Cadmium Contaminated SoilAffects Retinogenesis inLizard EmbryosPALMA SIMONIELLO1,2,FRANCESCA TRINCHELLA1,SILVANA FILOSA1, ROSARIA SCUDIERO1,DARIO MAGNANI3, THOMAS THEIL3,AND CHIARA MARIA MOTTA1*1Department of Biology, University Federico II, Napoli, Italy2Department of Biophysics, GSI Helmholtz Center for Heavy Ion Research, Darmstadt, Germany3Centre for Integrative Physiology, The University of Edinburgh, Edinburgh, United Kingdom

Podarcis sicula is the most abundant lizard species present insouthern Italy. As prey for many small mammals and birds, it fillsan important role also as soil top predator contributing, in severalareas, to the control of agricultural pests. Able to adapt to differentenvironmental conditions, including crowded urban areas, sincenow P. sicula has coped quite well with the loss and reduction ofhabitats due to natural or anthropic causes. From 2013, however, ithas been inserted in the IUCN red list as species deserving a leastconcern (LC). Several natural populations, in fact, are potentially

ABSTRACT Lizards are soil surface animals that represent an important link between invertebrates and higherpredators. Being part of wild fauna, they can be affected by contamination from anthropic activitiesand in particular, pesticides and chemical substances of various nature that reach the soil surfacedirectly or through fall out. Among these substances, heavy metals such as cadmium may exertparticularly marked toxic effect on both adult and embryos. In lizards, recent studies show thatcadmium may cause developmental defects, including alteration of eye development, withappearance of unilateral microphthalmia and retinal folding. In the present study, the effects ofcadmium incubation on retinal development were investigated demonstrating that cadmiuminterferes with cell cycle regulation by increasing proliferation. An increased expression of Otx2 andPax6 genes, markers of retinal differentiation, was also found. However, the cellular localization ofPax6 and Otx2 transcripts did not change in treated embryos: in the early stages of retinogenesis,the two genes were expressed in all retinal cells; in the differentiated retina, Otx2 remained in thecellular bodies of retinal cells forming the nuclear and the ganglion layers, whereas Pax6 wasexpressed only in the cells of the inner nuclear and the ganglion layers. Data suggest that theincreased expression of Pax6 and Otx2 could be ascribed to the hyperproliferation of retinal cellsrather than to an effective gene overexpression. J. Exp. Zool. 321A:207–219, 2014. © 2014 WileyPeriodicals, Inc.

How to cite this article: Simoniello P, Trinchella F, Filosa S, Scudiero R, Magnani D, Theil T, MottaCM. 2014. Cadmium contaminated soil affects retinogenesis in lizard embryos. J. Exp. Zool.321A:207–219.

J. Exp. Zool.321A:207–219,2014

Conflicts of interest: None.�Correspondence to: Chiara Maria Motta, Department of Biology,

University of Naples, Federico II, Via Mezzocannone 8, 80134 Naples, Italy.E‐mail: mottacm@unina.it

Received 13 July 2013; Revised 7 December 2013; Accepted 6 January2014

DOI: 10.1002/jez.1852Published online 30 January 2014 in Wiley Online Library

(wileyonlinelibrary.com).

RESEARCH ARTICLE

© 2014 WILEY PERIODICALS, INC.

endangered and soil and water contamination is the main cause.Negative effects of high levels of common xenobiotics such as, forexample, endocrine disruptors (Verderame et al., 2011), pesticides(De Falco et al., 2007), or herbicides (Bicho et al., 2013) are wellknown.Cadmium is another common toxicant for lizards: its effects

have been described on the liver (Simoniello et al., 2010a), thegonads (Simoniello et al., 2013), the brain and the retina (Scudieroet al., 2011), and the pituitary gland (Ferrandino et al., 2010). Theeffects are amplified by the fact that eggs are laid in the soil andhave a parchment shell that allows water exchange throughoutdevelopment (Belinsky et al., 2004). In embryos, therefore,cadmium may cause molecular and morphological alterations,affecting the regular development of several organs (Trinchellaet al., 2010; Simoniello et al., 2011) including the eye, in whichunilateral microphthalmia and retinal folding often appear(Simoniello et al., 2009, 2011; Scudiero et al., 2011). Similarmalformations in eye development have been described with arelatively high frequency in other vertebrates, elicited bychromosomal, monogenic, and environmental factors (Pennatiet al., 2001; Saka, 2004; Huang et al., 2013).Eye development in vertebrate embryos is a highly conserved

process regulated by the combined action of a network of genes(Land and Fernald, '92). ThePax6 gene is the “master control gene”of eye development in metazoa (Gehring, '96). In developingvertebrate eyes, Pax6 is first detected in the optic sulcus, then inlater stages it is strongly expressed in lens, cornea, and in the innerlayer of the cup (Walther and Gruss, '91) where it regulates retinalprogenitor cell differentiation (Ashery‐Padan and Gruss, 2001).Pax6 is able to induce ectopic eyes in Drosophila and Xenopus(Callaerts et al., '97; Altmann et al., '97) and Pax6 overexpressionresults in optic disc malformation, progressive retinal dysplasia,and microphthalmia (Manuel et al., 2008). In Pax6‐deficientmice and flies (Grindley et al., '97; Clements et al., 2009) and inheterozygous mutants, eyes develop with different severe defects(Collinson et al., 2001; Clements et al., 2009; Mort et al., 2011).Proper retinal photoreceptor development also requires ortho-

denticle protein homolog 2 (Otx2), a homeobox gene that containsa highly conserved homeodomain. The role of Otx2 in regionalspecification of the eye, particularly the retinal pigmentepithelium, has long been established from expression studiesin normal and mutant animal models (Bovolenta et al., '97;Martinez‐Morales et al., 2001; Tajima et al., 2009). In earlydevelopment, Otx2 specifies the anterior neuroectoderm duringgastrulation (Acampora et al., '95) and is expressed throughoutthe forebrain and midbrain in the developing embryo, with asharp boundary defining the midbrain–hindbrain junction(Simeone et al., '93). Effects of the loss of Otx2 function havebeen explored in targeted mutant mice. While Otx2 null embryosdisplay a severely altered cranial phenotype (Acampora et al., '95),heterozygous deletion ofOtx2 leads to a variable phenotype that isdependent on genetic background (Wyatt et al., 2008).

By investigating Pax6 and Otx2 expression in contaminatedembryos the present work obtains new insights into the effectof cadmium on the development of eyes and on retinogenesis inP. sicula embryos. The effects on gene expression and mRNAlocalization in altered eyes structures were monitored on in ovoembryos incubated in cadmium contaminated soil at differentstages of development by analysis of Otx2 and Pax6 expressionusing as probe two P. sicula cDNA fragments corresponding tothe coding regions of the two genes. The results show increasedexpression of these genes following cadmium incubation.However, the cellular localization of Pax6 and Otx2 transcriptsdid not change in cadmium contaminated embryos: in the earlystages of retinogenesis, the two genes were expressed in all retinalcells with a perinuclear localization; in the differentiatedretina, Otx2 remained in the cellular bodies of retinal cellsforming the nuclear layers and the ganglion layer, whereas Pax6was expressed only in the cells of the inner nuclear layer andthe ganglion layer. These data allow us to hypothesize that theincreased expression of Pax6 and Otx2 could be ascribed tothe hyperproliferation of retinal cells rather than to an effectiveCd‐induced gene overexpression.

MATERIALS AND METHODS

Egg Collection and Embryo IncubationGravid P. sicula females (20 specimens) were captured betweenMay and June from rural sites outside of Naples. Females werekept in a terrarium maintained under natural conditions oftemperature and photoperiod. The lizards were fed livemealwormsthree times a week and water was provided ad libitum. All effortswere made to avoid animal stress and to minimize the numbersused.Freshly laid eggs were placed in a terrarium containing

uncontaminated soil (control), some of themwere then transferredin a terrarium containing Cd contaminated soil (50mgCd/kg soil)at time intervals of 5 days. This concentration is above theguideline values for residential soil (http://www.epa.org.nz/contaminants/cadmium‐soil.html), but it is regularly found inpolluted areas and in soils used in intensive agriculture(Alloway, '95). Terraria were maintained at natural temperature(range 20–25°C) and water lost as vapor was reintroduced by dailysoil nebulizations with distilled water.Eggs were removed from terraria at regular time intervals

from deposition and washed to remove soil traces. Embryosrecovered from shells were immediately processed for cytologicaland biomolecular investigations. A total of 63 embryos wereused.The experiments were carried out in compliance with ethical

provisions established by the European Union and authorized bythe National Committee of the Italian Ministry of Health for invivo experimentation (Department for Veterinary Public Health,Nutrition and Food Safety).

208 SIMONIELLO ET AL.

J. Exp. Zool.

Light MicroscopyLizard embryos (n¼ 50) at different days post‐deposition (pd)were fixed in Bouin's solution and processed for paraffin waxembedding according to routine protocols. Sections were stainedwith hematoxylin–eosin to show general morphology or used forimmunochemistry and in situ hybridization analysis.

Proliferative IndexThe number of mitotic plates was determined as previouslydescribed (Simoniello et al., 2010a). Briefly, on eye sections fromboth control (n¼ 11) and Cd‐contaminated (n¼ 28) embryos, 15images at 20� magnification were taken from the differentsections of the various samples. The number of cells undergoingmitosis for arbitrary unit (au) of surface was counted and thesevalues were pooled and analyzed for significance (P< 0.05) byone‐way ANOVA followed by Tukey's test for differences betweenmeans using an Excel add‐in package.

ImmunohistochemistrySections placed on superfrost glass slides (Menzel‐Glaser,Braunschweig, Germany) were dewaxed in xylene and hydratedthrough alcohols (including a 15‐min incubation in 3% (v/v) H2O2

inmethanol to aid epitope recovery) to PBS (137mMNaCl, 2.7mMKCl, 10mM Na2HPO4, 2mM KH2PO4, pH 7.4), then boiled in10mM sodium citrate (pH 6) in a microwave. After blocking in10%normal goat serum in PBSwith 0.1% (v/v) TritonX‐100 (PBS‐TX), sections were incubated with Pax6 monoclonal antibody(Kawakami et al., '97, 1:40 dilution) at 4°C overnight. Sectionswere then washed twice in PBS‐TX and incubated in 10% normalgoat serum in PBS‐TX for 10min. Sections were incubated in a1:200 dilution of biotin‐conjugated goat anti‐mouse secondaryantibody in 10% normal goat serum in PBS‐TX overnight at roomtemperature and rinsed again in PBS‐TX. An avidin–biotinreaction was carried out using 0.05% (w/v) diaminobenzidine inTris‐buffered (pH 7.4) saline containing 0.02% H2O2. Sectionswere rinsed in water, dehydrated, cleared in xylene and mounted.

Total RNA IsolationTotal RNA was extracted according to the TRI‐Reagent (Sigma–Aldrich, St. Louis, MO, USA) protocol from the heads of embryos(n¼ 18) at 20 days pd, developed under natural (control,three groups each consisting of three pooled specimens) andCd‐contaminated (Cd‐treated, three groups each consisting ofthree pooled specimens) conditions. The concentration and purityof RNA samples were determined by UV absorbance spectropho-tometry; RNA integrity was checked on 1% agarose gelelectrophoresis.

RT‐PCR AnalysesTotal RNAs (5mg) from a control group were denatured by heatingat 65°C for 5min and then reverse‐transcribed in 20mL of reversetranscriptase (RT) buffer (50mM Tris–HCl, pH 8.3, 3mM MgCl2,

75mM KCl) containing 0.5mM of each deoxyribonucleosidetriphosphate [dNTP], 10mM dithiothreitol [DTT], 20U of RNaseinhibitor (Superase‐In, Ambion, Life Technologies Co., USA),1mM of oligo(dT)‐adaptor primer (50‐CGGAGATCTCCAATG-TGATGGGAAATTC(T)17‐30), and 200U of Superscript II reversetranscriptase enzyme (Invitrogen, Life Technologies Co., USA). Thesamples were incubated at 42°C for 60min, and successively at70°C for 15min to inactivate the reverse transcriptase.The resulting first‐strand cDNA was amplified by PCR using

forward‐ and reverse‐specific primers for Pax6 and Otx2,respectively. The primers, listed in Table 1, were designed on thenucleotide sequences of chicken Pax6 and Otx2 available at theEMBL Nucleotide Database.PCR reactionmixture contained 2mLfirst strand cDNA, 1� PCR

buffer [50mM Tris–HCl, pH 8.3, 10mM KCl, 5mM (NH4)2SO4,2mMMgCl2], 0.2mMdNTPs, 0.4mM each of specific primers, and2U of FastStart Taq DNA polymerase (Roche Diagnostics, Basel,Switzerland). Reactions were carried out in a GeneAmp thermalcycler (Applied Biosystem, Life Technologies Co., USA), with aninitial denaturation step at 95°C for 4min; 30 cycles of 95°C for30 sec, 60°C for 30 sec, 72°C for 1min, and a final elongation stepat 72°C for 7min.

Cloning and Identification of PCR ProductsPCR products were subcloned into the pCRII‐TOPO vector using aTA cloning kit (Invitrogen). Multiple independent clones weresequenced using automated methods (PRIMM) on an ABI PRISMGenetic Analyzer (PE Biosystems, Life Technologies Co., USA). Theidentity of the clones was evaluated by matching the sequences tothe nucleotide/protein sequences available at the EMBL Database.The fragments of the P. sicula Pax6 and Otx2 mRNAs obtained bythe PCR reactions are available in the GenBank database under theaccession numbers FN823239 and FN823240, respectively.

Northern blot Hybridization of RNAsTotal RNA from control and Cd‐treated embryos (15mg each) wassize‐fractionated by electrophoresis through a 1.2% agarose gelcontaining 2.2M formaldehyde. RNAs were transferred bycapillary blotting onto nylon membrane (Immobilon Nyþ,

Table 1. Specific primers used for PCR analyses.

Name Nucleotide sequence (50–30) Length Direction

Pax6F1 GGCACCAGGCCTGGGTGGTA 20‐mer SensePax6F2 CATCAGTTCAAATGGGGAAGATTC 24‐mer SensePax6R1 CCAGGAACTTGAACTGGAACTGA 23‐mer AntisensePax6R2 GGGCTGGTGGGCAGCATGCA 20‐mer AntisenseOtx2F1 CAGCAGCAGCAGCAGCAGCAGAA 23‐mer SenseOtxF2 CAGAAGTCCTACCCCATGACCTA 23‐mer SenseOtx2R1 ATCCAAGCAGTCAGCATTGAAGT 23‐mer Antisense

J. Exp. Zool.

RETINOGENESIS IN CADMIUM‐EXPOSED LIZARD EMBRYOS 209

Millipore, Billerica, MA, USA) and fixed by UV crosslinking. TheRNAs were probed for Pax6 and Otx2 mRNA by using the [a‐32P]‐labeled cDNA fragments encoding P. sicula Pax6 and Otx2. Themembrane was also hybridized with a radiolabeled P. sicula 18SrRNA probe to correct for equal amounts of RNA. The probes wereradiolabeled by the random priming method using a High PrimeDNA Labeling Kit (Roche).Pre‐hybridization and hybridization of the membrane was

carried out in UltraHyb hybridization buffer (Ambion) at 42°C for2 and 20 hr, respectively. Hybridization to target RNAwas detectedby autoradiography. Quantification was carried out by aPhosphorImager apparatus (Storm Imaging System, GlobalMedical Instrumentation, Ramsey, MN, USA) and expressed inarbitrary units.

cRNA ProbesThe P. sicula Pax 6 and Otx2 cDNA fragments cloned into thepCRII‐TOPO plasmid were used for generation of cRNA probes.The plasmids were linearized by HindIII to generate antisenseprobes, and by XhoI to generate sense probes. The cRNA synthesiswas performed by using the Dig‐RNA (SP6/T7) labeling Kit (RocheApplied Science), according to the manufacturer's conditions.

In Situ HybridizationSections (5–7mm) were placed on superfrost glass slides, fixed in4% paraformaldehyde in PBS pH 7.4 for 20min and incubated inPK buffer (Tris–HCl, 0.2M, pH 7.4, EDTA 10mMpH 8, proteinase K20mg/mL) at 37°C for 5min. After washing in glycine 0.2% in PBSfor 5min, sections were incubated at 68°C for 90min in a pre‐hybridization mix containing formamide 50%, SSC 5� , blockingreagent 20mg/mL, yeast total RNA 1mg/mL, heparin 0.1mg/mL,Tween‐20 01%, Chaps 0.1%, EDTA 5mM, pre‐heated at 95°C for5min. Hybridization was carried out at 68°C overnight using aDig‐labeled cRNA probe for P. sicula Pax6 or Otx2. Sections werewashed in SSC 2�, in formamide 50% in SSC 2� at 65°C for30min, and in Tween‐20 0.1% in PBS for 30min. Sections werethen incubated in blocking reagent 1%. Digoxigenin was revealedby incubating sections at 37°C for 2 hwith anAP‐conjugated anti‐Dig antibody diluted 1:1,000. Slides were washed in NTM (Tris–HCl 0.1M pH 9.5, NaCl 0.1M, MgCl2 50mM), incubated withlevamisole–Tween‐20 1� for 15min and stained with NBT/BCIPdiluted 1:50. In the negative controls, hybridization was carriedusing sense Pax6 or OTX2 RNA probes.

RESULTS

Morphological Effects of Cadmium Treatment on Eye DevelopmentIn Podarcis embryos, the eyes are large, pigmented structuresprotruding from the head profile from the very earliest stages ofdevelopment (Fig. Fig. 1A,B). After cadmium exposure they showsignificant alterations including reduced size (Fig. Fig. 1C),various degrees of malformation (Fig. Fig. 1D,E) and/or the

formations of fleshy growth close to the rim (Fig. Fig. 1C,E). Suchalterations occur at all stages of differentiation and in 90% ofcases are unilateral (Fig. Fig. 1E).In untreated embryos on day 5 pd, the eye is still rudimental

(Fig. Fig. 1F). The lens is large and undifferentiated and the vitrealchamber scarce as the optic cup is most often collapsed. The retina(Fig. Fig. 2A) appears as a pseudo‐stratified columnar epitheliummade of undifferentiated neurons; the presumptive retinal‐pigmented epithelium (RPE) is scarcely visible.On day 10 pd, the eye has an extended vitreal chamber

(Fig. Fig. 1G) and a proximal retina showing the first evidence of adifferentiating outer nuclear layer ONL (Fig. Fig. 2B). In the distalretina, no apparent sign of morphological differentiation can beappreciated (Fig. Fig. 2C). The RPE is recognizable but still verythin and scarcely pigmented (Fig. Fig. 2C).By day 20 pd, the proximal and mid‐distal retina are clearly

stratified with the inner plexiform layer IPL and the ganglion celllayer GCL clearly evident (Fig. Fig. 1H). At higher magnification(Fig. Fig. 2D), the ONL and the outer plexiform layer OPL are alsovisible. In the distal retina, no layering is appreciable. The RPE isthin and clearly pigmented (Fig. Fig. 2E) and the optic nerve andchiasm are formed (Fig. Fig. 1H).On day 40 pd, the eyes attain an adult layout with a

differentiated lens and a fully stratified retina in both proximaland distal regions (Fig. Fig. 1I). The two plexiform layers havethickened while the GCL has contracted and became 4–6 cells high(Fig. Fig. 2F).In embryos treated with cadmium from deposition (day 0),

significant alterations are observed in the retina from day 5 pd(Fig. Fig. 1J). These are usually unilateral, both in left and rightside with the same frequency, occur in about the 50% of theembryos examined and consist of a folding in the retina thatinvades the vitreal chamber (Fig. Fig. 1J,K). Interestingly, the samekind of alteration is observed in embryos treatedwith cadmium for5 days starting on days 5, 10 (data not shown), 15 (Fig. Fig. 1L,M),or 20 (Fig. Fig. 1N) pd. Various degrees of folding are observed inthe different treated embryos but in all cases they develop anormal layering (Fig. Fig. 1L,N).

Effects of Cadmium on Mitotic Activity in the Developing RetinaIn control eyes on day 5 pd, mitotic activity is concentrated inthe outermost portion of the optic cup, and no apparentdifference exists between the retina proximal or distal to theoptic nerve (Fig. Fig. 2A). On day 10 pd, the situation remainsessentially unchanged with the proximal (Figs. 2B and 3A) anddistal (Figs. 2C and 3B) retina showing an average of 16.5� 2.8and 14.2� 1.9 mitosis per arbitrary unit of surface (aus)respectively.By day 15 pd, proliferation in the proximal retina almost

completely ceases (1.2� 0.1mitosis/aus, Fig. Fig. 3A) so that fromday 20 pd, mitotic cells become very rare (Figs. 2D and 3A,C). Inthe distal retina, proliferation decreases more gradually an on

J. Exp. Zool.

210 SIMONIELLO ET AL.

Figure 1. Retinal development in control (A, B and F, I) or cadmium‐treated (C, E and J, N) Podarcis sicula embryos. (C, D and J, K) Embryostreated from deposition (day 0); (E, L, N) embryos treated for 5 days starting from day 10 (10þ 5Cd), 15 (15þ 5Cd), or 20 (20þ 5Cd) pd. (A)Normally developed eye protruding from the small head. Notice the pigmentation and the centrally located clear lens (arrowhead). (B) Eyewith formed eye lids (arrowhead). (C) Eye with a flesh protrusion (arrowhead). (D) Irregularly shaped eye (arrowhead); also notice the flat andextended mesencephalon (�). (E) Eye with abnormal pigmentation and the presence of outgrowths (arrowhead). (F) Optic cup with thick andundifferentiated retina (r) and lens (l). (G) Eye with still undifferentiated retina (r). Lens (l), vitreal chamber (v). (H) retina differentiated in theproximal but not in the anterior distal region (arrow). Emergence of the optic nerve (arrowhead), encephalon (e). (I) Eye with stratified retina(r). (J) Optic cup with folded (�), undifferentiated retina (r). (K) Embryo with unilateral folding of the retina (�). Also notice the asymmetricbuccal vault (b). Telencephalon (t). (L) Unilateral retinal folding (�) in an embryo also showing an altered telencephalon (t) and buccal vault (b).(M) Detail of figure G showing the regular stratification in the retinal ridges (�). The lens (l) is apparently normal. (N) Regular stratification in afolded retina (�). In this embryo, the telencephalon (t) and the buccal structures (b) appear normal. Staining with hemalum–eosin. Bars: (A–E):500mm; (F, G, J): 50mm; (H, I, K, M): 100mm; (L, N): 200mm.

J. Exp. Zool.

RETINOGENESIS IN CADMIUM‐EXPOSED LIZARD EMBRYOS 211

day 25 pd (Fig. Fig. 3D) several mitosis can still be observed(4.7� 0.6mitosis/aus).Treatment with cadmium significantly changes the proliferative

activity of the retinal cells. In the proximal retina (Fig. Fig. 3A), thenumber of mitosis remains unchanged on day 5 pd (data notshown) in embryos treated since deposition. Proliferation isreduced on day 10 pd (Fig. Fig. 3E) but increases on days 15 and 20pd (Fig. Fig. 3F). It is relevant to note that the same variations areseen in both normal and folded retina.In the distal retina (Fig. Fig. 3B), mitotic activity remains

unchanged on days 5 (data not shown) and 10 pd and also in theintact retina of 15 and 20 day old embryos. In contrast, the numberof mitotic cells significantly increases in folded retina withactivity values on days 15 and 20 pd approximately two‐ andthreefold higher than those determined in the contralateral intactretina.Proliferation in embryos treated with cadmium for 5 days

starting at different times after deposition also show significantchanges with respect to controls. In the proximal retina(Fig. Fig. 3C), the number of mitotic cells remains unchanged in5þ 5 embryos, but significantly increases in 15þ 5 and 20þ 5embryos. In both cases, the higher values, approximately 10‐fold

greater than controls, are seen in retina showing nomorphologicalevidence of alteration. In the distal retina (Fig. Fig. 3D), thenumber of mitotic cells remains unchanged in 5þ 5 embryos andin the intact retina of 15þ 5 and 20þ 5 embryos but increasesapproximately three times in folded retina of 15þ 5 (Fig. Fig. 3G)and 20þ 5 embryos.

Effects of Cadmium on Expression of Pax6 and Otx2 Genes in theDeveloping EyesTo evaluate gene expression levels and the localization of Pax6and Otx2 transcripts in the developing eyes of control andcadmium‐treated embryos, two cDNA fragments encoding Pax6and Otx2, respectively, were cloned and sequenced by RT‐PCR.Specific primers (Table 1) were designed on homologoussequences of avian and mammalian species. Combining thePax6‐F2 and Pax6‐R2 primers, the PCR reaction gave rise to a519‐bp DNA fragment encoding a polypeptide of 173 aminoacids, sharing 99% identity with the central region of chickenPax6. The PCR product obtained using the Otx2‐F1 and theOtx2‐R1 primers was a sequence of 546 bp, encoding apolypeptide of 182 amino acids that shares 96% identity withthe corresponding region of chicken Otx2 protein. The P. sicula

Figure 2. Distribution of mitotic cells in the developing retina of Podarcis sicula embryos. (A) Detail of Figure 1F. Mitotic cells (arrows) arefrequent in both proximal (p) and distal (d) undifferentiated retina. Note that cell division occurs only along the outer border adjacent to theevolving pigmented epithelium. Vitreal chamber (v). (B, C) Mitotic cells (arrows) in proximal and distal retina respectively. (D, E) Mitotic cells(arrow) in distal but not proximal retina. Thin, pigmented epithelium (arrowhead). (F) Fully differentiated retina with outer ONL and inner INLnuclear layers, outer OPL (�) and inner IPL plexiform layers and ganglion cell layer GCL. Mitotic cells are rarely observed. Staining withhemalum–eosin. Bars: 20mm.

J. Exp. Zool.

212 SIMONIELLO ET AL.

partial mRNA sequences are available at the EMBL/GenBank/DDBJ databases with the accession number FN823239 for Pax6and FN823240 for Otx2.Northern blot analyses were performed on total RNA

extracted from the heads of control and Cd‐treated embryos byusing the two cDNA fragments as probes. Three independentanalyses were performed, using the three different pools ofcontrol‐ and Cd‐treated total RNA. The results demonstrated that

the expression of both Pax6 and Otx2 genes increased in thecranial region of embryos incubated in Cd‐contaminated soil(Fig. Fig. 4).

Localization of Pax6 mRNA and Protein in Control and Cadmium‐Treated RetinaOn days 5 (data not shown) and 10 pd, Pax6 mRNA is uniformlydistributed in the retinal wall (Fig. Fig. 5A), in the perinuclear

Figure 3. Number of mitotic cells in the developing proximal (A, C) and distal (B, D) retina of Podarcis sicula embryos treated with cadmium atdeposition (A, B and E, G) or at different developmental stages (C, D, G). (A) The number of mitosis decreases on day 10 and increases ondays 15 and 20 pd. No significant differences exist between normal and folded retina. (B) The number of mitosis does not change on day 10and increases on days 15 and 20 but only in the folded retina. (C) The number of mitosis does not change in 5þ 5 days embryos and increasesin 15þ 5 and 20þ 5 days embryos, especially in morphologically intact retina. (D) The number of mitosis does not change in 5þ 5 daysembryos and increases in 15þ 5 and 20þ 5 days embryos but only in the folded retina. (E) Significant decrease in proliferation (mitotic cells,arrows) in a undifferentiated proximal retina. Compare with Figure 1B. (F) Significant increase in proliferation in an unfolded, differentiatedproximal retina. Compare with Figure 1D. (G) Significant increase in proliferation in a portion of folded, undifferentiated distal retina.Compare with Figure 1E. �Significant at P< 0.05. Staining with hemalum–eosin. Bars: 20mm.

J. Exp. Zool.

RETINOGENESIS IN CADMIUM‐EXPOSED LIZARD EMBRYOS 213

cytoplasm of the undifferentiated cells (Fig. Fig. 5B). The protein isalso present in all cells but it is more abundant in those located inthe vitreal region (Fig. Fig. 5C).On day 20 pd, in the differentiating proximal retina, both

messenger (Fig. Fig. 5D,E) and protein (Fig. Fig. 5F,G) are present.They localize mainly at the level of the INL but amoderate labelingof the presumptive GCL is also visible. In the distal retina, stillundifferentiated, the messenger (Fig. Fig. 5D) and the protein(Fig. Fig. 5H) are evenly distributed in all the cells.In the fully differentiated retina on day 40 pd, the messenger

(Fig. Fig. 5I,J) and the protein (Fig. Fig. 5K,L) are localizedexclusively in the INL and GCL. All the other layers remaincompletely unstained.In the embryos treated with cadmium, the localization of Pax6

mRNA does not change significantly with respect to controls. Itprogressively concentrates in the INL and GCL in both intact andfolded retina in animals treated from deposition (Fig. Fig. 5M) aswell as in animal treated at various developmental stages(Fig. Fig. 5O,P). From day 20 pd, the protein concentrates in theINL (Fig. Fig. 5N) but not in the GCL where it remains almostundetectable in both intact and folded retina (Fig. Fig. 5Q,R) of allembryos.

Localization of Otx2 mRNA in Control and Cadmium‐Treated RetinaOn days 5 and 10 pd, the mRNA is uniformly distributed in theundifferentiated retina (Fig. Fig. 6A,B). From day 20 pd, itprogressively localizes in INL, ONL, and GCL so that plexiform andoptic layers remain completely unlabeled (Fig. Fig. 6C,D).In cadmium treated embryos, messenger distribution does not

show any significant difference with respect to controls, in eitherintact or folded retina (Fig. Fig. 6E,H).

DISCUSSIONCadmium is highly toxic for the retina of Podarcis embryos whereit causes significant developmental anomalies. These includeanophthalmia, microphthalmia, and, at the histological level,various degrees of dysplasia. Similar alterations have beenreported in other vertebrates, for example, in zebrafish (Chowet al., 2009), hamster (Tassinari and Long, '82), and mouse(Roozbehi et al., 2007). These abnormalities are most oftenunilateral but randomly distributed between the left and righteyes, as previously demonstrated (Scudiero et al., 2011). In lizardembryos, such a response could not be due to a gradient of Cdpenetration in the egg as it developed completely buried in thecontaminated soil. The one‐sidedness could also not result from a

Figure 4. Expression of Pax6 and Otx2 transcripts. Total RNA from the heads of control and Cd‐treated lizard embryos at 20 days fromdeposition was extracted and subjected to northern blot analysis for expression of the indicated probes (upper panels). The same membraneswere rehybridized with an 18 sRNA probe (middle panels). Data are pooled from three (lower panels) independent experiments orrepresentative of three (upper and middle panels) independent experiments. �Significant at P< 0.05; a.u., arbitrary units.

J. Exp. Zool.

214 SIMONIELLO ET AL.

Figure 5. Localization of Pax6 mRNA and protein in control (A–L) and cadmium‐treated (M–R) retina of Podarcis sicula embryos. (A) Uniformdistribution of messenger in the retina. (B) Detail showing the mRNA in the cytoplasm of undifferentiated cells (�). (C) The protein isconcentrated in the vitreal cells (�). (D) Proximally differentiated retina with mRNA concentrated in the INL and GCL (arrow). The distal retina(�) is still uniformly labeled. (E) Detail showing the labeled INL and GCL. (F) Proximally differentiated retina with protein concentrated in INLand, to a lesser extent, in the GCL (arrow). The distal retina (�) is poorly labeled. (G) Detail of the labeled proximal retina. (H) Detail of the poorlylabeled (�) distal retina. (I) Fully differentiated eye with messenger localized in INL and GCL. (J) Detail. (K) Fully differentiated eye with proteinlocalized in INL and GCL. (L) Detail. (M) Undifferentiated retina with uniformly distributed mRNA (�). Notice the presence of a fold (��). (N)Proximally differentiated retina with protein in the INL (arrow). Notice the presence of several unlabeled folds (�). (O) In the intact and foldedretina the mRNA is concentrated in proximal INL and GCL (arrows). (P) Detail. (Q) Eyes with intact and folded retina; the protein isconcentrated in proximal INL but not GCL (arrows). (R) Detail. INL, inner nuclear layer; GCL, ganglion cell layer; IPL, inner plexiform layers; OPL,outer plexiform layers.

J. Exp. Zool.

RETINOGENESIS IN CADMIUM‐EXPOSED LIZARD EMBRYOS 215

different distribution of cadmium to the two eyes. If thepenetration route were external, the amniotic fluid should havediluted the ion and made it available to both eyes at the sameconcentration and the same would have occurred if cadmium hadreached the retina via the bloodstream.All organisms show a basic asymmetry in bilaterally symmet-

rical traits (fluctuating asymmetry) as a result of small, localanomalies occurring during development (Palmer andStröbeck, 2003). This naturally occurring asymmetry is highlyincreased by perturbing environmental stressors such pesticides(Allenbach et al., '99) and metals (Leary and Allendorf, '89).For this reason, fluctuating asymmetry has been proposed aspossible bioindicator of environmental poisoning (Parsons, '92;Allenbach, 2011). We hypothesize that cadmium has exerted thesame effect on both eyes in the lizard embryos, but only one, thatwith a larger perturbation of its symmetry, has developed visiblemorphological anomalies.The dysplasia observed in Podarcis embryos is represented by

marked retinal folding but there is no evidence indicating thatlaminar organization is also affected. Various degrees of retinaldysplasia are observed in experimental animals after a number of

traumas ranging from viral infection (Khalifa et al., '91), tovitamin shortage (Grondona et al., '96) or drug exposure (Kuwataet al., 2009). Retinal folding has been reported to occur as aconsequence of fixation (Szczech et al., '76; French et al., 2008). InPodarcis embryos, however, folds are unilateral and never foundin control animals. They are unlikely therefore, to be artifacts.Additionally, the occurrence of folding cannot be explained by thedeformities induced in the cranial skeleton. Folds are present bothin embryos that have marked cephalic alterations (interruptedcranial vault with exencephaly, incomplete buccal vault anddeformed jaws) and in embryos in which the skull is normallydeveloped.The more plausible hypothesis is that the retina undergoes

excessive growth and this was tested by comparing theproliferation rate in developing retina of treated and controlembryos. These results indicate that cadmium interferes with cellcycle regulation by increasing proliferation. The hyperprolif-erative effect of cadmium has been largely demonstrated in manytissues and cell types (Simoniello et al., 2010a; Wang et al., 2012;Yuan et al., 2013). In particular, in the proximal retina close to theoptic nerve, a high proliferation rate is maintained well after

Figure 6. Localization of Otx2 mRNA in control (A–D) and cadmium treated (E–H) retina of Podarcis sicula embryos. (A) Undifferentiatedretina with uniformly distributed messenger. Lens (l). (B) Detail of the proximal retina showing the first evidence of layering (arrows). (C)Proximally differentiated retina with messengers concentrated in INL and GCL (arrow). The distal retina is uniformly labeled (�). (D) Detailshowing the unlabeled OPL (arrow), IPL and optic fiber layer (arrowhead). (E) Folded retina with evenly distributed messenger (�). (F) Detail oflabeled cells (�). (G) Proximally differentiated retina with messengers concentrated in nuclear layers (arrow). The distal retina is still uniformlylabeled (�). (H) Detail showing the unlabeled OPL (arrow), IPL and optic fiber layer (arrowhead).

J. Exp. Zool.

216 SIMONIELLO ET AL.

day 15 pd, the time in which it should normally cease. In the distalretina, in contrast, the proliferation rate also significantlyincreases in all developmental stages, but only in retina showingfolding. The different effects of cadmium on distal and proximalretina of Podarcis are not surprising. The retina is a highlyregionalized structure in both adults (Barbour et al., 2002; Mowatet al., 2008; Hanazono et al., 2012) and embryos. For manyvertebrates including reptiles, the existence of distinct develop-mental gradients has been reported (Prada et al., '91; Reeseet al., '96; Francisco‐Morcillo et al., 2006).Interesting evidence emerging from these data is that the same

type of abnormalities are present in embryos treated from the dayof the deposition and in the more advanced stages of developmentat 5, 15, and 20 days pd. In all cases, proliferation is maintained inthe proximal retina over the expected time, both in intact andfolded retina. In the distal retina, however, a significant increase inproliferation is observed in the folded retina. The effects ofcadmium on the retina therefore seem independent of the stage ofdevelopment and this suggests that the ion does not interfere withthe genetic program directing the ontogenetic processes. Rather,its action would be exerted downstream on the mechanisms thatcontrol cell fate.The possibility that the cadmium effects result from variation in

the expression of Pax6 and Otx2 is supported by our data. Invertebrates, both genes have been implicated in the control of cellproliferation and specification in the retina (Hever et al., 2006).Our blot results show that both genes are moderately overex-pressed in the head region of treated embryos. Cytologicalanalyses however, demonstrate in these embryos an increase ofthe retinal surface due to the folding. Thus, the observed increaseinmessenger could be simply due to an increase in cells expressingthe messenger itself. More significant is the evidence thatcadmium down‐regulates Pax6 expression in ganglion cells. Infolded retina, the down‐regulation occurs at the transcriptionallevel while in intact retina it occurs at the translational level. Inboth cases, Pax6 protein is not present in ganglion cells. Pax6 isindispensable not only for the retinal development in the embryo(Marquardt et al., 2001) but also in the adult, in the amacrine andganglion cells (Macdonald andWilson, '96). The lack of the proteinin Podarcis ganglion cells, therefore, is strongly suggestive of animpaired retinal functionality. Concerning the Otx2 proteinhowever, the antibodies used so far have given no clear resultsand therefore, information about its presence and localizationremains absent.In conclusion, these data plainly demonstrate that cadmium is

toxic to the eye development in Podarcis embryos. The effects aremanifestedmacroscopically as anophthalmia andmicrophthalmiaand, at the cytological level, as retinal dysplasia probably due to aloss of control over the proliferative processes. This event does notdepend on a seemingly abnormal expression of Pax6 andOtx2 andtherefore the molecular mechanisms leading to the observedalterations still need to be identified.

The results draw our attention to the major impact that thesealterations could have at the ecological level. The lizards huntusing especially the eyesight: the birth of offspring with abnormalvisual abilities could therefore cause a significant decrease of thefitness. Adult specimens exposed to cadmium in addition show alow fecundity (Simoniello et al., 2010b, 2013; Scudiero et al., 2011)and it is not difficult to expect that these two effects combinedmight be able to threaten the survival of natural populations,especially of those exposed to other anthropic pressure. The loss ofthe lizards from a natural environment would inevitably causeecosystem imbalances, altering the trophic cascade: lizards in factare secondary consumers, responsible for controlling the popula-tion of many invertebrates as well as flora such as weeds. Thepresence of cadmium in agricultural and wild soils, therefore,should be strictly controlled.Finally, the results here described highlight that the effects of a

xenobiotic should be also studied on not typical target organs,whose alterations, however, could prove disastrous not for thesurvival of the individual, but of the entire population.

ACKNOWLEDGMENTThe authors gratefully thank Dr. Edward Howell for criticalreading of the manuscript.

LITERATURE CITEDAcampora D, Mazan S, Lallemand Y, et al. 1995. Forebrain andmidbrain regions are deleted in Otx2�/�mutants due to a defectiveanterior neuroectoderm specification during gastrulation. Develop-ment 121:3279–3290.

Allenbach DM. 2011. Fluctuating asymmetry and exogenous stress infishes: a review. Rev Fish Biol Fisher 21:1–22.

Allenbach DM, Brown Sullivan K, Lydy MJ. 1999. Higher fluctuatingasymmetry as a measure of susceptibility to pesticides in fishes.Environ Toxicol Chem 18:899–905.

Alloway BJ. 1995. Heavy metals in soils. London: Chapman & Hall.Altmann CR, Chow RL, Lang RA, Hemmati‐Brivanlou A. 1997. Lensinduction by Pax‐6 in Xenopus laevis. Dev Biol 185:119–123.

Ashery‐Padan R, Gruss P. 2001. Pax6 lights‐up the way for eyedevelopment. Curr Opin Cell Biol 13:706–714.

Barbour HR, Archer MA, Hart NS, et al. 2002. Retinal characteristics ofthe ornate dragon lizard, Ctenophorus ornatus. J Comp Neurol450:334–344.

Belinsky A, Ackerman RA, Dmi'el R, Ar A. 2004. Water in reptilian eggsand hatchlings. In: Deeming DC, editor. Reptilian incubation;environment, evolution and behaviour. Nottingham: NottinghamUniversity Press. p 125–141.

Bicho RC, Amaral MJ, Faustino AM, et al. 2013. Thyroid disruption inthe lizard Podarcis bocagei exposed to a mixture of herbicides: afield study. Ecotoxicology 22:156–165.

Bovolenta P, Mallamaci A, Briata P, Corte G, Boncinelli E. 1997.Implication of OTX2 in pigment epithelium determination andneural retina differentiation. J Neurosci 17:4243–4252.

J. Exp. Zool.

RETINOGENESIS IN CADMIUM‐EXPOSED LIZARD EMBRYOS 217

Callaerts P, Halder G, Gehring WJ. 1997. PAX‐6 in development andevolution. Annu Rev Neurosci 20:483–532.

Chow ES, Hui MN, Cheng CW, Cheng SH. 2009. Cadmium affectsretinogenesis during zebrafish embryonic development. Toxicol ApplPharmacol 235:68–76.

Clements J, Hens K, Merugu S, et al. 2009. Mutational analysis of theeyeless gene and phenotypic rescue reveal that an intact Eyelessprotein is necessary for normal eye and brain development inDrosophila. Dev Biol 334:503–512.

Collinson JM, Quinn JC, Buchanan MA, et al. 2001. Primary defects inthe lens underlie complex anterior segment abnormalities of thePax6 heterozygous eye. Proc Natl Acad Sci USA 98:9688–9693.

De Falco M, Sciarrillo R, Capaldo A, et al. 2007. The effects of thefungicide methyl thiophanate on adrenal gland morphophysiologyof the lizard, Podarcis sicula Arch Environ Contam Toxicol 53:241–248.

Ferrandino I, Favorito R, Grimaldi MC. 2010. Cadmium induceschanges on ACTH and PRL cells in Podarcis sicula lizard pituitarygland. Eur J Histochem 54:e45.

Francisco‐Morcillo J, Hidalgo‐Sánchez M, Martín‐Partido G. 2006.Spatial and temporal patterns of proliferation and differentiation inthe developing turtle eye. Brain Res 1103:32–48.

French J, Halliday J, Scott M, et al. 2008. Retinal folding in the termrabbit fetus—developmental abnormality or fixation artifact?Reprod Toxicol 26:262–266.

Gehring WJ. 1996. The master control gene for morphogenesis andevolution of the eye. Genes Cells 1:11–15.

Grindley JC, Hargett LK, Hill RE, Ross A, Hogan BL. 1997. Disruption ofPAX6 function in mice homozygous for the Pax6Sey‐1Neu mutationproduces abnormalities in the early development and regionaliza-tion of the diencephalon. Mech Dev 64:111–126.

Grondona JM, Kastner P, Gansmuller A, et al. 1996. Retinal dysplasiaand degeneration in RARb2/RARg2 compound mutant mice.Development 122:2173–2188.

Hanazono G, Tsunoda K, Kazato Y, Suzuki W, Tanifuji M. 2012.Functional topography of rod and cone photoreceptors in macaqueretina determined by retinal densitometry. Invest Ophthalmol Vis Sci53:2796–2803.

Hever AM, Williamson KA, van Heyningen V. 2006. Developmentalmalformations of the eye: the role of PAX6, SOX2 and OTX2. ClinGenet 69:459–470.

Huang L, Wang C, Zhang Y, Wu M, Zuo Z. 2013. Phenanthrene causesocular developmental toxicity in zebrafish embryos and the possiblemechanisms involved. J Hazard Mater 261:172–180.

Kawakami A, Kimura‐Kawakami M, Nomura T, Fujisawa H. 1997.Distributions of PAX6 and PAX7 proteins suggest their involvment inboth early and late phases of chick brain development. Mech Dev66:119–130.

Khalifa MA, Rodrigues MM, Rajagopalan S, Swoveland P. 1991. Eyepathology associated with measles encephalitis in hamsters. ArchVirol 119:165–173.

Kuwata M, Yoshizawa K, Matsumura M, Takahashi K, Tsubura A. 2009.Ocular toxicity caused by paclitaxel in neonatal Sprague–Dawleyrats. In Vivo 23:555–560.

Land MF, Fernald RD. 1992. The evolution of eyes. Annu Rev Neurosci15:1–29.

Leary RF, Allendorf FW. 1989. Fluctuating asymmetry as an indicator ofstress: implications for conservation biology. Trends Ecol Evol4:214–217.

Macdonald R, Wilson SW. 1996. Pax proteins and eye development.Curr Opin Neurobiol 6:49–56.

Manuel M, Pratt T, Liu M, Jeffery G, Price DJ. 2008. Overexpression ofPax6 results in microphthalmia, retinal dysplasia and defectiveretinal ganglion cell axon guidance. BMC Dev Biol 8:59.

Marquardt T, Ashery‐Padan R, Andrejewski N, et al. 2001. Pax6 isrequired for the multipotent state of retinal progenitor cells. Cell105:43–55.

Martinez‐Morales JR, Signore M, Acampora D, Simeone A, BovolentaP. 2001. Otx genes are required for tissue specification in thedeveloping eye. Development 128:2019–2030.

Mort RL, Bentley AJ, Martin FL, et al. 2011. Effects of aberrant Pax6gene dosage on mouse corneal pathophysiology and cornealepithelial homeostasis. PLoS ONE 6:e28895.

Mowat FM, Petersen‐Jones SM, Williamson H, et al. 2008.Topographical characterization of cone photoreceptors and thearea centralis of the canine retina. Mol Vis 14:2518–2527.

Palmer AR, Strobeck C. 2003. Fluctuating asymmetry analysesrevisited. In: Polak M, editor. Developmental instability: causesand consequences. New York: Oxford University Press. p 427–442.

Parsons PA. 1992. Fluctuating asymmetry: a biological monitor ofenvironmental and genomic stress. Heredity 68:361–364.

Pennati R, Groppelli S, de Bernardi F, Sotgia C. 2001. Action of valproicacid on Xenopus laevis development: teratogenic effects on eyes.Teratog Carcinog Mutagen 21:121–133.

Prada C, Puga J, Pérez‐Méndez L, López R, Ramírez G. 1991. Spatial andtemporal patterns of neurogenesis in the chick retina. Eur J Neurosci3:559–569.

Reese BE, Johnson PT, Baker GE. 1996. Maturational gradients in theretina of the ferret. J Comp Neurol 375:252–273.

Roozbehi A, Almasi‐Tork S, Piryaee A, Sadeghi Y. 2007. Effects ofcadmium on photoreceptors and ganglionic cells of retinal layer inmice embryo–an ultrastructural study. Indian J Exp Biol 45:469–474.

Saka M. 2004. Developmental toxicity of p,p0‐dichlorodiphenyltri-chloroethane, 2,4,6‐trinitrotoluene, their metabolites, and benzo[a]pyrene in Xenopus laevis embryos. Environ Toxicol Chem 23:1065–1073.

Scudiero R, Filosa S, Motta CM, Simoniello P, Trinchella F. 2011.Cadmium in the wall lizard Podarcis sicula: morphological andmolecular effects on embryonic and adult tissues. In: Baker KJ,editor. Reptiles: biology, behavior and conservation. Happauge, NY:Nova Science Publishers. p 147–162.

J. Exp. Zool.

218 SIMONIELLO ET AL.

Simeone A, Acampora D, Mallamaci A, et al. 1993. A vertebrate generelated to orthodenticle contains a homeodomain of the bicoid classand demarcates anterior neuroectoderm in the gastrulating mouseembryo. EMBO J 12:2735–2747.

Simoniello P, Trinchella F, Borrelli L, et al. 2009. Effects of cadmium onretinal development in lizard embryo: a molecular and morphologi-cal study. Comp Biochem Physiol A 154:S21–S22.

Simoniello P, Filosa S, Riggio M, et al. 2010a. Responses to cadmiumintoxication in the liver of the wall lizard Podarcis sicula. CompBiochem Physiol C Toxicol Pharmacol 151:194–203.

Simoniello P, Trinchella F, Scudiero R, Filosa S, Motta CM.2010b. Cadmium in Podarcis sicula disrupts prefollicular oocyterecruitment by mimicking FSH action. The Open Zool J 3:37–41.

Simoniello P, Motta CM, Scudiero R, Trinchella F, Filosa S. 2011.Cadmium‐induced teratogenicity in lizard embryos: correlationwith metallothionein gene expression. Comp Biochem Physiol CToxicol Pharmacol 153:119–127.

Simoniello P, Filosa S, Scudiero R, Trinchella F, Motta CM. 2013.Cadmium impairment of reproduction in the female wall lizardPodarcis sicula. Environ Toxicol 28:553–562.

Szczech GM, Purmalis BP, Carlson RG. 1976. Folded retinas in ratfetuses: artifacts produced by fixation in alcohol. Toxicol ApplPharmacol 35:347–354.

Tajima T, Ohtake A, Hoshino M, et al. 2009. OTX2 loss of functionmutation causes anophthalmia and combined pituitary hormonedeficiency with a small anterior and ectopic posterior pituitary.J Clin Endocrinol Metab 94:314–319.

TassinariMS, Long SY. 1982. Normal and abnormalmidfacial developmentin the cadmium‐treated hamster. Teratology 25:101–113.

Trinchella F, Cannetiello M, Simoniello P, Filosa S, Scudiero R. 2010.Differential gene expression profiles in embryos of the lizardPodarcis sicula under in ovo exposure to cadmium. Comp BiochemPhysiol C Toxicol Pharmacol 151:33–39.

Verderame M, Prisco M, Andreuccetti P, Aniello F, Limatola E. 2011.Experimentally nonylphenol‐polluted diet induces the expression ofsilent genes VTG and ERa in the liver of male lizard Podarcis sicula.Environ Pollut 159:1101–1107.

Walther C, Gruss P. 1991. Pax‐6, a murine paired box gene, is expressedin the developing CNS. Development 113:1435–1449.

Wang B, Li Y, Shao C, Tan Y, Cai L. 2012. Cadmium and its epigeneticeffects. Cur Med Chem 19:2611–2620.

Wyatt A, Bakrania P, Bunyan DJ, et al. 2008. Novel heterozygous OTX2mutations and whole gene deletions in anophthalmia, micro-phthalmia and coloboma. Hum Mutat 29:E278–E283.

Yuan D, Ye S, Pan Y, et al. 2013. Long‐term cadmium exposure leads tothe enhancement of lymphocyte proliferation via down‐regulatingp16 by DNA hypermethylation. Mutat Res 757:125–131.

J. Exp. Zool.

RETINOGENESIS IN CADMIUM‐EXPOSED LIZARD EMBRYOS 219