Overexpression of human histone methylase MLL1upon exposure to a food contaminant mycotoxin,deoxynivalenolKhairul I. Ansari1, Imran Hussain1, Hriday K. Das2 and Subhrangsu S. Mandal1

1 Department of Chemistry and Biochemistry, The University of Texas at Arlington, TX, USA

2 Pharmacology & Neuroscience, University of North Texas Health Science Center, Fort Worth, TX, USA

Elucidating the regulatory network of proto-oncogenes

in normal healthy cells and under toxic stress is impor-

tant for understanding the mechanism of human dis-

eases [1–5]. Mixed lineage leukemias (MLLs) are a set

of evolutionary conserved genes that are often rear-

ranged and misregulated in acute lymphoblastic and

myeloid leukemias [1,2,6]. Humans encode several

MLL protein families, such as MLL1, MLL2, MLL3,

MLL4 and Set1 [1,7–14]. In general, they are master

regulators of homeobox (Hox) genes which are critical

for cell differentiation and development [1,2,15,16].

Because of their importance in gene regulation and dis-

ease, researchers have purified MLL proteins from

human cells and have demonstrated that MLLs posses

histone H3 lysine-4-specific methyl-transferase activities

and play a critical role in gene activation [9,17–20].

MLLs exist as multiprotein complexes inside cells with

several common protein subunits such as Ash2, Wdr5,

Rbbp5 and CGBP [1,9,10,19,21]. Recently, we affinity

purified several MLL complexes from human cells and

demonstrated that MLL1 plays critical roles in his-

tone H3 lysine-4 methylation and Hox gene regulation

[21]. We also demonstrated that downregulation of

MLL1 results in cell-cycle arrest in the G2 ⁄M phase

indicating its critical role in cell-cycle progression [22].

Although recent discoveries of MLL-associated his-

tone H3 lysine-4-specific methyl-transferase activities

have shed significant light on the complex function of

MLLs in gene regulation, little is known about their

own regulation in normal cells or in cells under stress

[1]. However, it has been reported that certain chemo-

therapeutic stresses result in MLL rearrangement and

misregulation, leading to the development of secondary

leukemias in humans [23,24]. These observations indi-

cated that MLL1 is stress-responsive gene. Herein, we

studied the effect of a potential carcinogenic mycotox-

Keywords

deoxynivalenol; mixed lineage leukemia;

MLL; mycotoxin; Sp1

Correspondence

S. S. Mandal, Department of Chemistry and

Biochemistry, The University of Texas at

Arlington, Arlington, TX 76019, USA

Fax: +1 817 272 3808

Tel: +1 817 272 3804

E-mail: smandal@uta.edu

(Received 2 February 2009, revised 29

March 2009, accepted 7 April 2009)

doi:10.1111/j.1742-4658.2009.07055.x

Mixed lineage leukemias (MLLs) are histone-methylating enzymes with

critical roles in gene expression, epigenetics and cancer. Although MLLs

are important gene regulators little is known about their own regulation.

Herein, to understand the effects of toxic stress on MLL gene regulation,

we treated human cells with a common food contaminant mycotoxin,

deoxynivalenol (DON). Our results demonstrate that MLLs and Hox genes

are overexpressed upon exposure to DON. Studies using specific inhibitors

demonstrated that Src kinase families are involved in upstream events in

DON-mediated upregulation of MLL1. Sequence analysis demonstrated

that the MLL1 promoter contains multiple Sp1-binding sites and impor-

tantly, the binding of Sp1 is enriched in the MLL1 promoter upon expo-

sure to DON. Moreover, antisense-mediated knockdown of Sp1 diminished

DON-induced MLL1 upregulation. These results demonstrated that MLL1

gene expression is sensitive to toxic stress and Sp1 plays crucial roles in the

stress-induced upregulation of MLL1.

Abbreviations

ChIP, chromatin immunoprecipitation; DON, deoxynivalenol; Hox, homeobox; MLL, mixed lineage leukemia.

FEBS Journal 276 (2009) 3299–3307 ª 2009 The Authors Journal compilation ª 2009 FEBS 3299

in, deoxynivalenol (DON) on the regulation of MLL1.

Notably, DON is a toxin produced by pathogenic

fungi during the infection of cereal crops and is often

linked with various acute and chronic human diseases,

including cancer [25–27]. Herein, we report that MLL1

and its target Hox genes are upregulated upon expo-

sure to DON and transcription factor Sp1 plays criti-

cal roles in the DON-mediated upregulation of MLL1.

Results

DON induces expression of MLL

To understand the effects of mycotoxic stress on MLL

expression, we treated cultured human cells

(H358 cells) with varying concentrations of DON (up

to 33 lm) for 7.5 h. We isolated RNA from the treated

and untreated control cells and subjected it to RT-

PCR with primers specific to MLL1 and Set1. As seen

in Fig. 1A,B, treatment with DON induced two- to

five-fold overexpression of MLL1 and Set1 in a con-

centration-dependent manner. MLL1 overexpression

by DON was more dramatic (8.3-fold) at the protein

level (lane 4, Fig. 1C,D). The decrease in expression of

MLL1 and Set1 at 10 h or longer (Fig. 1C,D) is likely

caused by cell death induced by DON. Because MLL1

is upregulated upon exposure to DON, we analyzed

the expression of several other proteins (such as

Rbbp5, Wdr5 and Ash2) known to interact with

MLL1 [9,21]. We also analyzed the effect of DON on

expression of some MLL1 target Hox genes (HoxA2,

HoxA7, HoxB1, HoxB7, etc.). Importantly, similar to

MLL1, Rbbp5 and Wdr5 were overexpressed upon

treatment with DON, whereas Ash2 was not affected

significantly (Fig. 2). Similarly, HoxA7, HoxA2 and

HoxB1 were overexpressed, whereas HoxB7 was down-

regulated upon exposure to DON (Fig. 2 and data not

shown). The upregulation of MLL1, its several inter-

Incubation time (h)

1 2 3 4 5 6 0 2.5 5 7.5 10 15

β -actin

MLL1

Set1

0

2

4

6

8

10

MLL1 Set1

0 h 2.5 h 5 h 7.5 h 10 h 15 h

o t e v i t a l e r (

e s a e r c n i d l o

F

) l o r t n o c

o t e v i t a l e r (

e s a e r c n i d l o

F

) l o r t n o c

1

2

3

4

5

6

MLL1 Set1

0.33 µM

3.3 µM

33 µM

β -actin

MLL1

Set1

1 2 3 4 5 6 7 8 0 0.33 3.3 33 DON (µM)

A C

B D

Fig. 1. DON-induced expression of MLL1

and Set1. (A) Human lung cancer cells

(H358) were treated with varying concentra-

tions (0–33 lM) of DON for 7.5 h. Total RNA

was subjected to RT-PCR analysis with

primers specific to b-actin (control), MLL1

and Set1. Each experiment was duplicated

for accuracy. (B) Quantification of MLL1 and

Set1 expression as seen in (A). Bars indi-

cate SEM. (C) Total protein extracts from

DON (3.3 lM DON for various time points)

treated H358 cells were analyzed by wes-

tern blot using anti-actin (control), anti-MLL1

and anti-Set1 Ig. (D) Quantification of

expressed proteins as seen in (C) relative

to actin.

Water DON

1 2 3 4 5 6 7 8

β -actin

Rbbp5

Ash2

Wdr5

HoxA7

HoxB7

o t e v i t a l e r ( e s a e r c n i d l o F

) l o r t n o c

0.0

0.5

1.0

1.5

2.0

2.5

3.0

3.5

4.0

5 p b b R

5 r d W

2 h s A

7 A

x o

H

7 B

x o

H

A B

Fig. 2. DON-induced expression of MLL1-int-

eracting and target genes (A). Human lung

cancer cells (H358) were treated with 3.3 lM

DON for 7.5 h. Total RNA was subjected to

RT-PCR analysis with primers specific

for b-actin (control), Rbbp5, WDR5, Ash2,

HoxA7 and HoxB7. Lanes 1–4, untreated

control; lanes 5–8, treated with DON (B).

Quantification of gene expression level as

seen in (A). Bars indicate SEM.

MLL1 misregulation by deoxynivalenol K. I. Ansari et al.

3300 FEBS Journal 276 (2009) 3299–3307 ª 2009 The Authors Journal compilation ª 2009 FEBS

acting proteins or selected target Hox genes upon

exposure to DON indicated that expression of these

proteins is sensitive to toxic stress.

Notably, we analyzed the effects of DON on cell

growth and determined the cytotoxicity (IC50) towards

H358 cells using a 3-(4,5-dimethylthiazol-2-yl)-2,5-

diphenyl-tetrazolium bromideassay, as described previ-

ously [28]. Upon treatment with 3.3 lm DON, up to 5,

47 and 68% of H358 cells were killed at 7.5, 24 and

72 h post treatment, respectively. The IC50 value is

determined to be 1 lm. These results demonstrated

that DON is significantly cytotoxic towards human

cells.

Src kinase inhibitor suppressed the DON-induced

upregulation of MLL1

To understand potential mechanism of DON-mediated

upregulation of MLL1 and Hox genes, we examined

the involvement of different DON-responsive signaling

pathways. Because DON is known to induce ribotoxic

stress that instigates various signaling cascades, includ-

ing MAP ⁄Src kinases [29–33], we initially examined

whether inhibition of MAP ⁄Src kinase activation had

any effect on DON-induced upregulation of MLL1.

We treated cells with a Src kianse inhibitor (PP2) or a

MAP kinase inhibitor (PD98059) and then exposed the

cells to DON. As expected, MLL1 was upregulated

upon treatment with DON (lanes 1 and 4–7, Fig. 3).

However, upon treatment with PP2, DON-induced

expression of MLL1 and HoxA7 was suppressed in a

concentration-dependent manner at both the mRNA

and protein levels (compare lanes 4–7 with lane 1,

Fig. 3A,B). These results indicated that Src kinases

play a critical role in regulating upstream events that

lead to MLL1 and HoxA7 upregulation by DON.

Notably, PP2 has no significant effect on DON-

induced expression of Set1, Rbbp5, Ash2 and Wdr5

(data not shown) suggesting the involvement of alter-

nate pathways. Because MLL1 induction was sup-

pressed by Src kinase inhibitor (PP2), we examined

whether MAP kinases are also involved in DON-medi-

ated MLL1 upregulation. However, application of

PD98059 did not have any significant effect on DON-

induced upregulation of MLL1, indicating no involve-

ment of MAP kianses in this process (Fig. 3C).

Sp1 plays a critical role in DON-induced MLL1

upregulation

To understand the mechanism of MLL1 upregulation

by DON, we analyzed the MLL1 promoter for the

presence of various cis-elements recognized by specific

transcription factors (such as Sp1, AP2), particularly

those known to be activated by mycotoxins [27,29–36].

Interestingly, we found the presence of multiple Sp1-

binding sites in the MLL1 promoter ()3000 to

+500 nucleotide region; Fig. 4). To investigate possi-

ble role of Sp1 in MLL1 gene regulation, we knocked

down Sp1 in H358 cells by using Sp1-specific antisense

and then analyzed the expression of MLL1 in the

absence and presence of DON (3.3 lm). As seen in

Fig. 5A,B, treatment with Sp1 antisense effectively

knocked down Sp1 expression at both the mRNA and

the protein level (compare lanes 1 with 3). Upon

knockdown of Sp1, the basal level of MLL1 expression

was not significantly affected at the mRNA or the

PP2 (µM)

DON (3.3 µM) + + –

– –

– + + + +

1 2 3 4 5 6 7

β -actin

MLL1

HoxA7

Ash2

10 0.1 1 10 25

A

+ + + +

PP2 (µM) 10 0.1 1 10 25

β -actin

MLL1

Ash2

DON (3.3 µM)

1 2 3 4 5 6 7

– – –

+ –

B

PD89059 (µM)

DON (3.3 µM) + + + + +

1 2 3 4 5 6 7

β -actin

MLL1

– –

– –

25 1 5 25 50

C

Fig. 3. Effect of DON on expression of MLL1 and HoxA7 genes in

presence of MAP ⁄ Src kinase inhibitor PP2 and PD98059.

H358 cells were treated 0.1, 1, 10 and 25 lM PP2 and 1, 5, 25 and

50 lM PD98059 for 1 h prior to treatment with 3.3 lM DON for an

additional 7.5 h. (A). RT-PCR analysis of RNA extract from cells

treated with PP2 with primers specific to b-actin (control), MLL1,

Ash2 and HoxA7. (B) Western blot of the total proteins extract of

the cells treated with PP2 with antibodies specific for b-actin, MLL1

and Ash2. (C) RT-PCR analysis of RNA extract from cells treated

with PD98059 with primers specific to b-actin (control) and MLL1.

Each experiment was performed in duplicate.

K. I. Ansari et al. MLL1 misregulation by deoxynivalenol

FEBS Journal 276 (2009) 3299–3307 ª 2009 The Authors Journal compilation ª 2009 FEBS 3301

protein level (Fig. 5A,B, lanes 1 and 3). Interestingly,

however, DON-induced upregulation of MLL1

(mRNA and protein level) was suppressed to almost

normal levels under an Sp1 knocked down environ-

ment (Fig. 5A,B, lanes 2 and 4). These results indi-

cated that Sp1 is critical for MLL1 regulation,

especially in presence of DON.

Because the MLL1 promoter contains multiple Sp1-

binding sites and our results demonstrated that Sp1 is

critical in regulating MLL1 on exposure to DON, we

hypothesized that DON modulates binding of Sp1 to

the MLL1 promoter. To confirm our hypothesis, we

treated H358 cells with 3.3 lm DON and subjected

them to chromatin immunoprecipitation (ChIP) using

anti-Sp1 Ig (Fig. 5C,D). In parallel, we also performed

ChIP with an unrelated antibody (actin antiserum).

The immunoprecipitated DNA fragments were PCR

amplified using primers specific for MLL1 promoter

regions R1 ()497 to )593), R2 ()5 to )105), MLL1-

ORF (as control) and b-actin-ORF (a second unre-

lated control). Our results demonstrated that no Sp1

was bound to the ORF region of actin in either the

absence or presence of DON (Fig. 5C, upper, lanes

5 and 6). Similarly, Sp1 binding was not enriched in

the MLL1-ORF region in the presence of DON

(MLL1-ORF; Fig. 5C, lanes 5 and 6). Interestingly,

however, the binding of Sp1 was significantly enriched

in the Sp1-binding sites of the MLL1 promoter regions

R1 and R2 in the presence of DON, although more

enrichment was observed in the R2 region (closer to

the transcription start site) (Fig. 5C,D, lanes 5 and 6).

ChIP analysis showed no binding of b-actin to the

MLL1 promoters and ORF region, irrespective of the

presence or absence of DON (Fig. 5C, lanes 3 and 4).

These results demonstrated that binding and enrich-

ment of Sp1 to the MLL1 promoter regions (R1 and

R2) in the presence of DON is specific and this dem-

onstrates that Sp1 is crucial for transcriptional activa-

tion of MLL1 under DON treatment.

Furthermore, because phosphorylation of Sp1 is well

known to be associated with toxic stress, we analyzed

the state of Sp1 phosphorylation upon DON exposure

[33,37]. We performed immunoprecipitation of Sp1

using anti-Sp1 Ig (nonphosphorylated) from DON-

treated and untreated cells. We analyzed the immuno-

precipitates by western blot using both anti-Sp1 Ig

(nonphosphorylated) and anti-phosphotyrosine Ig that

recognize tyrosine-phosphorylated proteins. Interest-

ingly, upon DON treatment, the protein level of Sp1

was not significantly affected, although, the level of

tyrosine-phosphorylated Sp1 was increased (Fig. 5E).

These results indicated that DON induces phosphory-

lation of Sp1 and this might be linked with MLL1

upregulation.

Discussion

Because MLLs are proto-oncogenes and are known to

be rearranged or misregulated under chemotherapeutic

stress, leading to secondary leukemias [23,24], elucidat-

ing the stress responsive regulatory mechanism of

MLL is important. Herein, our studies showed that

exposure to mycotoxin DON-induced expression of

MLL1, several MLL interacting proteins and MLL

target Hox genes. Notably, MLL1 exists as a multipro-

tein complex inside the cell with subunits like Ash2,

Wdr5 and Rbbp5, and MLL1 executes its histone

methyl-transferase activity and regulates target Hox

genes in the context of the multiprotein complex

[1,9,10]. Therefore, because MLL1 and several Hox

genes (HoxA7, HoxA2, etc.) were overexpressed upon

exposure to DON, we anticipated that MLL-interact-

ing proteins might be upregulated in a similar fashion.

However, our results demonstrated that although

several MLL1-interacting proteins such as Wdr5 and

Rbb5 were upregulated upon exposure to DON,

Ash2 expression was not significantly affected. These

observations suggest that Ash2 is a unique component

of MLLs and may have other distinct functions that

are yet to be revealed. It is also possible that Ash2 is

normally distributed in different protein complexes

which may be redistributed (without being induced)

under stress to compensate for the higher expression of

MLL1. This aspect needs further investigation for

complete understanding. Similarly, although the MLL1

Fig. 4. Sp1-binding sites in the MLL1 promoter. MLL1 gene pro-

moter (from )3000 to +500 bp) sequence was analyzed for pres-

ence of Sp1-binding sites (GGGCGG, GGCGGG, CCCGCC and

CCGCCC) using http://www.ifti.org/ promoter screening tool. Puta-

tive Sp1 Binding sites are underlined. Transcription start site (ATG)

is shown as +1.

MLL1 misregulation by deoxynivalenol K. I. Ansari et al.

3302 FEBS Journal 276 (2009) 3299–3307 ª 2009 The Authors Journal compilation ª 2009 FEBS

target genes HoxA7, HoxA2 and HoxB1, along with

MLL1, were upregulated upon exposure to DON, we

observed that HoxB7 expression decreased. These

results suggested that the mechanism of regulation,

especially in presence of DON, is different for HoxB7

(as well as HoxA2 and HoxB1) and HoxA7, although

they are all targets of MLL1 in normal circumstances

(without DON). Nevertheless, our results showing the

DON-induced upregulation of MLL1 and related pro-

teins indicated that MLL1 and its associated genes are

sensitive to toxic stress.

The effect of DON is very well studied in plants

[38,39]. In mammalian cells, DON induces oxidative

stress, activates MAP ⁄Src kinases and induces inflam-

mation and oxidative stress-responsive genes such as

interleukins and cyclooxygenase [32,36,40–42]. Using

RT-PCR analysis, we also observed that interleukin-

8 and cyclooxygenase are overexpressed in H358 cells

upon exposure to DON, indicating the induction of

oxidative stress in human cells, as reported earlier

(data not shown) [36,41]. Furthermore, using Src

kinase inhibitor (PP2), we demonstrated that DON-

induced MLL1 and HoxA7 gene upregulation were

alleviated in the presence of PP2. These observations

demonstrated that Src kinases are involved in

upstream events in DON-mediated upregulation of

MLL1 and HoxA7. Notably, our results demonstrated

that application of PP2 has no significant effect on the

DON-induced upregulation of other proteins such as

Set1, Wdr5 and Rbbp5 (data not shown), suggesting

the involvement of alternate pathways in the regulation

of these genes.

Our sequence analysis demonstrated that the MLL1

promoter contains multiple binding sites for Sp1, a

1 2 3 4 5 6

Water DON Water DON Water DON

Input Actin Sp1 Anti-serum

MLL1 ( ORF )

MLL1 ( R1 )

(R2)

β -actin

1 2 3 4 Water DON Water DON

Scramble antisense

28S rRNA

Sp1

MLL1

Sp1 antisense

1 2 3 4 Water DON Water DON

Scramble antisense

β -actin

Sp1

MLL1

Sp1 antisense

Sp1

Sp1-p

0 0.33 3.3 33 DON (µM)

0.0

0.2

0.4

0.6

0.8

1.0

Actin Sp1 Actin Sp1 Actin Sp1 Actin Sp1

Actin (ORF) MLL (ORF) MLL1 (R1) MLL1 (R2)

Water

DON

o t e v i t a l e r (

t n e m

t i u r c e r

d l o F

) t u p n i

ChIP anti-sera

Target DNA region

A B

C E

D

Fig. 5. Effect of knockdown of Sp1 on

DON-induced upregulation of MLL1.

H358 cells were treated with Sp1-specific

phosphorothioate antisense for 48 h fol-

lowed by treatment with 3.3 lM DON for

7.5 h. (A) RT-PCR analysis of Sp1 and MLL1

using specific primers. 28S rRNA was used

a quantitative control. (B) Total protein was

analyzed by western blot using anti-actin

(control), anti-Sp1 and anti-MLL1 Ig. (C)

DON-induced recruitment of Sp1 in the

MLL1 promoter. H358 cells treated with

3.3 lM DON for 7.5 h were subjected to

ChIP assay using Sp1 and actin antibodies.

Actin ChIP was used as a nonspecific anti-

body control. ChIP DNA fragments were

PCR amplified using primer specific to dif-

ferent Sp1-binding sites in the MLL1 promot-

ers. b-actin (ORF): PCR-amplified ‘+712 to

+1011’ of b-actin (unrelated control); MLL1

(ORF): PCR-amplified ‘+3190 to +3380’ of

MLL1 gene (control); MLL1 (R1 and R2)

PCR-amplified ‘)497 to )593’ and ‘)5 to

)105’ of the MLL1 promoter. (D) Quantifica-

tion of Sp1 recruitment as seen in (C). (E)

Western blot analysis of phosphorylated Sp1

upon DON treatment. H358 cells were trea-

ted 0–33 lM DON for 7.5 h. The whole-cell

extracts were immunoprecipitated with anti-

Sp1 Ig. The Sp1 immunoprecipitate was ana-

lyzed by western blot using both anti-Sp1

and anti-phosphotyrosine Ig.

K. I. Ansari et al. MLL1 misregulation by deoxynivalenol

FEBS Journal 276 (2009) 3299–3307 ª 2009 The Authors Journal compilation ª 2009 FEBS 3303

transcription factor that is well known to be activated

and phosphorylated under stress [29,33,34,36,43]. The

literature relating to mycotoxin-mediated activation of

Sp1 and our results showing the presence of multiple

Sp1-binding sites in the MLL1 promoter, prompted us

to hypothesize that Sp1 plays a critical role in the reg-

ulation of MLL1, especially under mycotoxic stress

[33,37,43]. Our studies demonstrated that antisense-

mediated knockdown of Sp1 suppressed the effects of

DON on upregulation of MLL1. In addition, the level

of Sp1 is enriched in the Sp1-binding regions of the

MLL1 promoter upon exposure to DON. These results

demonstrated that Sp1 acts a mediator in translating

the effects of DON on MLL1 gene upregulation.

Notably, cells respond to stress by activating signaling

pathways that regulate defense responsive genes

[36,38,39]. An early step in the stress response includes

phosphorylation of the MAP ⁄Src kinases leading to

their activation [36]. Sp1 and other Sp1 family mem-

bers are differentially acetylated, phosphorylated

and ⁄or glycosylated, and bind variants of a GC-rich

box in promoter of target genes. Because the MLL1

promoter contains multiple Sp1-binding sites and is

regulated by Sp1, as well as the Src family of kinases

on DON treatment, we hypothesized that Sp1 is likely

phosphorylated and recruited to the MLL1 promoter,

resulting in its upregulation. Our studies demonstrated

that Sp1 is phosphorylated upon exposure to DON.

Although, at this point we could not directly analyze

recruitment of the phosphorylated Sp1 into the MLL1

promoter because of the unavailability of the phospho-

Sp1-specific antibody, the increased recruitment of the

Sp1 in the MLL1 promoter may be linked with phos-

phorylation of Sp1.

In conclusion, we demonstrated that MLL1, several

MLL-associated proteins and Hox genes are upregulat-

ed upon exposure to mycotoxin DON via involvement

of Src kinase activation. The transcription factor Sp1

plays critical role in upregulating MLL1 gene expres-

sion under mycotoxic stress. Although further analysis

is needed to understand the detailed mechanism of

MLL gene (and other DON-responsive genes) regula-

tion in normal cell or under stress, our studies estab-

lished a novel link between MLL gene regulation, the

stress response and DON, and revealed critical stress-

responsive MLL1 gene regulatory pathways. Although,

the mechanism is not clear, MLL is well known to be

rearranged and misregulated in various cancers and it

is likely that different types of stresses cause MLL mis-

regulation and rearrangement. As exposure to DON

induces upregulation of MLL1, we hypothesize that

this may be one of the possible mechanism by which

DON exerts is carcinogenic action in human cells.

Experimental procedures

Cell culture and treatments with DON

Human cells (H358, a lung cancer, ATCC) were grown on

RPMI media supplemented with 10% fetal bovine serum,

l-glutamine (1%) and penicillin ⁄ streptomycin (0.1%)

(Sigma, St Louis, MO, USA). For the toxin treatment, cells

were grown to 80% confluence and treated with varying

concentrations of DON (Sigma) for different times, as

needed. Total RNA and proteins were isolated from the

treated and untreated cells and subjected to RT-PCR and

western blot analysis. For the RT-PCR analysis, each

experiment was performed in two to four replicates in par-

allel. For the western blot analysis, proteins from replicate

experiments were pulled together prior to SDS ⁄PAGE.

Preparation of RNA, nuclear proteins and

whole-cell extract

DON-treated and untreated cells were harvested by centrifu-

gation at 500 g, resuspended in diethyl pyrocarbonate-

treated buffer A (20 mm Tris ⁄HCl, pH 7.9, 1.5 mm MgCl2,

10 mm KCl, 0.5 mm dithiothreitol and 0.2 mm phenyl-

methanesulfonyl fluoride), incubated on ice for 10 min and

then centrifuged at 3500 g for 5 min. The supernatant

containing the cytoplasmic extracts was subjected to phenol–

chloroform extraction followed by LiCl precipitation of

cytoplasmic mRNA by incubating overnight at )80 �C. ThemRNA was washed with diethyl pyrocarbonate treated 70%

EtOH, air dried and resuspended in diethyl pyrocarbonate-

treated water. Nuclear proteins extracts were prepared from

the nuclear pellets, as descried previously [21,22]. For prepa-

ration of whole-cell protein extracts cells were incubated in

whole cells extract buffer (50 mm Tris ⁄HCl pH 8.0, 150 mm

NaCl, 5 mm EDTA, NP-40, 0.2 mm phenylmethanesulfonyl

fluoride, 1 · protease inhibitors) for 20 min on ice. The

whole cell extract was separated from histone protein by

centrifugation at 12 000 g for 10 min.

RT-PCR and western blots

Reverse transcription reactions were performed in a total

volume of 25 lL containing 1 lg of total RNA, 2.4 lm of

oligo-dT, 100 U of MMLV reverse transcriptase (Promega,

Madison, WI, USA), 1 · first strand buffer (Promega),

100 lm dNTPs, 1 mm dithiothreitol and 20 U of RNaseOut

(Invitrogen, Carlsbad, CA, USA). This cDNA (1 lL) was

used for PCR with primer pairs listed in Table 1. Each of the

experiments was performed in two replicates for three times.

The normality of the data was analyzed by using t-test and

analyses of the variants (ANOVA) were performed at 5%

level of significance.

Equivalent amount of proteins were analyzed in

SDS ⁄PAGE and subjected to western blot analysis with

MLL1 misregulation by deoxynivalenol K. I. Ansari et al.

3304 FEBS Journal 276 (2009) 3299–3307 ª 2009 The Authors Journal compilation ª 2009 FEBS

specific antibodies. MLL1, MLL2, Set1, Ash2 and Rbbp5,

antibodies were purchased from Bethyl laboratory (Mont-

gomery, TX, USA).

Immunoprecipitation and western blotting of Sp1

and phosphorylated Sp-1

For western blot analysis of the Sp1 expression, equivalent

amounts of whole-cell extract (DON-treated and untreated)

were separated in 8% SDS ⁄PAGE and subjected to western

blot analysis using anti-Sp1 Ig (Upstate, Waltham, MA,

USA). For the analysis of DON-induced phosphorylation of

Sp1, we performed immunoprecipitation of Sp1 from the

whole-cell protein extract using anti-Sp1 Ig, as described ear-

lier [21]. The Sp1 immunoprecipitates were electrophoresed

in 8% SDS ⁄PAGE and subjected to western blot using both

anti-Sp1 (nonphosphorylated) and anti-phosphotyrosine Ig

(Upstate) that recognize tyrosine phosphorylated proteins.

Antisense-mediated knockdown of Sp1

The Sp1 antisense (5¢-CTGAATATTAGGCATCACTCC

AGG-3¢) was transfected into H358 cells using Maxfect

transfection reagent (MoleculA). In brief, H358 cells were

grown to 60% confluence, washed twice with fetal bovine

serum-free RPMI media and then incubated with transfec-

tion reagent–antisense complex for 5 h in serum-free RPMI

prior to the addition of complete growth medium (with 10%

serum). Cells were then incubated for 48 h followed by treat-

ment with 3.3 lm DON for 7.5 h. Cells were then harvested

for RNA, nuclear protein extraction or ChIP analysis. A

scramble antisense without any sequence homology with Sp1

(5¢-CGTTTGTCCCTCCAGCATCT-3¢) was used as control.

ChIP experiment

The ChIP assay was performed using H358 cells and anti-

Sp1 mAb (Bethyl lab) using EZ Chip� chromatin immuno-

precipitation kit (Upstate) as described previously [21,22].

Immunoprecipitated DNA obtained from the ChIP was

PCR amplified with different primers (specific to Sp1 rich

sites in MLL1 promoter, Table 1).

Acknowledgements

This work was supported by grants from Texas

Advanced Research Program (00365-0009-2006) and

American Heart Association (SM 0765160Y). We also

thank Saoni Mandal and other Mandal lab members

for critical discussions.

References

1 Ansari KI, Mishra BP & Mandal SS (2009) MLL his-

tone methylases in gene expression, hormone signaling

and cell cycle. Front Biosci 14, 3483–3495.

2 Hess JL (2004) MLL: a histone methyltransferase

disrupted in leukemia. Trends Mol Med 10, 500–507.

3 Bhaumik SR, Smith E & Shilatifard A (2007) Covalent

modifications of histones during development and

disease pathogenesis. Nat Struct Mol Biol 14, 1008–

1016.

4 Jana NR (2008) NSAIDs and apoptosis. Cell Mol Life

Sci 65, 1295–1301.

5 Hampsey M & Reinberg D (2003) Tails of intrigue:

phosphorylation of RNA polymerase II mediates his-

tone methylation. Cell 113, 429–432.

6 Ayton PM & Cleary ML (2001) Molecular mechanisms

of leukemogenesis mediated by MLL fusion proteins.

Oncogene 20, 5695–5707.

7 Hughes CM, Rozenblatt-Rosen O, Milne TA, Copeland

TD, Levine SS, Lee JC, Hayes DN, Shanmugam KS,

Bhattacharjee A, Biondi CA et al. (2004) Menin associ-

ates with a trithorax family histone methyltransferase

complex and with the hoxc8 locus. Mol Cell 13, 587–597.

8 Goo YH, Sohn YC, Kim DH, Kim SW, Kang MJ,

Jung DJ, Kwak E, Barlev NA, Berger SL, Chow VT

et al. (2003) Activating signal cointegrator 2 belongs

Table 1. Primers used for RT-PCR, chromatin immunoprecipitation and antisense experiments.

Primers Forward primer (5¢- to 3¢) Reverse primer (5¢- to 3¢)

b-actin AGAGCTACGAGCTGCCTGAC GTACTTGCGCTCAGGAGGAG

MLL1 GAGGACCCCGGATTAAACAT GGAGCAAGAGGTTCAGCATC

Set1 CTGACGAGATGGTCATCGAA CGATTTTCTGGGACTCG

Rbbp5 GCATCCATTTCCAGTGGAGT TGGTGACATCCACTTCCTCA

Ash2 CCTGAAGCAGACTCCCCATA AGCCCATGTCACTCATAGGG

HoxA7 TTCCACTTCAACCGCTACCT TTCATACATCGTCCTCCTCGT

Sp1 TCATACCAGGTGCAAACCAA GCTGGGAGTCAAGGTAGCTG

MLL1 (R1) CAGAGCTGGTTAGGCAGGTT CCCCGTGAAGTGAAGCAG

MLL1 (R2) TCGGGCTAACCCATCTTGTA GGGAGAGCAGCTTCCAGTAT

Sp1 antisense CTGAATATTAGGCATCACTCCAGGa

a Phosphorothioate antisense oligonucleotide.

K. I. Ansari et al. MLL1 misregulation by deoxynivalenol

FEBS Journal 276 (2009) 3299–3307 ª 2009 The Authors Journal compilation ª 2009 FEBS 3305

to a novel steady-state complex that contains a subset

of trithorax group proteins. Mol Cell Biol 23, 140–149.

9 Dou Y, Milne TA, Ruthenburg AJ, Lee S, Lee JW,

Verdine GL, Allis CD & Roeder RG (2006) Regulation

of MLL1 H3K4 methyltransferase activity by its core

components. Nat Struct Mol Biol 13, 713–719.

10 Crawford BD & Hess JL (2006) MLL core components

give the green light to histone methylation. ACS Chem

Biol 1, 495–498.

11 Takeda S, Chen DY, Westergard TD, Fisher JK,

Rubens JA, Sasagawa S, Kan JT, Korsmeyer SJ, Cheng

EH & Hsieh JJ (2006) Proteolysis of MLL family

proteins is essential for taspase1-orchestrated cell cycle

progression. Genes Dev 20, 2397–2409.

12 Glaser S, Schaft J, Lubitz S, Vintersten K, van derHo-

even F, Tufteland KR, Aasland R, Anastassiadis K,

Ang SL & Stewart AF (2006) Multiple epigenetic main-

tenance factors implicated by the loss of Mll2 in mouse

development. Development 133, 1423–1432.

13 Cho YW, Hong T, Hong S, Guo H, Yu H, Kim D,

Guszczynski T, Dressler GR, Copeland TD, Kalkum M

et al. (2007) PTIP associates with MLL3- and MLL4-

containing histone H3 lysine 4 methyltransferase com-

plex. J Biol Chem 282, 20395–20406.

14 Issaeva I, Zonis Y, Rozovskaia T, Orlovsky K, Croce

CM, Nakamura T, Mazo A, Eisenbach L & Canaani E

(2007) Knockdown of ALR (MLL2) reveals ALR target

genes and leads to alterations in cell adhesion and

growth. Mol Cell Biol 27, 1889–1903.

15 Lappin TR, Grier DG, Thompson A & Halliday HL

(2006) HOX genes: seductive science, mysterious mecha-

nisms. Ulster Med J 75, 23–31.

16 Guenther MG, Jenner RG, Chevalier B, Nakamura T,

Croce CM, Canaani E & Young RA (2005) Global and

Hox-specific roles for the MLL1 methyltransferase.

Proc Natl Acad Sci USA 102, 8603–8608.

17 Tenney K & Shilatifard A (2005) A COMPASS in

the voyage of defining the role of trithorax ⁄MLL-con-

taining complexes: linking leukemogensis to covalent

modifications of chromatin. J Cell Biochem 95, 429–

436.

18 Sims RJ III & Reinberg D (2006) Histone H3 Lys 4

methylation: caught in a bind? Genes Dev 20, 2779–

2786.

19 Lee JS, Shukla A, Schneider J, Swanson SK, Washburn

MP, Florens L, Bhaumik SR & Shilatifard A (2007)

Histone crosstalk between H2B monoubiquitination

and H3 methylation mediated by COMPASS. Cell 131,

1084–1096.

20 Capotosti F, Hsieh JJ & Herr W (2007) Species selectiv-

ity of mixed-lineage leukemia ⁄ trithorax and HCF prote-

olytic maturation pathways. Mol Cell Biol 27,

7063–7072.

21 Ansari KI, Mishra BP & Mandal SS (2008) Human

CpG binding protein interacts with MLL1, MLL2 and

hSet1 and regulates Hox gene expression. Biochim Bio-

phys Acta 1779, 66–73.

22 Mishra BP, Ansari KI & Mandal SS (2009) Dynamic

association of MLL1, H3K4 trimethylation with chro-

matin and Hox gene expression during the cell cycle.

FEBS J 276, 1629–1640.

23 Libura J, Ward M, Solecka J & Richardson C (2008)

Etoposide-initiated MLL rearrangements detected at

high frequency in human primitive hematopoietic stem

cells with in vitro and in vivo long-term repopulating

potential. Eur J Haematol 81, 185–195.

24 Moneypenny CG, Shao J, Song Y & Gallagher EP

(2006) MLL rearrangements are induced by low doses

of etoposide in human fetal hematopoietic stem cells.

Carcinogenesis 27, 874–881.

25 Richard JL (2007) Some major mycotoxins and their

mycotoxicoses – an overview. Int J Food Microbiol 119,

3–10.

26 Rotter BA, Prelusky DB & Pestka JJ (1996) Toxicology

of deoxynivalenol (vomitoxin). J Toxicol Environ Health

48, 1–34.

27 Pestka JJ & Smolinski AT (2005) Deoxynivalenol: toxi-

cology and potential effects on humans. J Toxicol Envi-

ron Health B Crit Rev 8, 39–69.

28 Ansari KI, Grant JD, Woldemariam GA, Kasiri S &

Mandal SS (2009) Iron(III)–salen complexes with less

DNA cleavage activity exhibit more efficient apoptosis

in MCF7 cells. Org Biomol Chem 7, 926–932.

29 Kinser S, Jia Q, Li M, Laughter A, Cornwell P, Corton

JC & Pestka J (2004) Gene expression profiling in

spleens of deoxynivalenol-exposed mice: immediate

early genes as primary targets. J Toxicol Environ Health

A 67, 1423–1441.

30 Pestka JJ (2008) Mechanisms of deoxynivalenol-induced

gene expression and apoptosis. Food Addit Contam Part

A Chem Anal Control Expo Risk Assess 25, 1128–1140.

31 Wong SS, Zhou HR & Pestka JJ (2002) Effects of

vomitoxin (deoxynivalenol) on the binding of transcrip-

tion factors AP-1, NF-kappaB, and NF-IL6 in

raw 264.7 macrophage cells. J Toxicol Environ Health A

65, 1161–1180.

32 Wong SS, Zhou HR, Marin-Martinez ML, Brooks K &

Pestka JJ (1998) Modulation of IL-1beta, IL-6 and

TNF-alpha secretion and mRNA expression by the

trichothecene vomitoxin in the RAW 264.7 murine

macrophage cell line. Food Chem Toxicol 36, 409–419.

33 Zhang Y, Dickman MB & Jones C (1999) The myco-

toxin fumonisin B1 transcriptionally activates the p21

promoter through a cis-acting element containing two

Sp1 binding sites. J Biol Chem 274, 12367–12371.

34 D’Addario M, Arora PD, Ellen RP & McCulloch CA

(2002) Interaction of p38 and Sp1 in a mechanical

force-induced, beta 1 integrin-mediated transcriptional

circuit that regulates the actin-binding protein filamin-

A. J Biol Chem 277, 47541–47550.

MLL1 misregulation by deoxynivalenol K. I. Ansari et al.

3306 FEBS Journal 276 (2009) 3299–3307 ª 2009 The Authors Journal compilation ª 2009 FEBS

35 Kuo L, Chang HC, Leu TH, Maa MC & Hung WC

(2006) Src oncogene activates MMP-2 expression via

the ERK ⁄ Sp1 pathway. J Cell Physiol 207, 729–734.

36 Zhou HR, Jia Q & Pestka JJ (2005) Ribotoxic stress

response to the trichothecene deoxynivalenol in the

macrophage involves the SRC family kinase Hck. Toxi-

col Sci 85, 916–926.

37 Ryu H, Lee J, Zaman K, Kubilis J, Ferrante RJ, Ross

BD, Neve R & Ratan RR (2003) Sp1 and Sp3 are oxi-

dative stress-inducible, antideath transcription factors in

cortical neurons. J Neurosci 23, 3597–3606.

38 Ansari KI, Walter S, Brennan JM, Lemmens M,

Kessans S, McGahern A, Egan D & Doohan FM

(2007) Retrotransposon and gene activation in wheat in

response to mycotoxigenic and non-mycotoxigenic-asso-

ciated Fusarium stress. Theor Appl Genet 114, 927–937.

39 Walter S, Brennan JM, Arunachalam C, Ansari KI,

Hu X, Khan MR, Trognitz F, Trognitz B, Leonard G,

Egan D et al. (2008) Components of the gene network

associated with genotype-dependent response of wheat

to the Fusarium mycotoxin deoxynivalenol. Funct Integr

Genomics 8, 421–427.

40 Gray JS & Pestka JJ (2007) Transcriptional regulation

of deoxynivalenol-induced IL-8 expression in human

monocytes. Toxicol Sci 99, 502–511.

41 Islam Z, Gray JS & Pestka JJ (2006) p38 Mitogen-acti-

vated protein kinase mediates IL-8 induction by the

ribotoxin deoxynivalenol in human monocytes. Toxicol

Appl Pharmacol 213, 235–244.

42 Moon Y & Pestka JJ (2003) Deoxynivalenol-induced

mitogen-activated protein kinase phosphorylation and

IL-6 expression in mice suppressed by fish oil. J Nutr

Biochem 14, 717–726.

43 Dynan WS & Tjian R (1983) The promoter-specific

transcription factor Sp1 binds to upstream sequences in

the SV40 early promoter. Cell 35, 79–87.

K. I. Ansari et al. MLL1 misregulation by deoxynivalenol

FEBS Journal 276 (2009) 3299–3307 ª 2009 The Authors Journal compilation ª 2009 FEBS 3307