for binding to some antigens(e.g. hIgG). While these results are preliminary,they demonstrate how sequence analysis ofdefined synthetic libraries can reveal trends thatcould be used to further improve library designand performance (see Discussion).

Analysis of scFvs and Fabs binding tomurine vascular endothelial growthfactor (mVEGF)

We chose to analyze the selected anti-mVEGFscFvs in detail. Lib-scFv2 and Lib-scFv yielded 68and 18 unique binding clones, respectively, andthese were analyzed in a high-throughput competi-tive phage ELISA to obtain estimates of affinity.Phage were incubated with 100 nM mVEGF toestablish an equilibrium between the phage-displayed scFvs and mVEGF. The mixtures werethen transferred to plates coated with mVEGF tocapture scFv-phage that remained uncomplexedwith the solution phase mVEGF. By comparingthe amount of scFv-phage captured in the presenceof solution-phase mVEGF to the amount capturedin the absence of mVEGF, we could rank the cloneson the basis of relative affinities (Figure 5). Whilethe single-point competition ELISA is only semi-quantitative, it serves as a filter to rapidly assessrelative affinities within a large population. Themost promising clones can be subsequently ana-lyzed with more accurate assays.

Based on the results of the high-throughputassay, we chose five clones each from the mono-valent and bivalent libraries for further analysis.The scFvs were converted to the Fab format andcompetitive phage ELISAs were used to estimatethe affinities of the phage-displayed scFvs andFabs for mVEGF as IC50 values. The data from thetwo different formats were in good agreement;the IC50 values of seven of the Fabs were withintwofold of those of the corresponding scFvs(Figure 5). Four of the Fabs were purified as freeproteins and IC50 values were determined with

Table 2. Results of library sorting against proteinantigens

Antigena Library Percentage positive Unique clones

mVEGF scFv2 70 68/111scFv 35 18/91

hIGF scFv2 67 144/167scFv 40 48/88

hIgE scFv2 81 162/192scFv 4 NSb

hIgG scFv2 58 92/93scFv 79 30/92

hGH scFv2 19 NSb

scFv 6 NSb

hGHbp scFv2 23 NSb

scFv 6 NSb

Percentage positive specific binding clones were determinedby phage ELISA after three rounds of selection for binding toimmobilized antigen. Individual binding clones were subjectedto DNA sequence analysis and the number of unique cloneswas determined by alignment of the heavy chain CDRs (e.g. fol-lowing selection for binding to mVEGF, 68 of 111 sequencedclones from Lib-scFv2 were unique). See Materials and Methodsfor further details.

a The following antigens were analyzed: murine vascularendothelial growth factor (mVEGF), human insulin-like growthfactor 1 (hIGF), human immunoglobulin E (hIgE), humanimmunoglobulin G (hIgG), human growth hormone (hGH),human growth hormone binding protein (hGHbp).

b NS indicates that clones were not sequenced.

Figure 4. Origins of CDR-H3sequences. Unique clones selectedfor binding to either an anti-gD-tagepitope antibody (anti-gD) or oneof four protein antigens (hIGF,mVEGF, hIgE or hIgG) were clus-tered on the basis of the oligonu-cleotide from which CDR-H3sequences were derived (Figure 3).For each antigen (x axis), the graphshows the percentage of scFv clones(y axis) that contained CDR-H3sequences derived from oligonu-cleotide H3-1(white bars), H3-2(light grey bars), H3-3 (dark greybars) or H3-4 (black bars).

304 Synthetic Antibody Libraries

competitive ELISAs. Three of the free proteinsactually exhibited lower IC50 values than the corre-sponding phage-borne Fabs, and the best Fab pro-tein bound to mVEGF with an IC50 of 60 nM.

Discussion

We used a structure-based approach to designlibraries of synthetic heavy chain CDRs displayedon a single scaffold. Using the structure of Fv4D5as a guide, we chose CDR positions with signifi-cant exposure to solvent as sites for diversification(Figure 1). This necessitated the exclusion ofresidues that influence CDR main-chainconformations,30,31 and thus our strategy likelylimited conformational diversity. However, wereasoned that by not perturbing buried residueswe would increase the probability of maintainingthe structural integrity of the protein fold, andwould thus generate a diverse population of sur-faces displayed on a stable scaffold. To furtherreduce the possibility of structural perturbations,we used the Kabat database of natural antibodysequences23 to guide the diversity design at eachrandomized position. Tailored degenerate codonswere used to mimic the natural diversity observedwithin each position of CDR-H1 and CDR-H2(Figure 2). Within the naturally highly diverseCDR-H3, we allowed for a random distribution of12 amino acid residues but reduced the overallhydrophobicity by excluding aliphatic side-chainsin an attempt to reduce the probability of non-specific hydrophobic interactions (Figure 3). Wedisplayed our designed diversities in monovalentor bivalent scFv-phage libraries containing greaterthan 1010 unique members, and we tested the

performance of these libraries against a collectionof six protein antigens.

Overall, the selection experiments were very suc-cessful, in that specific binders were obtainedagainst all six antigens. Furthermore, DNA sequen-cing of clones selected against four of the antigensrevealed that the binding populations containedmany unique sequences (Table 2). Analysis of 86unique anti-mVEGF clones revealed a broad rangeof affinities with the tightest binders exhibitingIC50 values in the 100 nM range (Figure 6). It isnotable that the bivalent format allowed for theselection of numerous unique clones while themonovalent format allowed for the selection of thefew clones with the highest affinities (Figure 5).Thus, while the monovalent format is well suitedfor stringent affinity selections, the bivalent formatmay prove useful against difficult antigens or forobtaining panels of antibodies covering differentepitopes. The use of a defined scaffold enabled thefacile conversion of clones from the scFv to theFab format, and importantly, purified Fab proteinsretained high affinity for antigen (Figure 6).

By restricting the diversity of our syntheticlibraries to the heavy chain, we reasoned that wecould simplify sequencing and protein analysis.The feasibility of this strategy was supported bynumerous structural and functional studies whichhave shown that the heavy chain usually plays adominant role in antigen binding.18,20,32 – 36 Inaddition, even phage-displayed libraries in whichsynthetic diversity was entirely restricted toCDR-H3 have been successful in generating mod-erate affinity antibodies.10 Furthermore, manynatural camelid immunoglobulins consist of anindependent heavy chain, which is highly stableand functional in the absence of a light chain.37,38

Our results build on these studies and support the

Figure 5. High-throughput phage competition ELISA for estimating affinities of anti-mVEGF scFvs. The x axis showsthe clone number; clones 1–68 were from Lib-scFv2 and clones 69–86 were from Lib-scFv. The y axis shows the ratio ofthe phage ELISA signal (A450) in the presence of 100 nM mVEGF (þVEGF) to that in the absence of solution-phasemVEGF (2VEGF). Asterisks indicate clones that were chosen for further analysis. See Materials and Methods forfurther details.

Synthetic Antibody Libraries 305

view that synthetic heavy chain diversity alonemay be sufficient for the generation of high-affinityantibodies against most antigens.37 – 41

The affinities of our antibody fragments comparefavorably with those obtained from other syntheticantibody repertoires,10,13,14,42 but as noted pre-viously, the affinities of synthetic antibodies gener-ally fall short of the low nanomolar affinitiesexhibited by natural antibodies.43 A major reasonfor this shortcoming is the fact that, in animals,high-affinity antibodies are evolved from low-affinity progenitors through the introduction ofadditional somatic mutations. No such affinitymaturation mechanism was used in our work orin previous synthetic antibody studies. It is alsopossible that framework diversity may be requiredfor high-affinity recognition of some antigenclasses. The simplest way to improve affinity maybe to increase naıve library diversity,27,28 andlibrary diversities an order of magnitude greaterthan those reported here can be readily achievedwith our methods.44 Alternatively, moderateaffinities selected from the naıve repertoire can beimproved by introducing diversity into the buriedheavy chain CDR residues, the heavy chain frame-work or the light chain,45 and these processes aregreatly simplified by the use of a single, definedscaffold. Thus, we are quite hopeful that themoderate affinities attained from our naıvelibraries can be further improved throughimprovements in library design or through theapplication of affinity maturation mechanismsanalogous to those functioning in the naturalimmune system.

An ultimate goal for combinatorial antibodyengineering would be the construction of a univer-sal synthetic antibody library capable of generatinghigh affinity antibodies against any antigen with-out the need for affinity maturation. While thisgoal has not yet been attained, we feel that ourresults represent a significant advance in this direc-tion. We have focused our efforts on not only

developing useful synthetic libraries, but also ondeveloping and integrating robust methods forlibrary design, construction and application. Withthe methods reported here, essentially any CDRdesign of interest can be converted into an actuallibrary in less than one week, thus enabling therapid testing of concepts and principles. In fact,we have constructed second-generation libraries,which incorporate insights gleaned from the cur-rent study, and the results of these further studiesare forthcoming.

Materials and Methods

Materials

Enzymes and M13-KO7 helper phage were from NewEngland Biolabs. Maxisorp immunoplates were fromNUNC (Roskilde, Denmark). E. coli XL1-Blue was fromStratagene. BSA and Tween 20 were from Sigma. Tetra-methylbenzidine (TMB) substrate was from Kirkegaardand Perry Laboratories (Gaithersburg, MD). Protein Gaffinity columns were from Zymed Laboratories (SouthSan Francisco, CA).

Oligonucleotides

DNA degeneracies are represented in the IUB code(D ¼ A/G/T, K ¼ G/T, M ¼ A/C, N ¼ A/C/G/T,R ¼ A/G, S ¼ G/C, V ¼A/C/G, W ¼A/T, Y ¼ C/T).Degenerate codons are shown in bold text. The followingmutagenic oligonucleotides were used for libraryconstructions:

H1: TCC TGT GCA GCT TCT GGC TTC AVT ATTRVM RVM WMY KVK ATA CAC TGG GTG CGTCAG G;

H2: AAG GGC CTG GAA TGG GTT GCA KDKATT DMT CCT NMYDMK GGT DMK ACT DMTTAT GCC GAT AGC GTC AAG GGC;

H3-1: GTC TAT TAT TGT AGC CGC TGG GGADVK DVK DVK DVK DVK GCT ATG GAC TACTGG GGT CAA G;

Figure 6. Sequences and affinities of anti-mVEGF scFvs and Fabs. The clone numbers correspond to those in Figure 5.The sequences of the CDR residues diversified in the libraries are shown and numbered according to the nomenclaturedescribed by Kabat et al.52 The affinities were estimated as IC50 values by competitive ELISAs with scFv-phage, Fab-phage or purified Fab protein. ND indicates that these values were not determined. See Materials and Methods forfurther details.

306 Synthetic Antibody Libraries

H3-2: GTC TAT TAT TGT AGC CGC DVK DVKDVK DVK DVK DVK DVK GCT ATG GAC TACTGG GGT;

H3-3: GCC GTC TAT TAT TGT AGC CGC DVKDVK DVK DVK DVK NNK TAC GCT ATG GACTAC TGG GGT;

H3-4: GCC GTC TAT TAT TGT AGC CGC DVKDVK DVK DVK DVK DVK NNK TAC GCT ATGGAC TAC TGG GGT.

Vector construction

To display scFv4D5 on the surface of M13 bacterio-phage, we modified a previously described phagemid(pS1602) designed for the display of hGH fused toP3-C.46 Standard molecular biology techniques wereused to replace the fragment of pS1602 encoding forhGH with a DNA fragment encoding the VL domainof humanized 4D5 (amino acid residues 1–107), aspacer containing two stop codons (DNA sequence:TAAAGGCCTTAAGAGATCTCC, stop codons are inbold text), the VH domain of humanized 4D5 (aminoacid residues 1–120), a Gly/Ser linker sequence andP3-C. The resulting phagemid (pS2018) was used as thetemplate for the construction of a library designed toselect optimized linkers between the light and heavychain variable domains, using described methods.44

A mutagenic oligonucleotide was used to replace thestop codon spacer between the DNA encoding the VL

and VH domains within pS2018 with a linker library.The library was designed to insert linkers consisting ofan epitope tag (gD-tag)47 flanked on either side byfour positions containing random combinations of the20 natural amino acid residues (amino acid sequence:XXXXMADPNRFRGKDLXXXX), and it contained1.8 £ 1010 unique members.

Phage from the library were cycled through tworounds of binding selection with an anti-gD-tag antibodycoated on 96 well Nunc Maxisorp immunoplates asthe capture target. Phage were propagated in E. coliXL1-Blue with the addition of M13-KO7 helper phage.A clone that bound to both an anti-gD-tag antibody andthe extracellular domain of ErbB2 in phage ELISAswas sequenced; this phagemid (pS2019a) containedthe following linker between the VL and VH domains:SDMPMADPNRFRGKNLVFHSEIS. There was an Aspto Asn mutation in the gD-tag sequence that did notappear to affect binding to the anti-gD-tag antibody inphage ELISAs.

For bivalent display of scFv4D5, a dimerizationdomain (consisting of a human IgG1 hinge region and aGCN4 homodimerizing leucine zipper)48 was insertedbetween the C terminus of the scFv VH domain and theGly/Ser linker preceding P3-C. The resulting phagemidwas named pS2025e.

Library construction

Libraries were constructed using describedmethods18,44 with “stop template” versions of pS2019aand pS2025e. For each phagemid, a stop template wasconstructed by replacing codons in CDR-H1, CDR-H2and CDR-H3 with TAA stop codons. The stop templateversions of pS2019a and pS2025e were named pS2021band pS2025b, respectively.

Each stop template was used as the template for theKunkel mutagenesis method49 with mutagenic oligo-nucleotides designed to simultaneously repair the stop

codons and introduce mutations at the designed sites.CDR-H1 and CDR-H2 were mutagenized with oligo-nucleotides H1 and H2, respectively, and CDR-H3 wasmutagenized with an equimolar mixture of oligonucleo-tides H3-1, H3-2, H3-3 and H3-4. Mutations in all threeCDRs were introduced simultaneously in a singlereaction.

The mutagenesis reactions were electroporated intoE. coli SS320, as described,44 and phage production wasinitiated by the addition of M13-K07 helper phage.After overnight growth at 37 8C, phage were harvestedby precipitation with polyethylene glycol (PEG)/NaCl.Each library contained 5.0 £ 1010 unique members. Todetermine the functional diversity of each library (i.e.the number of clones displaying scFvs), individualclones were analyzed in a phage ELISA with an anti-gD-tag antibody as the capture target. In the scFv library(Lib-scFv) and the bivalent scFv library (Lib-scFv2), 41%and 28% of the clones exhibited positive ELISA signals,respectively. Thus, the functional diversities of Lib-scFvand Lib-scFv2 were 2.1 £ 1010 and 1.4 £ 1010, respectively.

Library sorting

NUNC 96 well Maxisorp immunoplates were coatedovernight at 4 8C with antigen (5 mg/ml) and blockedfor two hours with BSA. Phage from the librariesdescribed above were propagated in E. coli XL1-Bluewith the addition of M13-KO7 helper phage. Althoughthe phagemids contained an IPTG-inducible Ptac promo-ter, the cultures were grown in the absence of IPTGbecause these conditions provided optimal phage yieldsand protein display levels. After overnight growth at37 8C, phage were concentrated by precipitation withPEG/NaCl and resuspended in PBT buffer (phosphate-buffered saline (PBS), 0.5% (w/v) BSA, 0.1% (v/v)Tween 20), as described.44 Phage solutions (1012 phage/ml) were added to the coated immunoplates. Followinga two hour incubation to allow for phage binding, theplates were washed ten times with PBS, 0.5% Tween 20.Bound phage were eluted with 0.1 M HCl for ten min-utes and the eluant was neutralized with 1.0 M Trisbase. Eluted phage were amplified in E. coli XL1-Blueand used for further rounds of selection.

The libraries were cycled through two rounds of bind-ing selection with antigen-coated plates. A round ofbinding selection with anti-gD-tag antibody as thecapture target was then performed in order to eliminateclones in which the scFv gene had been deleted. Thiswas followed by a third round of antigen selection, afterwhich individual clones were analyzed for antigen-specific binding.

Individual clones from the third round of selection forantigen binding were grown in a 96 well format in 500 mlof 2YT broth supplemented with carbenicillin and M13-KO7 helper phage, and the culture supernatants wereused directly in phage ELISAs44,50 to detect phage-displayed scFvs that bound to antigen but not to BSA.Specific binding clones were defined as those that exhib-ited at least tenfold stronger ELISA signals on antigen-coated plates in comparison to signals on BSA-coatedplates, these clones were subjected to DNA sequenceanalysis.

Culture supernatants containing phage particles wereused as templates for PCRs that amplified DNA frag-ments encoding for the VH domain. The PCR primerswere designed to add M13(221) and M13R universalsequencing primers at either end of the amplified

Synthetic Antibody Libraries 307

fragments, thus facilitating the use of these primers insequencing reactions. The amplified DNA fragmentswere sequenced using Big-Dye terminator sequencingreactions, which were analyzed on an ABI Prism 370096 capillary DNA analyzer (PE Biosystems, Foster City,CA). All reactions were performed in a 96 well format.

High-throughput competitive phage ELISA

A single-point competitive phage ELISA was usedto rapidly estimate the affinities of phage-displayedanti-mVEGF scFvs. Colonies of E. coli XL1-Blue harbor-ing phagemids were inoculated directly into 150 mlof 2YT broth supplemented with carbenicillin andM13-KO7 helper phage; the cultures were grown over-night at 37 8C in a 96 well format. Culture supernatantscontaining scFv-phage were diluted fivefold in PBTbuffer either with or without 100 nM mVEGF. After onehour incubation at room temperature, the mixtures weretransferred to plates coated with mVEGF and incubatedfor 15 minutes. The plates were washed with PBS,0.05% Tween 20 and incubated for 30 minutes withhorseradish peroxidase/anti-M13 antibody conjugate(1:5000 dilution in PBT buffer). The plates were washed,developed with TMB substrate, quenched with 1.0 MH3PO4, and absorbance determined spectrophoto-metrically at 450 nm. For each clone, the fraction ofscFv-phage uncomplexed with solution phase mVEGFwas calculated by dividing the A450 in the presence of100 nM VEGF by the A450 in the absence of mVEGF.

Conversion of scFvs to Fabs

Phagemid DNA was used as the template for a PCRwith primers that amplified the DNA fragment encodingfor the VH domain of the anti-mVEGF scFv. The DNAfragment was digested with restriction enzymes, whichcleaved the DNA upstream of the region encoding forCDR-H1 (Mlu I) and downstream of the region encodingfor CDR-H3 (Apa I). The digested DNA fragment wasligated into a similarly digested vector (pS2307a)designed for the phage display of Fab4D5.48 The result-ing phagemid contained a biscistronic gene under thecontrol of the alkaline phosphatase promoter, asdescribed. The first open reading frame encoded a poly-peptide consisting of the stII secretion signal followedby the Fab4D5 light chain and a gD-tag epitope. Thesecond open reading frame encoded a fusion poly-peptide consisting of the following: the stII secretionsignal, the Fab4D5 heavy chain with the CDRs replacedby those of the anti-mVEGF scFv, a hexaHis tag, anamber (TAG) stop codon, a Gly/Ser linker sequence andP3-C. Expression in the amber suppressor strain E. coliXL-1 Blue co-infected with M13-KO7 resulted in the pro-duction of M13 bacteriophage displaying a Fab versionof the anti-mVEGF scFv.

For the production of free Fab protein, E. coli34B8 (anon-suppressor strain) harboring the phagemid clonewere grown for 24 hours at 30 8C in low phosphate AP5medium, as described.51 The culture was pelleted andhypotonic shockate was prepared by freezing the pelletat 220 8C for 18 hours, resuspending in 1 mM EDTA,10 mM Tris–HCl (pH 8.0), and incubating on ice for onehour. The shockate was centrifuged and the supernatantwas applied to a protein G affinity column; the columnwas washed with PBS and Fab protein was eluted with200 mM acetic acid and dialyzed into PBS. Protein con-

centrations were determined spectrophotometrically(e260 ¼ 67 £ 104 M21 cm21).

Affinity measurements by competitive ELISA

A modified phage ELISA44,50 was used to estimate thebinding affinities of phage-displayed anti-mVEGF scFvsand Fabs. Phage ELISAs were carried out on platescoated with mVEGF, as described above. Phage display-ing antibody fragments were serially diluted in PBTbuffer and binding was measured to determine a phageconcentration giving ,50% of the signal at saturation.A fixed, sub-saturating concentration of phage was pre-incubated for two hours with serial dilutions of mVEGFand then transferred to assay plates coated withmVEGF. After 15 minutes incubation, the plates werewashed with PBS, 0.05% Tween 20 and incubated for30 minutes with horseradish peroxidase/anti-M13 anti-body conjugate (1:5000 dilution in PBT buffer). Theplates were washed, developed with TMB substrate,quenched with 1.0 M H3PO4, and absorbance determinedspectrophotometrically at 450 nm. The binding affinitiesof the antibody fragments were determined as IC50

values defined as the concentration of mVEGF thatblocked 50% of the phage binding to the immobilizedmVEGF.

A competitive ELISA was used to determine thebinding affinities of purified Fab proteins. A fixed, sub-saturating concentration of Fab protein (,10 nM) inPBT buffer was pre-incubated for two hours with serialdilutions of mVEGF and then transferred to platescoated with mVEGF. After 15 minutes incubation, theplates were washed with PBS, 0.05% Tween 20 and incu-bated 30 minutes with horseradish peroxidase/protein Gconjugate (1:2000 dilution in PBT buffer). The plateswere washed, developed and absorbance determinedspectrophotometrically; the binding affinities weredetermined as IC50 values, as described above.

Additional material

The DNA sequences of the phage display phagemidsand protein expression plasmids are available from G.F.(at gml@gene.com). The DNA sequences of the scFvsselected for binding to antigens are available from S.S.S.(at sidhu@gene.com).

Acknowledgements

We are grateful to the Genentech DNA synthesisand sequencing groups. We thank Len Presta andPaul Carter for helpful discussions and advice.

References

1. Hudson, P. J. (1999). Recombinant antibody con-structs in cancer therapy. Curr. Opin. Immunol. 11,547–557.

2. Sidhu, S. S. (2000). Phage display in pharmaceuticalbiotechnology (Review). Curr. Opin. Biotechnol. 11,610–616.

3. Rader, C. & Barbas, C. F. (1997). Phage display ofcombinatorial antibody libraries. Curr. Opin. Biotech-nol. 8, 503–508.

308 Synthetic Antibody Libraries

4. Hoogenboom, H. R. (2002). Overview of antibodyphage-display technology and its applications.Methods Mol. Biol. 178, 1–37.

5. Xu, J. L. & Davis, M. M. (2000). Diversity in theCDR3 region of V(H) is sufficient for most antibodyspecificities. Immunity, 13, 37–45.

6. Al-Lazikani, B., Lesk, A. M., Chothia, C. (1997). Stan-dard conformations for the canonical structures ofimmunoglobulins. J. Mol. Biol. 273, 927–948.

7. Padlan, E. A. (1996). X-ray crystallography of anti-bodies. Advan. Protein. Chem. 49, 57–133.

8. Nissim, A., Hoogenboom, H. R., Tomlinson, I. M.,Flynn, G., Midgley, C., Lane, D. & Winter, G. (1994).Antibody fragments from a ‘single pot’ phage dis-play library as immunochemical reagents. EMBO J.13, 692–698.

9. Hoogenboom, H. R. & Winter, G. (1992). By-passingimmunisation. Human antibodies from syntheticrepertoires of germline VH gene segments rearrangedin vitro. J. Mol. Biol. 227, 381–388.

10. Barbas, C. F., Bain, J. D., Hoekstra, D. M. & Lerner,R. A. (1992). Semisynthetic combinatorial Ablibraries: a chemical solution to the diversity pro-blem. Proc. Natl Acad. Sci. USA, 89, 4457–4461.

11. Braunagel, M. & Little, M. (1997). Construction of asemisynthetic antibody library using trinucleotideoligos. Nucl. Acids Res. 25, 4690–4691.

12. de Kruif, J., Boel, E. & Logtenberg, T. (1995). Selectionand application of human single chain Fv antibodyfragments from a semi-synthetic phage antibody dis-play library with designed CDR3 regions. J. Mol. Biol.248, 97–105.

13. Knappik, A., Ge, L., Honegger, A., Pack, P., Fischer,M., Wellnhofer, G. et al. (2000). Fully synthetichuman combinatorial antibody libraries (HuCAL)based on modular consensus frameworks and CDRsrandomized with trinucleotides. J. Mol. Biol. 296,57–86.

14. Garrard, L. J. & Henner, D. J. (1993). Selection of ananti-IGF-1 Fab from a Fab phage library created bymutagenesis of multiple CDR loops. Gene, 128,103–109.

15. de Wildt, R. M. T., Mundy, C. R., Gorick, B. D. &Tomlinson, I. M. (2000). Antibody arrays for high-throughput screening of antibody–antigen inter-actions. Nature Biotechnol. 18, 989–994.

16. Eigenbrot, C., Randal, M., Presta, L., Carter, P. &Kossiakoff, A. A. (1993). X-ray structures of the anti-gen-binding domains from three variants of huma-nized anti-p185HER2 antibody 4D5 and comparisonwith molecular modeling. J. Mol. Biol. 229, 969–995.

17. Chen, Y., Wiesmann, C., Fuh, G., Li, B., Christinger,H. W., McKay, P. et al. (1999). Selection and analysisof an optimized anti-VEGF antibody: crystalstructure of an affinity-matured Fab in complexwith antigen. J. Mol. Biol. 293, 865–881.

18. Vajdos, F. F., Adams, C. W., Breece, T. N., Presta, L. G.,de Vos, A. M. & Sidhu, S. S. (2002). Comprehensivefunctional maps of the antigen-binding site of ananti-ErbB2 antibody obtained with shotgun scanningmutagenesis. J. Mol. Biol. 320, 415–428.

19. Eigenbrot, C., Gonzalez, T., Mayeda, J., Carter, P.,Werther, W., Hotaling, T. et al. (1994). X-ray struc-tures of fragments from binding and nonbinding ver-sions of a humanized anti-CD18 antibody: structuralindications of the key role of VH residues 59 to 65.Proteins, 18, 49–62.

20. Faelber, K., Kirchhofer, D., Presta, L., Kelley, R. F. &Muller, Y. A. (2001). The 1.85 A resolution crystal

structures of tissue factor in complex with huma-nized Fab D3H44 and of free humanized FabD3H44: revisiting the solvation of antigen combiningsites. J. Mol. Biol. 313, 83–97.

21. Lee, V., Sidhu, S. S. & Fuh, G. (2004). Bivalent anti-body phage display mimics natural immuno-globulin. J. Immunol. Methods, 284, 119–132.

22. Pack, P. & Pluckthun, A. (1992). Miniantibodies: useof amphipathic helices to produce functional, flexiblylinked dimeric Fv fragments with high avidity inEscherichia coli. Biochemistry, 31, 1579–1584.

23. Johnson, G. & Wu, T. T. (2000). Kabat database andits applications: 30 years after the first variabilityplot. Nucl. Acids Res. 28, 214–218.

24. Fiucane, M. D., Tuna, M., Lees, J. H. & Woolfson,D. N. (1999). Core-directed protein design. I. Anexperimental method for selecting stable proteinsfrom combinatorial libraries. Biochemistry, 38,11604–11612.

25. Kristensen, P. & Winter, G. (1998). Proteolytic selec-tion for protein folding using filamentous bacterio-phages. Fold. Des. 3, 321–328.

26. Sieber, V., Pluckthun, A. & Schmid, F. X. (1998).Selecting proteins with improved stability by aphage-based method. Nature Biotechnol. 16, 955–960.

27. Griffiths, A. D., Williams, S. C., Hartley, O., Tomlin-son, I. M., Waterhous, P., Crosby, W. L. et al. (1994).Isolation of high affinity human antibodies directlyfrom large synthetic repertoires. EMBO J. 13,3245–3260.

28. Vaughan, T. J., Williams, A. J., Pritchard, K.,Osbourn, J. K., Pope, A. R., Earnshaw, J. C. et al.(1996). Human antibodies with sub-nanomolaraffinities isolated from a large non-immunizedphage display library. Nature Biotechnol. 14, 309–314.

29. Sheets, M. D., Amersdorfer, P., Finnern, R., Sargent,P., Lindqvist, E., Schier, R. et al. (1998). Efficientconstruction of a large nonimmune phage antibodylibrary: the production of high-affinity humansingle-chain antibodies to protein antigens. Proc.Natl Acad. Sci. USA, 95, 6157–6162.

30. Al-Lazikani, B., Lesk, A. M. & Chothia, C. (1997).Standard conformations for the canonical structuresof immunoglobulins. J. Mol. Biol. 273, 927–948.

31. Chothia, C., Lesk, A. M., Gherardi, E., Tomlinson,I. M., Walter, G., Marks, J. D. et al. (1992). Structuralrepertoire of the human VH segments. J. Mol. Biol.227, 799–817.

32. Muller, Y. A., Chen, Y., Christinger, H. W., Li, B.,Cunningham, B. C., Lowman, H. B. & de Vos, A. M.(1998). VEGF and the Fab fragment of a humanizedneutralizing antibody: crystal structure of the com-plex at 2.4 A resolution and mutational analysis ofthe complex interface. Structure, 15, 1153–1167.

33. Franklin, M. C., Carey, K. D., Vajdos, F. F., Leahy, D. J.& de Vos, A. M. (2004). Insights into ErbB signalingfrom the structure of the ErbB2–pertuzumab com-plex. Cancer Cell. In the press.

34. Braden, B. C., Souchon, H., Eisele, J.-L., Bentley, G. A.,Bhat, T. N., Navaza, J. & Poljak, R. J. (1994). Three-dimensional structures of the free and the antigen-complexed Fab from monoclonal anti-lysozyme anti-body D44.1. J. Mol. Biol. 243, 767–781.

35. Prasad, L., Sharma, S., Vandonselaar, M., Quail, J. W.,Lee, J. S., Waygood, E. B. et al. (1993). Evaluation ofmutagenesis for epitope mapping. J. Biol. Chem. 268,10705–10708.

36. Vix, O., Rees, B., Thierry, J.-C. & Altschuh, D. (1993).Crystallographic analysis of the interaction between

Synthetic Antibody Libraries 309

cyclosporin A and the Fab fragment of a monoclonalantibody. Proteins: Struct. Funct. Genet. 15, 339–348.

37. Hamers-Casterman, C., Atarhouch, T., Muyldermans,S., Robinson, G., Hamers, C., Songa, E. B. et al. (1993).Naturally occurring antibodies devoid of lightchains. Nature, 363, 446–448.

38. Sheriff, S. & Constantine, K. L. (1996). Redefining theminimal antigen-binding fragment. Nature Struct.Biol. 3, 733–736.

39. Bond, C. J., Marsters, J. C., Jr. & Sidhu, S. S. (2003).Contributions of CDR3 to VHH domain stability andthe design of monobody scaffolds for naive antibodylibraries. J. Mol. Biol. 332, 643–655.

40. Arbabi Ghahroudi, M., Desmyter, A., Wyns, L.,Hamers, R. & Muyldermans, S. (1997). Selection andidentification of single domain antibody fragmentsfrom camel heavy-chain antibodies. FEBS Letters,414, 521–526.

41. Koide, A., Abbatiello, S., Rothgery, L. & Koide, S.(2002). Probing protein conformational changes inliving cells by using designer binding proteins:application to the estrogen receptor. Proc. Natl Acad.Sci. USA, 99, 1253–1258.

42. Krebs, B., Rauchenberger, R., Reiffert, S., Rothe, C.,Tesar, M., Thomassen, E. et al. (2001). High-through-put generation and engineering of recombinanthuman antibodies. J. Immunol. Methods, 254, 67–84.

43. Berry, J. D. & Popkov, M. (2004). Antibody librariesfrom immunized repertoires. In Phage Display in Bio-technology and Drug Discovery (Sidhu, S. S., ed.), Mar-cel Dekker, New York. In the press.

44. Sidhu, S. S., Lowman, H. B., Cunningham, B. C. &Wells, J. A. (2000). Phage display for selection ofnovel binding peptides. Methods Enzymol. 328,333–363.

45. Baca, M., Presta, L. G., O’Connor, S. J. & Wells, J. A.(1997). Antibody humanization using monovalentphage display. J. Biol. Chem. 272, 10678–10684.

46. Sidhu, S. S., Weiss, G. A. & Wells, J. A. (2000). Highcopy display of large proteins on phage for func-tional selections. J. Mol. Biol. 296, 487–495.

47. Lasky, L. A. & Dowbenko, D. J. (1984). DNAsequence analysis of the type-common glycoprotein-D genes of herpes simplex virus types 1 and 2.DNA, 3, 23–29.

48. Lee, V., Sidhu, S. S. & Fuh, G. (2003). Bivalent anti-body phage display mimics natural immuno-globulins. J. Immunol. Methods, 284, 119–132.

49. Kunkel, T. A., Roberts, J. D. & Zakour, R. A. (1987).Rapid and efficient site-specific mutagenesis withoutphenotypic selection. Methods Enzymol. 154, 367–382.

50. Deshayes, K., Schaffer, M. L., Skelton, N. J.,Nakamura, G. R., Kadkhodayan, S. & Sidhu, S. S.(2002). Rapid identification of small binding motifswith high-throughput phage display: discovery ofpeptidic antagonists of IGF-1 function. Chem. Biol. 9,495–505.

51. Presta, L. G., Chen, H., O’Connor, S. J., Chisholm, V.,Meng, Y. G., Krummen, L. et al. (1997). Humaniza-tion of an anti-vascular endothelial growth factormonoclonal antibody for the therapy of solid tumorsand other disorders. Cancer Res. 57, 4593–4599.

52. Kabat, E. A., Wu, T. T., Redi-Miller, M., Perry, H. M.& Gottesman, K. S. (1987). Sequences of Proteins ofImmunological Interest, 4th edit., National Institutesof Health, Bethesda, MD.

53. Broger, C. (2000). XSAE 1.5 edit., F. Hoffman-LaRoche, Basel, Switzerland.

Edited by I. Wilson

(Received 11 November 2003; received in revised form 18 February 2004; accepted 19 February 2004)

310 Synthetic Antibody Libraries