neutrophil apoptosis Involvement of a ferroprotein sensor in hypoxia-mediated inhibition of

doi:10.1182/blood-2002-02-0454Prepublished online June 28, 2002;2002 100: 3008-3016

Paul D. Upton, John Deighton, Andrew P. Greening and Edwin R. ChilversKaty I. Mecklenburgh, Sarah R. Walmsley, Andrew S. Cowburn, Michael Wiesener, Benjamin J. Reed, neutrophil apoptosisInvolvement of a ferroprotein sensor in hypoxia-mediated inhibition of

http://bloodjournal.hematologylibrary.org/content/100/8/3008.full.htmlUpdated information and services can be found at:

(973 articles)Phagocytes �Articles on similar topics can be found in the following Blood collections

http://bloodjournal.hematologylibrary.org/site/misc/rights.xhtml#repub_requestsInformation about reproducing this article in parts or in its entirety may be found online at:

http://bloodjournal.hematologylibrary.org/site/misc/rights.xhtml#reprintsInformation about ordering reprints may be found online at:

http://bloodjournal.hematologylibrary.org/site/subscriptions/index.xhtmlInformation about subscriptions and ASH membership may be found online at:

Copyright 2011 by The American Society of Hematology; all rights reserved.20036.the American Society of Hematology, 2021 L St, NW, Suite 900, Washington DC Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by

For personal use only. by guest on June 6, 2013. bloodjournal.hematologylibrary.orgFrom

http://bloodjournal.hematologylibrary.org/content/100/8/3008.full.html

http://bloodjournal.hematologylibrary.org/cgi/collection/phagocytes

http://bloodjournal.hematologylibrary.org/site/misc/rights.xhtml#repub_requests

http://bloodjournal.hematologylibrary.org/site/misc/rights.xhtml#reprints

http://bloodjournal.hematologylibrary.org/site/subscriptions/index.xhtml

http://bloodjournal.hematologylibrary.org/subscriptions/ToS.dtl

http://bloodjournal.hematologylibrary.org/


PHAGOCYTES

Involvement of a ferroprotein sensor in hypoxia-mediated inhibitionof neutrophil apoptosisKaty I. Mecklenburgh, Sarah R. Walmsley, Andrew S. Cowburn, Michael Wiesener, Benjamin J. Reed,Paul D. Upton, John Deighton, Andrew P. Greening, and Edwin R. Chilvers

Neutrophil apoptosis represents a majormechanism involved in the resolution ofacute inflammation. In contrast to theeffect of hypoxia observed in many othercell types, oxygen deprivation, as we haveshown, causes a profound but reversibledelay in the rate of constitutive apoptosisin human neutrophils when aged in vitro.This effect was mimicked by exposingcells to 2 structurally unrelated iron-chelating agents, desferrioxamine (DFO)and hydroxypyridines (CP-94), and it ap-peared specific for hypoxia in that nomodulation of apoptosis was observed

with mitochondrial electron transport in-hibitors, glucose deprivation, or heatshock. The involvement of chelatable ironin the oxygen-sensing mechanism wasconfirmed by the abolition of the DFO andCP-94 survival effect by Fe2� ions. Al-though hypoxia inducible factor-1� (HIF-1�) mRNA was identified in freshly iso-lated neutrophils, HIF-1� protein was onlydetected in neutrophils incubated underhypoxic conditions or in the presence ofDFO. Moreover, studies with cyclohexam-ide demonstrated that the survival effectof hypoxia was fully dependent on con-

tinuing protein synthesis. These resultsindicate that the neutrophil has a ferropro-tein oxygen-sensing mechanism identi-cal to that for erythropoietin regulationand results in HIF-1� up-regulation andprofound but reversible inhibition of neu-trophil apoptosis. This finding may haveimportant implications for the resolutionof granulocytic inflammation at sites oflow-oxygen tension. (Blood. 2002;100:3008-3016)

© 2002 by The American Society of Hematology

Introduction

Neutrophils are key effector cells of the innate immune system andplay a vital role in host defense against gram-negative bacteria.However, excessive or sustained activation of these cells can resultin significant tissue damage, with injury resulting from the releaseof histotoxic granule contents, reactive-oxygen intermediates, andother proinflammatory mediators.1 Persistent accumulation ofprimed and activated neutrophils is a cardinal feature of a numberof lung diseases, including acute lung injury, bronchiectasis, andchronic obstructive airways disease, and it is associated withdisease progression and destruction of lung tissue.2 Similarly, inmyocardial infarction, neutrophils have been implicated in extend-ing the area of primary myocardial injury by releasing protease-richgranule contents into adjacent viable tissue,3 and, in rheumatoidarthritis, neutrophil-derived reactive-oxygen species and granuleenzymes have been demonstrated in synovial fluid and againimplicated in disease pathogenesis.4,5 Understanding the mecha-nisms that modulate neutrophil influx, activation, and longevity istherefore of major pathophysiologic importance to a number oforgan systems. The latter 2 events are regulated in large part by thecapacity of senescent neutrophils to undergo spontaneous apopto-sis, which leads to inhibition of secretory function and to promptingestion and removal by inflammatory macrophages.6,7

Apoptosis is a constitutive event in neutrophils and is proposedto be a major mechanism underlying the resolution of granulocyteinflammation.8-11 Neutrophil apoptosis and subsequent macrophageclearance have also been identified in a number of in vivo settings,including pulmonary inflammation in neonates,12 resolution ofexperimental pneumonia,13 and resolution of oleic-acid–inducedacute lung injury.14 Interleukin-10 (IL-10) has also been shown toenhance the resolution of lipopolysaccharide (LPS)-induced pulmo-nary inflammation in rats by promoting granulocyte apoptosis,13

again lending support to the importance of neutrophil apoptosis andclearance in the resolution of inflammation.

It is now recognized that the rate of neutrophil apoptosis can beprofoundly influenced by certain inflammatory mediators includinggranulocyte macrophage–colony-stimulating factor (GM-CSF), G-CSF, IL-1�, IL-2, IL-6, LPS and interferon-� (IFN-�).2,15 Suchdata highlight the potential importance of the local environment tothe modulation of neutrophil apoptosis in vivo. Furthermore, therate of neutrophil apoptosis can be accelerated by exposing thesecells to stress-inducing stimuli. Hence, UV irradiation, hyperosmo-lar and oxidizing conditions, and phagocytosis of oil-red particles16

have all been shown to stimulate neutrophil apoptosis.17,18 Onesurprising exception to this role is the ability of extreme hypoxia to

From the Respiratory Medicine Division, Department of Medicine, University ofCambridge School of Clinical Medicine, Addenbrooke’s and PapworthHospitals, Cambridge; Respiratory Medicine Unit, Department of Medicine,University of Edinburgh Medical School; Respiratory Medicine Unit, WesternGeneral Hospital, Edinburgh; and Institute of Molecular Medicine, JohnRadcliffe Hospital, Wellcome Trust Centre for Human Genetics, Oxford, UnitedKingdom.

Submitted February 12, 2002; accepted June 6, 2002. Prepublished online asBlood First Edition Paper, June 28, 2002; DOI 10.1182/blood-2002-02-0454.

Supported by a Raymond and Beverly Sackler Studentship (S.R.W.), the MRC(S.R.W.), Wellcome Trust (E.R.C.), Faculty of Medicine, University of

Edinburgh (K.I.M.), Chest, Heart and Stroke Association (Scotland) (E.R.C.),Papworth Hospital NHS Trust (E.R.C.), and British Lung Foundation (E.R.C.).

K.I.M. and S.R.W. are joint first authors.

Reprints: Edwin R. Chilvers, Respiratory Medicine Division, Department ofMedicine, Level 5, Box 157, Addenbrooke’s Hospital, Hills Road, Cambridge,CB2 2QQ, United Kingdom; e-mail: [email protected].

The publication costs of this article were defrayed in part by page chargepayment. Therefore, and solely to indicate this fact, this article is herebymarked ‘‘advertisement’’ in accordance with 18 U.S.C. section 1734.

© 2002 by The American Society of Hematology

3008 BLOOD, 15 OCTOBER 2002 � VOLUME 100, NUMBER 8




inhibit apoptotic cell death in these cells.19,20 This contrasts with themajor proapoptotic effect of hypoxia observed in other cell types,including cultured neurons,21 human adenocarcinoma HT 29cells,22 and certain oncogenically transformed cells.23

Tissue injury and inflammation can result in a significantdecrease in local oxygen tension, and it is essential that the normalmechanisms of tissue protection and repair not be compromised bysuch conditions. Clearly, the importance of neutrophil apoptosis inthe resolution of inflammation dictates that any ability of hypoxiato block this process could have important adverse effects on theclearance of these cells in vivo. Although the mean alveolar PO2 inhealthy adults is 13.6 kPa, mean PO2 values of 3.5 kPa have beenreported in rheumatoid synovium,24 with even lower valuesrecorded in wound tissues (range, 0.8-1.5 kPa).25,26

To enable cells to respond to changes in oxygen tension,mechanisms for cellular oxygen sensing must be present. Studieslooking at the 3� hypoxic response element of the EPO gene led tothe identification of a transcriptional activator, hypoxia induciblefactor-1 (HIF-1).27 HIF-1 is a heterodimeric member of the basichelix-loop-helix Per-Arnt-Sim homology (PAS) proteins and iscomposed of an HIF-1� (or aryl hydrocarbon nuclear translocator[ARNT]) subunit, which is constitutively expressed, and anHIF-1� subunit whose expression and transcriptional activity aretightly regulated by the ambient oxygen concentration.28 Thisregulator has been identified in many mammalian cell types29 andin most human tissues,30 and it appears to play a key role in oxygenhomeostasis. HIF-1� contains an oxygen-dependent degradationdomain (ODDD) through which it interacts with von Hippel-Lindau tumor-suppressor protein and subsequently undergoesproteasomal breakdown.31 This process is dependent on prolylhydroxylation of HIF-1� by the prolyl hydroxylase domain (PHD)–containing proteins 1, 2, and 332; these proteins have an absoluterequirement for oxygen and hence represent the proximal sensingmechanism by which the existence of hypoxia is detected by a cell.

In view of the importance of neutrophil apoptosis to theresolution of inflammation and our previous observation thathypoxia can inhibit this event, we wanted to explore the cellularevents underlying this process and the associated oxygen-sensingmechanisms. We demonstrate that the apoptotic threshold inneutrophils is acutely but reversibly regulated by the ambient PO2

and that the hypoxia-mediated survival effect can be mimicked bythe iron chelators DFO and CP-94, suggesting the involvement of asimilar ferroprotein-sensing mechanism as described in othertissues. Of note, prolonged hypoxia (24 hours or longer) appears toinduce a more refractory survival effect. The specificity of thiseffect is demonstrated in part by the inability of mitochondrialelectron chain inhibitors, glucose deprivation, or heat shock toinfluence the rate of neutrophil apoptosis. Furthermore, the antiapo-ptotic effect of hypoxia is shown to be dependent on continuingprotein synthesis, associated with the up-regulation of HIF-1�protein levels, and independent of IL-8 release.

Materials and methods

Neutrophil isolation and culture

Human neutrophils were purified from the peripheral blood of healthyhuman volunteers by dextran sedimentation followed by centrifugationthrough discontinuous plasma-Percoll gradients.7,33 Cell purity, assessedusing air-dried cytocentrifuge preparations fixed in methanol and stainedwith May-Grunwald-Giemsa, was routinely greater than 95% neutrophilswith less than 0.1% mononuclear cell contamination. The above neutrophil

isolation method results in minimal cell priming or activation, as judged bylow levels (less than 5%) of basal shape change and formyl-methionyleucyl-phenylalanine (fMLP)–stimulated superoxide anion generation.34,35 Viabil-ity was assessed by the capacity of cells to exclude trypan blue and wasgreater than 99% under all experimental conditions tested. Purified cellswere washed sequentially in platelet-poor plasma and phosphate-bufferedsaline (PBS) without and with CaCl2 and MgCl2, and they were suspendedat 5 � 106 cells/mL in Iscove modified Dulbecco medium (IMDM)supplemented with 10% autologous serum, 50 U/mL streptomycin, and 50U/mL penicillin (supplemented IMDM). Human peripheral blood mono-cytes were isolated using the same plasma-Percoll gradient system detailedabove, with cells harvested from the upper platelet-poor plasma/42%Percoll interface.7 Approval was obtained from the Cambridge localresearch ethics committee for these studies. Informed consent was providedaccording to the Declaration of Helsinki.

Neutrophils were routinely cultured in supplemented IMDM in thepresence or absence of test agents (1 �M-10 mM desferrioxamine [DFO], 3mM FeCl2, 0.1-10 �g/mL cyclohexamide, 1 mM azide, 1 mM potassiumcyanide, 100 ng/mL rotenone, 100 �M cobaltous chloride, 0.1 �g/mLgliotoxin, 200 U/mL tumor necrosis factor-� (TNF-�), 100 �M ZVAD-fmk, or 25 �M Boc-D-fmk) at 6.75 � 105 cell/150 �L in flat-bottomed,96-well Falcon flexible plates (Becton Dickinson, Franklin Lakes, NJ) in ahumidified 5% CO2/air or 5% CO2/nitrogen atmosphere at 37°C. The latterincubations were undertaken using an MK3 anaerobic incubator (DonWhitley Scientific, Yorkshire, United Kingdom) that reduced the PO2 of theculture medium (measured using an automated blood gas analyser, modelABL-330; Radiometer, Copenhagen, Denmark) to 3.3 � 0.3 kPa by 60minutes. To generate truly anaerobic conditions for certain experiments, 5%CO2/5% H2/90% nitrogen was used in a MACS 500 Don Whitley H2

catalyst–dependent anaerobic incubator, which reduced the PO2 of thecultured medium to 0.2 � 0.17 kPa. These values were independentlyverified using an oxygen electrode (World Precision Instruments, Sara-sota, FL); the PO2 of the medium was maintained at these levelsthroughout the subsequent incubation period (data not shown).

To assess the effects of heat shock on the rate of neutrophil apoptosis,cells were incubated at either 42°C or 4°C for 1 hour before incubation at37°C under normoxic or hypoxic conditions.36,37 For glucose deprivation,cells were incubated in IMDM without D-glucose or sodium pyruvate(Gibco Life Technologies, Paisley, Scotland).

Assessment of neutrophil apoptosis

After gentle resuspension, neutrophils were harvested and cytocentrifuged,and the resultant slide preparations were fixed and stained as detailed above.Cell morphology was examined under oil-immersion light microscopyusing a 100� objective, and apoptotic neutrophils were defined as cellscontaining darkly stained pyknotic nuclei.7 For each condition examined,slides were prepared from triplicate incubations, and more than 500neutrophils covering at least 5 randomly selected high-power fields werecounted with the observer masked to the assay conditions. Apoptosis wasalso assessed by 2 independent flow cytometry–based methods usingfluorescein isocyanate–labeled recombinant human annexin V38 and pro-pidium iodide staining.39,40

ELISA measurement of secreted IL-8

IL-8 released into culture supernatants was measured by enzyme-linkedimmunosorbent assay (ELISA). Following 6- and 20-hour incubations at5 � 106/mL under normoxia, hypoxia, or anoxia, cells were removed bycentrifugation (352g, 10 minutes), and supernatants were collected. Micro-lon 96-well ELISA plates (L Greiner, Stonehouse, Gloucester, UnitedKingdom) were coated overnight at 4°C with 50 �L mouse monoclonalantihuman IL-8 at 2 �g/mL. Following 3 washes with PBS � 0.05%Tween, plates were blocked with 100 �L of 5% fetal calf serum(FCS)/0.05% Tween/PBS for 1.5 hours, washed once with PBS � 0.05%Tween, and incubated overnight at 4°C with 50 �L recombinant humanIL-8 standards at 0 to 100 000 pg/mL and 50 �L supernatant samples, eachin duplicate. Plates were subsequently washed 3 times as described above,incubated for 3 hours at 37°C with 50 �L biotinylated antihuman IL-8

HYPOXIC INHIBITION OF NEUTROPHIL APOPTOSIS 3009BLOOD, 15 OCTOBER 2002 � VOLUME 100, NUMBER 8




polyclonal antibody at 0.125 �g/mL, washed 3 more times, incubated with 50 �Lextraavidin alkaline phosphatase conjugate at 1:400 for 3 hours at 37°C, andwashed twice with PBS � 0.05% Tween and once with distilled water. ELISAreactions were developed in the dark at 37°C with 50 �L/well of 1 mg/mLp-nitrophenyl phosphate in diethanolamine buffer. Plates were read on aBio-Rad 550 microplate reader (Bio-Rad Laboratories, Hercules, CA) at405 lambda and were analyzed with MPM version 1.57 software (Bio-Rad).

Identification of HIF-1� mRNA and protein in cell lysates

To obtain total cellular RNA, freshly isolated neutrophils or monocytes(30 � 106 cells) were washed twice in PBS (without CaCl2 and MgCl2), andthe resultant cell pellet was lysed by incubation in 6 mL TRIzol reagent (5minutes, 25°C). Following the addition of 1.2 mL chloroform, the sampleswere vortex-mixed for 2 to 3 minutes and centrifuged (12 000g, 4°C, 15minutes), and the RNA was recovered and precipitated from the upperaqueous phase by the addition of an equal volume of propan-2-ol. Afterincubation for 10 minutes at room temperature or overnight at 20°C, theRNA was pelleted (12 000g, 4°C, 10 minutes), washed in 6 mL 75%(vol/vol) ethanol, and recentrifuged (7500g, 4°C, 5 minutes). The finalpellets were air dried for 20 to 30 minutes, redissolved in a minimumamount of 0.5% sodium dodecyl sulfate (SDS), and stored at 80°C beforeanalysis. RNA content was quantified using an RNA/DNA calculator(Pharmacia Biotech, Herts, United Kingdom).

Total cellular RNA was extracted from HeLa cells as a positive controlfor endothelial PAS domain protein 1 (EPAS) using the above protocol.HeLa cells were grown in Dulbecco modified Eagle medium (DMEM)with 10% fetal calf serum, 1% glutamine, 100 U/mL penicillin, and 100�g/mL streptomycin. Cells were used when they were 100% confluent andserially passaged.

For the RNA protection assays, 40 �g total neutrophil RNA wassubjected to parallel hybridization with 32P-labeled riboprobes for HIF-1�and EPAS-1. These were generated using SP6 or T7 RNA polymerase. Thetemplates used yielded protected riboprobes of distinct sizes: 221 base pair(bp) for EPAS-1 (nucleotides 2542 to 2762; GenBank accession no.U81984) and 268 bp for HIF-1� (nucleotides 760 to 1028; GenBankaccession no. U22431). Hybridization was performed at 60°C in 80%formamide, 40 mM PIPES (piperazine-N,N�-bis(2-ethane sulfonic acid; pH6.4), 400 mM NaCl, and 1 mM EDTA (ethylenediaminetetraacetic acid)overnight, and RNase digestion was performed at 20°C for 30 minutes.Protected fragments were then subjected to denaturing polyacrylamide gelelectrophoresis (PAGE) using 8% gels.

For detection of HIF-1� protein, neutrophils and monocytes wereresuspended at a cell density of 5 � 106/mL in supplemented IMDM thathad been incubated overnight in normoxic (21% O2) or hypoxic (0% O2)conditions. Cells were cultured in a final volume of 2 mL in 6-well Falconplates and were incubated for the time period specified in either a hypoxicor a normoxic (�1 mM DFO) environment. Neutrophils were thenharvested rapidly into a large volume of ice-cold PBS and were collected bycentrifugation (7500g, 4°C), 1 minute). RNA was extracted as previouslydetailed. The protein-containing supernatant was transferred to clean tubesand incubated for 10 minutes at room temperature with propan-2-ol (1.5mL/1 mL TRIzol used for the initial lysis). Resultant protein pellets(12 000g, 4°C) were washed 3 times in 0.3 M guanidine hydrochloride in95% ethanol (2 mL/1 mL TRIzol, resuspended and incubated in 100%ethanol for 20 minutes at 25°C), and vacuum dried and dissolved in 50 �L1% SDS (50°C, 30 minutes). Finally, the samples were centrifuged(10 000g, 4°C, 10 minutes), and the resultant supernatants were stored at80°C. Protein concentrations were assessed using a bicinchoninic acidprotein assay (Pierce, Rockford, IL).

For immunoblotting, proteins were resolved in SDS/6% polyacrylamidegels and transferred to Immobilon P (Millipore, Bedford, MA) overnight in10 mM glycine/10% methanol/0.05% SDS. Membranes were blocked withPBS/5% fat-free dried milk/0.1% Tween 20. For HIF-1� detection,monoclonal antibody (mAb) 28b was used at a final concentration of 4�g/mL. This antibody was raised against a glutathione-S-transferase (GST)fusion containing amino acids 329 to 530 of human HIF-1�. For EPAS-1,190b supernatant was diluted at a 1:4 ratio. Detection was with horseradishperoxidase (HRP)–conjugated goat antimouse immunoglobulin (DAKO,Ely, United Kingdom), used at 1:2000 dilution, and enhanced chemilumines-

cence (SuperSignal Ultra; Pierce and Warriner, Chester, United Kingdom).After analysis, membranes were stained with Ponceau S to verify equalprotein loading and transfer.

Semiquantitative RT-PCR for adrenomedullin

Semiquantitative reverse transcription–polymerase chain reaction (RT-PCR) was set up using an Access RT-PCR system from Promega(Southampton, United Kingdom). Primer sequences were designed usingthe published mRNA sequences in GenBank. Sequences were (all 5� to 3�):adrenomedullin forward, AAGAAGTGGAATAAGTGGGCT; adrenomedul-lin reverse, TGGCTTAGAAGACACCAGAGT; �-actin forward, ATG-AAGTGTGACGTTGACATCCG; �-actin reverse, GCTTGCTGATCCA-CATCTGCTG; glyceraldehyde-3-phosphate dehydrogenase (GAPDH)forward, AGAACATCATCCCTGCCTC; and GAPDH reverse, GCCAAAT-TCGTTGTCATACC. Each primer set produced a single band of theexpected size in RT-PCR reactions (410 bp adrenomedullin, 232 bp �-actin,346 bp GAPDH). Neutrophil RNA was extracted as detailed abovefollowing 3-hour incubation in normoxia, hypoxia, and anoxia. Semiquanti-tative RT-PCR used an initial RT step at 48°C followed by 95°C for 5minutes. PCR was then performed over 20 cycles using the followingconditions for all 3 PCR products: denaturation at 95°C for 60 seconds,annealing at 54°C for 90 seconds, and extension at 72°C for 50 seconds. Atthe end of this protocol, a final elongation step of 72°C for 7 minutes wasperformed. All reactions contained 2 mM MgSO4 and used 100 ng RNA fora 10-�L reaction volume. PCR products were fractionated on a Tris borateEDTA/2% agarose gel. Gel images were captured using a Stratagene EagleEye II system (Stratagene Europe, Amsterdam, Netherlands), and bandintensities were calculated using the Scion Image program (Scion, Freder-ick, MD). Adrenomedullin expression was corrected for GAPDH and �-actin.

Statistical analysis

Results are expressed as mean � SEM of (n) number of independentexperiments; these were all conducted using neutrophils from separatedonors, with each condition performed in triplicate. Statistical analysis wasperformed using analysis of variance, with comparisons between groupsmade using the Newman-Keuls procedure. Differences were consideredsignificant when P .05.

Results

Effects of hypoxia on neutrophil apoptosis in vitro

Incubation of isolated human peripheral blood neutrophils underhypoxic conditions (PO2 3.3 � 0.3 kPa) caused a profound inhibi-tion of neutrophil apoptosis. This effect was verified using 3independent methods to assess apoptosis—neutrophil morphology(Figure 1A,D), externalization of plasma membrane phosphatidyl-serine (annexin V binding; Figure 1B), and DNA fragmentation(propidium iodide staining; Figure 1C). Cell viability (assessed bytrypan blue exclusion) was more than 95% at all time pointsexamined (data not shown). Previous experimental work hasdemonstrated that the inhibition of neutrophil apoptosis underhypoxic conditions is concentration dependent, with a thresholdeffect observed at a PO2 of 8.8 � 0.5 kPa.19

Detailed kinetic analysis of the effects of hypoxia on neutrophilapoptosis demonstrated that hypoxia could delay the rate ofconstitutive apoptosis even when introduced at a late stage (eg,after 15 hours of normoxia when more than 50% of the cells hadalready undergone apoptosis) (Figure 2A). Similarly, when neutro-phils were incubated initially under hypoxic conditions and thentransferred back to a normoxic environment, the cells regainedtheir ability to undergo apoptosis. This occurred at a rate and to anextent identical to that observed in cells incubated for the entireperiod under normoxic conditions (Figure 2B). This ability ofso-called hypoxic neutrophils to regain their ability to undergo

3010 MECKLENBURGH et al BLOOD, 15 OCTOBER 2002 � VOLUME 100, NUMBER 8




apoptosis at a normal rate when reoxygenated was, however, lostwhen the initial period of hypoxic exposure was extended to 20hours (Figure 3).

Inability of mitochondrial inhibitors, glucose deprivation,or heat shock to inhibit neutrophil apoptosis

Subsequent experiments were undertaken to determine the specific-ity of the survival effect of hypoxia in neutrophils and particularlyto determine whether such an effect could be observed whenneutrophils were subjected to other forms of stress, namely heatshock, glucose deprivation, or inhibition of mitochondrialoxidative metabolism.

In contrast to the marked survival effect of hypoxia, heat shockat either 42°C or 4°C did not influence the rate of constitutiveapoptosis at early (5 hours) or late (20 hours) times (Figure 4A).Western blot and flow immunocytometric analysis of Hsp 70expression in neutrophils demonstrated no alteration in the level ofHsp 70 expression at 4 and 20 hours under normoxic or hypoxicconditions (data not shown).

Although glucose deprivation has been linked to the inhibitionof apoptosis resistance in hemopoietic and breast cancer cells41 andit has been demonstrated that high glucose levels induce apoptosisin FRTL5 and endothelial cells,42,43 neither glucose removal norglucose supplementation influenced the extent of neutrophil apopto-sis at 20 hours under normoxic or hypoxic conditions (Figure 4B).The relatively low levels of apoptosis observed in this particular setof experiments reflected the need to replace normal 10% autolo-gous serum with dialyzed (glucose-free) fetal calf serum (datanot shown).

Finally, neutrophils were incubated under normoxic (21%oxygen) or hypoxic (3 kPa oxygen) conditions in the presence andabsence of the mitochondrial complex I inhibitor, rotenone (100ng/mL), or the complex IV inhibitors, sodium azide (1 mM) andpotassium cyanide (1 mM). These inhibitors were used at aconcentration previously demonstrated to modulate TNF-�–induced apoptosis in murine fibrosarcoma cells.44 As shown inFigure 4C, these agents were unable to mimic or abrogate thesurvival effect of hypoxia even after prolonged coincubation (20hours), suggesting that the ability of hypoxia to inhibit neutrophilapoptosis is not a consequence of compromised oxidative metabo-lism or a decline in cellular adenosine triphosphate (ATP) levels.Such data would concur with our previous nuclear magneticresonance (NMR) spectroscopy findings indicating that the ATP/adenosine diphosphate (ADP) ratio in the neutrophil does notchange as the cell undergoes apoptosis.45

Figure 1. Inhibition of neutrophil apoptosis by hypoxia. Freshly isolated humanperipheral blood neutrophils were incubated at 5 � 106 cells/mL in atmospheres containing21% (open bars) or 3% oxygen (gray bars). At the time points indicated, cells wererecovered and apoptosis was assessed (A) by morphologic examination of cytocentrifugepreparations, (B) by flow cytometry of annexin V binding, or (C) by flow cytometry followingpropidium iodide staining. Data in panel A represent the mean � SEM of 3 separateexperiments each performed in triplicate (*P .05, compared with time-matched controlsincubated in 21% oxygen). Data in panels B and C are representative flow-cytometryhistograms; identical data were obtained in 4 additional independent experiments.(D) Classic neutrophil appearances following in vitro aging under normoxia and hypoxia areshown, and apoptotic cells are highlighted by arrowheads.

Figure 2. Effect of delayed hypoxic incubation andreoxygenation on the kinetics of neutrophil apopto-sis. (A) Neutrophils were incubated at 5 � 106 cells/mLin 21% oxygen for the time periods indicated at rightbefore they were transferred to an incubator containing3% oxygen. Top and bottom curves represent the timecourses for the onset of apoptosis in neutrophils culturedthroughout in 21% or 3% oxygen, respectively. Percent-age apoptosis was assessed morphologically from cyto-centrifuge preparations. (B) Effect of reoxygenation wasexamined by incubating neutrophils in 3% oxygen forincreasing periods of time (indicated at right) before theywere transferred to an incubator containing 21% oxygen.Top and bottom curves represent the kinetics for theonset of apoptosis for neutrophils incubated throughoutin 21% oxygen or 3% oxygen, respectively. In panels Aand B, data represent the mean � SEM of 4 separateexperiments, each performed in triplicate.





Protective effect of hypoxia on neutrophil apoptosisis protein synthesis dependent

To investigate whether the inhibition of neutrophil apoptosis byhypoxia was protein synthesis dependent, the effect of cyclohexi-mide (CHX) was studied. Initial time-course studies indicated thatalthough the survival effect of hypoxia was completely lost in thepresence of 50 �M CHX, this concentration of CHX also caused amajor increase in the extent of apoptosis between 4 and 24 hours.46

In view of this, we tested the effect of lower concentrations of CHX(0.1-10 �g/mL), which, although they continue to interfere withprotein synthesis,47 do not affect the basal rate of neutrophilapoptosis. Figure 5B demonstrates that CHX, even at these muchlower concentrations (1-10 �g/mL), was able to inhibit the survivaleffect of hypoxia.

Hypoxia does not modulate neutrophil release of IL-8

To assess whether the hypoxic regulation of IL-8 release fromneutrophils could in part explain the survival effect, IL-8 release

into culture supernatants was measured using ELISA. AlthoughIL-8 was detectable at all time points, there was no significantdifference in IL-8 levels in cells incubated under normoxic,hypoxic, or anoxic conditions at either 6 or 20 hours (Figure 6).

Effect of the iron chelators DFO and CP-94on neutrophil apoptosis

To pursue the hypothesis that HIF-1 may be involved in theinhibition of neutrophil apoptosis by hypoxia, we examined theeffect of 2 structurally distinct iron chelators, DFO and 1,2-diethyl-3-hydroxypyridine-4-1 (CP-94), on the rate of neutrophil apopto-sis. These agents have been shown to mimic the cellular andbiochemical effects of hypoxia in other cell types and to induceHIF-1 activation. DFO and CP-94 caused a concentration-dependent inhibition of neutrophil apoptosis and, at maximallyeffective (nontoxic) concentrations, were able to inhibit apoptosisto an extent similar to that observed under extreme hypoxia (Figure7A). The survival effect of DFO, CP-94, and hypoxia were alsononadditive (data not shown), suggesting a common mechanism ofaction. Confirmation that the functional effects of DFO and CP-94were caused by their iron-chelating properties was obtained bydemonstrating that inclusion of a molar excess of iron (Fe2�) couldfully block the survival effect of these agents (Figure 7B).

Expression of HIF-1 in human neutrophils

To explore the potential involvement of HIF-1 in hypoxic signalingin the neutrophil, we sought evidence for HIF-1 mRNA and proteinexpression. RNase protection assays were performed using totalRNA extracted from freshly isolated neutrophils and monocytes toidentify mRNA for HIF-1 and endothelial PAS domain protein 1(EPAS-1). EPAS-1 shares 48% sequence homology with HIF-1�.48

HeLa cell RNA was used as a positive control for the EPAS RNaseprotection assays. Figure 8A demonstrates the presence of HIF-1�mRNA in freshly isolated monocytes and neutrophils; this is incontrast to EPAS, which was only identified in the HeLa cells. Todemonstrate whether hypoxia could modulate HIF-1� proteinlevels, neutrophils were incubated for 3 hours in hypoxic condi-tions, ensuring that these cells were initially resuspended in

Figure 3. Ability of prolonged hypoxic exposure to impair the subsequent rateof neutrophil apoptosis following reoxygenation. Neutrophils were incubated for20 to 30 hours in 21% (f) or 3% (F) oxygen, and apoptosis was assessedmorphologically on cytocentrifuge preparations. In addition, the extent of apoptosiswas assessed in cells initially incubated in 3% oxygen for 20 hours before transfer to21% oxygen (‚). Data are expressed as mean � SEM of 5 separate experiments,each performed in triplicate.

Figure 4. Inability of heat and cold shock, glucose deprivation, and mitochondrial inhibitors to modulate the rate of neutrophil apoptosis in vitro. (A) Neutrophils(5 � 106/mL) were incubated at 42°C (heat shock) or 4°C (cold shock) for 1 hour before culture at 37°C under normoxic (21% oxygen) conditions for 5 or 20 hours. Control cellswere preincubated for 1 hour at 37°C before culture under normoxic (open bar) or hypoxic (3% oxygen; diagonally striped bar) conditions. Cells were recovered at the timepoints indicated, and apoptosis was assessed morphologically. Data represent mean � SEM of 7 independent experiments, each performed in triplicate (*P .05 comparedwith time-matched controls). (B) Neutrophils were cultured under normoxic (21% oxygen; open bars) or hypoxic (3% oxygen; filled bars) conditions in IMDM containing either4.5 g/L glucose (control), 10 g/L glucose, no glucose, or sodium pyruvate. In all conditions IMDM was supplemented with 10% dialyzed (glucose-free) fetal calf serum. Cellswere recovered at 20 hours, and apoptosis was assessed morphologically. Data represent the mean � SEM of 4 independent experiments, each performed in triplicate.(C) Neutrophils were cultured under normoxic (21% oxygen) (open bars) or hypoxic (3% oxygen) (filled bars) conditions for 20 hours in the presence or absence of sodiumazide (1 mM), potassium cyanide (1 mM), or rotenone (100 ng/mL), as indicated. Apoptosis was assessed morphologically. Data represent the mean � SEM of triplicateincubations from 1 of 2 representative experiments.





medium that had been pre-equilibrated at 0% oxygen overnight.Thereafter, whole-cell lysates were prepared using a TRIzol-basedlysis method and were analyzed for HIF-1� by Western blotting. Asshown in Figure 8B, HIF-1� was not detectable in the control cellsbut was found in cells incubated under hypoxic conditions or in thepresence of DFO.

Effect of hypoxia on adrenomedullin transcription

To demonstrate that a HIF-1�–dependent gene was transcription-ally regulated by hypoxia in neutrophils, we examined the effect ofhypoxia and anoxia on adrenomedullin expression using semiquan-titative RT-PCR. After 3 hours of incubation, adrenomedullin RNAexpression—corrected for �-actin expression—was increased by28% in hypoxia and 20% in anoxia compared with normoxiccontrols. Furthermore, when corrected for GAPDH expression,adrenomedullin RNA was increased by 50% and 62% in hypoxiaand anoxia, respectively (data not shown).

Effect of cobalt on the extent of neutrophil apoptosis

In contrast to the ability of cobalt ions to replicate the effect ofhypoxia on erythropoietin expression in Hep3B cells,49,50 100 �Mcobaltous chloride caused no mimicry of the hypoxic survivaleffect in neutrophils cultured for 20 hours and no additionalsurvival advantage in the hypoxic cells (Figure 9).

Constitutive neutrophil apoptosis is not blocked by thecaspase inhibitors ZVAD-fmk and Boc-D-fmk

To address whether the survival effect of hypoxia might reflect aninhibition of caspase activity, we initially examined whether theinhibition of caspase activity could prevent constitutive neutrophilapoptosis. This was performed by incubating cells in the presenceof 100 �M ZVAD-fmk or 25 �M Boc-D-fmk. These agents,although they abolished the proapoptotic effect of TNF-� andgliotoxin (from 95% to 9% at 2 hours; P � .0001) (Figure 10A),had no effect on the extent of constitutive apoptosis at 6 and 20hours (Figure 10B,C, respectively).

Discussion

These experiments indicate that neutrophils have a ferroproteinoxygen sensor that is able to induce a profound and transcription-dependent inhibition of neutrophil apoptosis. This effect seems tobe specific for hypoxia and to display a striking resemblance to theoxygen-dependent regulation of erythropoietin and angiogenicgrowth-factor expression observed in other cell types.51 Hence, the

ability of hypoxia to inhibit neutrophil apoptosis could be mim-icked by exposure of the cells to 2 discrete iron-chelating agents,DFO and CP-94, in a manner that was blocked by the inclusion ofan excess of Fe2� ions, and it was associated with the induction ofHIF-1� protein. Moreover, it has been shown that this effect is notmimicked by antioxidants.19

Detailed kinetic analysis revealed that aging neutrophils couldalso respond to hypoxia by delaying apoptosis and that reoxygen-ation caused a prompt reversal of the survival effect. After 20hours, however, neutrophils were unable to regain their normalapoptotic potential, implying that a more long-term resetting of thecell’s apoptotic threshold/steady state occurred with prolongedexposure of neutrophils to low-oxygen tension.

The effect of hypoxia on neutrophil apoptosis appears distinctfrom the effect of other stress-inducing stimuli. Hence, UVirradiation, sphingosine treatment, and incubation of neutrophilsunder hyperosmolar conditions17,18 all result in p38 mitogen-activated protein kinase (MAPK) activation, and specific inhibitionof this pathway fully protects against the proapoptotic effects ofthese stimuli. The antiapoptotic effect of hypoxia, however, is notmodulated by the specific p38 MAPK inhibitor SB 203580 (K.M.,E.R.C., unpublished observations, January 1998) and is not influ-enced by glucose deprivation. Moreover, the release of antiapop-totic cytokines, including IL-8, seemed unlikely because weshowed no significant difference in IL-8 release between thedifferent oxygen tensions and found similar results for GM-CSF,IL-6, IL-1�, and TNF-� (S.R.W., E.R.C., unpublished observa-tions, December 2001).

Although up-regulation of heat-shock proteins, especially Hsp70 and Hsp 27, have been shown to increase the resistance ofcertain cells to cytotoxic drug or Fas-induced apoptosis52 and

Figure 6. Effect of oxygen tension on neutrophil release of IL-8. Neutrophils(5 � 106/mL) were cultured in normoxia (N; 21%), hypoxia (H; 3%), or anoxia (A; 0%) for 6or 20 hours as indicated, and supernatants were collected and stored at 20°C. IL-8release was subsequently analyzed by ELISA. Phytohemagglutinin-stimulated (10 �g/mL)peripheral blood mononuclear cell (PBMC) supernatants were used as positive controls.Neutrophil data represent mean of 9 separate experiments, each performed in duplicate.PBMC control data represent mean � SEM of 3 separate experiments.

Figure 5. Effect of cycloheximide on hypoxia-medi-ated inhibition of neutrophil apoptosis. Isolated neu-trophils were cultured at 5 � 106/mL in the presence orabsence of 50 �g/mL (A) or 0.1 to 10 �g/mL (B) of CHX inatmospheres containing 21% or 3% oxygen. Cells wererecovered at the time points indicated, and apoptosis wasassessed morphologically. (A) Time-course data (CHX50 �g/mL) showing mean � SEM of triplicate incubationsfrom a single experiment representative of 2. (B) Concen-tration-response data at 20 hours (open bars, cellsincubated in 21% oxygen; gray bars, cells incubated at3% oxygen). Data represent mean � SEM of 6 separateexperiments.





although Hsp 70 is constitutively expressed in neutrophils,37 therate of neutrophil apoptosis was not sensitive to heat-shocktreatment in normoxia or under reduced-oxygen conditions. Thisargues against a role for conventional heat-shock proteins in theinhibition of neutrophil apoptosis by hypoxia and again lendssupport to a prosurvival effect of hypoxia mediated through anindependent pathway involving specific oxygen sensors and,potentially, HIF-1�.

In normoxia, HIF-1� is rapidly destroyed by ubiquitin protea-some pathways53-55; indeed, in neutrophils we demonstrated thepresence of HIF protein only under hypoxic conditions, where thisregulated proteolysis is suppressed.56 In addition, the up-regulationof adrenomedullin RNA in neutrophils by hypoxia supports theability of HIF-1 to act as a transcriptional regulator in these cellsbecause adrenomedullin has 8 recognized HIF-1�–binding sites inits promoter region alone.57

HIF-1� proteolysis is dependent on an interaction with the vonHippel-Lindau tumor-suppressor protein, which recruits the func-tional E3 ligase complex31 and is itself regulated by the enzymatichydroxylation of prolyl residues within the LXXLAP amino acidmotif of HIF-1�.32,58-60 Recent studies with Caenorhabditis el-

egans have revealed a novel prolyl hydroxylase egl-9, which has 3mammalian homologues—prolyl hydroxylase domain-containingproteins (PHDs) 1, 2, and 3.32 All these human enzymes requireiron, oxoglutarate, and oxygen as cofactors, and each hydroxylateshuman HIF-1� at Pro-564.32

PHD1 has been shown to modify HIF-1� in an oxygen-concentration–dependent manner and, as such, provides a mecha-nism for the ability of oxygen to regulate HIF-1� stability but nodirect link to the regulation of apoptosis. PHD2, however, has beenidentified as a human homolog of rat SM-20,61,62 a protein thatlocalizes to the mitochondria and regulates caspase-dependentapoptosis in nerve growth factor-dependent neurons. In addition,PHD3 has been shown to have significant sequence homology toSM-20.32,63,64 This offers the possibility that these novel oxygen-and iron-dependent regulators of HIF-1� could be linked directlyto pathways that regulate apoptosis with HIF-1� serving otherfunctions. The inability of cobalt to mimic the hypoxic inhibition ofneutrophil apoptosis does not exclude a role for HIF because cobaltacts by substitution at the catalytic center of 2 oxoglutarate32 and,therefore, provides no additional mechanistic information.

The role of caspase activity in the constitutive apoptosis ofhematopoietic cells remains uncertain. Hence, although caspaseactivation is identified in temperature-regulated65 and TNF-�–induced66,67 neutrophil apoptosis, we show no effect of caspaseblockade on constitutive neutrophil apoptosis. This would make thenegative regulation of caspase activity, as recently demonstratedfor caspase 9,68 an unlikely target for hypoxia in neutrophils. Ourdemonstration that iron chelators mimic the effect of hypoxia onneutrophil apoptotic thresholds suggests that the same mechanism

Figure 7. Effect of the iron chelators DFO and CP-94on neutrophil apoptosis. (A) Neutrophils were culturedat 5 � 106 cells/mL under normoxic (21% oxygen) condi-tions for 20 hours in the presence or absence of increas-ing concentrations of DFO or CP-94. (B) Cells wereincubated again under normoxic conditions for 20 hoursin the absence or presence of CP-94 (300 �M), DFO(300 �M), and FeCl2 (3 mM) as indicated. Apoptosis wasassessed morphologically. In panels A and B, datarepresent the mean � SEM of 3 separate experiments,each performed in triplicate, with values in panel Aexpressed as a percentage of the matched-vehicle con-trol values.

Figure 8. Expression of HIF-1 in human neutrophils. (A) Ribonuclease protectionassay of total RNA from monocytes (M) and neutrophils (N) was performed forEPAS-1 and HIF-1�, as detailed in “Materials and methods,” with HeLa cell RNA usedas a positive control. A representative blot from 2 separate experiments is shown.(B) Neutrophils (5 � 106/mL) were incubated for 3 hours in normoxic (21% oxygen)(� 1 mM DFO) or hypoxic (3% oxygen) environments, and whole-cell lysates wereprepared. Hypoxia-treated HeLa cells were used as positive controls. Proteins wereseparated by SDS-PAGE and probed using an HIF-1� antibody (mAb 28b).Immunoreactive bands were imaged by enhanced chemiluminescence. A representa-tive blot from 2 separate experiments is shown.

Figure 9. Effect of cobaltous chloride on neutrophil apoptosis. Neutrophils(5 � 106/mL) were incubated in the presence or absence of cobaltous chloride(100 �M) for 20 hours in atmospheres containing 21% or 3% oxygen. Apoptosis wasassessed morphologically, and data represent mean � SD of triplicate incubationsfrom 1 of 2 representative experiments.





of 2-oxoglutarate–dependent oxygenase function found to regulateHIF hydroxylation and proteolysis may be operating in thisresponse, either through HIF itself or through another hydroxyla-tion target.

In summary, we have shown that hypoxia causes a profound butreversible inhibition of neutrophil apoptosis. This effect wasspecific for hypoxia and mediated by a ferroprotein-sensingmechanism characteristic of PHD-regulated events in other celltypes. Although hypoxia also caused a marked increase in HIF-1�levels, the precise role of this protein in regulating apoptosis

signaling in neutrophils remains to be determined. These findingshave important implications for the clearance of neutrophils at sitesof inflammation and injury.

Acknowledgments

We thank P. J. Ratcliffe and J. M. Gleadle (University of Ox-ford) for contributions to this work and for critical appraisal ofthe manuscript.

References

1. Condliffe AM, Kitchen E, Chilvers ER. Neutrophilpriming: pathophysiological consequences andunderlying mechanisms. Clin Sci. 1998;94:461-471.

2. Haslett C. Resolution of acute inflammation andthe role of apoptosis in the tissue fate of granulo-cytes [editorial]. Clin Sci. 1992;83:639-648.

3. Engler RL, Dahlgren MD, Peterson MA, Dobbs A,Schmid-Schonbein GW. Accumulation of poly-morphonuclear leukocytes during 3-h experimen-tal myocardial ischaemia. Am J Physiol. 1986;251:H93–H100.

4. Grootveld MC, Henderson EB, Farrell A, BlakeDR, Parkes HG, Haycock P. Oxidative damage tohyaluronate and glucose in synovial fluid duringexercise of the inflamed rheumatoid joint: detec-tion of abnormal low-molecular–mass metabolitesby proton-n.m.r. spectroscopy. Biochem J. 1991;273:459-467.

5. Parkes HG, Grootveld MC, Henderson EB, Far-rell A, Blake DR. Oxidative damage to synovialfluid from the inflamed rheumatoid joint detectedby 1H NMR spectroscopy. J Pharm Biomed Anal.1991;9:75-82.

6. Metchnikoff E. Lecture VII Pasteur Institute, 1891.In: Starling FA, Starling EH, eds. Lectures on theComparative Pathology of Inflammation. NewYork, NY: Dover Publications; 1986.

7. Savill J, Henson JE, Wyllie AH, Walport MJ, Hen-son PM, Haslett C. Macrophage phagocytosis ofaging neutrophils in inflammation: programmedcell death in the neutrophil leads to recognition bymacrophages. J Clin Invest. 1989;83:865-875.

8. Haslett C, Savill J, Meagher LC. The neutrophil.Curr Opin Immunol. 1989;2:10-18.

9. Savill J, Dransfield I, Hogg N, Haslett C. Vitronec-tin receptor mediates phagocytosis of cells under-going apoptosis. Nature. 1990;343:170-173.

10. Savill J. Macrophage recognition of senescentneutrophils. Clin Sci. 1992;83:649-655.

11. Haslett C, Savill J, Whyte M, Stern M, DransfieldI, Meagher LC. Granulocyte apoptosis and thecontrol of inflammation. Phil Trans R Soc London.1994;B:345-327.

12. Grigg JM, Savill J, Sarraf C, Haslett C, SilvermanM. Neutrophil apoptosis and clearance by macro-phages in the lungs of neonates with pulmonaryinflammation. Lancet. 1991;338:720-722.

13. Cox G, Crossley J, Xing Z. Macrophage engulf-ment of apoptotic neutrophils contributes to theresolution of acute pulmonary inflammation invivo. Am J Respir Cell Mol Biol. 1995;12:232-237.

14. Hussain N, Wu F, Zhu L, Thrall RS, KreschJ. Neutrophil apoptosis during the developmentand resolution of oleic acid-induced acute lunginjury in the rat. Am J Respir Cell Mol Biol. 1998;19:867-874.

15. Cox G, Gauldie J, Jordana M. Bronchial epithelialcell-derived cytokines (G-CSF and GM-CSF) pro-mote the survival of peripheral blood neutrophilsin vitro. Am J Respir Cell Mol Biol. 1992;7:507-513.

16. Coxon A, Rieu P, Barklow FJ, et al. A novel rolefor the �2 integrin CD11b/CD18 in neutrophil apo-ptosis: a homeostatic mechanism in inflamma-tion. Immunity. 1996;5:653-666.

17. Frasch SC, Nick JA, Fadok VA, Bratton DL,Worthen GS, Henson PM. p38 mitogen-activatedprotein-kinase dependent and-independent intra-cellular signal transduction pathways leading toapoptosis in human neutrophils. J Biol Chem.1998;273:8389-8397.

18. Mecklenburgh K, Murray J, Brazil T, Ward C,Rossi AG, Chilvers ER. Role of neutrophil apo-ptosis in the resolution of pulmonary inflamma-tion. Monaldi Arch Chest Dis. 1999;54:345-349.

19. Hannah S, Mecklenburgh K, Rahman I, et al.Hypoxia prolongs neutrophil survival in vitro.FEBS Lett. 1995;372:233-237.

20. Leuenroth SJ, Grutkoski PS, Ayala A, Simms H.

Suppression of PMN apoptosis by hypoxia is de-pendent on Mcl-1 and MAPK activity. Surgery.2000;128:171-177.

21. Rosenbaum DM, Michaelson M, Batter DK, DoshiP, Kessler JA. Evidence for hypoxia-induced, pro-grammed cell death of cultured neurons. AnnNeurol. 1994;36:864-870.

22. Yao KS, Clayton M, O’Dwyer PJ. Apoptosis inhuman adenocarcinoma HT29 cells induced byexposure to hypoxia. J Natl Cancer Inst. 1995;87:117-122.

23. Graeber TG, Osmanian C, Jacks T, et al. Hyp-oxia-mediated selection of cells with diminishedapoptotic potential in solid tumors. Nature. 1996;379:88-91.

24. Ellis GA, Edmonds SE, Gaffney K, Williams RB,Blake D. Synovial tissue oxygenation profile ininflamed and non-inflamed knee joints [abstract].Br J Rheumatol. 1994;33(suppl 1):172.

25. Niinikoski J, Hunt TK, Englebert Dunphy J. Oxy-gen supply in healing tissue. Am J Surg. 1972;123:247-252.

26. Hunt TK, Twomey P, Zederfeldt B, Englebert Dun-phy J. Respiratory gas tensions and pH in healingwounds. Am J Surg. 1967;114:302-307.

27. Semenza GL, Wang GL. A nuclear factor inducedby hypoxia via de novo protein synthesis binds tothe human erythropoietin gene. Mol Cell Biol.1992;12:5447-5454.

28. Wang GL, Jiang B-H, Rue EA, Semenza GL.Hypoxia-inducible factor 1 is a basic-helix-loop-helix-PAS heterodimer regulated by cellular O2

tension. Proc Natl Acad Sci U S A. 1992;92:5510-5514.

29. Wang GL, Semenza GL. General involvement ofhypoxia-inducible factor 1 in transcriptional re-sponse to hypoxia. Proc Natl Acad Sci U S A.1993;90:4304-4308.

30. Wiener CM, Booth G, Semenza GL. In vivo ex-pression of mRNAs encoding hypoxia-inducible

Figure 10. Effect of caspase inhibition on neutrophil apoptosis. (A) Neutrophils (5 � 106/mL) were cultured for 2 hours in the presence or absence of gliotoxin and TNF-�with or without 100 �M ZVAD-fmk. Data represent 6 replicates from one experiment. (B,C) Neutrophils (5 � 106/mL) were cultured under normoxic (21%), hypoxic (3%), oranoxic (0%) conditions for 6 hours (B) or 20 hours (C) in DMEM containing 10% autologous serum (Monofeed) in the presence or absence of 100 �M ZVAD-fmk or 25 �MBoc-D-fmk. Control, untreated, and 1 �L/mL dimethyl sulfoxide (vehicle)–treated neutrophils were also analyzed. Data represent the mean � SEM of 3 experiments, eachperformed in triplicate.





factor 1. Biochem Biophys Res Comm. 1996;225:485-488.

31. Cockman ME, Masson N, Mole DR, et al. Hyp-oxia inducible factor-a binding and ubiquitylationby the von Hippel-Lindau tumour suppressor pro-tein. J Biol Chem. 2000;275:25733-25741.

32. Epstein ACR, Gleadle JM, McNeill LA, et al.C. elegans EGL-9 and mammalian homologs de-fine a family of dioxygenases that regulate HIF byprolyl hydroxylation. Cell. 2001;107:43-54.

33. Haslett C, Guthrie LA, Kopamiak MM, JohnsonRB, Henson PM. Modulation of multiple neutro-phil functions by preparative methods or traceconcentrations of bacterial lipopolysaccaride.Am J Pathol. 1985;119:101-110.

34. Condliffe AM, Chilvers ER, Haslett C, Dransfield I.Priming differentially regulates neutrophil adhe-sion molecule expression/function [abstract]. Im-munology. 1996;89:105.

35. Kitchen E, Rossi AG, Condliffe AM, Haslett C,Chilvers ER. Demonstration of reversible primingof human neutrophils using platelet activating fac-tor. Blood. 1996;88:4330-4337.

36. Eid NS, Kravath RE, Lanks KW. Heat-shock pro-tein synthesis by human polymorphonuclearcells. J Exp Med. 1987;165:1448-1452.

37. Cox G, Moseley P, Hunninghake GW. Induction ofheat-shock protein 70 in neutrophils during expo-sure to subphysiological temperatures. J InfectDis. 1993;167:769-771.

38. Ward C, Chilvers ER, Lawson mL, et al. NF-kBactivation is a critical regulator of human granulo-cyte apoptosis in vitro [abstract]. J Biol Chem.1999;274.

39. Nicoletti I, Migliorati G, Oagliacci MC, Grignani F,Riccardi C. A rapid and simple method for mea-suring thymocyte apoptosis by propidium iodidestaining and flow cytometry. J Immunol Methods.1991;139:271-279.

40. Murray J, Barbara J, Dunkley SA, et al. Regula-tion of neutrophil apoptosis by tumour necrosisfactor-�: requirement for CD120a (TNFR-55) andCD120b (TNFR-75) for induction of apoptosis invitro. Blood. 1997;90:2772-2783.

41. McCormick TS, McColl KS, Distelhorst C. Mouselymphoma cells destined to undergo apoptosis inresponse to thapsigargin treatment fail to gener-ate a calcium-mediated grp78/grp94 stress re-sponse. J Biol Chem. 1997;272:6087-6092.

42. Donnini D, Zambito AM, Perrella G, Ambesi-Impi-ombata FS, Curcio F. Glucose may induce deaththrough a free radical-mediated mechanism. Bio-chem Biophys Res Comm. 1996;219:412-417.

43. Baumgartner-Parzer SM, Wagner L, PettermannM, Grillari J, Gessel A, Waldhaus W. High-glu-

cose–triggered apoptosis in cultured endothelialcells. Diabetes. 1995;44:1323-1327.

44. Schulze-Osthoff K, Bakker AC, VanhaesebroeckB, Beyaert R, Jacob WA, Fiers W. Cytotoxic activ-ity of tumour necrosis factor is mediated by earlydamage of mitochondrial function: evidence forthe involvement of mitochondrial radical genera-tion. J Biol Chem. 1992;267:5317-5323.

45. Nunn JF. Nunn’s Applied Respiratory Physiology.Cambridge, United Kingdom: The UniversityPress; 1993.

46. Whyte M, Savill J, Meagher LC, Haslett C. Cou-pling of neutrophil apoptosis to recognition bymacrophages: coordinated acceleration by pro-tein synthesis inhibitors. J Leuk Biol. 1997;62:195-202.

47. Cox G, Oberley LW, Hunninghake GW. Manga-nese superoxide dismutase and heat shock pro-tein 70 are not necessary for suppression of apo-ptosis in human peripheral blood neutrophils.Am J Respir Cell Mol Biol. 1994;10:493-498.

48. Tian H, McKnight SL, Russel DW. EndothelialPAS domain protein 1 (EPAS 1), a transcriptionalfactor selectively expressed in endothelial cells.Genes Dev. 1997;11:72-82.

49. Goldberg MA, Dunning SP, Bunn HF. Regulationof the erythropoietin gene: evidence that the oxy-gen sensor is a heme protein. Science. 1988;242:1412-1415.

50. Huang LE, Ho V, Arany Z, et al. Erythropoietingene regulation depends on heme-dependentoxygen sensing and assembly of interacting tran-scription factors. Kidney Int. 1997;51:548-552.

51. Gleadle JM, Ebert BL, Ratcliffe PJ. Regulation ofangiogenic growth factor expression by hypoxia,transition metals and chelating agents. Am JPhysiol. 1995;268:C1362–C1368.

52. Samali A, Cotter TG. Heat shock proteins in-crease resistance to apoptosis. Exp Cell Res.1996;223:163-170.

53. Huang LE, Gu J, Schau M, Bunn H. Regulation ofhypoxia-inducible factor 1� is mediated by an O2-dependent degradation domain via the ubiquitin-proteasome pathway. Proc Natl Acad Sci U S A.1998;95:7987-7992.

54. Kallio PJ, Wilson WJ, O’Brien S, Makino Y, Poel-linger L. Regulation of the hypoxia-inducible tran-scription factor 1a by the ubiquitin-proteasomepathway. J Biol Chem. 1999;274:6519-6525.

55. Salceda S, Caro J. Hypoxia-inducible factor 1�(HIF-1�) protein is rapidly degraded by the ubiq-uitin-protease system under normoxic conditions:its stabilization by hypoxia depends on redox-induced changes. J Biol Chem. 1997;272:22642-22647.

56. Sutter CH, Laughner E, Semenza GL. Hypoxia-inducible factor 1a protein expression is con-trolled by oxygen-regulated ubiquitination that isdisrupted by deletions and missense mutations.Proc Natl Acad Sci U S A. 2000;97:4748-4753.

57. Garayoa M, Martinez A, Lee S, et al. Hypoxia-inducible factor-1 (HIF-1) up-regulates ad-renomedullin expression in human tumor celllines during oxygen deprivation: a possible pro-motion mechanism of carcinogenesis. Mol CellEndocrinol. 2000;14:848-862.

58. Jaakkola P, Mole DR, Tian Y-M, et al. Targeting ofHIF-a to the von Hippel-Lindau ubiquitylationcomplex by O2-regulated prolyly hydroxylation.Science. 2001;292:468-472.

59. Ivan M, Kondo K, Yang H, et al. HIF� targeted forVHL-mediated destruction by proline hydroxyla-tion: implications for O2 sensing. Science. 2001;292:464-468.

60. Masson N, William C, Maxwell P, Pugh CW, Rat-cliffe PJ. Independent function of two destructiondomains in hypoxia-inducible factor-� chains acti-vated by prolyl hydroxylation. EMBO J. 2001;20:5197-5206.

61. Wax SD, Rosenfield CL, Taubman MB. Identifica-tion of a novel growth factor-responsive gene invascular smooth muscle cells. J Biol Chem. 1994;269:13041-13047.

62. Dupuy D, Aubert I, Duperat VG, et al. Mapping,characterization, and expression analysis of theSM-20 human homologue, c1orf12, and identifi-cation of a novel related gene, SCAND2. Genom-ics. 2000;69:348-354.

63. Lipscomb EA, Sarmiere PD, Freeman RS. SM-20is a novel mitochondrial protein that causescaspase-dependent cell death in nerve growthfactor-dependent neurons. J Biol Chem. 2001;276:5085-5092.

64. Madden SL, Galella EA, Riley D, Bertelsen AH,Beaudy GA. Induction of cell growth regulatorygenes by p53. Cancer Res. 1996;56:5384-5390.

65. Pryde JG, Walker A, Rossi AG, Hannah S, HaslettC. Temperature-dependent arrest of neutrophilapoptosis. J Biol Chem. 2000;275:33574-33584.

66. Kettritz R, Scheumann J, Xu Y, Luft FC, Haller H.TNF-�–accelerated apoptosis abrogates ANCA-mediated neutrophil respiratory burst by acaspase-dependent mechanism. Kidney Int.2002;61:502-515.

67. Niwa M, Hara A, Kanamori Y, et al. Nuclear fac-tor-�B activates dual inhibition sites in the regula-tion of tumor necrosis factor-�–nduced neutrophilapoptosis. Eur J Pharmacol. 2000;407:211-219.

68. Nishiyama J, Yi X, Venkatachalam MA, Dong Z.cDNA cloning and promoter analysis of ratcaspase-9. Biochem J. 2001;360:49-56.





neutrophil apoptosis Involvement of a ferroprotein sensor in hypoxia-mediated inhibition of

Documents

Transcript of neutrophil apoptosis Involvement of a ferroprotein sensor in hypoxia-mediated inhibition of