Mouse Adipose Tissue-Derived Adult Stem Cells ExpressedOsteogenic Specific Transcripts of Osteocalcin and ParathyroidHormone Receptor During Osteogenesis

P.K. Teotia, K.E.-D. Hussein, K.-M. Park, S.-H. Hong, S.-M. Park, I.-C. Park, S.-R. Yang, and H.-M. Woo

0041-1345/1http://dx.doi

3102

ABSTRACT

Introduction. Adult mesenchymal stem cells (MSCs) have potential to differentiate intovarious lineages, replacing cells during normal turnover and tissue regeneration to replacedamaged or lost adult tissues during osteoporosis and arthritis, or traumatic injuries. Weinvestigated the osteogenic signature in mouse adipose tissue (AD)- and bone marrow(BM)-derived MSCs.Materials and Methods. MSCs from adipose tissue and bone marrow were compared forosteogenic endogenous mRNA markers by reverse-transcription polymerase chain reaction(RT-PCR). Cellular proliferation and immunophenotype analyzed by flow cytometryrevealed that mouse AD-MSCs and BM-MSCs shared similar characteristics.Result. Isolated AD-MSC and BM-MSC showed high proliferation rates and fibroblastmorphology. Flow cytometry revealed positive markers for mesenchyme, but negative forprimitive hematopoietic and endothelial cells. At day 21, Alizarin red S and Von-kossastaining of differentiated cells showed high calcium deposits compared with undifferentiatedcells. After 21 days of osteogenic differentiation, AD-MSCs expressed osteocalcin andparathyroid hormone (PTH) compared with undifferentiated cells. Osteogenic-specifictranscript of osteocalcin (OC), bone gamma carboxyglutamate protein, and PTH receptor(PTHr) were detected only in differentiated not undifferentiated cells. UndifferentiatedBM-MSCs, expressed all markers at low intensity, which amplified during differentiation.Conclusion. Our findings suggest that the OC and PTHr can be used as differentiationmarkers for osteogenesis of mouse AD-MSC.

From the Stem Cell Institute (P.K.T., K.E.-D.H., K.-M.P.,S.-H.H., S.-M.P., S.-R.Y., H.-M.W.), College of Veterinary Medi-cine (P.K.T., K.E.-D.H., K.-M.P., I.-C.P., H.-M.W.), and College ofMedicine (S.-H.H., S.-M.P., S.-R.Y.), Kangwon National Univer-sity, Chuncheon, South Korea; and the Renal Division (H.-M.W),Brigham and Women’s Hospital, Harvard Medical School,Boston, Massachusetts.

Corresponding author: Se-Ran Yang, DVM, PhD, College ofMedicine and Stem Cell Institute, Kangwon National University,Hyojadong 192-1, Chuncheon, Gangwon, Korea. E-mail: seran.yang@gmail.com

Corresponding author and reprint requests to Heung-MyongWoo, DVM, PhD, Department of Veterinary Surgical Science,College of Veterinary Medicine, and Stem Cell Institute, KangwonNational University, Hyojadong 192-1, Chuncheon, Gangwon,Korea. E-mail: woohm@kangwon.ac.kr

ADIPOSE-DERIVED mesenchymal stem cells (AD-MSCs) have several advantages as a tissue source,

including a high stem cell concentration compared withbone marrow,1 easy accessibility, abundance, and differen-tiation into osteogenic lineages.2,3 Moreover, in humans, theuse of AD-MSC, as an alternative to bone marrow stemcells (BMSC) for clinical therapy relieves patients froma painful bone marrow aspiration facilitating autologoustransplantation. These advantages render AD-MSC a highlydesirable stem cell source for tissue regeneration.4,5 Mousebone marrow-derived MSCs (BM-MSCs) and AD-MSCsisolated using conventional methods1,6 were compared fortheir mRNA expression levels of osteocalcin (OC), para-thyroid hormone receptor (PTHr) and bone gammacarboxyglutamate protein (Bglap 1) during osteogenicdifferentiation. OC, one of the most abundant proteins in

3/$esee front matter.org/10.1016/j.transproceed.2013.08.017

ª 2013 by Elsevier Inc. All rights reserved.360 Park Avenue South, New York, NY 10010-1710

Transplantation Proceedings, 45, 3102e3107 (2013)

ADULT MSC EXPRESS OSTEOGENIC-SPECIFIC TRANSCRIPTS 3103

bone, plays an important role in the differentiation of oste-oblastic progenitor cells, being significantly upregulatedduring matrix synthesis and mineralizationn.7 In variousclinical trials, PTH had been shown to be useful to preventfractures in osteoporotic subjects.8,9 Subcutaneous injec-tion of PTH exerts potent anabolic effects on the skel-eton.10 Degenerative diseases such as osteoporosis andarthritis as well as traumatic injuries, including nonunionfractures and tumor resections, pose significant challengesfor health care professionals. Adult MSCs can poten-tially be employed in therapeutic approaches for tissue-engineered repair of bone defects.11 In addition, clini-cians have shown a keen interest in transplantation ofgenetically engineered overexpressed nonosteogenic cellsto repair large bone defects11,12 for tissue engineering.However, to obtain potent osteogenic cells, requiresidentification of the transcriptional markers that areexpressed during cell differentiation. In the present study,we determined the osteogenic markers in mouse AD- andBM-MSCs, which can be further analyzed to enhancespecific genes that generate highly potent osteogenic cellsfor bone tissue regeneration.

MATERIALS AND METHODSIsolation of Mouse AD- and BM-MSCs

We isolated, expanded, and characterizedmouseMSCs from adiposetissue and bonemarrow.All animal procedures were conducted underguideline approved by our Institutional Animal Care and UseCommittee. MSCs were isolated from 10- to 11-week-old BALB/cmice killed by cervical dislocation. Inguinal fat pads were washedthree times in phosphate-buffered saline (PBS) containing 1% peni-cillin/streptomycin (P/S) before being thoroughly minced for diges-tionwith collagenase I 5mL; 1mg/mL (Worthington,Columbus,OH).After incubation in a shaking water bath (200 rpm) at 37�C for 60minutes. After 60 minutes of digestion, 5 mL of high-glucose Dul-becco’s Modified EagleMedium (DMEM)þ 10% fetal bovine serum(FBS) þ 1% P/S was added to inhibit collagenase. Further more, theamount sieved through a 70-mm cell strainer followed by washingthe sieve with 10 mL of medium. Filtered cells, were centrifuged at400g (1500 rpm) for 15 minutes and the pellets washed with PBS at1500 rpm. After washing, the pellet-containing cells were cultured in100mm2 cell culture dishes in completemedia to isolatemesenchymalstem cells. BM-MSCs were isolated from the same mice as previouslydescribed.1,6 The femur and tibia were dissected from the trunk afterthe muscles were scraped off to avoid contamination. After flushing

Table 1. Osteoge

Markers Primer Sequences

Osteocalcin (OC) F:50 GAC CAT CTT TCT GCT CAC TCTR:50 GTG ATA CCA TAG ATG CGT TTG

PTH receptor F:50 GAC AAG CTG CTC AAG GAA GTTR:50 GGA ATA TCC CAC GGT GTA GAT

Bglap 1 F:50 AGA CAA GTC CCA CAC AGC AGR:50 GGC GGT CTT CAA GCC ATA CT 3

b-Tubulin F:50 GGAACATAGCCGTAAACTGC30

R:50 TCACTGTGCCTGAACTTACC30

themarrow, the remaining compact bonewas chopped into small 1- to3-mm3 pieces and treated with 5 mL collagenase II (1 mg/mL;Worthington) containing 20% FBS. The chips were digested for60 minutes in a shaking incubator (200 rpm) at 37�C. Collagenasedigestion was stopped when the bone chips became loosely attachedto each other. Further, the bone chips washed 3 times with PBS andtreated with enzyme were seeded into a 100-mm2 cell culture dish inpresence of complete media (DMEMþ15% FBSþ1% P/S). Duringincubation at 37�C in a 5% CO2 incubator for 9 days, media werechanged on the third day to remove nonadherent cells and tissuedebris.

Characterization by Flow Cytometry Analysis

At passage 2, cells were harvested by trypsin digestion. An aliquotof 2 � 105 cells were stained with fluoroscein isothiocyonate(FITC)-conjugated anti-mouse CD45, CD34, CD86 (eBioscience,San Diego, CA) and PE-conjugated anti-mouse CD44 (eBio-science), corresponding to the isotypes were used as controls.Flow cytometry allowed characterization labeled cells but nega-tive for primitive hematopoietic progenitor and endothelial cellmarkers.

Osteogenic Differentiation and Staining of Cells

The potential of the isolated cells to differentiate into the oste-ogenic lineage was examined in differentiation medium. Passage2 cells (5 � 104 cells/35 mm2 culture dish) were cultured underosteogenic conditioned medium, namely, DMEM supplementedwith 100 mmol/L dexamethasone (Sigma), 10 mmol/L b-glycer-olphosphate (Sigma) and 5 mg/mL ascorbate-2-phosphate(Sigma). The culture medium was changed after every 48 hoursup to 4 weeks. Differentiated cells were stained with Alizarin red(Sigma) and Von-kossa to identify calcium deposits in culture asdescribed previously.7 For alizarin staining, we mixed dissolved 2g Alizarin red in 100 mL distilled water, and adjusted the pH to4.1e4.3 with 0.1% NH4OH. The dark brown solution was filteredand stored in the dark or covered with foil. Cells carefully washedwith PBS were fixed for 30 minutes by adding 10% neutralbuffered formalin to cover the cell monolayer. After �30minutes, the cells were washed with distilled water and Alizarinred S staining solution added to cover the dish. Further, the dishwas placed in the dark at room temperature for 45 minutes. Cellswashed 4 times with 1 mL distilled water were analyzed underlight microscopy after adding PBS to avoid drying. Undifferen-tiated MSCs, without extracellular calcium deposits, appearslightly reddish, whereas MSC-derived osteoblasts, bright orange-red. For Von-kossa staining, 5% silver nitrate and 5% sodiumthiosulfate are dissolved in distilled water. Cells fixed with 4%

nic Markers

Size Annealing Temperature (�C)

G 30 276 62TAG 30

CTG 30 448 67CAT G 30

30 302 610

317 59

Fig 1. Morphologic characteristic of adipose tissue (AD) and bone marrow (BM) derived mesenchymal stem cells (MSCs) showedsimilar structure and with high proliferation rate BM-MSCs (AeF). At day 9, AD-MSC and BM-MSCs were highly confluent and passagedfurther to increase the number (B, E). Fluorescent activated cell sorter (FACS) analysis showed that cells were positive for mesenchymalmarker but negative for primitive hematopoietic progenitor and endothelial cells. (G) BM-MSCs expressed negative for CD45, CD34, andCD86, and positive for CD44, AD-MSCs expressed negative for CD45, CD34 marker and positive for CD44 marker. Images (AeE) weretaken under light inverted microscope at �40 magnification. FACS analysis was performed on BD FACS Calibur flow cytometer.

3104 TEOTIA, HUSSEIN, PARK ET AL

paraformaldehyde for 30 minutes were rinsed 3 times with 3 mLdistilled water for 3 minutes. Cells stained with 5% silver nitratewere incubated under bright light for 30 minutes (60-watt lamp)

before being rinsed thrice with 3 mL distilled water for 3 minutesfollowed by treatment with 5% sodium thiosulfate for 5 minutes.The stained cells were observed under light microscopy.

Fig 2. Mouse adipocyte-derivedmesynchymal stem cells (mAD-MSCs) and mouse bone marrow(mBM) MSCs were maintained for3 weeks under osteogenic condi-tioned medium. Differentiated cellswere stained with Alizarin red atdifferent time interval to detectcalcium deposition. (A, B) At day21, AD-MSCs and BM-MSC sho-wed positive orange red staining,indicating calcium deposits overthe surface of dish. (C, D) In con-gruent with Alizarin redestainedcells, Von-Kossaestained AD-MSCand BM-MSC also express positivestaining. To quantitate the intensityof Alizarinestained cells, the redmatrix precipitate was dissolvedusing lyseis buffer and absorbancewas measured at 570 nm usinga spectrophotometer (E). Image Jsoftware (NIH) was used to analyzethe red stained area in Von-Kossaestained cells (F). Gene expressionat mRNA level showed undifferenti-ated BM-MSCs express the os-teogenic markers compared withAD-MSCs (G). After 21 days ofdifferentiation, mAD-MSC ex-pressed band for osteocalcin, Bglap1, and parathyroid hormone re-ceptor compared with the undiffer-entiated cells and mBM-MSCexpressed high intensity bandfor all markers. This shows thatosteocalcin (OC), bone gamma car-boxyglutamate protein (Bgalp), andparathyroid hormone (PTH) are thetranscriptional genes for osteogene-sis ofmouse AD-MSCandBM-MSChave high differentiation ability intoosteocytes. B-tubulin is used asinternal control. Images A and Bwere taken under �100 magnifi-cation; C and D were takenunder �40 magnification. *P < .05and **P < .005.

ADULT MSC EXPRESS OSTEOGENIC-SPECIFIC TRANSCRIPTS 3105

RNA Extraction and Reverse Transcription-Polymerase ChainReaction Analysis for Osteogenic Endogenous Markers

Total RNA was isolated using the RNeasy Mini Kit (Quigen,Germany). Standard reverse transcription was performed using thereverse transcriptase Quanti Tect kit (Quigen, Germany). Eachreaction mixture included 500 mg/mL cDNA, 2 mL 10� buffer, 2 mLDNTP, 1 mL of each forward and reverse primers, and 0.4 mL Tag

polymerase in a total volume of 20 mL. Polymerase chain reaction(PCR) cycles were performed at 94�C preincubation for 2 minutes,followed by 30e34 denaturation cycles at 94�C for 30 seconds,annealing at 58e67�C for 30 seconds and elongation at 72�C for 30seconds, followed by 10 minutes fill up at 72�C. The primers,sequences, size, and corresponding annealing temperatures for oste-ogenicmarkers are listed in Table 1. OC is encoded by the Bglap gene,which was used to confirmits endogenous expression.

3106 TEOTIA, HUSSEIN, PARK ET AL

Image and Statistical Analysis

Pictures of differentiated AD-MSC and BM-MSC in osteogeniclineages were analyzed using the image J analysis program (NIH).Two-tailed student’s t-tests were used to evaluate significantdifferences between results expressed as mean values � standarddeviations P < .05 was considered to be significant.

RESULTSIsolation of MSCs Derived From Mouse Adipose Tissue andBone Marrow

MSCs isolated from mouse adipose tissue and from bonemarrow showed high proliferation rates and adherenceto plastic surfaces (Fig 1AeF). MSCs (2 � 105) harvestedby trypsin digestion were stained individually usingFITC–conjugated anti-mouse CD45, CD34, CD86, andPE-conjugated anti-mouse CD44. Unlabeled cells wereused as controls and FITC rat immunoglobulin (Ig)G2aand PE rat IgG2b, as corresponding isotype antibodies.Flow cytometric analysis showed AD-MSCs to be positivefor CD44, but negative for CD45 and CD34 (Fig 1G).BM-MSCs were positive for CD44 but negative forCD45. CD34, CD86, suggesting that MSCs isolatedfrom mouse adipose tissue or bone marrow exhibitedthe appropriate characteristics and a high proliferationrate.

BM-MSCs Showed Greater Osteogenic Potential Than AD-MSCs

To identify calcium in differentiated cells, we employedAlizarin red S and Von-Kossa staining on day 21. Calciumforms an Alizarin red S-calcium complex in a chelationprocess that yields orange red staining (Fig 2A, B). Aftertheir lysis stained cells were quantified, with absorbancemeasured at 570 nm using a spectrophotometer. Differen-tiated BM-MSCs showed high calcium deposits with highabsorbance (1.30 � 0.01) compared with AD-MSCs (1.05 �0.09; Fig 2E). In Von-Kossa staining, differentiated cellstreated with silver nitrate solution underwent reduction ofthe calcium using a strong light yielding silver deposits,which were visualized as metallic silver (Fig 2C, D). BM-MSCs showed a significantly higher percentage of stainedarea (37.3% � 0.23%) compared with AD-MSC (21.8% �1.21%); (Fig 2 E, F).

Osteocalcin and PTHr Are Critical Markers Under OsteogenicDifferentiation of Mouse AD-MSCs

At day 21, RT-PCR for all bone markers OC, PTHr, andBgalp1 were highly expressed by BM-MSCs compared withAD-MSCs. Osteogenic-specific transcription of OC andPTHr were clearly detected only in differentiated but notundifferentiated AD-MSCs, showing that during differenti-ation AD-MSC transcription into osteogenic cells occurred;in case of BM-MSC, it was difficult to interpret as undif-ferentiated cells express all of the markers. OC, Bgalp, andPTHr seem to be transcriptional genes for osteogenicdifferentiation of mouse AD-MSC.

DISCUSSION

The goal of tissue engineering is to generate biologicalsubstitutes to repair or replace injured tissue. There are 3fundamental elements. First, appropriate cells are required togive rise to the structural tissue. Second, appropriate growthfactors and differentiation stimuli must exist for the cellsto proceed down the proper lineage. Third by, a scaffoldingmatrix must act as a building block for cellular attachment,differentiation, and maturation into the desired tissue.However, the cellular and extracellular mechanism are stillnot clearly known. MSCs hold great potential for the differ-entiation into osteogenic lineage and development of newtreatment strategies for a host of orthopedic conditions.4,11,12

This study showed that OC and PTHr are bone-specific genesthat are expressed during the osteogenesis of mouse AD-MSC. BM- and AD-MSCs differentiate into osteoblast-likecells and express transcriptional markers OC, Bglap, andPTHr, making MSC a good source for cell and gene therapy.Because AD-MSC are easy to isolate and culture, they can beapplied for autologous transplantation in large bone defects.There is also evidence of production of OC by adipose tissueand its role in metabolism.13 One of the approaches thatwould increase bone healing is by applying highly expressed,osteoblast-differentiated cells in combination with biomate-rials to provide ECM for MSC proliferation and differentia-tion into new bone. The use of gene therapy to accelerateosteoblastic differentiation by overexpressing osteogenictranscriptional factors can provide highly efficient cells.2

Advances in fabrication of biodegradable scaffolds thatserve as a bed for MSCs implantation will hopefully lead tobetter biocompatibility and host tissue integration.

ACKNOWLEDGMENTS

This research was supported by iPET (Korea Institute of Planningand Evaluation for Technology in Food, Agriculture, Forestry andFisheries), Ministry of Food, Agriculture, Forestry and Fisheries,Republic of Korea. This work was also supported by a grant fromthe Next-Generation BioGreen 21 program (No. PJ009627), RuralDevelopment Administration Republic of Korea.

REFERENCES

1. Sung JH,YangHM,Park JB, et al. Isolation andCharacterizationof Mouse Mesenchymal Stem Cells. Transplant Proc. 2008;40:2649.

2. Pittenger MF, Mackay AM, Beck SC. Multilineage potentialof adult human mesenchymal stem cells. Science. 1999;284:143.

3. Fraser JK, Wulur I, Alfonso Z, et al. Fat tissue: an underap-preciated source of stem cells for biotechnology. Trends Biotechnol.2006;24:150.

4. Amit NP, Jorge G. Potential clinical applications of adulthuman mesenchymal stem cell therapy. 2011;4:61.

5. Kalinina NI, Sysoeva VY, Rubina KA, et al. Mesenchymalstem cells in tissue growth and repair. Acta Naturae. 2011;3:30.

6. Zhu H, Guo ZK, Jiang XX, et al. A protocol for isolation andculture of mesenchymal stem cells from mouse compact bone. NatProtoc. 2010;5:550.

7. Ryoo HM, Hoffmann HM, Beumer T, et al. Stage-specificexpression of Dlx-5 during osteoblast differentiation: involvementin regulation of osteocalcin gene expression. Mol Endocrinol.1997;11:1681.

ADULT MSC EXPRESS OSTEOGENIC-SPECIFIC TRANSCRIPTS 3107

8. Cosman F, Lindsay R. Therapeutic potential of parathyroidhormone. Curr Osteoporos Rep. 2004;2:5.

9. Lindsay R, Zhou H, Cosman F, et al. Effects of a one-monthtreatment with PTH (1-34) on bone formation on cancellous,endocortical, and periosteal surfaces of the human ilium. J BoneMiner Res. 2007;22:495.

10. Reeve J, Meunier PJ, Parsons JA. Anabolic effect of humanparathyroid hormone fragment on trabecular bone in involutionalosteoporosis: a multicentre trial. BMJ. 1980;280:1340.

11. Tu Q, Valverde P, Li S, et al. Osterix over expression inmesenchymal stem cells stimulates healing of critical-sized defectsin murine calvarial bone. Tissue Eng. 2007;13:2431.

12. Zheng H, Guo Z, Ma Q, et al. Cbfa1/osf2 transduced bonemarrow stromal cells facilitate bone formation in vitro and in vivo.Calcif Tissue Int. 2003;74:194.

13. Foresta C, Strapazzon G, De Toni L, et al. Evidence forosteocalcin production by adipose tissue and its role in humanmetabolism. J Clin Endocrinol Metab. 2010;95:3502.