Modulo is a target of Myc selectively required for

growth of proliferative cells in Drosophila

Laurent Perrina,b,*, Corinne Benassayagc, Dominique Morelloc,Jacques Pradelb, Jacques Montagned

aInstitut de Genetique Humaine, 141 rue de la Cardonille, 34396 Montpellier Cedex 5, FrancebLaboratoire de Genetique et de Physiologie du Developpement, Institut de Biologie du Developpement de Marseille,

CNRS-INSERM-Universite de la Mediterranee, Case 907, Parc Scientifique de Luminy, 13288 Marseille Cedex 09, FrancecCentre de Biologie du Developpement CNRS, UMR5547, IFR 109, 118 route de Narbonne, Batiment 4R3, 31062 Toulouse Cedex, France

dFriedrich Miescher-Institut, P.O. Box 2543, Maulbeerstrasse 66, CH-4002 Basel, Switzerland

Received 6 February 2003; received in revised form 10 April 2003; accepted 10 April 2003

Abstract

In Drosophila, the homologue of the proto-oncogene Myc is a key regulator of both cell size and cell growth. The identities and roles of

dMyc target genes in these processes, however, remain largely unexplored. Here, we investigate the function of the modulo (mod) gene,

which encodes a nucleolus localized protein. In gain of function or loss of function experiments, we demonstrate that mod is directly

controlled by dMyc. Strikingly, in proliferative imaginal cells, mod loss-of-function impairs both cell growth and cell size, whereas larval

endoreplicative tissues grow normally. In contrast to dMyc, over-expressing Mod in wing imaginal discs is not sufficient to induce cell

growth. Taken together, our results indicate that mod does not possess the full spectrum of dMyc activities, but is required selectively in

proliferative cells to sustain their growth and to maintain their specific size.

q 2003 Elsevier Science Ireland Ltd. All rights reserved.

Keywords: Cell growth; Proliferative/endoreplicative tissues; Nucleolus; Ribosome biogenesis; Myc

1. Introduction

During development, the program of growth has to

coordinate the increase in cell mass (i.e. cell growth) with

cell proliferation, to give rise to an adult organism whose

final size depends on cell size and cell number (reviewed in

Conlon and Raff (1999)). Drosophila is an attractive system

to study growth that occurs essentially during larval life. In

late embryogenesis, cells dedicated to form the larval tissues

stop dividing and, after hatching, support multiple rounds of

endocycles (Pearson, 1974; Smith and Orr-Weaver, 1991) to

sustain their growth (Follette et al., 1998; Weiss et al.,

1998). The adult structures differentiate from the imaginal

discs that individualize as groups of cells invaginating from

the ectoderm during mid-embryogenesis, then grow and

proliferate during larval life and early metamorphosis

(Cohen, 1993). Imaginal discs are subdivided into compart-

ments (Garcia-Bellido et al., 1973), so that cells from one

compartment neither mix nor compete with cells in an

adjacent compartment (Simpson, 1976). Growth and size in

discs are controlled in a compartment-specific manner, as in

the organs of mammals (Conlon and Raff, 1999; Day and

Lawrence, 2000), and many genes involved in growth

control are conserved throughout evolution (Neufeld and

Edgar, 1998; Weinkove and Leevers, 2000).

Newly-hatched larvae must feed to reinitiate both

proliferation of imaginal cells and endoreplication of larval

tissues. If larvae are then transferred to amino acid-deprived

media, endoreplication stops, while proliferation and

growth of imaginal cells only slow down (Britton and

Edgar, 1998). Mutations for the Drosophila TOR homo-

logue (dTOR) also affect more growth of endoreplicative

tissues than imaginal discs (Oldham et al., 2000; Zhang

et al., 2000), suggesting that, congruent with studies in yeast

0925-4773/03/$ - see front matter q 2003 Elsevier Science Ireland Ltd. All rights reserved.

doi:10.1016/S0925-4773(03)00049-2

Mechanisms of Development 120 (2003) 645–655

www.elsevier.com/locate/modo

* Corresponding author. Address: Laboratoire de Genetique et de

Physiologie du Developpement, Institut de Biologie du Developpement

de Marseille, CNRS-INSERM-Universite de la Mediterranee, Case 907,

Parc Scientifique de Luminy, 13288 Marseille Cedex 09, France. Tel.:

þ33-4-91-26-96-11; fax: þ33-4-91-82-06-82.

E-mail address: perrin@ibdm.univ-mrs.fr (L. Perrin).

and mammals (Dennis et al., 1999), dTOR acts as a nutrient

sensor to orchestrate growth. In mammals, mTOR is

assumed to act in the PI3K signaling pathway (Gingras

et al., 1998) and to activate S6 Kinase (S6K), which results

in enhanced translation of mRNAs that encode components

of the protein synthesis machinery (Jefferies et al., 1997). In

Drosophila, mutations in intermediates of the PI3K

signaling pathway typically lead to a severe developmental

delay and an autonomous reduction in cell size, cell growth,

and proliferation without affecting cell identity specification

(Bohni et al., 1999; Verdu et al., 1999; Weinkove et al.,

1999). Drosophila mutations for S6K (dS6K) also reduce

cell size and cell growth (Montagne et al., 1999). However,

it has recently been shown that dS6K is independent of the

PI3K pathway, although it does require functional dTOR

(Radimerski et al., 2002a).

Quiescent cells, when stimulated to proliferate, grow

until they reach a size threshold required for the G1/S

transition (Gao and Raff, 1997; Killander and Zetterberg,

1965; Nurse et al., 1976). In mammals, mitogenic stimu-

lation induces the transient early expression of the Ras

and c-Myc proto-oncogenes (Eisenman and Cooper, 1995).

However, ectopic expression of c-Myc in mouse liver does

not activate cell proliferation, but rather leads to cell

hypertrophy accompanied by the induction of ribosomal and

nucleolar protein gene expression (Kim et al., 2000). This

suggests that in proliferative cells, c-Myc does not trigger

cell cycle progression per se, but rather directs cell growth

and hence allows cells to reach the critical size required for

G1/S progression. In Drosophila, over expressing the c-Myc

homologue (dMyc) increases the rate of cell growth but not

that of cell division. The G1/S transition is accelerated as a

consequence of an effect on Cyclin E, but cells accumulate

in G2 (Johnston et al., 1999). Ectopic expression of

Drosophila Ras (dRas) induces a comparable effect on

cell growth that is, at least in part, a consequence of

increased amount of dMyc protein (Prober and Edgar,

2000). Thus, the dMyc-dependent mechanism that triggers

Cyclin E expression at the G1/S transition is likely to be the

size sensor that links cell growth with cell cycle progression

(Stocker and Hafen, 2000).

Hence, dMyc and dRas, as well as the dTOR/dS6K

cassette and components of the PI3K pathway, participate in

independent pathways that converge to regulate both cell

size and cell growth. Conversely, a homologue for the tumor

suppressor PTEN (Di Cristofano and Pandolfi, 2000) has

been identified in Drosophila as a negative regulator of

growth that antagonizes the PI3K pathway (Goberdhan et al.,

1999; Stocker et al., 2002). Two additional tumor

suppressor genes, which together constitute the tuberous

sclerosis complex (TSC) (Young and Povey, 1998) have

been underscored in Drosophila (dTsc1 and dTsc2), as

mutation of either one of them increases both cell size and

growth (Potter et al., 2001; Tapon et al., 2001). In addition,

nucleolar size is strongly increased in dTSC1 mutant cells

(Gao and Pan, 2001). More recently, it has been reported

that TSC is able to downregulate S6Kinase activity both in

mammalian cells and in Drosophila (Gao et al., 2002;

Goncharova et al., 2002; Inoki et al., 2002; Manning et al.,

2002; Radimerski et al., 2002b; Tee et al., 2002). The

relationship of these regulators to the nucleolus and to

translational capacity strongly supports the notion that

ribosome biogenesis is a limiting step for growth. In favor

of this, a screen for growth defective mutants led to the

identification of new genes whose products are required for

protein synthesis (Galloni and Edgar, 1999).

Since the mechanisms through which these regulators

control cell growth remains largely elusive, identification of

their target genes constitutes a critical step to elucidate how

independent signals can be integrated to achieve the process

of growth. The modulo (mod; Garzino et al., 1992) gene

product has been previously shown to localize at the

nucleolus in proliferative cells (Perrin et al., 1998).

Consistent with this location at the site of ribosome

biogenesis (Shaw and Jordan, 1995), Mod displays a

modular organization, which is often found in non

ribosomal nucleolar proteins, including an acidic stretch,

two basic regions located at both ends of the molecule and

four reiterated RRMs (for RNA Recognition Motifs) in the

remaining core of the protein. We previously demonstrated

that RRMs provides a sequence-specific RNA binding

activity and that nucleolar Mod is highly phosphorylated

and part of a ribunucleoprotein complex (Perrin et al.,

1999). Whereas no vertebrate homologues have been

identified to date, Mod appears to be structurally related

to Nucleolin, an abundant protein of proliferating verte-

brate’s cells that has recently been shown to be transcrip-

tionnally activated by c-myc (Kim et al., 2000). We show

here that mod is required for growth and size control of

proliferative cells, but not of endoreplicative cells. Further-

more, in agreement with its cellular growth phenotypes and

its expression pattern similar to that of dmyc, we show that

mod is a transcriptional target of dMyc.

2. Results

2.1. Loss-of mod function induces a developmental delay but

does not affect growth of endoreplicative tissues

Modulo protein accumulates at the nucleolus (Perrin

et al., 1998). This observation prompted us to analyze the

function of mod in growth and proliferation processes. The

previously characterized A4-4L8 deletion (Garzino et al.,

1992) disrupts the divergently transcribed kurtz (krz) and

mod genes situated at the right tip of the third chromosome

(Roman et al., 2000). krz is an essential cell non-

autonomous neural gene, whose mutant phenotype can be

rescued by selective expression of a krz cDNA in the CNS

(Roman et al., 2000). Previous rescue experiments demon-

strated that lack of mod results in an extended larval third

instar and in a cell-autonomous Minute-like phenotype

L. Perrin et al. / Mechanisms of Development 120 (2003) 645–655646

(Perrin et al., 1998; Roman et al., 2000). The A4-4L8

deletion complemented with a krz rescue transgene (see

Section 4, Experimental procedures), hereafter referred to as

mod L8, has been used in this study to determine the function

of mod in controlling growth. Homozygous mod L8 larvae

reached the third larval stage with a 6-hour delay (data not

shown) and did not exhibit significant size differences

relative to wild type (Fig. 1A and B). In agreement with the

study of Roman et al. (2000), mod L8 larvae enter pupari-

ation with a 3-day delay (Fig. 1B). Most die as pharate adult.

The few escapers were reduced in body weight (26%) and

total wing area (6%). Remarkably, the wing cell area was

strongly reduced by 22% (Fig. 1C). Although these defects

are consistent with mod being required for growth and cell

size regulation, overall larval growth was not impaired in

5 day-old larvae (Fig. 1A). To gain insight into this striking

phenotype, larval tissues were analyzed during the third

instar. Interestingly, larval tissues in mod L8 animals were

normal, as depicted for the midgut, which was comparable

to wild type at 3–5 days AEL (Fig. 1D–G). The endo-

replicative cells of the larval gut were of normal size in

mod L8 mutants (Fig. 1H and I). The results indicate that

mod function is not required for growth of endoreplicative

cells.

The larval midgut also contains diploid intestinal adult

precursor cells (apc) that proliferate during larval stages to

form groups of approximately 4–8 cells prior to pupariation

in wild type (5 days AEL, Fig. 1H). In contrast, at the same

age, the mod L8 midgut had fewer isolated intestinal apc,

usually as doublets, or occasionally as groups of 3–4 cells

(Fig. 1I). In addition, mutant apc appeared smaller than wild

type (data not shown). Proliferation was, however, not

arrested, since apc eventually formed groups of 4–8 cells in

7 days AEL mutant larvae (data not shown). Taken together,

these observations suggest that mod is selectively required

in diploid cells to sustain growth.

2.2. Mod is autonomously required for growth and size

control of imaginal cells

Imaginal discs are composed mainly of proliferative

cells. To better understand mod L8 related growth defects,

imaginal discs were analyzed during larval development. As

shown in Fig. 2A and B, mod L8 wing imaginal discs were

severely delayed in growth. However, at the extended third

instar (7–8 days AEL), the mutant discs attained a size

comparable to prepupal wild type discs (Fig. 2A and B),

suggesting that mod is required for growth of imaginal

tissues. The reduced growth rate was not due to an enhance-

ment of cell death, as no increase of apoptotic cells was

observed in mod L8 mutant imaginal discs stained with

acridine orange (data not shown). Somatic mod L8 clones

exhibit a growth-related phenotype characterized by short

slender bristles and reduced cell number (Perrin et al.,

1998). Within third instar discs, mod L8 clones contained

very few cells when induced in a wild type background (data

Fig. 1. Recessive phenotypes of mod loss-of-function. The age in days after

egg laying (AEL), of wild type (A) and mod L8 mutant (B), is indicated

underneath. Note that regarding growth, wild type and mod L8 five day-old

larvae look similar; mod L8 mutant display an extended third instar larval

period and develop to pharate. (C) Growth defects of mod L8 escapers:

reduction in male weight (mg), wing area (mm2) and cell area (mm2) are

plotted (n ¼ 12 and error bars indicate standard deviations). (D–G)

Hoechst DNA staining of wild type (left) and mutant (right) anterior

midguts (same magnification) dissected at 3 (D-E) and 5 days (F–G) AEL.

Note that mod loss-of-function does not modify the growth of this larval

tissue. (H–I) A higher magnification of wild type and mod L8 anterior

midguts at 5 days AEL shows that in the mutant the number of intestinal

adult precursor cells (apc) is much lower (arrow), while size of

endoreplicative larval cells seem unaffected.

L. Perrin et al. / Mechanisms of Development 120 (2003) 645–655 647

not shown), confirming the cell autonomous nature of mod

function. In contrast, clones were larger and comprised

many more cells when induced in a Minute background

(Fig. 2C). As Minute cells are known to be at a growth and

proliferative disadvantage (Morata and Ripoll, 1975), these

results indicate that mod L8 cells grow and proliferate at a

lower rate than wild type cells.

To address the question of a potential effect during cell

cycle progression, dissociated cells from mod L8 prepupal

wing discs were analyzed with a fluorescence-activated cell

sorter (FACS). Cell cycle profile analysis did not reveal

any significant difference in mutant versus wild type cells

(Fig. 2D). However, the mod mutation is associated with a

reduction in size of both G1 and G2 cells (Fig. 2D). This

observation suggests that Mod also acts on cell size control

as reported for other growth regulators (Montagne, 2000).

2.3. Mod over-expression does not alter compartment size

Loss-of-function experiments showed that Mod is

necessary for cell growth. We then tested whether over-

expression suffices to stimulate cell growth. Using the

UAS/Gal4 system, Mod was overproduced together with

GFP in the entire posterior compartment of wing imaginal

discs. This over-expression did not significantly increase

posterior compartment size (Fig. 3A and B). Using GFP as a

landmark, the determination of the posterior/anterior area

ratio showed that compartment size was not affected

(Fig. 3E). To examine a possible effect on apoptosis, wing

discs over-expressing Mod in their posterior compartments

were stained with Acridine Orange. Clearly, apoptotic cells

were more abundant in the posterior than in the anterior

compartment (Fig. 3C), indicating that an excess of Mod

results in increased cell death. Interestingly, although

co-expression of P35 with Mod efficiently suppresses

apoptosis, this did not modify the posterior/anterior ratio

(Fig. 3D–E). Taken together, these results show that

Mod-induced apoptosis does not influence compartment

size.

Nevertheless, the fact that over-expressed Mod is not

able to overcome the limit on compartment size could mask

specific effects on individual cells. Therefore, imaginal disc

cells either over-expressing GFP alone or Mod þ GFP

marker within their posterior compartment, were disso-

ciated and analyzed by FACS. mod gain-of-function within

the whole posterior compartment left the cell cycle profile

unaltered (Fig. 3F). However, both these G1 and G2 cells

were slightly bigger (Fig. 3F), whereas cells from the

anterior compartment (GFP minus) were similar in size

(data not shown). This observation suggests that over-

expression of Mod can trigger a cell size increase but not

compartment growth.

2.4. Clonal over-expression of Mod

To further investigate the function of Mod in the context

of cell competition, the ‘flip out’ technique was used to

generate clones over-expressing Mod. Over-expression of

Mod was accompanied by GFP as marker, and P35 to inhibit

Mod-induced apoptosis (Fig. 3 and data not shown). In

control clones, proliferation and growth rates were identical

(Fig. 4A and B; Mass Doubling Time (MDT) ¼ Cell

Doubling Time (CDT) ¼ 11.9 h), congruent with the

Fig. 2. mod loss-of-function affects growth of imaginal tissues. (A–B)

Hoechst DNA staining of wild type (A) and mod L8 (B) third instar wing

discs (same magnification) dissected at various days AEL (indicated at the

bottom right of each panel). Note that growth of mutant imaginal discs is

severely impaired but still continues during the extended larval period,

which allows the disc to eventually reach a size comparable to that of

wild type. (C) mod L8 homozygous somatic clones observed in yw,

HS-Flp/P{b5.8T12}; FRT82B, HS-pmyc, M(3)96C/ FRT82B, mod L8

larvae were induced during first larval stage. As surrounding Minute cells

have a growth disadvantage, large mod 2/2 mutant clones are recovered.

Imaginal discs were double stained with Mod specific antibody (green) and

with propidium iodine (red). (D) FACS analysis of dissociated cells from

either mod L8 (black) or wild type (red) wing imaginal discs. Cell cycle

profiles (left), as estimated by DNA content, are unchanged in the mutant,

whereas both G1 (top right) and G2 (bottom right) cells have a reduced size

in the mod L8 mutant, as measured by forward scatter (FSC).

L. Perrin et al. / Mechanisms of Development 120 (2003) 645–655648

expected coupling of cell growth and proliferation in wild

type imaginal discs (Neufeld et al., 1998). Unexpectedly,

clonal over-expression of Mod did not modify the growth

rate (MDT ¼ 12.0 h), but was associated with significantly

slower proliferation (CDT ¼ 13.6 h). While these obser-

vations show that Mod is not sufficient to trigger cell

growth, they also implicate Mod over-expression in

increased cell size. To verify the apparent cell size increase,

dissociated cells from discs containing GFP clones were

analyzed by FACS. Consistent with the delay in cell

Fig. 3. Over-expression of Mod within posterior compartment of wing

discs, does not affect growth but increases cell size. The enGal4 driver has

been used to induce GFP alone (A) or in combination with Mod (B, C) or

with Mod and P35 (D) in the posterior compartment of wing imaginal discs.

(A, B) Detection of GFP fluorescence. (C) Acridine Orange staining

indicates that Mod over-expression induces apoptosis. (D) P35 expression

prevents Mod-induced apoptosis. (E) The relative area of the anterior and

posterior compartments were calculated by measuring the number of pixels

with Adobe Photoshop (see Section 4, Experimental procedures), and used

to determine the mean value of the posterior/anterior area ratio for each

genotype from the indicated number ðnÞ of discs analysed. Bars indicate

standard variations. (F) FACS analysis of dissociated cells from wing

imaginal discs over-expressing either GFP alone (grey) or in combination

with Mod (black) in the posterior compartment. Mod over-expression does

not affect the cell cycle profile (as estimated by DNA content, left), but

induces a size increase of both G1 (top right) and G2 (bottom right) cells, as

measured by forward scatter (FSC).

Fig. 4. Clones over-expressing Mod display an increased cell size. (A) Cell

doubling time (CDT) of clones over-expressing various combinations of

GFP, Mod P35 and Stg, as indicated. Clones were generated by inducing

ectopic Act . Gal4 at 72 h AEL, and analysed at 120 h AEL. Clones have

been classified with respect to the number of cells they contain. The number

of clones in each class is plotted as a percentage of the total number ðnÞ of

clones analysed for each genotype. Median CDT are indicated in each

panel. (B) The mean value of clone area (plotted in pixels) has been

calculated with Adobe Photoshop (see Section 4, Experimental procedures)

from the given number of clone ðnÞ and used to calculate the mass doubling

time (MDT); the statistically significance was estimated by T-test

(P [StgþMod/wt] ¼ 1.6 £ 10210; P [StgþMod/Mod] ¼ 4.9 £ 10211;

P [StgþMod/Stg] ¼ 2.6 £ 10218; P values are considered highly significant

when less than 0.01). (C) FACS analysis of dissociated cells from wing

imaginal discs. Cells over-expressing GFP in combination with Mod

(black) have been compared to the surrounding GFP minus cells from the

same disc (grey). Clones were generated as described above (A). Mod

over-expression in clones induces a decrease in G1 cell number

accompanied by an accumulation of G2 cells (left), but also a size

increase of both G1 (top right) and G2 (bottom right) cells, as measured

by forward scatter (FSC).

L. Perrin et al. / Mechanisms of Development 120 (2003) 645–655 649

doubling, Modþ cells were indeed slightly larger than wild

type, although the effect was more pronounced in G2 than in

G1 cells (Fig. 4C). Moreover, analysis of the cell cycle

profile revealed that the population of over-expressing cells

was reduced in G1 relative to G2 (Fig. 4C). In contrast,

the cell cycle profile was not changed upon mod

mis-expression within the entire compartment, either in

loss-of-function mutants (Fig. 2D) or in compartment

over-expression (Fig. 3F). A similar discrepancy has been

reported in loss-of-function mutants for Drosophila TOR: in

mosaic wing discs, mutant cells accumulate in G1 (Zhang

et al., 2000), whereas the cell cycle profile is unchanged

when the entire wing disc is mutant (Oldham et al., 2000).

The molecular mechanism underlying cell competition

might be responsible for this discrepancy, creating inter-

ference with cell cycle progression in heterogeneous cell

populations.

In Modþ clones, the cell size increase along with the G2

accumulation raised the possibility that Mod may slow

down cell division by delaying G2/M transition. To address

this question, String (the rate limiting phosphatase for

G2/M; Neufeld et al., 1998) was expressed alone or in

combination with Mod using the ‘flip out’ technique. Cell

division was slightly faster in Stringþ cells as compare to

wild type (CDT ¼ 10.9 and 11.9 h, respectively; Fig. 4A),

and further accelerated upon co-expressing Mod and String

together (CDT ¼ 10 h; Fig. 4A). If Mod functions as a brake

of G2/M transition, co-expression of String might counter-

act this effect. However, expressing Mod and String

together accelerates cell division rate more than String

alone does. Hence, this cooperative effect rather excludes

that Mod could antagonize String at G2/M transition.

Strikingly, String over-expression promoted growth of

Modþ cells (MDT ¼ 10.5 h for Mod and String together,

as compared to 12 and 13 h for either Mod or String,

respectively, Fig. 4B). No evident hypothesis can be

proposed to explain how is accomplished the overgrowth

induced by Mod and String co-expression. However, this

observation indicates that Mod, while insufficient to direct

growth alone, can nonetheless cooperate with Stg to

promote growth.

2.5. Mod is a dMyc target

During embryogenesis, the pattern of mod expression

(Graba et al., 1994) closely resembles that of dmyc (Gallant

et al., 1996). As shown in Fig. 5D, in stage 10 embryos mod

transcripts are visible in the mesoderm, the anterior and

posterior midgut precursors, the salivary gland precursors in

parasegment 2 and the anal plate. This pattern is

indistinguishable from that of pitchoune ( pit), a potential

dMyc target (Zaffran et al., 1998). In ovaries, transcripts of

dmyc, pit and mod, are likewise identically detected

throughout egg chamber development, except at stage 2

(Gallant et al., 1996; Zaffran et al., 1998 and our

unpublished observations). To determine whether mod

expression is transcriptionally controlled by dMyc, mod

mRNA level was measured in loss-of function dmyc

mutants. No change in mod expression was observed (data

not shown) for the viable hypomorphic allele dmyc P0

(Johnston et al., 1999). In contrast, both in situ hybridization

and quantitative RT-PCR on third instar larval imaginal

discs, showed that mod transcription was severely impaired

in the pupal lethal dmyc PL35 mutants (Bourbon et al., 2002;

Fig. 5A, B). Thus sufficient diminishing of dmyc þ

function reveals dMyc requirement for mod expression.

The effect of dMyc on mod transcription was also analyzed

in gain-of-function experiments, using the UAS/Gal4

system. In third instar wing imaginal discs, dMyc over-

expression directed by dpp regulatory sequences led to a

marked increase in mod transcription (Fig. 5C). Also, in

engrailed(en)-Gal4/UASdmyc embryos, mod transcription

was strongly induced in the posterior cells of each

Fig. 5. Transcriptional regulation of mod by dMyc. (A) Suppression of mod

transcripts in dmycPL35 loss-of function mutant in third instar wing imaginal

discs as compared to wild type. (B) Similar suppression of mod mRNA and

dMyc mRNA level in dmycPL35 mutant is observed by semi-quantitative

RT-PCR; note that the transcript level of the internal control croquemort

(croq) is not affected in dmycPL35 mutant. (C) In situ detection of mod

transcripts in third instar larval wing imaginal discs, either UASdmyc (left)

or dppGAL4-UASdmyc (right); note the strong ectopic expression of mod

transcripts at the A/P compartment boundary in response to dmyc over-

expression. (D) In situ detection of mod transcripts in early stage 11

embryos, either enGAL4 (left), or enGAL4-UASdmyc (right); note the

strong ectopic expression of mod transcripts in the posterior cells of each

parasegment upon dmyc induction.

L. Perrin et al. / Mechanisms of Development 120 (2003) 645–655650

parasegment where dMyc was over-expressed (Fig. 5D).

Taken together, these results show that dMyc is required for

mod expression.

2.6. mod transcriptional activation by dMyc depends on an

E box sequence element

E-boxes constitute functional Myc binding sites that

typically reside downstream of the transcriptional start sites

of target genes (Grandori and Eisenman, 1997). The action

of Myc in regulating transcription has been described as

involving binding of Myc homo-or heterodimers to an

‘E-box’ sequence based on a ‘CACGTG’ motif. A 1 kb

DNA fragment located upstream of mod coding sequences

has previously been shown capable of directing reporter

gene expression that mimics the mod embryonic expression

pattern (Alexandre et al., 1996 and Fig. 6A). This fragment

harbors a canonical CACGTG E-box between the mod

initiator ATG and a transcriptional start site assigned by

primer extension (data not shown and Fig. 6B). A 365 bp

fragment (P1) encompassing both the transcription start site

and the E-box (Fig. 6A and B) was fused to a Lac-Z reporter

gene. Trangenic flies containing this P1-LacZ chimeric gene

expressed b-Gal in a pattern similar to endogenous mod.

Further, on expressing dMyc in embryos (enGAL4,

UASdMyc), mod expression and P1-LacZ expression were

augmented in the posterior compartments (compare Fig. 6C

with Fig. 5D). To ask whether the responsiveness of P1 to

dMyc is E-box dependant, the canonical CACGTG E-box

was mutated (CAGGTG) to abolish a potential dMyc-DNA

interaction, according to Myc binding specificity (Grandori

and Eisenman, 1997 and Fig. 6B). When fused to a Lac-Z

reporter gene, this mutated P1 fragment was no longer able

to mimic the mod transcription pattern, either in wild type or

en-Gal4/UASdmyc embryos (Fig. 6, compare D with C).

Taken together, these results strongly support the notion that

mod transcription is controlled by dMyc, and favor the

possibility that dMyc binds directly to the canonical E-box

residing in mod regulatory sequences.

3. Discussion

Recent studies have underscored a role for dMyc both in

cell growth and cell size regulation. In contrast, little is yet

known concerning target genes regulated by dMyc in vivo

and their functions. We have shown here that mod is a

downstream target of dMyc and is likely to be directly

regulated. We previously demonstrated that Mod is a dual

chromatin/RNA binding protein mainly located at the

nucleolus (Perrin et al., 1999). In the same vein, diminished

mod activity leads to a Minute-like phenotype (Perrin et al.,

1998; Roman et al., 2000), thus suggesting a role for Mod in

ribosome biogenesis. Here we have carried out a detailed

analysis of mod growth-related phenotypes and have shown

that it acts on growth and size of proliferative cells.

Fig. 6. mod transcriptional activation by dMyc depends on an E box

sequence within its promoter. (A) A BamH1-Mlu1 DNA fragment (B and

M, respectively) encompassing the mod transcription start site (arrow), has

been previously shown to direct the embryonic expression of a reporter

gene in a pattern identical to that of mod (Alexandre et al., 1996). Location

of the Mod ATG (p) and of the P1 DNA fragment (dotted line) are

indicated. (B) Putative regulatory region in the vicinity of the mod

transcription start site (þ1) determined by primer extension analysis (the

primer-matching sequence is underlined). The Mlu1 restriction site is

indicated, the ATG is doubly underlined and the putative Myc binding site

CACGTG is boxed. The P1 fragment expends from 2136 to þ229

nucleotide positions. (C) The P1-LacZ transgene directs bGal expression

(left) in a pattern identical to that of mod (compare with Fig. 5A). Note the

staining in the mesoderm, the anterior and posterior midgut, the salivary

gland precursors and the anal plate. In P1-LacZ embryos, dMyc ectopic

expression driven by enGAL4 induces bGal expression in the posterior

cells of each parasegment (right). (D) Left: Mutation of the E box sequence

within the P1 fragment leads to dramatic suppression of bGal expression.

Faint bGal staining is observed in anterior and posterior midgut while

mesoderm, salivary gland precursors and anal plate no longer express bGal.

Right: Ectopic induction of dMyc has no effect on P1 mut-LacZ expression.

L. Perrin et al. / Mechanisms of Development 120 (2003) 645–655 651

3.1. mod functions downstream of dMyc selectively in

proliferative cells

mod loss-of-function selectively affects imaginal diploid

cells but not endoreplicative tissues. In addition, Mod over-

expression affects diploid cells but not endoreplicative

tissues. For instance, salivary glands cells were bigger in

cell and nucleus size upon ectopic expression of dMyc, but

looked normal following Mod over-expression (L.P.,

unpublished results).

Since amino acids directly control growth of endorepli-

cative tissues (Britton and Edgar, 1998), it is unlikely that

Mod is related to nutrient availability. Indeed, in agreement

with the phenotype specific for proliferative cells, we show

here that mod transcription is controlled by dMyc, whose

mammalian homologue is a proto-oncogene deregulated in

various tumors (Pelengaris et al., 2000). Furthermore, we

identified in the 50 UTR of mod an E-box DNA element that

confers dMyc responsiveness to the mod transcription unit,

suggesting that mod is a direct target of dMyc. In contrast,

this transcriptional promoter element is not responsive to

Drosophila PI3K (L.P., unpublished results). This indicates

that mod expression is not simply controlled by cell growth

and cell size increase, but constitutes a specific dMyc target

in the mitogenic response. Nevertheless, mod is certainly

not involved in all the various cellular processes controlled

by dMyc, as in dmyc PL35 mutant, imaginal and endorepli-

cative tissues are equally affected (L.P., unpublished

results).

3.2. Mod functions in the nucleolus

We previously reported Mod to be a sequence-specific

RNA binding protein, which localizes mainly to the

nucleolus in a highly phosphorylated ribonucleoprotein

complex (Perrin et al., 1999). In addition, Mod is detected

throughout the entire nucleolus of proliferative imaginal

cells, but is present only at the nucleolar periphery in larval

cells (Perrin et al., 1998). In light of our observation that

mod selectively affects growth and size of proliferative

imaginal cells, it is likely that Mod is functionally required

within the nucleolus. Hence, regarding its RNA-binding

properties as well as its requirement for cell growth, Mod

might affect ribosome biogenesis.

Mod phosphorylation is stimulated by serum in cell

culture (Perrin et al., 1999), suggesting that Mod may act as

an integrator of dMyc transcriptional activity and of kinase

cascades such as the PI3K signaling pathway. Drosophila

PI3K is a dimer of Dp110 catalytic and P60 regulatory

subunits, and acts as a growth promoter (Weinkove et al.,

1999). It is, however, unlikely that this kinase activity

affects the nucleolar localization of Mod, since ubiquitous

expression of dominant negative or constitutively active

Dp110 derivatives do not perturb Mod sub-nucleolar local-

ization in either imaginal cells or endoreplicative tissues

(L.P., unpublished results).

Mod shares structural similarities with Nucleolin, the

most abundant nucleolar protein in mammalian cells

(Ginisty et al., 1999). Strikingly, Nucleolin relocalizes at

the periphery of the nucleolus upon actinomycin treatment

(Caizergues-Ferrer et al., 1987) and is upregulated in hyper-

trophic mouse liver cells induced by c-Myc over-expression

(Kim et al., 2000). Furthermore, the human RNA-helicase

MrDb and its Drosophila counterpart Pit are also targets

for c-Myc and dMyc, respectively (Grandori et al., 1996;

Zaffran et al., 1998). This suggests that Myc function as well

as that Myc target genes may have been conserved through-

out evolution, although functional homology between Mod

and Nucleolin remains to be demonstrated.

3.3. Mod effects on cell size, growth and proliferation

Consistent with mod being a dMyc target, our experi-

ments revealed that Mod is required for growth of imaginal

cells. However, in contrast to dMyc, over-expression of

Mod does not trigger cell growth on its own, indicating that

additional target genes are required to mediate the growth

enhancement induced by dMyc. Also, that loss-of mod

function only affects proliferative cells reveals that different

target genes are recruited to accomplish the dMyc-

dependent growth in endoreplicative tissues.

Over-expression of Mod alone does not increase cell

growth but leads to a slight increase in cell size. In Modþ

clones, the cell size increase is accompanied by an increase

in G2 cells, which might be due to a block at G2/M tran-

sition leading to a subsequent slow down of cell division

rate. Since dMyc over-expression does not affect G2/M

transition it is, therefore, unlikely that Mod, a dMyc-target,

could repress G2/M transition. We also have ruled out such

a Mod-induced negative effect on cell cycle progression, as

over-expressing Mod and String together accelerates cell

division more than String alone does. This unambiguously

excludes a Mod negative effect on cell cycle regulators, but

somewhat suggests an acceleration of G1/S transition in

Modþ clones. Since the decrease of the G1/G2 ratio does not

occur when Mod is over-expressed within the entire

compartment, it is, however, unlikely that Mod acts directly

on cell cycle progression. In contrast, the fact that in adult

wings of mod L8 escapers cell size was more reduced (22%)

than overall wing area (6%), suggests that Mod could

directly act on cell size through a not yet characterized

mechanism. This hypothesis is further supported by the

observation that change in Mod dosage always induces cell

size variations, which can be observed in absence of cellular

growth effect.

In conclusion, we provide the first in depth analysis of the

in vivo effects of a dMyc target, mod. Loss-of mod function

results in a slow down of growth that is restricted to

proliferative cells, whereas Mod over-expression is not

sufficient to accelerate cell growth rate. However, when

co-expressed with String, Mod is able to increase cell

growth, validating the concept that cell growth achievement

L. Perrin et al. / Mechanisms of Development 120 (2003) 645–655652

integrates various independent molecular events. Therefore,

future work dedicated to the identification of other dMyc-

target should shed light on the molecular mechanisms that

control cell size and cell growth downstream of dMyc in the

mitogenic response.

4. Experimental procedures

4.1. Fly strains

UASmod and P1-LacZ lines were generated by

P-element mediated transformation. In the P{b5.8T12};

mod L8/TM6B strain (Roman et al., 2000), the mod L8

deletion removes the last three genes at the Tip of 3R. These

are, from centromere to telomere, kurtz, mod and MAP 205.

It has been shown that MAP205 is a non-essential gene

(Pereira et al., 1992). Indeed terminal deletions of 3R, which

only delete MAP205, are viable and do not display any

growth defect. Since the P{b5.8T12} insertion mediates a

selective krz rescue (Roman et al., 2000), the P{b5.8T12};

mod L8/TM6B selectively allowed the determination of mod

loss of function phenotypes.

The following fly strains have already been described:

UASP35 (Hay et al., 1994); FRT82B, mod L8/TM6B (Perrin

et al., 1998); Actin5C . CD2 . Gal4, UAS-GFP and

enGal4, UASGFP (Neufeld et al., 1998); UASdmyc

(Zaffran et al., 1998). The FRT82B, HS-pmyc, M(3)96C

strain was generated by recombination of the FRT82B,

HS-pmyc chromosome (Xu and Rubin, 1993) with the

Minute mutation M(3)96C. To analyse somatic clones in a

context rescued for krz, the krz rescue transgene

(P{b5.8T12}) and the FRT82B, mod L8 chromosome were

brought in the same line (P{b5.8T12}; FRT82B mod L8/

TM6B). The dmyc PL35 mutant (Bourbon et al., 2002)

specifically affects dmyc function, as lethality can be

rescued by ectopic dMyc expression (C.B. and D. Cribbs

unpublished result).

4.2. Generation of somatic clones

mod somatic clones were generated as previously

described (Perrin et al., 1998). For the generation of somatic

clones in a Minute background, a chromosome bearing both

the FRT82B insertion and the Minute mutation M(3)96C was

constructed.

4.3. Immunohistochemistry, histology and in situ

hybridisation

Dissected larval tissues and imaginal discs were fixed in

4% paraformaldehyde/PBT (PBS, 0.1% Triton X100) for

15 min at room temperature, washed in PBT and incubated

5 min in Hoechst solution (5 mg/ml) for DNA detection.

Tissues were extensively washed in PBT, and then mounted

in Permafluor (Immunotech, France). Apoptotic cells were

identified by Acridine Orange staining as described

(Neufeld et al., 1998). Mod immunodetection on third

larval imaginal discs was performed as previously

described, (Perrin et al., 1998) then discs were treated

with RNAse A (15 mg/ml) in PBT, washed and incubated in

a 5 mg/ml propidium iodine solution for 3 minutes. After

several washes in PBT, discs were mounted in Permafluor

for observation. In situ hybridisation was performed using a

digoxigenin labelled probe according to Graba et al. (1994)

and b-Galactosidase staining was performed as described in

Alexandre et al. (1996).

4.4. RNA extraction and RT-PCR

Total RNAs were extracted from embryos with the Trizol

procedure following manufacturer’s instructions (Gibco

BRL). One mg of total RNA was reverse transcribed using

Superscript II RNase H2 reverse transcriptase (Gibco BRL)

and oligodT primer in a final reaction volume of 20 ml. Semi

quantitative PCR was performed using 2 ml of reverse

transcript sample per reaction, 200 nM of each primer and

2U of Taq polymerase (Promega). The thermal cycling

conditions included an initial denaturation step (95 8C for

5 min) and 20, 23, 26 and 29 cycles (94 8C for 30 s; 58 8C

for 30 s and 728 for 1 min). Experiments were performed in

duplicate. The sequences of the different primers used are

the following: crq F: GCTGGCTGGAGGCACCTATCC30,

crqR: GCGGGAACATGTCGCCCGTGG30; dmycF: 50CC-

GACGACCGGCTCTGATAG30, dmycR: 50GGCACGAG-

GGATTTGTGGGTA30; modF: 50CGTGGAGGCGGTGA

CTATATC30, modR: 50CACTTTCCGCAGGTCGGCTTC30.

4.5. Size measurement in adults

Twelve flies, either wild type or mod L8 escapers grown

in optimal feeding conditions, were weighed 2 days after

hatching. Analysis of wing area and cell density was

performed as previously described (Montagne et al., 1999).

4.6. Flow cytometry

Six hours egg collections from wild type or mod l8/þ

adults were grown in optimal feeding conditions. 20 larvae

of each genotype were collected just prior to pupariation

during the short window of time (less than 3 h) when larvae

immobilize and are no longer reactive, preceding anterior

spiracle eversion and hardening of the external tissues

(Bainbridge and Bownes, 1981). FACS analyses were

performed according to Neufeld et al. (1998). Experiments

were reproduced at least three times.

4.7. Proliferation and growth rate measurements

Clones expressing Gal4 were induced and identified

using the flip out technique in HS-Flp; Act . CD2 . Gal4,

UASGFP as described (Neufeld et al., 1998). GFP positive

L. Perrin et al. / Mechanisms of Development 120 (2003) 645–655 653

cells were counted using a Zeiss AxioPhot microscope.

Cell doubling times (CDT) were obtained from the formula

tðln 2=ln NÞ; where N is the mean cell number per clone and

t the age (hours) of the clone. To measure clone and

compartment size, discs were imaged using a Zeiss

AxioPhot microscope and the areas of GFP-positive clones

determined using the histogram function of Adobe Photo-

shop. Clonal over-expression was undertaken so that each

discs did not contain more than five clones to avoid overlap

between them. Each experiment was repeated at least twice

on more than 80 clones for each condition leading to

reproducible results. Mass doubling times (MDT) were

calculated as MDT ¼ t{ln 2/ln(final clone area/area of one

cell)} where t is the age (hours) of the clone.

4.8. P-element mediated transformation

UASmod was constructed by ligation of the mod cDNA

into a P(UAST) vector (Brand and Perrimon, 1993). Wild

type or mutant P1 fragments containing mod regulatory

sequences were generated by PCR amplification (primers

available upon request) and subcloned in p(CasperAUG-

bGal). P-element transformation used standard methods

(Rubin and Spradling, 1982). Several independent trans-

formants were tested and gave similar results for each

construct.

Acknowledgements

We thank G. Roman and R.L. Davis for P{b5.8T12};

mod L8/TM6B flies, the Bloomington Stock Centre for

providing the strains used for the somatic and germ line

clonal analyses and Pierre Leopold for UAS stocks. We also

would like to thank Tracy Hayden for help with the FACS

analysis and Michel Semeriva for fruitful discussions

throughout this work. We also thank D. Cribbs for critical

comments on the manuscript. This work was supported by

the CNRS and by grants from l’ARC, LNCC and ACI to

J.P., by a CEFIPRA postdoctoral fellowship to L.P. (Grant

No. 1603-1) and by the Swiss Cancer League to J.M.

References

Alexandre, E., Graba, Y., Fasano, L., Gallet, A., Perrin, L., De Zulueta, P.,

et al., 1996. The Drosophila teashirt homeotic protein is a DNA-binding

protein and modulo, a HOM-C regulated modifier of variegation, is a

likely candidate for being a direct target gene. Mech. Dev. 59, 191–204.

Bainbridge, S.P., Bownes, M., 1981. Staging the metamorphosis of

Drosophila melanogaster. J. Embryol. Exp. Morphol. 66, 57–80.

Bohni, R., Riesgo-Escovar, J., Oldham, S., Brogiolo, W., Stocker, H.,

Andruss, B.F., et al., 1999. Autonomous control of cell and organ size

by CHICO, a Drosophila homolog of vertebrate IRS1-4. Cell 97,

865–875.

Bourbon, H.M., Gonzy-Treboul, G., Peronnet, F., Alin, M.F., Ardourel, C.,

Benassayag, C., et al., 2002. A P-insertion screen identifying novel

X-linked essential genes in Drosophila. Mech. Dev. 110, 71–83.

Brand, A.H., Perrimon, N., 1993. Targeted gene expression as a means of

altering cell fates and generating dominant phenotypes. Development

118, 401–415.

Britton, J.S., Edgar, B.A., 1998. Environmental control of the cell cycle in

Drosophila: nutrition activates mitotic and endoreplicative cells by

distinct mechanisms. Development 125, 2149–2158.

Caizergues-Ferrer, M., Belenguer, P., Lapeyre, B., Amalric, F., Wallace,

M.O., Olson, M.O., 1987. Phosphorylation of nucleolin by a nucleolar

type NII protein kinase. Biochemistry 26, 7876–7883.

Cohen, S.M., 1993. Imaginal Disc Development, Cold Spring Harbor

Laboratory Press, Cold Spring Harbor.

Conlon, I., Raff, M., 1999. Size control in animal development. Cell 96,

235–244.

Day, S.J., Lawrence, P.A., 2000. Measuring dimensions: the regulation of

size and shape. Development 127, 2977–2987.

Dennis, P.B., Fumagalli, S., Thomas, G., 1999. Target of rapamycin (TOR):

balancing the opposing forces of protein synthesis and degradation.

Curr. Opin. Genet. Dev. 9, 49–54.

Di Cristofano, A., Pandolfi, P.P., 2000. The multiple roles of PTEN in

tumor suppression. Cell 100, 387–390.

Eisenman, R.N., Cooper, J.A., 1995. Signal transduction. Beating a path to

Myc. Nature 378, 438–439.

Follette, P.J., Duronio, R.J., O’Farrell, P.H., 1998. Fluctuations in cyclin E

levels are required for multiple rounds of endocycle S phase in

Drosophila. Curr. Biol. 8, 235–238.

Gallant, P., Shiio, Y., Cheng, P.F., Parkhurst, S.M., Eisenman, R.N., 1996.

Myc and Max homologs in Drosophila. Science 274, 1523–1527.

Galloni, M., Edgar, B.A., 1999. Cell-autonomous and non-autonomous

growth-defective mutants of Drosophila melanogaster. Development

126, 2365–2375.

Gao, F.B., Raff, M., 1997. Cell size control and a cell-intrinsic maturation

program in proliferating oligodendrocyte precursor cells. J. Cell. Biol.

138, 1367–1377.

Gao, X., Pan, D., 2001. TSC1 and TSC2 tumor suppressors antagonize

insulin signaling in cell growth. Genes Dev. 15, 1383–1392.

Gao, X., Zhang, Y., Arrazola, P., Hino, O., Kobayashi, T., Yeung, R.S.,

et al., 2002. Tsc tumour suppressor proteins antagonize amino-acid–

TOR signalling. Nat. Cell. Biol. 4, 699–704.

Garcia-Bellido, A., Ripoll, P., Morata, G., 1973. Developmental compart-

mentalisation of the wing disk of Drosophila. Nat. New Biol. 245,

251–253.

Garzino, V., Pereira, A., Laurenti, P., Graba, Y., Levis, R.W., Le Parco, Y.,

et al., 1992. Cell lineage-specific expression of modulo, a dose-

dependent modifier of variegation in Drosophila. Embo. J. 11,

4471–4479.

Gingras, A.C., Kennedy, S.G., O’Leary, M.A., Sonenberg, N., Hay, N.,

1998. 4E-BP1, a repressor of mRNA translation, is phosphorylated and

inactivated by the Akt(PKB) signaling pathway. Genes Dev. 12,

502–513.

Ginisty, H., Sicard, H., Roger, B., Bouvet, P., 1999. Structure and functions

of nucleolin. J. Cell. Sci. 112, 761–772.

Goberdhan, D.C., Paricio, N., Goodman, E.C., Mlodzik, M., Wilson, C.,

1999. Drosophila tumor suppressor PTEN controls cell size and number

by antagonizing the Chico/PI3-kinase signaling pathway. Genes Dev.

13, 3244–3258.

Goncharova, E.A., Goncharov, D.A., Eszterhas, A., Hunter, D.S.,

Glassberg, M.K., Yeung, R.S., et al., 2002. Tuberin regulates p70 S6

kinase activation and ribosomal protein S6 phosphorylation. A role for

the TSC2 tumor suppressor gene in pulmonary lymphangioleiomyo-

matosis (LAM). J. Biol. Chem. 277, 30958–30967.

Graba, Y., Laurenti, P., Perrin, L., Aragnol, D., Pradel, J., 1994. The

modifier of variegation modulo gene acts downstream of dorsoventral

and HOM-C genes and is required for morphogenesis in Drosophila.

Dev. Biol. 166, 704–715.

Grandori, C., Eisenman, R.N., 1997. Myc target genes. Trends Biochem.

Sci. 22, 177–181.

Grandori, C., Mac, J., Siebelt, F., Ayer, D.E., Eisenman, R.N., 1996.

L. Perrin et al. / Mechanisms of Development 120 (2003) 645–655654

Myc-Max heterodimers activate a DEAD box gene and interact with

multiple E box-related sites in vivo. Embo. J. 15, 4344–4357.

Hay, B.A., Wolff, T., Rubin, G.M., 1994. Expression of baculovirus P35

prevents cell death in Drosophila. Development 120, 2121–2129.

Inoki, K., Li, Y., Zhu, T., Wu, J., Guan, K.L., 2002. TSC2 is phosphorylated

and inhibited by Akt and suppresses mTOR signalling. Nat. Cell. Biol.

4, 648–657.

Jefferies, H.B., Fumagalli, S., Dennis, P.B., Reinhard, C., Pearson, R.B.,

Thomas, G., 1997. Rapamycin suppresses 5’TOP mRNA translation

through inhibition of p70s6k. Embo. J. 16, 3693–3704.

Johnston, L.A., Prober, D.A., Edgar, B.A., Eisenman, R.N., Gallant, P.,

1999. Drosophila myc regulates cellular growth during development.

Cell 98, 779–790.

Killander, D., Zetterberg, A., 1965. A quantitative cytochemical investi-

gation of the relationship between cell mass and initiation of DNA

synthesis in mouse fibroblasts in vitro. Exp. Cell. Res. 40, 12–20.

Kim, S., Li, Q., Dang, C.V., Lee, L.A., 2000. Induction of ribosomal genes

and hepatocyte hypertrophy by adenovirus-mediated expression of

c-Myc in vivo. Proc. Natl Acad. Sci. USA 97, 11198–11202.

Manning, B.D., Tee, A.R., Logsdon, M.N., Blenis, J., Cantley, L.C., 2002.

Identification of the tuberous sclerosis complex-2 tumor suppressor

gene product tuberin as a target of the phosphoinositide 3-kinase/akt

pathway. Mol. Cell. 10, 151–162.

Montagne, J., 2000. Genetic and molecular mechanisms of cell size control.

Mol. Cell. Biol. Res. Commun. 4, 195–202.

Montagne, J., Stewart, M.J., Stocker, H., Hafen, E., Kozma, S.C., Thomas,

G., 1999. Drosophila S6 kinase: a regulator of cell size. Science 285,

2126–2129.

Morata, G., Ripoll, P., 1975. Minutes: mutants of drosophila autonomously

affecting cell division rate. Dev. Biol. 42, 211–221.

Neufeld, P.N., Edgar, B.A., 1998. Connections between growth and the cell

cycle. Curr. Opin. Cell. Biol. 10, 784–790.

Neufeld, T.P., de la Cruz, A.F., Johnston, L.A., Edgar, B.A., 1998.

Coordination of growth and cell division in the Drosophila wing. Cell

93, 1183–1193.

Nurse, P., Thuriaux, P., Nasmyth, K., 1976. Genetic control of the cell

division cycle in the fission yeast Schizosaccharomyces pombe. Mol.

Gen. Genet. 146, 167–178.

Oldham, S., Montagne, J., Radimerski, T., Thomas, G., Hafen, E., 2000.

Genetic and biochemical characterization of dTOR, the drosophila

homolog of the target of rapamycin. Genes Dev. 14, 2689–2694.

Pearson, M.J., 1974. Polyteny and the functional significance of the

polytene cell cycle. J. Cell. Sci. 15, 457–479.

Pelengaris, S., Rudolph, B., Littlewood, T., 2000. Action of Myc in vivo-

proliferation and apoptosis. Curr. Opin. Genet. Dev. 10, 100–105.

Pereira, A., Doshen, J., Tanaka, E., Goldstein, L.S., 1992. Genetic analysis

of a Drosophila microtubule-associated protein. J. Cell. Biol. 116 (2),

377–383.

Perrin, L., Demakova, O., Fanti, L., Kallenbach, S., Saingery, S., Mal’ceva,

N.I., et al., 1998. Dynamics of the sub-nuclear distribution of Modulo

and the regulation of position-effect variegation by nucleolus in

Drosophila. J. Cell. Sci. 111, 2753–2761.

Perrin, L., Romby, P., Laurenti, P., Berenger, H., Kallenbach, S., Bourbon,

H.M., et al., 1999. The Drosophila modifier of variegation modulo gene

product binds specific RNA sequences at the nucleolus and interacts

with DNA and chromatin in a phosphorylation-dependent manner.

J. Biol. Chem. 274, 6315–6323.

Potter, C.J., Huang, H., Xu, T., 2001. Drosophila Tsc1 functions with Tsc2

to antagonize insulin signaling in regulating cell growth, cell

proliferation, and organ size. Cell 105, 357–368.

Prober, D.A., Edgar, B.A., 2000. Ras1 promotes cellular growth in the

Drosophila wing. Cell 100, 435–446.

Radimerski, T., Montagne, J., Rintelen, F., Stocker, H., Van der Kaay, J.,

Downes, C.P., Hafen, E., Thomas, G., 2002a. dSbK-regulated cell

growth is dPKB/dPI(3)K-independent, but requires dPDK1Nat. Cell

Biol. 4, 251–255.

Radimerski, T., Montagne, J., Hemmings-Mieszczak, M., Thomas, G.,

2002b. Lethality of Drosophila lacking TSC tumor suppressor function

rescued by reducing dS6K signaling. Genes Dev. 16, 2627–2632.

Roman, G., He, J., Davis, R.L., 2000. kurtz, a novel nonvisual arrestin, is an

essential neural gene in Drosophila. Genetics 155, 1281–1295.

Rubin, G.M., Spradling, A.C., 1982. Genetic transformation of Drosophila

with transposable element vectors. Science 218, 348–353.

Shaw, P.J., Jordan, E.G., 1995. The nucleolus. Ann. Rev. Cell. Dev. Biol.

11, 93–121.

Simpson, P., 1976. Analysis of the compartments of the wing of Drosophila

melanogaster mosaic for a temperature-sensitive mutation that reduces

mitotic rate. Dev. Biol. 54, 100–115.

Smith, A.V., Orr-Weaver, T.L., 1991. The regulation of the cell cycle

during Drosophila embryogenesis: the transition to polyteny. Develop-

ment 112, 997–1008.

Stocker, H., Andjelkovic, M., Oldham, S., Laffargue, M., Wymann, M.P.,

Hemmings, B.A., et al., 2002. Living with lethal PIP3 levels: viability

of flies lacking PTEN restored by a PH domain mutation in Akt/PKB.

Science 295, 2088–2091.

Stocker, H., Hafen, E., 2000. Genetic control of cell size. Curr. Opin. Genet.

Dev. 10, 529–535.

Tapon, N., Ito, N., Dickson, B.J., Treisman, J.E., Hariharan, I.K., 2001. The

Drosophila tuberous sclerosis complex gene homologs restrict cell

growth and cell proliferation. Cell 105, 345–355.

Tee, A.R., Fingar, D.C., Manning, B.D., Kwiatkowski, D.J., Cantley, L.C.,

Blenis, J., 2002. Tuberous sclerosis complex-1 and -2 gene products

function together to inhibit mammalian target of rapamycin (mTOR)-

mediated downstream signaling. Proc. Natl Acad. Sci. USA 99,

13571–13576.

Verdu, J., Buratovich, M.A., Wilder, E.L., Birnbaum, M.J., 1999. Cell-

autonomous regulation of cell and organ growth in Drosophila by

Akt/PKB. Nat. Cell. Biol. 1, 500–506.

Weinkove, D., Leevers, S.J., 2000. The genetic control of organ growth:

insights from Drosophila. Curr. Opin. Genet. Dev. 10, 75–80.

Weinkove, D., Neufeld, T.P., Twardzik, T., Waterfield, M.D., Leevers, S.J.,

1999. Regulation of imaginal disc cell size, cell number and organ size

by Drosophila class I(A) phosphoinositide 3-kinase and its adaptor.

Curr. Biol. 9, 1019–1029.

Weiss, A., Herzig, A., Jacobs, H., Lehner, C.F., 1998. Continuous Cyclin E

expression inhibits progression through endoreduplication cycles in

Drosophila. Curr. Biol. 8, 239–242.

Xu, T., Rubin, G., 1993. Analysis of genetic mosaics in developing and

adult Drosophila tissues. Dev. Suppl. 117, 1223–1237.

Young, J., Povey, S., 1998. The genetic basis of tuberous sclerosis. Mol.

Med. Today 4, 313–319.

Zaffran, S., Chartier, A., Gallant, P., Astier, M., Arquier, N., Doherty, D.,

et al., 1998. A Drosophila RNA helicase gene, pitchoune, is required for

cell growth and proliferation and is a potential target of d-Myc.

Development 125, 3571–3584.

Zhang, H., Stallock, J.P., Ng, J.C., Reinhard, C., Neufeld, T.P., 2000.

Regulation of cellular growth by the drosophila target of rapamycin

dTOR. Genes Dev. 14, 2712–2724.

L. Perrin et al. / Mechanisms of Development 120 (2003) 645–655 655