Molecular Responses to Cadmium in Roots of Pisum Sativum L

MOLECULAR RESPONSES TO CADMIUM IN ROOTSOF PISUM SATIVUM L.

FACUNDO RIVERA-BECERRIL1,2,∗, ASHRAF METWALLY3, FABRICEMARTIN-LAURENT4, DIEDERIK VAN TUINEN1, KARL-JOSEF DIETZ5,

SILVIO GIANINAZZI1 and VIVIENNE GIANINAZZI-PEARSON1

1UMR 1088 INRA/5184 CNRS/U. Bourgogne Plante-Microbe-Environnement, INRA-CMSE, BP86510, 21065 Dijon Cedex, France; 2Depto. El Hombre y su Ambiente, CBS, Universidad

Autonoma Metropolitana-Xochimilco, Calz. del Hueso 1100, Col. Villa Quietud, 04960 Mexico DF,Mexico; 3Botany Department, Faculty of Science, Assiut University, 71516 Assiut, Egypt; 4UMRA111 INRA/U. Bourgogne, Microbiologie et Geochimie des Sols, BP 86510, 21065 Dijon Cedex,

France; 5Department of Physiology and Biochemistry of Plants, University of Bielefeld,Universitatsstraβe 25, 33501 Bielefeld, Germany

(∗author for correspondence, e-mail: [email protected], Tel: +52-55-54837226,Fax: +52-55-54837469

(Received 31 March 2005; accepted 19 July 2005)

Abstract. Molecular responses to Cd were studied in roots of three pea genotypes (cv. Frisson,VIR4788, VIR7128) growing in a polluted substrate. Root and shoot fresh biomass was decreased byCd pollution in all genotypes. Gene expression profiling after one weeks’ exposure to Cd revealed thatgenes encoding stress-related proteins (heat-shock protein, pI206, chitinase, chalcone isomerase), ametallothionein, γ -glutamylcysteine synthetase and glutathione reductase were up-regulated in thepea genotypes. A glutathione synthetase gene was activated only in VIR4788 but a homoglutathionesynthetase gene was unaffected by Cd, and concomitantly glutathione/homoglutathione accumu-lation in plant roots did not change with Cd stress. However, the overall concentration of thiolgroups, which indicate the presence of phytochelatins and/or homophytochelatins, increased more than2-fold.

Keywords: cadmium, glutathione metabolism, pea, stress-related genes, thiols

1. Introduction

Cadmium (Cd) is recognised to be the heavy metal (HM) posing the most threatto agricultural food quality, due to its mobility in the soil-plant system and longbiological half-life (McLaughlin et al., 2000). Major inputs of Cd into agriculturalsoils come from soil amendments with municipal sewage sludges, atmospheric de-position (Wagner, 1993) and the application of phosphatic fertilizers (McLaughlinet al., 2000). Cd is naturally present in soils at concentrations of 0.1–0.5 mg kg−1

(Schutzendubel and Polle, 2002) but, in some polluted soils in Europe, it can reachup to 150 mg kg−1 (Wagner, 1993; Dubois et al., 2002; Schutzendubel and Polle,2002). These levels clearly exceed 2 mg kg−1, the maximum limit established(Blaylock and Huang, 2000; Dubois et al., 2002).

Water, Air, and Soil Pollution (2005) 168: 171–186 C© Springer 2005

172 F. RIVERA-BECERRIL ET AL.

The main basis of Cd toxicity in biological systems lies in its strong affinity forthiol groups (SH−) contained in cysteine residues of proteins (Wagner, 1993; Hall,2002), its ability to bind to oxygen, nitrogen and sulphur atoms (Schutzendubeland Polle, 2002), the generation of free radicals, resulting in oxidative stress (Dixitet al., 2001; Hall, 2002), and the competition for the adsorption sites between Cdand several mineral nutrients sharing similar chemical properties (Hernandez et al.,1996; Sanita di Toppi and Gabbrielli, 1999). Visual symptoms and physiologicaleffects of Cd stress are well documented in higher plants, especially those of agri-cultural importance like legumes and cereals (Das et al., 1997; Sanita di Toppi andGabbrielli, 1999), but there is a paucity of information about the molecular basesof such responses. Within this context, understanding the molecular mechanismsof HM tolerance and detoxification is an important goal towards developing plantsfor phytoremediation of contaminated soils (Cobbett, 2000).

Exposure to Cd can induce a series of parallel and/or consecutive events in plantcells (Sanita di Toppi and Gabbrielli, 1999) which include the synthesis of stress-related proteins, metallothioneins (MT), glutathione (GSH) and phytochelatins (PC)(Rauser, 1995; Hall, 2002). Heat-shock proteins (HSP) are a group of stress-relatedproteins where the HSP70 chaperone family has a strong affinity for misfoldedproteins affected by interactions with HM, and contributes to reestablishing theirnative conformation (Sanita di Toppi and Gabbrielli, 1999). Pathogenesis-related(PR) proteins and phytoalexins, elicited as part of the plant response to microbialand/or viral infection (Gianinazzi et al., 1970; Van Loon and Van Strien, 1999),have also been described to be related to stress response to HMs, including Cd(Hammerschmidt, 1999; Hensel et al., 1999; Repetto et al., 2003).

MT and PC are the two major HM-binding polypeptides in plant cells. MT aregene-encoded low molecular weight proteins (<10 kDa) with a large fraction ofcysteine residues (Kagi and Schaffer, 1988) and one MT, encoded by the PsMTA

gene, has been reported from pea (Evans et al., 1990). PC are small peptides (5to 23 amino acids) which are synthesized from glutathione (GSH) in a reactioncatalysed by a phytochelatin synthase (Grill et al., 1989). The pathway for GSHsynthesis involves two ATP-dependent steps (Matamoros et al., 1999): (i) a γ -glutamylcysteine (γ EC) is formed from glutamate and cysteine by the enzyme γ -glutamylcysteine synthetase that is encoded by the gene gsh1, and (ii) a glycine isadded to the C-terminal site of the γ EC by the enzyme GSH synthetase, encoded bythe gene gsh2. Glutathione reductase, an enzyme encoded by the gene gr, reducesglutathione disulphide (GSSG) to form two GSH (Stevens et al., 1997). Somelegumes, including pea, possess another thiol tripeptide, homoglutathione (hGSH),which partially or fully replaces GSH and is a precursor of homophytochelatins(hPC) (Moran et al., 2000). hGSH is synthesized from γ EC and β-alanine by aspecific hGSH synthetase, encoded by the gene hgsh2 (Moran et al., 2000).

Pea is one of the most important legume crops in Europe and it shows a highcapacity for Cd accumulation, principally in the roots (Rivera-Becerril et al., 2002;Belimov et al., 2003). In order to better understand the mechanisms by which pea

MOLECULAR RESPONSES TO CD IN PEA ROOTS 173

roots avoid Cd toxicity, molecular responses to Cd were analysed in three genotypes.Expression was monitored of four stress-related genes, a metallothionein-encodinggene and genes encoding for the enzymes involved in GSH and hGSH metabolism.Since presence of plant thiols above GSH/hGSH-level is recognized as an indica-tor of PC/hPC synthesis, accumulation of GSH/hGSH and thiol groups was alsoquantified in the pea roots.

2. Methods

2.1. PLANTS AND GROWTH CONDITIONS

Seeds of three Pisum sativum L. genotypes were used in this study: cv. Frisson(URLEG, INRA, Dijon), VIR4788 (from Mongolia) and VIR7128 (from Daghes-tan) (Vavilov’s Institute for Plant Industry, St. Petersburg).

2.1.1. Experiment 1Pea seeds were scarified, surface-disinfected and germinated as previously des-cribed (Rivera-Becerril et al., 2002). Five day-old seedlings were individuallytransplanted into ten pots containing 400 g of sand (Special Aquarium, Quartz,Nr. 3, Zolux, France), previously washed with water and autoclaved three timesfor 1 h at 121 ◦C in order to eliminate eventual parasites including resistant spores.Two weeks after transplanting, half the pots received CdCl2·2.5H2O in solutionto obtain 4 mg Cd kg−1 sand. This concentration was also selected consideringresults from previous studies to determine tolerance to Cd in a collection of peagenotypes exposed to different levels of the HM (Belimov et al., 2003). Pots wereplaced in a random design in a growth chamber (20–24 ◦C night/day, 16 h photope-riod, 330 µmol m−2 s−1, 70% relative humidity). Plants received 20 ml of LongAshton solution three times a week and Milli-Q water on other days. Five plantswere harvested one week after application of the Cd solution for each pea genotypeand treatment and root systems were thoroughly washed in running tap water, thendeionised water. Shoot and root samples were weighted fresh and stored in liquidnitrogen.

2.1.2. Experiment 2After surface-disinfection, pea seeds were germinated for three days in the dark, atroom temperature, on wet filter paper in Petri dishes. Seedlings were grown underhydroponic conditions for ten days in randomised polyethylene pots (four seedlingsper pot) containing 1.6 L of a nutrient solution composed of 1.5 mM KNO3, 0.7mM Ca(NO3)2, 0.5 mM MgSO4, 0.25 mM NH4H2PO4, 11.9 µM Fe(III)-tartrate,11.5 µM H3BO3, 1.25 µM MnSO4, 0.2 µM ZnSO4, 0.075 µM CuSO4, 0.025 µMMoO3. Cd was added as CdCl2 at a concentration of 5 µmol l−1 to half the pots. Thenutrient solution was aerated and replaced twice a week. Shoot and root samples of


ten plants per pea genotype and treatment were weighted fresh and stored in liquidnitrogen.

2.2. RNA EXTRACTION AND DNASE TREATMENT

Total RNA was extracted from roots of three week-old pea plants from Experiment1 (Franken and Gnadinger, 1994). Samples were treated with DNase by incubating50 µg RNA 30 min at 37 ◦C with 40 U RNase inhibitor (RNasine, RibonucleaseInhibitor, Promega), 3 U RNase-free DNase (RQ1 DNase, Promega), 6 µl 10×buffer and DEPC water to a final volume of 60 µl. The DNase was removed withone vol phenol/chloroform/isoamyl alcohol (25:24:1) and RNA was precipitatedovernight at –20 ◦C in 0.1 vol sodium acetate (3 M) and 2.5 vol ethanol (96%).After centrifuging down at 4 ◦C, the RNA pellet was washed with ethanol (70◦),centrifuged again, dried and resuspended in 10 µl DEPC water. Concentration of theDNA-free RNA was estimated by spectrometry and quality checked in denaturingagarose gels.

2.3. CDNA SYNTHESIS AND CLONING

DNA-free RNA (1 µg) was denatured 10 min at 65 ◦C, placed on ice for 5 min andreverse transcribed to first strand cDNA in a 25 µl volume reaction for 15 min at25 ◦C, followed by 1 h at 37 ◦C, and 2 min at 95 ◦C, in presence of 200 U reversetranscriptase (Reverse Transcriptase M-MLV RNase H−, Promega), 80 U RNaseinhibitor (RNasine, Ribonuclease Inhibitor, Promega), 2.5 µM dNTPs, 0.75 µgoligo(dT)15 primer (Promega), with the buffer recommended by the enzyme sup-plier. cDNA was stored at −20 ◦C until use.

One µl cDNA was used as template for PCR in a final volume of 20 µl containing100 µM dNTPs, 1X PCR buffer (Gibco-BRL, USA), 2.5 mM MgCl2, 0.25 U TaqDNA polymerase (Gibco-BRL, USA) and 0.5 µM specific primers, deduced fromavailable sequences for pea genes encoding β-tubulin (X54845), HSP70 (L03299),γ -glutamylcysteine synthetase (AF128455), glutathione synthetase (AF231137),homoglutathione synthetase (AF258319), glutathione reductase (X98274), andPsMTA (Z23097) (Table I). Primers used for the last gene have the same affi-nity for a very recently described metallothionein isoform (AB176564). PCR wasperformed in a T3 Thermocycler (Biometra) with the following parameters: initialdenaturation at 95 ◦C for 3 min, 30 cycles of denaturation at 95 ◦C for 45 s, annea-ling at respective temperature (64 ◦C for cht or 62 ◦C for the other genes) for 45 s,elongation at 72 ◦C for 45 s, and a final elongation at 72 ◦C for 5 min.

Amplified cDNA fragments were extracted by Geneclean (Bio 101, Vista, USA),ligated to pGEM-T vector (Promega) and used to transform competent Escherichiacoli JM109 cells (Promega). Recombinant clones were screened by PCR (Gussovand Clackson, 1989), subcultured and plasmid DNA was isolated (Sambrook et al.,1989). Sequencing was performed using T7 and SP6 primers (Genome Express


TABLE I

Primers used in real-time RT-PCR experiments

Gene Primers (5′-3′) Expected size (bp)

β-tub for CAACGAAGCTAGCTGTGGTCG

rev AGTAAGCATCATCCTATCAGG 348

pI206 for GCACTCATCATCAAGGAACC

rev GAAATCTCCAGTACCACCAG 97

cht for GATGGACGGTGTGCTGGTC

rev CACGCGTATGGACCGTCTG 190

chi for ATGAGTTCCCAGCGGTGGTTAC

rev CCTTCCCATTTAGTGGCAAGAG 168

hsp70 for GGTTACTGTGCCTGCTTAC

rev CCTCGAGCACTGAGACATC 202

PsMTA for GTCTAGTGGATTGAGCTACTC

rev GGGTCACAAGTGCAGTTATC 152

gsh1 for GGTTTCCAGCCAAAGTGGGAG

rev GCTTCAGAACTAAAGTCCAG 160

gsh2 for TCCTGGTGTTGGATTGGTTC

rev TCCTGGAGAGAGATTCCTGAAG 160

hgsh2 for GATCAGCATTTTGTTTCCGC

rev GTTCCATCCGATAGAATTTCTC 109

gr for CGGTTGTTATCCAATGCTGG

rev TATTAGGACGCTGAGCCCTG 159

Company, Grenoble, France or MWG, Ebersberg, Germany). Sequence identitywas confirmed by similarity searches in the EMBL database using the BLASTN2.2.4 program (Altschul et al., 1997; www.ncbi.nlm.nih.gov). cDNA fragmentspreviously cloned into PT7 Blue plasmid (Ruiz-Lozano et al., 1999) were used forpI206, cht and a chi genes.

2.4. QUANTIFICATION OF GENE EXPRESSION

Recombinant plasmids extracted from transformed E. coli cells were serially dilutedfrom 107 to 101 copies to establish a standard curve for each target gene. 2.5 µlaliquot from each dilution were used as template in 25µl final volume PCR reactionsusing 1.2 µl 10 µM of corresponding primer (Table I), enzyme and buffer providedin the SmartTM Kit for SybrTM Green I (Eurogentec), as recommended by thesupplier. PCR was carried out in a Smart Cycler (Cepheid R©): one cycle at 95 ◦Cfor 12 min, 40 cycles at 95 ◦C for 15 s, 64 ◦C for cht or 62 ◦C for the other genesfor 15 s and 72 ◦C for 15 s, followed by one cycle at 60 ◦C for 95 s. Melting curveswere realized by increasing the temperature from 60 ◦C to 90 ◦C at 0.2 ◦C s−1 steps,


in order to verify the purity of the real-time RT-PCR products (Devers et al., 2004).Calibration curves representing the log of the concentration of the target gene infunction of cycle threshold were obtained for each gene.

RT-PCR reactions were carried out on cDNA from three replicate root systemsper genotype and treatment, in a 25 µl final volume containing as template 1 µl four-fold diluted cDNA under the same conditions as described above. Cycle thresholdwas transformed to absolute quantification using the equations from the respectivecalibration curves.

2.5. THIOL GROUP AND GLUTATHIONE/HOMOGLUTATHIONE MEASUREMENTS

Accumulation of thiol groups and GSH/hGSH was quantified in ten replicate rootsystems per pea genotype and treatment from Experiment 2 as described by Noctorand Foyer (1998) and Griffith (1980), respectively. This method does not discrimi-nate between GSH and hGSH. Briefly, plant roots (100 mg fresh weight) were ho-mogenized in 0.1 M HCl containing l mM EDTA and the homogenate centrifuged(12000 rpm, 5 min). For thiol groups, the supernatant (200 µl) was mixed with700 µl assay buffer containing 120 mM Na phosphate, pH 7.8, 6 mM EDTA, andabsorbance (412 nm) was measured following the addition of 100 µl of 6 mM 5′-dithiobis-2-nitrobencoic acid (DTNB) to the sample. Thiol group concentration wascalculated against a standard curve for GSH. Concentration of GSH/hGSH was de-termined in an assay based on oxidation then reduction of GSH. GSH was oxidisedin a mixture of 120 mM phosphate buffer, pH 7.8, 6 mM EDTA, 0.3 mM NADPH, 3mM DTNB and sample extract (Fadzilla et al., 1997). Reduction of oxidized GSHwas initiated by addition of 10 µl glutathione reductase (5 U ml−1) and changein absorbance was recorded at 412 nm. GSH/hGSH concentrations were deducedfrom a standard curve for reduction of different concentrations of oxidized GSH.

2.6. STATISTICAL ANALYSES

The Student-Newman-Keuls test (P ≤ 0.05) was used to evaluate differences be-tween means of treatments using the SAS statistical software package (SAS, 1986).

3. Results

3.1. PLANT GROWTH

The three pea genotypes (cv. Frisson, VIR4788, VIR7128) growing in presence ofCd presented typical symptoms of Cd-toxicity (chlorosis, decrease in turgor, leafdesiccation). Root and shoot fresh weight was significantly (P ≤ 0.05) decreasedby Cd stress as compared to control plants (Expt. 1, Figure 1A, B). Reductions inroot and shoot fresh weight were similarly observed in the hydroponically grown


Figure 1. Biomass (g root and shoot fresh weight) of pea genotypes (cv. Frisson, VIR4788, VIR7128).(A) Roots and (B) shoots of three week-old pea plants grown in the absence (�) or presence (�) of4 mg Cd kg−1sand substrate (average ± SE of five plants). (C) Roots and (D) shoots of ten day-old peaplants grown under hydroponic conditions in absence (�) or presence (�) of 5 µmol Cd l−1 (average± SE of ten plants).

plants in the presence of Cd (Expt. 2, Figure 1C, D). Roots became fragile as aresult of direct contact with the pollutant.

3.2. GENE EXPRESSION IN CD-TREATED PLANTS

Figure 2A illustrates, for each gene studied, the range of absolute transcript numbersin roots of the pea genotypes growing in presence and absence of Cd. The PsMTA

gene encoding a MT exhibited the highest expression (>109 copies µg−1 total RNA)followed by the β-tub gene (>108 copies). The genes chi, gsh1 and gr reached 108

copies, whilst the pI206 and hgsh2 genes were between 107 and 108 copies. Genesshowing the lowest levels of expression were cht, hsp70 and gsh2.

In order to evaluate the relative level of expression of each gene, transcript num-ber was normalised against that for β-tub, a constitutive gene previously used asstandard control for study of MT-encoding genes expression in Arabidopsis thaliana


growing in presence of copper (Murphy and Taiz, 1995), and which showed nosignificant variation between pea genotypes and treatments (average 11.6 ± 1.6 ×107 copies). Results showed that after one week of exposure to Cd, all three genesencoding the stress-related proteins pI206, chitinase and chalcone isomerase wereclearly activated by Cd in the three pea genotypes, and cv. Frisson consistently pre-sented the highest transcript levels (Figure 2B, C, D). Expression of pI206 increased22.3 and 19.7-fold in cv. Frisson and VIR4788, respectively, and only 7.7-fold inVIR7128. The cht gene was significantly (P ≤ 0.05) activated almost 12-fold in cv.Frisson exposed to Cd, but only 1.4 and 2.4-fold in VIR4788 and VIR7128, respec-tively. Finally, chi was activated in all three genotypes and significantly (P ≤ 0.05)in cv. Frisson and VIR7128. Expression of hsp70 was increased between 40 and79% by Cd treatment in the roots of the pea genotypes (Figure 2E). The PsMTA

gene showed the greatest response to Cd and was the most strongly (P ≤ 0.05)expressed gene in Cd-treated roots of the pea genotypes: +165% in cv. Frisson,+274% in VIR4788 and +78% in VIR7128 (Figure 2F). As for pI206, cht andchi, highest expression of the PsMTA gene was observed in Cd-treated cv. Frisson.

Genes involved in GSH metabolism were also up-regulated in roots of pea plantsexposed to Cd stress. Transcripts of gsh1 encoding γ -glytamylcysteine synthetase,the first enzyme in GSH synthesis, significantly (P ≤ 0.05) increased from 50 to 76%in all the three pea genotypes (Figure 2G). In contrast, increases in transcript levelsof gsh2, encoding glutathione synthetase, only occurred significantly (P ≤ 0.05)in Cd-treated VIR4788 (4.3-fold) (Figure 2H). The hgsh2 gene was not activatedby Cd in any of the pea genotypes and constitutive transcript levels were lowest inthe VIR4788 genotype (Figure 2I). The gr gene was activated by Cd pollution tosimilar levels (from 104 to 134%) in the three pea genotypes (Figure 2J).

3.3. GLUTATHIONE/HOMOGLUTATHIONE AND THIOL GROUP

CONCENTRATIONS IN PEA TISSUES

When the three pea genotypes were grown in presence of Cd under hydroponicconditions (Expt. 2), root GSH/hGSH levels (from 0.46 to 0.64 nmol mg−1 fresh

Figure 2. Expression profiles of genes in roots of three-week-old pea genotypes (cv. Frisson, VIR4788,VIR7128) estimated by real-time RT-PCR: PsMTA (metallothionein), β-tub (β-tubulin), chi (chal-cone isomerase), gsh1 (γ -glutamylcysteine synthetase), gr (glutathione reductase), pI206 (pI206),hgsh2 (homoglutathione synthetase), cht (chitinase), hsp70 (heat-shock protein), gsh2 (glutathionesynthetase). (A) Range of absolute transcript numbers (copies µg−1 total RNA) in roots grown inpresence and absence of Cd. Results are presented as a bar spreading from the highest to the lowestamounts observed. They are organized in descending order from the gene presenting the highest level(PsMTA) to the gene presenting the lowest level (gsh2). (B–J) Relative transcript levels of the differentgenes in roots of pea plants grown in absence (�) or presence (�) of 4 mg Cd kg−1 (average ± SE ofthree plants).


Figure 3. Accumulation of glutathione/homogluathione (A) and thiol groups (B) in roots of three peagenotypes (cv. Frisson, VIR4788, VIR7128) grown under hydroponic conditions in absence (�) orpresence (�) of 5 µmol Cd l−1 (average ± SE of ten plants).

weight) were not modified in the HM-treated plants (Figure 3A). However, con-centrations of thiol groups indicative of PC and/or hGSH synthesis significantly(P ≤ 0.05) increased more than 100% in roots of the pea plants (+138%, cv. Fris-son; +142% VIR4788; +172%, VIR7128) treated with Cd. Overall levels of thiolgroup accumulation in Cd-stressed plants was greatest in the VIR4788 genotypeand least in VIR7128 (Figure 3).

4. Discussion

The pea genotypes cv. Frisson, VIR4788 and VIR7128 showed stunted growthand typical toxicity symptoms when exposed to Cd, as reported previously


(Rivera-Becerril et al., 2002; Belimov et al., 2003; Repetto et al., 2003). Negative ef-fects of Cd have been reported to be associated with the inhibition of enzyme activi-ties, protein denaturation, reductions in photosynthesis and decreases in chlorophylland carotenoid content in shoots of pea (Hernandez et al., 1996; Rivera-Becerrilet al., 2002). The present work demonstrates that the HM also affects gene expres-sion in the roots of pea, that is where HM accumulation principally occurs in thislegume (Hernandez et al., 1996; Rivera-Becerril et al., 2002; Belimov et al., 2003).

Cd induced overexpression in the pea roots of genes encoding the stress-relatedproteins chitinase, pI206, chalcone isomerase and HSP70. Except for HSP70, thisresponse was always greatest in cv. Frisson. Recent proteome analysis of VIR4788roots also showed a Cd-induced increase in levels of the protein pI49, which belongsto the same gene family as pI206 (Repetto et al., 2003). Chitinase and pI206 fall intothe category of PR proteins. Although PR proteins are typical of plant responsesto microbial or viral infection (Gianinazzi et al., 1970; Van Loon and Van Strien,1999), they are also elicited by HM. For example, synthesis of the protein CBP20(PR-4) was induced in tobacco exposed to Zn (Hensel et al., 1999), and a increasedactivity of chitinases was reported in A. thaliana subjected to Pb (Lummerzheimet al., 1995). PR proteins are often transported into the intercellular spaces of planttissues (Van Loon and Gerritsen, 1989), and it seems likely that any stress factorthat disrupts the integrity of the plasma membrane, including HM, could lead tosynthesis of these proteins (Cruz-Ortega and Ownby, 1993). Synthesis of PR pro-teins may also protect roots from invasion by pathogen during periods associatedwith HM stress (Cruz-Ortega and Ownby, 1993). Production of isoflavonoid phy-toalexins is not only stimulated in many plant-pathogen interactions, but also byabiotic agents (Hammerschmidt, 1999). This is in line with the activation by Cd ofthe chi gene, which encodes a chalcone isomerase, in roots of the pea genotypesand of a phenylalanine ammonia-lyase gene in wheat roots (Snowden et al., 1995).

Cd can alter plasma membrane integrity via distorsion of proteins (Fodor et al.,1995). HSP70, which has been reported to increase in leaves and roots as a responseto HM-stress (Neumann et al., 1994; Hall, 2002), binds to denatured proteins andaids in the establishment of their native configuration and their reintegration into themembrane complex (Sanita di Toppi and Gabbrielli, 1999). The increase in hsp70transcripts observed in the present work in pea roots after exposition to Cd mayreflect synthesis of HSP under the HM-stress, a mechanism that has been proposed tocontribute to HM-tolerance in other plants (Wollgiehn and Neumann, 1999). In cellcultures of Lycopersicon peruvianum subjected to Cd, for example, considerableamounts of HSP70 were bound to membranes which could be indicative of theformation of complexes of Cd-denatured proteins (Neumann et al., 1994).

Greatest levels of transcript accumulation were observed for the PsMTA genein the roots of pea exposed to Cd. Earlier observations have indicated that PsMTA

transcripts are highly abundant even in pea roots which have not been exposed tohigh concentrations of HM (Evans et al., 1990). This is consistent with MT beingone of the major types of cysteine-rich metal binding peptides in organisms (Cobbett


and Goldsbrough, 2000; Hall, 2002), and suggests that they play an important role inHM homeostasis in pea roots. In A. thaliana, it was proposed that MTs are involvedin chaperoning excess metals in mesophyll cells and root tips (Guo et al., 2003).

The central role of GSH in protecting plants against HM is widely recognized(Xiang and Oliver, 1998; Matamoros et al., 1999). GSH is the precursor of PCpolypeptides, which chelate Cd in the cytoplasm to sequester it into the vacuole,and the genes gsh1, gsh2 and gr code for enzymes involved in pathways leadingto GSH synthesis. In this context, the gsh1 and gr genes were up-regulated byCd in roots of all three pea genotypes whilst activation of gsh2 gene was onlyobserved in the genotype VIR4788. Activation by Cd of one or the other genehas also been reported in Brassica juncea roots, in A. thaliana roots and shoots,and in poplar shoots (Schafer et al., 1998; Xiang and Oliver, 1998; Zhu et al.,1999b). Likewise, increased γ -glutamylcysteine synthetase activity (encoded bygsh1) occurs in roots and shoots of maize seedlings exposed to Cd (Ruegseggerand Brunold, 1992), and increased glutathione synthetase activity (encoded bygsh2) has been reported in roots of another pea genotype (Ruegsegger et al., 1990).Induction of glutathione reductase (encoded by gr) has been suggested to providedefence against oxidative damage imposed by HM (Dixit et al., 2001), highertolerance to Cd stress in chloroplasts, and decreased Cd accumulation in shoots(Pilon-Smits et al., 2000). In legumes, synthesis of hGSH has also been implicatedin plant responses to HM through the activity of a homoglutathione synthetaseencoded by hgsh2, reported as being preferentially expressed in roots and nodulesof M. truncatula (Klapheck, 1988; Frendo et al., 1999, 2001). The present studyshows that hgsh2 is also expressed in roots of pea, as previously reported (Moranet al., 2000), but the gene is not activated by Cd in any of the genotypes and, as forgsh2, overall transcript accumulation is low.

Alterations in the expression of gsh1, gsh2 or gr can be expected to affect GSHand/or PC levels (Howden et al., 1995; Zhu et al., 1999a,b). In plant tissues, Cdis considered a strong inducer of PC/hPC synthesis (Cobbett and Goldsbrough,2000) and the presence of thiol groups above GSH/hGSH levels is recognized as anindicator of PC accumulation (Ruegsegger et al., 1990; Brune et al., 1995). Roottissues of the pea genotypes exposed to Cd accumulated much higher levels ofthiol groups (+138–172%) than controls, suggesting potential Cd chelation by PCand/or hPC in their roots. Detailed characterisation of pea GSH, hGSH, MT, PCand hPC, by HPLC and mass spectrometry could help to better understand theirrole in Cd sequestration in roots.

5. Conclusions

Cd triggers a cascade of events in roots of pea which results in the increased expres-sion of genes belonging to metabolic pathways including stress-related responses(pI206, cht, chi, hsp70), metallothionein (PsMTA) and glutathione synthesis (gsh1,


gsh2, gr). The variation observed in the extent of these molecular responses inthe three pea genotypes studied here does not appear to be related to their previ-ously reported variation in tolerance or sensitivity to Cd pollution (Rivera-Becerrilet al., 2002; Belimov et al., 2003). Metwally et al. (2005) recently reported thatCd-sensitivity of pea genotypes may be more related to relative increases in malon-dialdehyde concentration as well as chitinase and peroxidase activities.Finally,since roots of cv. Frisson consistently respond to Cd by increased expression ofstress-related genes (pI206, cht, chi) and of the MT-encoding gene (PsMTA), thispea genotype could be an appropriate plant model for monitoring in systems of Cdpollution.

Acknowledgements

This research was performed within the framework of a European Union-RTDINCO-Copernicus project (IC15-CT 98-0116). We would like to thank G. Duc(INRA, Dijon, France) for providing seeds of cv. Frisson, A. Borisov (ARRIAM, St.Petersburg, Russia) for donation of VIR4788 and VIR7128 seeds, and P. Franken(Max-Planck Institut, Marburg, Germany) for the β-tub primers. O. Chatagnieris acknowledged for technical assistance. F. Rivera-Becerril was supported by afellowship from the CONACyT-SFERE (Mexico-France) programme (Promotion,1998).

References

Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W. and Lipman, D. J.:1997, ‘Gapped BLAST and PSI-BLAST: A new generation of protein database search programs’,Nucleic Acids Res. 25, 3389–3402.

Belimov, A. A., Safronova, V. I., Tsyganov, V. E., Borisov, A. Y., Kozhemyakov, A. P., Stepanok, V.V., Martenson, A. M., Gianinazzi-Pearson, V. and Tikhonovich, I. A.: 2003, ‘Genetic variabilityin tolerance to cadmium and accumulation of heavy metals in pea (Pisum sativum L.)’, Euphytica131, 25–35.

Blaylock, M. J. and Huang, J. W.: 2000, ‘Phytoextraction of metals’, in I. Raskin and B. D. Ensley(eds), Phytoremediation of Toxic Metals: Using Plants to Clean up the Environment, John Wiley& Sons, London, pp. 53–70.

Brune, A., Urbach, W. and Dietz, K.-J.: 1995, ‘Differential toxicity of heavy metals is partly relatedto a loss of preferential extraplasmic compartmentation: a comparison of Cd-, Mo-, Ni- andZn-stress’, New Phytol. 129, 403–409.

Cobbett, C. S.: 2000, ‘Phytochelatins and their roles in heavy metal detoxification’, Plant Physiol.123, 825–832.

Cobbett, C. S. and Goldsbrough, P. B.: 2000, ‘Mechanisms of metal resistance: phytochelatins andmetallothioneins’, in I. Raskin and B. D. Ensley (eds.), Phytoremediation of Toxic Metals: UsingPlants to Clean up the Environment, John Wiley & Sons, London, pp. 247–269.

Cruz-Ortega, R. and Ownby, J. D.: 1993, ‘A protein similar to PR (pathogenesis-related) proteins iselicited by metal toxicity in wheat roots’, Physiol. Plant. 89, 211–219.


Das, P., Samantaray, S. and Rout, G. R.: 1997, ‘Studies on cadmium toxicity in plants: A review’,Environ. Pollut. 98, 29–36.

Devers, M., Soulas, G. and Martin-Laurent, F.: 2004, ‘Real-time reverse transcription PCR analysis ofexpression of atrazine catabolism genes in two bacterial strains isolated from soil’, J. Microbiol.Meth. 56, 3–15.

Dixit, V., Pandey, V. and Shyam, R.: 2001, ‘Differential antioxidative responses to cadmium in rootsand leaves of pea (Pisum sativum L. cv. Azad)’, J. Exp. Bot. 52, 1101–1109.

Dubois, J. P., Benitez, N., Liebig, T., Baudraz, M. and Okopnik, F.: 2002, ‘Le cadmium dans les solsdu haut Jura suisses’, in D. Baize and M. Terce (eds.), Les Elements Traces Metalliques Dans lesSols. Approches Fonctionnelles et Spatiales, INRA Editions, Paris, pp. 33–52.

Evans, I. M., Gatehouse, L. N., Gatehouse, J. A., Robinson, N. J. and Croy, R. R. D.: 1990, ‘A genefrom pea (Pisum sativum L.) with homology to metallothionein genes’, FEBS Lett. 262, 29–32.

Fadzilla, N. M., Finch, R. P. and Burdon, R. H.: 1997, ‘Salinity, oxidative stress and antioxidantresponses in shoot cultures of rice’, J. Exp. Bot. 48, 325–331.

Fodor, E., Szabo-Nagy, A. and Laszlo, E.: 1995, ‘The effects of cadmium on the fluidity and H+-ATPase activity of plasma membrane from sunflower and wheat roots’, J. Plant Physiol. 147,87–92.

Franken, F. and Gnadinger, F.: 1994, ‘Analysis of parsley arbuscular endomycorrhiza: Infection de-velopment and mRNA levels of defense-related genes’, Mol. Plant-Microbe Int. 7, 612–620.

Frendo, P., Gallesi, D., Turnbull, R., van de Sype, G., Herouart, D. and Puppo, A.: 1999, ‘Locali-sation of glutathione and homoglutathione in Medicago truncatula is correlated to a differentialexpression of genes involved in their synthesis’, Plant J. 17, 215–219.

Frendo, P., Hernandez-Jimenez, M. J., Mathieu, C., Duret, L., Gallesi, D., Van de Sype, G., Herouart,D. and Puppo, A.: 2001, ‘A Medicago truncatula homoglutathione synthetase is derived fromglutathione synthetase by gene duplication’, Plant Physiol. 126, 1706–1715.

Gianinazzi, S., Martin, C. and Vallee, J. C.: 1970, ‘Hypersensitivite aux virus, temperature et proteinessolubles chez le Nicotina xanthi n.c. Apparition de nouvelles macromolecules lors de la repressionde la synthese virale’, C. R. Acad. Sc. Paris 270, 2383–2386.

Griffith, O. W.: 1980, ‘Determination of glutathione and glutathione disulfide using glutathione re-ductase and 2-vinylpyridine’, Anal. Biochem. 106, 207–212.

Grill, E., Loffler, S., Winnacker, E.-L. and Zenk, M. H.: 1989, ‘Phytochelatins, the heavy-metal-binding peptides of plants, are synthesized from glutathione by a specific γ -glutamylcysteinedipeptidyl transpeptidase (phytochelatin synthase)’, Proc. Natl. Acad. Sci. USA 86, 6838–6842.

Guo, W.-J., Bundithya, W. and Goldsbrough, P. B.: 2003, ‘Characterization of the Arabidopsis metal-lothionein gene family: tissue-specific expression and induction during senescence and in responseto copper’, New Phytol. 159, 369–382.

Gussov, D. and Clackson, T.: 1989, ‘Direct clone characterization from plaques and colonies by thepolymerase chain reaction’, Nucleic Acids Res. 17, 4000.

Hall, J. L.: 2002, ‘Cellular mechanisms for heavy metal detoxification and tolerance’, J. Exp. Bot. 53,1–11.

Hammerschmidt, R.: 1999, ‘Phytoalexins: what have we learned after 60 years?’, Annu. Rev. Phy-topathol. 37, 285–306.

Hensel, G., Kunze, G. and Kunze, I.: 1999, ‘Expression of the tobacco gene CBP20 in response todevelopmental stage, wounding, salicylic acid and heavy metals’, Plant Sci. 148, 165–174.

Hernandez, L. E., Carpena-Ruiz, R. and Garate, A.: 1996, ‘Alterations in the mineral nutrition of peaseedlings exposed to cadmium’, J. Plant Nutr. 19, 1581–1598.

Howden, R., Andersen, C. R., Goldsbrough, P. B. and Cobbett, C. S.: 1995, ‘A cadmium sensitive,glutathione-deficient mutant of Arabidopsis thaliana’, Plant Physiol. 107, 1067–1073.

Kagi, J. H. R. and Schaffer, A.: 1988, ‘Biochemistry of metallothionein’, Biochemistry 27, 8509–8515.


Klapheck, S.: 1988, ‘Homoglutathione: Isolation, quantification and ocurrence in legumes’, Physiol.Plant. 74, 727–732.

Lummerzheim, M., Sandroni, M., Castresana, C., Oliveira, D., de Montagu, M., van Roby, D. andTimmerman, B.: 1995, ‘Comparative microscopic and enzymatic characterization of the leafnecrosis induced in Arabidopsis thaliana by lead nitrate and by Xanthomonas campestris pv.campestris after foliar spray’, Plant Cell Environ. 18, 499–509.

Matamoros, M. A., Moran, J. F., Iturbe-Ormaetxe, I., Rubio, M. C. and Becana, M.: 1999, ‘Glutathioneand homoglutathione synthesis in legume root nodules’, Plant Physiol. 121, 879–888.

McLaughlin, M. J., Bell, M. J., Wright, G. C. and Cozens, G. D.: 2000, ‘Uptake and partitioning ofcadmium by cultivars of peanut (Arachis hypogaea L.)’, Plant Soil 222, 51–58.

Metwally, A., Safronova, V. I., Belimov, A. A. and Dietz, K.-J.: 2005, ‘Genotypic variation of theresponse to cadmium toxicity in Pisum sativum L’, J. Exp. Bot. 56, 167–178.

Moran, J. F., Iturbe-Ormaetxe, I., Matamoros, M. A., Rubio, M. C., Clemente, M. R., Brewin, N. J. andBecana, M.: 2000, ‘Glutathione and homoglutathione synthetases of legume nodules. Cloning,expression, and subcellular localization’, Plant Physiol. 124, 1381–1392.

Murphy, A. and Taiz, L.: 1995, ‘Comparison of metallothionein gene expression and nonprotein thiolsin ten Arabidopsis ecotypes. Correlation with copper tolerance’, Plant Physiol. 109, 945–954.

Neumann, D., Lichtenberger, O., Gunther, D., Tschiersch, K. and Nover, L.: 1994, ‘Heat-shockproteins induce heavy-metal tolerance in higher plants’, Planta 194, 360–367.

Noctor, G. and Foyer, C. H.: 1998, ‘Simultaneous measurement of foliar glutathione, γ -glutamylcysteine, and amino acids by high-performance liquid chromatography: comparison withtwo other assay methods for glutathione’, Anal. Biochem. 264, 98–110.

Pilon-Smits, E. A. H., Zhu, Y. L., Sears, T. and Terry, N.: 2000, ‘Overexpression of glutathionereductase in Brassica juncea: effects on cadmium accumulation and tolerance’, Physiol. Plant.110, 455–460.

Rauser, W. E.: 1995, ‘Phytochelatins and related peptides. Structure, biosynthesis and function’, PlantPhysiol. 109, 1141–1149.

Repetto, O., Bestel-Corre, G., Dumas-Gaudot, E., Berta, G., Gianinazzi-Pearson, V. and Gianinazzi,S.: 2003, ‘Targeted proteomics to identify cadmium-induced protein modifications in Glomusmosseae-inoculated pea roots’, New Phytol. 157, 555–567.

Rivera-Becerril, F., Calantzis, C., Turnau, K., Caussanel, J.-P., Belimov, A. A., Gianinazzi, S., Strasser,R. J. and Gianinazzi-Pearson, V.: 2002, ‘Cadmium accumulation and buffering of cadmium-induced stress by arbuscular mycorrhiza in three Pisum sativum L. genotypes’, J. Exp. Bot. 53,1177–1185.

Ruegsegger, A. and Brunold, C.: 1992, ‘Effect of cadmium on γ -glutamylcysteine synthesis in maizeseedlings’, Plant Physiol. 99, 428–433.

Ruegsegger, A., Schmutz, D. and Brunold, C.: 1990, ‘Regulation of glutathione synthesis by cadmiumin Pisum sativum L’, Plant Physiol. 93, 1579–1584.

Ruiz-Lozano, J. M., Roussel, H., Gianinazzi, S. and Gianinazzi-Pearson, V.: 1999, ‘Defence genesare differentially induced by a mycorrhizal fungus and Rhizobium in wild type and symbiosis-defective pea genotypes’, Mol. Plant-Microbe Int. 12, 976–984.

Sambrook, J., Fritsch, E. F. and Maniatis, T.: 1989, Molecular Cloning: A Laboratory Manual, ColdSpring Harbor Laboratory Press, New York.

Sanita di Toppi, L. and Gabbrielli, R.: 1999, ‘Response to cadmium in higher plants’, Environ. Exp.Bot. 41, 105–130.

SAS Institute Inc.: 1986, Introductory guide for personal computers, SAS Institute Inc, Cary.Schafer, H. J., Haag-Kerwer, A. and Rausch, T.: 1998, ‘cDNA cloning and expression analysis of genes

encoding GSH synthesis in roots of the heavy-metal accumulator Brassica juncea L.: evidencefor Cd-induction of a putative mitochondrial γ -glutamylcysteine synthetase isoform’, Plant Mol.Biol. 37, 87–97.


Schutzendubel, A. and Polle, A.: 2002, ‘Plant responses to abiotic stresses: heavy metal-inducedoxidative stress and protection by mycorrhization’, J. Exp. Bot. 53, 1351–1365.

Snowden, K. C., Richards, K. D. and Gardner, R. C.: 1995, ‘Aluminium-induced genes: induction bytoxic metals, low calcium, and wounding and pattern of expression in root tips’, Plant Physiol.107, 341–348.

Stevens, R. G., Creissen, G. P. and Mullineaux, P. M.: 1997, ‘Cloning and characterisation of acytosolic glutathione reductase cDNA from pea (Pisum sativum L.) and its expression in responseto stress’, Plant Mol. Biol. 35, 641–654.

Van Loon, L. C. and Gerritsen, Y. A. M.: 1989, ‘Localization of pathogenesis-related proteins ininfected and non-infected leaves of Samsun NN tobacco during the hypersensitive reaction totobacco mosaic virus’, Plant Sci. 63, 131–140.

Van Loon, L. C. and Van Strien, E. A.: 1999, ‘The families of pathogenesis-related proteins, theiractitivies, and comparative analysis of PR-1 type proteins’, Physiol. Mol. Plant Pathol. 63, 85–97.

Wagner, G. J.: 1993, ‘Accumulation of cadmium in crop plants and its consequences to human health’,Adv. Agron. 51, 173–212.

Wollgiehn, R. and Neumann, D.: 1999, ‘Metal stress response and tolerance of cultured cells fromSilene vulgaris and Lycopersicon peruvianum: role of heat stress proteins’, J. Plant Physiol. 154,547–553.

Xiang, C. and Oliver, D. J.: 1998, ‘Glutathione metabolic genes coordinately respond to heavy metalsand jasmonic acid in Arabidopsis’, Plant Cell 10, 1539–1550.

Zhu, Y. L., Pilon-Smits, E. A. H., Jouanin, L. and Terry, N.: 1999a, ‘Overexpression of glutathionesynthetase in indian mustard enhances cadmium accumulation and tolerance’, Plant Physiol. 119,73–79.

Zhu, Y. L., Pilon-Smits, E. A. H., Tarun, A. S., Weber, S. U., Jouanin, L. and Terry, N.: 1999b,‘Cadmium tolerance and accumulation in indian mustard is enhanced by overexpressing γ -glutamylcysteine synthetase’, Plant Physiol. 121, 1169–1177.

Molecular Responses to Cadmium in Roots of Pisum Sativum L

Documents

Transcript of Molecular Responses to Cadmium in Roots of Pisum Sativum L