ORIGINAL ARTICLE

Marine-Based Cultivation of Diacarnus Spongesand the Bacterial Community Composition of Wildand Maricultured Sponges and Their Larvae

Oded Bergman & Markus Haber & Boaz Mayzel &Matthew A. Anderson & Muki Shpigel & Russell T. Hill &Micha Ilan

Received: 6 August 2010 /Accepted: 9 May 2011 /Published online: 26 May 2011# Springer Science+Business Media, LLC 2011

Abstract Marine organisms including sponges (Porifera)contain many structurally diverse bioactive compounds,frequently in a low concentration that hampers theircommercial production. Two solutions to this problem are:culturing sponge explants for harvesting the desiredcompound and cultivation of sponge-associated bacteria.These bacteria (often considered the source of the desiredcompounds) include the Actinobacteria, from which manynovel drugs were developed. In a long-term experiment(lasting 767 days), we evaluated the culture amenability ofthe sponge Diacarnus erythraenus in a mariculture system,placed at 10- and 20-m depths. The growth and survivalrates of sponge fragments were monitored. Wild andmaricultured sponges from both depths and their larvaewere sampled at different time intervals for denaturinggradient gel electrophoresis (DGGE) profiling of thebacterial community residing within them. 16S rRNA genesequences of both cultured bacterial isolates and clonelibraries of unculturable bacteria were composed andcompared, focusing on Actinobacteria. Sponges from bothdepths did not differ significantly either in mean growth

rates (percent weight change year−1 ± S.E.) (64.5%±21% at10 m and 79.3%±19.1% at 20 m) or in seasonal growthrates. Survival was also very similar (72% at 10 m and 70%at 20 m). There were 88 isolates identified from adults and40 from their larvae. The isolates and clone librariesshowed diverse bacterial communities. The DGGE profilesof wild and maricultured sponges differed only slightly,without a significant effect of depths or dates of sampling.This long-term experiment suggests that D. erythraenusprobably remained healthy and indicates its mariculturesuitability.

Keywords Diacarnus erythraenus . Red Sea . 16S rRNAgene . Aquaculture .Mariculture . Phylogenetic analysis .

Marine natural products

Introduction

The oceans contain a wealth of bioactive natural products,with more than 20,000 structurally diverse compoundsdiscovered to date from this environment (Glaser andMayer 2009). Sponges are one of the most prolific sourcesfor the isolation of these structurally complex compounds(Proksch et al. 2003; Blunt et al. 2009). A wide variety offunctions has been attributed to these sponge-derivedcompounds, including their use as predator repellents,anti-pathogen and anti-fouling agents, competition facilita-tion, involvement in communication between individuals,and involvement in sponge reproduction (Hay and Fenical1996; Thoms et al. 2006; Hay 2009; Turon et al. 2009).Many of these compounds have also been shown to possessa wide variety of activities that may benefit man, includinganticancer, anti-inflammatory, antimicrobial, antifungal,

O. Bergman :M. Haber : B. Mayzel :M. Ilan (*)Department of Zoology, Tel Aviv University,Tel Aviv 69978, Israele-mail: milan@post.tau.ac.il

M. A. Anderson : R. T. HillInstitute of Marine and Environmental Technology,University of Maryland Center for Environmental Science,Columbus Center, Suite 236, 701 East Pratt Street,Baltimore, MD 21202, USA

M. ShpigelNational Center for Mariculture, IOLR,P.O. Box 1212, Eilat 88212, Israel

Mar Biotechnol (2011) 13:1169–1182DOI 10.1007/s10126-011-9391-6

antiviral, and antimalarial activity (Faulkner 2002; Blunt et al.2003; Proksch et al. 2003; Newman and Cragg 2004;Sipkema et al. 2005; Piel 2009). Based on these discoveries,there are many promising possibilities for the biotechnolog-ical applications of secondary metabolites isolated fromsponges as potential sources for new drugs and leadcompounds in the pharmaceutical industry.

Sponges are known to harbor diverse communities ofmicroorganisms from all three domains of life (Bacteria,Archaea, and Eukarya), and these communities may comprisemore than 40% of the sponge volume (Hentschel et al. 2003;Hill 2004; Wang 2006; Taylor et al. 2007). These micro-organisms are believed to provide many beneficial functionsto the host sponge, including supply of nutrients, skeletalstabilization, processing of waste products, and secondarymetabolite production (Hentschel et al. 2002). Symbioticbacteria may also have an effect on the health of their spongehosts (Webster et al. 2002; Webster 2007). A growing bodyof evidence indicates the involvement of sponge-associatedmicroorganisms in the production of some compoundsoriginally thought to be produced by the host sponges(Kobayashi and Ishibashi 1993; Bewley and Faulkner 1998;Schmidt et al. 2000; Proksch et al. 2003; Piel et al. 2004a, b;Glaser and Mayer 2009). For example, a striking similarityhas been found between compounds isolated from unrelatedsponges and in particular to compounds previously isolatedfrom bacteria (Taylor et al. 2007). The use of molecular toolshas revealed that many sponges share common bacterialcommunities that are often highly phylogenetically complex,including members of many different phyla. These commu-nities of sponge-associated bacteria were found to differfrom those of the surrounding seawater (Giovannoni andRappe 2000; Webster et al. 2001a, 2004; Hentschel et al.2002, 2003; Taylor et al. 2004, 2005).

Sponges, like other marine invertebrates, may acquiremicrobial symbionts from the surrounding seawater or byvertical transmission via their reproductive elements (Orenet al. 2005; Enticknap et al. 2006; Sharp et al. 2007;Schmitt et al. 2008). Using transmission electron microscopy,the vertical transition of bacteria has been suggested forseveral sponge species, mainly through mature oocytes (Leviand Levi 1976; Gaino et al. 1987; Sciscioli et al. 1994). Ahigh microbial diversity and vertical transmission of at leastten bacterial phyla was found in a study on several spongespecies (Schmitt et al. 2008). Oren et al. (2005) havedemonstrated the possible vertical transmission of a cyano-bacterium in the Red Sea sponge Diacarnus erythraenus.Using 16S rRNA gene sequencing, a single cyanobacterialtype was found both in the adult sponge and in the larvaefrom that sponge species.

While bacterial communities are known to be quiteabundant and diverse, it has been suggested that only about1% of the symbiotic bacteria are cultivable (Hentschel et al.

2003; Imhoff and Stoehr 2003; Hill 2004). The isolation ofsponge bacterial symbionts in pure culture has beensuccessfully demonstrated for a number of phyla: namely,Actinobacteria, Bacteroidetes, Cyanobacteria, Firmicutes,Planctomycetes, Proteobacteria, and Verrucomicrobia (Tayloret al. 2007). Of particular interest to the pharmaceuticalindustry is Actinobacteria. Members of this class have beenfound to be a rich source for novel drugs, with more thantwo thirds of known naturally occurring antibiotics producedby one order (Actinomycetales) (Okami and Hotta 1988;Berdy 1989). It is therefore no surprise that immense effortsare being made to isolate novel representatives of this groupfor natural product research. Since the report by Webster etal. (2001b) showing novel actinobacteria residing in thesponge Rhopaloeides odorabile, Actinobacteria has beentargeted for cultivation from sponges in order to isolate novelactinomycetes for drug screening. A good example is theculture of Micromonospora sp. strain M42, isolated from thesponge Acanthostrongylophora sp., which has been demon-strated to produce manzamines, marine alkaloids of complexstructures with a large variety of bioactivities (Sims et al.,submitted for publication). Several additional studies havedemonstrated the successful cultivation of members of thisgroup (Li and Liu 2006; Zhang et al. 2008).

The isolation of natural products directly from spongescomes with a number of problems, including the difficulty ofmaintaining a continuous supply of huge amounts of spongetissue (Duckworth 2009). Not only is this an economicproblem but it also presents the potential for a majorecological disaster as tons of sponge tissue can be neededin order to produce even a small amount of a natural product,such as in the case of halichondrin B (Hart et al. 2000). Theaquaculture of sponge explants is thought to be the mostcost-effective method for the accumulation of sponge tissueand their compounds of interest (Munro et al. 1999; Osingaet al. 1999). The possibility of using sponge explants forbiomass production depends heavily on the species andconditions of culture (Belarbi et al. 2003). The explantsdevelop as genetically identical adults, and if grown in theopen sea, this environment can be seen as an unrestrictedbioreactor (sensu Osinga 2003). Two important measure-ments in the culture of sponges are growth rates and survival(Duckworth and Battershill 2003; De Caralt et al. 2010). Todate, a vast majority of sponge cultivation experiments arecarried out for only short periods of time (months); thus,they can only be used as estimates for a long-term cultivation(Duckworth and Battershill 2003).

As some of the secondary metabolites may be produced bybacteria, understanding the changes in associated bacterialcommunities following transfer of the sponges to a culturefacility is pivotal. To date, detailed studies on changes in thebacterial communities of aquacultured sponges have focusedon sponges transferred to closed systems only.

1170 Mar Biotechnol (2011) 13:1169–1182

A significant increase in bacterial community diversitywas reported for the sponges Mycale laxissima and Irciniastrobilina upon transfer to a recirculation aquaculturesystem (Mohamed et al. 2008a, b).

D. erythraenus (class Demospongiae) is a massivebranching sponge, distributed in the Red Sea (Kelly-Borgesand Vacelet 1995). Previous studies have found norsesterter-pene peroxide acids in this sponge, which demonstratedantimalarial, antiviral, and anti-toxoplasmosis activities(Kashman and Rotem 1979; El Sayed et al. 2001; Youssef2004). To the best of our knowledge, no work has beenperformed on the associated bacterial communities of thissponge either in the wild or in aquaculture.

In the present study, we cultured explants ofD. erythraenusin a sea-based mariculture system in a long-term experiment.In addition to mean growth rates and survival, we examinedthe bacterial community structure of adult D. erythraenus andits larvae, harvested from the natural coral reef and from themarine-based culture facility. We employed analyses of thecultivable and uncultivable bacteria using denaturing gradientgel electrophoresis (DGGE) and a comparison of 16S rRNAgene sequence profiles of cultured bacterial isolates and clonelibraries. Special emphasis was devoted to the culture ofActinobacteria given their track record in the production ofinteresting novel bioactive compounds. The aim of theseanalyses was to detect any changes that might take place inthe associated bacterial communities upon transfer of thesponge to a mariculture facility. Understanding the relation-ships between sponge-associated bacteria and their hosts isstill in its early stages (Zhang et al. 2008). Better knowledgemight contribute to maintaining healthy sponges followingtheir transfer to aquaculture, enabling their continuousproduction of the compound of interest as well as contribut-ing to future findings of promising new drugs from culturedbacteria.

Materials and Methods

Analysis of Environmental Conditions

Relative light intensity (lum/ft2) and temperature weremeasured using HOBO Pendant Temperature and LightData Logger, model UA-002-08. Data loggers wereattached to each of the frames, at 10 and 20 m. The datawere later analyzed using HOBOware Pro software(version 2.2.1).

Sponge Sampling and Cultivation Experiment

D. erythraenus specimens were collected using SCUBA atdepths of 5–7 m in front of the Interuniversity Institute forMarine Sciences (IUI), at the northern tip of the Gulf of

Aqaba in Eilat, Israel (29o30′07 N, 34o55′02 S). Specimenswere cut from wild sponges at the reef, leaving part of thesponge attached to the substratum to allow its regeneration.Thirty-nine sponges showing a similar color and state ofhealth were cut at the same time underwater, tagged, andplaced in separate plastic Ziploc bags filled with seawater.The sponges were transported submerged in seawater to thelaboratory immediately after harvest and placed in a flow-through seawater system. From each sponge, eight equal-sized (ca. 1 cm3) fragments (clones) were cut. Two fragmentswere instantly frozen in liquid nitrogen, stored at −80°C, andkept for later DNA extraction. The remaining six fragmentswere used for cultivation in a mariculture facility. Tominimize stress, the fragments were cut based on spongemorphology to expose the minimal area of sponge innertissue. Thus, most of the surface of each fragment wascovered by the pinacoderm layer. The mariculture system(also referred to as “frames”) consisted of two artificialplastic frames, each 2×2 m2 in dimension. The frames weredeployed on December 2005 in open water, facing the IUIpier, anchored by sinkers to the seabed, and suspended atdepths of 10 and 20 m by flotation barrels (seabed at 42 m).An array of four detachable square frames, 1 m2 each, wasmounted on each frame using plastic cable ties. Threerandomly chosen fragments of each individual sponge wereplaced on each frame using a pre-weighed PVC plate. Theattachment of the fragment to the PVC plate was done usinga stainless steel wire (0.5 mm), entering an osculum andpassing inside the water canal. The frames were deployed (at10 and 20 m) on December 2005. The experiment lasted atotal of 767 days. The frames were cleared of foulingorganisms every 2–3 weeks. Growth rate measurementswere done using the Wet Weight method (Barthel andTheede 1986); briefly, the sponge fragments were detachedfrom the frames but maintained submerged in seawater-filledtanks. Before weighing, excess water from each fragmentwas gently absorbed using a paper towel. Size and survivalwere monitored and recorded at 6-month intervals. Annualgrowth rates were determined by comparing the initial wetweight to the final one using the following equation:Wt�W0W0

� 100� D�1 � 365, where Wt and W0 are final andinitial weight, respectively, and D is the duration of theexperiment in days.

Six months after the installation (October 2006), threeindividuals of D. erythraenus were collected from twosources: the frame of the mariculture system at a depth of10 m and wild sponges from the reef adjacent to the IUIcenter. The individuals were placed in separate plastic bagsfilled with seawater. Removal of transient and looselyattached bacteria was done immediately after collection,prior to any other treatment, by rinsing the sponges threetimes with 0.2-μm-filtered seawater. Each sponge samplewas placed on a sterile cutting surface and sampled for

Mar Biotechnol (2011) 13:1169–1182 1171

microbial cultivation and molecular analysis (DGGE and16S rRNA gene libraries). Water samples collected adjacentto the sampled sponges for each of the collection sites werealso used for microbial cultivation.

Collection of Sponge Larvae

During the processing of wild D. erythraenus, twosponge individuals were found to contain incubatedlarvae. These were removed by soaking the sponge tissuein 0.2-μm-filtered seawater and gently revealing the innersurface of the sponge with sterile forceps. A total of 60larvae were collected, rinsed three times in sterile seawater(0.2-μm-filtered), and sampled for microbial cultivationand molecular analysis (DGGE and 16S rRNA genelibraries).

Isolation of Sponge-Associated Bacteria

From every sponge sample, approximately 1 cm3 was cutusing a sterile blade. Each cube, containing externalpinacoderm as well as internal mesohyl tissue, waspulverized in 9 ml of artificial sterile seawater using asterile mortar and pestle. This initial homogenate wasserially diluted and 100-μl aliquots from the appropriatedilutions were plated. Four different isolation media wereused, comprising one general medium designed for thegrowth of heterotrophic marine bacteria and three mediadesigned for the isolation of Actinobacteria (Webster et al.2001a; Taylor et al. 2007). The media were: generalmedium marine agar 2216 (MA) (BD Biosciences,Franklin Lakes, NJ, USA) and Actinobacterial selectivemedia modified ISP Medium 2 (see below) (ISP; BDBiosciences); Starch casein agar was prepared usingsoluble starch (1 g), casein dissolved in 10 ml of 1 MNaOH (1 g), K2HPO4 (0.5 g), and agar (20 g) in 1 l dH2O,pH adjusted to 7.0–7.5, and R2A (BD Biosciences). EachActinobacteria medium was modified to contain 2% (w/v)NaCl, supplemented with 10 μg/ml cycloheximide and25 μg/ml nystatin to control fungal growth and 10 μg/mlnalidixic acid to inhibit Gram-negative bacteria. R2A wasadditionally supplemented with a vitamin solution(Janssen et al. 1997). In addition, 20 larvae from twoindividuals were homogenized in 100 μl of artificialseawater, serially diluted, and plated. Seawater was alsoplated on marine agar 2216. Bacterial colonies of distinctmorphotypes (i.e., different colors, shapes, and textures)were selected, picked, and purified by repeated streakplating. Bacterial isolates from MA plates were plated ontofresh MA plates, while isolates from the Actinobacteria mediawere all plated on ISP2 that was not supplemented with

antibiotics. These bacteria were identified by 16S rRNA genesequencing.

Nucleic Acid Extraction from Bacterial Isolates

From each isolated bacterial culture, a colony was pickedusing a sterile inoculation needle and transferred into a 1.7-mlEppendorf tube containing 80 μl TE buffer. After growth,extraction of nucleic acid from the bacterial isolates was doneusing one of two methods. Method one: the tubes werevortexed and then subjected to three successive rounds ofheating (100°C for 4 min) and cooling (−80°C for 2 h). Whenextraction using the first method failed, a second one wasused: a PowerSoil DNA extraction kit (Mo Bio LaboratoriesInc., Carlsbad, CA, USA) was used following the manufac-turer’s instructions.

PCR Amplification and Sequencing of 16S rRNA Genesfrom Bacterial Isolates

The PCR reaction mixtures (50 μl) were prepared containing10×reaction buffer, 2 mM MgCl2, 250 mM (each) deoxy-nucleotide, 1 μm forward and reverse primers, and 1 U ofDream Taq DNA polymerase (Fermentas). The primersutilized for bacterial isolates identification were 63f (5′-CAGGCC TAA CAC ATG CAA GTC-3′) and 1387r (5′-GGG CGG WGT GTA CAA GGC-3′) (Marchesi et al.1998). PCR was carried out by using a Bioer XP Cycler(Bioer Technology, Tokyo, Japan) and performed under thefollowing conditions: initial denaturation at 94°C for 3 min,followed by 30 cycles of 94°C for 1 min, 54°C for 1 min,followed by incubation at 72°C for 5 min. The productswere visualized by agarose gel electrophoresis. Bacterialisolates were grouped by morphology and screened byrestriction length fragment polymorphism (RFLP) analysisfor similarities in band patterns. The PCR products of allisolates were digested using the restriction enzyme BsuRI(HaeIII) (Fermentas, Burlington, ON, Canada) for 1.5 h. Theproducts were visualized by agarose (2%) gel electro-phoresis and ran at 70 V for 2 h. Following analysis, atleast one representative of each RFLP group was sent forsequencing. For large groups, additional representativeswere analyzed. The PCR products from amplified 16SrRNA genes of bacterial isolates were shipped forsequencing to Mc-Lab (San Francisco, CA, USA).Sequencing was performed on an ABIPrism®3730xlDNASequencer (Applied Biosystems) with the 16SrDNA sequence primer 63f. Sequence data were editedwith FinchTV Version 1.4.0 software (Geospiza Inc.,Seattle, WA, USA). The edited sequences were comparedto known sequences in Genbank using BLAST (http://

1172 Mar Biotechnol (2011) 13:1169–1182

blast.ncbi.nlm.nih.gov/) to determine the phylogeneticidentity of bacterial isolates.

DNA Extraction from Sponge and Larvae Tissue

A small section of each sponge individual (1 cm3) andentire larvae were lyophilized for DNA extraction. Thelyophilized tissue was ground to powder using a sterilemortar and pestle. Total DNA was obtained using avariation of the mechanical lysis method of Enticknap etal. (2006). Briefly, 100 mg of the powdered tissue wasplaced in a 2-ml microcentrifuge tube. Sponge tissue wascovered with 1 ml of 1X TE buffer and 500 ml of guanidinethiocyanate buffer, and a metal Tissuelyzer ball was added.The tube was placed in a Tissuelyzer (Qiagen, Valencia,CA, USA) and shaken at 220 rpm for 2 min. Thishomogenate was put on ice and ammonium acetate wasadded to 2.5 M. The homogenate was cleaned using aphenol/chloroform (1:1) method followed by isopropanolprecipitation for DNA isolation. The resulting DNAwas re-suspended in 1X TE buffer. This DNAwas used for DGGEanalysis and clone library construction.

Denaturing Gradient Gel Electrophoresis

A total of 31 sponge individuals and one larval sample werecollected on six occasions spanning nearly 3 years (betweenMay 2005 and January 2008). Nineteen D. erythraenusindividuals were collected from the open-water frameaquaculture setup and 12 individuals were collected fromthe surrounding natural reef. The samples were processed byDGGE on two different gels because of their large number.The gels were analyzed separately because of the difficultyin obtaining an accurate comparison between gels. TheDGGE of 16S rRNA gene fragments from sponge individ-uals and larvae was used to study the total bacterialcommunities. A 200-bp fragment of the 16S rRNAgene was PCR-amplified from total community DNAusing the P2 (ATTACCGCGGCTGCTGG) and P3(CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGCCTACGGGAGGCAGCAG) primers (Muyzeret al. 1993). The following PCR conditions were used: 95°Cfor 5 min, 94°C for 1 min, 55°C for 1 min, 72°C for 1 min(steps 2–4 for 30 cycles), 72°C for 5 min. DGGE wasperformed using a Bio-Rad DCode system (Bio-Rad,Hercules, CA, USA) with 8% (w/v) polyacrylamide gel anda denaturing gradient of 40–75% in 1X Tris–acetate–EDTAbuffer. The gel was run at 60 V for 18 h at 60°C. Gels werestained with SYBR gold (20 ml SYBR gold/500 ml 1XTAE) for 30 min and imaged with a Typhoon 9410 imagesystem (Amersham Biosciences, Piscataway, NJ, USA).

DGGE fingerprint profiles were analyzed using theGelComparII software (Applied Maths, Kortrijk, Belgium).Images of DGGE gels were imported into the program andsimilarity dendrograms were constructed using the Dicecoefficient (2% tolerance, 1.25% optimization) with aUPGMA calculation. The density of bands was notconsidered in this analysis.

Clone Library Construction

Clone libraries of 16S rRNA gene amplicons wereconstructed from one sponge individual and one larva toanalyze the diversity of the bacterial communities present inthe tissue. 16S rRNA gene fragments were PCR-amplifiedusing universal eubacterial primers 27F (AGA GTT TGATCM TGG CTC AG) and 1492R (TAC GGY TAC CTTGTT ACG ACT T). The following PCR settings were used:94°C for 5 min, 92°C for 30 s, 48°C for 2 min, 72°C for1.5 min (steps 2–4 for 25 and 30 cycles), 72°C for 10 min.The amplification products were visualized by 1% agarosegel electrophoresis, and bands of appropriate size(∼1,500 bp) from the lowest PCR cycle number for whicha band was visible were excised from the gel with a sterilescalpel. Gel fragments were purified using QIAquick GelExtraction kit (Qiagen). The PCR products were ligatedinto a TOPO-XL vector and transformed into OneShot TOP10 chemically competent Escherichia coli cells using aTOPO-XL PCR cloning kit (Invitrogen, Carlsbad, CA,USA). Plasmid DNA was isolated and purified fromindividual clones. The resulting DNA was sequenced withthe 27F primer by using an ABI 3130xl DNA sequencer.

Phylogenetic Analysis

16S rRNA gene fragment sequences obtained from isolatesand two clone libraries were analyzed. The sequences wereedited using PreGap4 and Gap4 in the Staden Package(http://staden.sourceforge.net). All sequences were com-pared to 16S rRNA genes in the Genbank database (http://www.ncbi.nlm.nih.gov/). The edited sequences were firstanalyzed using BLAST (Altschul et al. 1990) to identify theclosest relatives. All clone sequences >600 bp and theirclosest relative sequences were imported into the ARBsoftware package (Ludwig et al. 2004). ARB software wasused to align these sequences to a local database using theSSU PT server. Phylogenetic trees of the clone sequenceswere constructed using the neighbor-joining algorithmincluded in ARB and were bootstrapped using the Phylipdistance matrix produced by ARB. Isolates with a maxi-mum identity of equal or more than 98% to culturedrepresentatives were grouped by genus.

Mar Biotechnol (2011) 13:1169–1182 1173

Evaluation of Library Size

Library size evaluation was done using the AmericanSociety for Limnology and Oceanography website (http://www.aslo.org/lomethods/free/2004/0114a.html). Phylo-types were entered by the number of appearance. A non-parametric abundance-based richness estimator was used—SChao1. This non-parametric estimator was found suitablefor the estimation of phylotype richness, from prokaryotic16S rRNA gene libraries (Kemp and Aller 2004).

Nucleotide Sequence Accession Numbers

16S rRNA gene sequences from clone libraries weresubmitted to GenBank and assigned with accession numbersHM854375 to HM854447. 16S rRNA gene sequences fromisolates were also submitted to GenBank and assigned withaccession numbers HM854448 to HM854575.

Natural Product Content

Sponge samples were frozen immediately after collectionfor evaluation of natural product contents. Samples werelyophilized and extracted using petrol ether, followed bychromatography using Sephadex LH-20 as previouslydescribed (Kashman and Rotem 1979), and examined by1H-NMR (400 MHz).

Results and Discussion

Analysis of Environmental Conditions

Temperature varied significantly between the two depths(Z(df5403)= −51.607, P=0.001) and was 23.4°C (S.E.=0.02°C) at 10 m and 23.5°C at 20 m (S.E.=0.02°C). Thissmall difference, though statistically significant, is due tothe large sample size and probably has less biologicalsignificance. Moreover, the S.D. of the temperaturesmeasured at this time period, for each of the two depths,is above 1.2°C. Light intensity differed significantly(Z(df5403)= −37.480, P=0.001) between the depths with18.3 lum/ft² (S.E.=0.7 lum/ft²) at 10 m and 3.8 lum/ft²(S.E.=0.08 lum/ft²) at 20 m.

Marine-Based Cultivation of D. erythraenus Fragments

After the first 6 months (first time interval), a difference of11% was found in the survival percentage between the twodepths (96% survival at 10 m and 85% at 20 m). Thisdifference was reduced to zero (80% survival at bothdepths) by the second time interval, 1 year after theinitiation of the experiment (Fig. 1c). The final survival

rates at the end of the experiment were very similarbetween the two depths (72% at 10 m and 70% at 20 m),with no significant difference. Similar survival rates (75%)were measured for the sponge Spongia officinalis after anexperiment which lasted 4 years (Corriero et al. 2004).Interestingly, lower survival rates were measured at the firstyear of both studies. Similar survival rates were also notedfor Negombata magnifica (71.4%) grown at depths of 10and 20 m (Hadas et al. 2005). The measured mean weightchange (%) per year of D. erythraenus was 64.5±21 (S.E.)at 10 m and 79.3±19.1 (S.E.) at 20 m (Fig. 1a). Nosignificant differences in the final growth rates were found

0

20

40

60

80

100

120

D.e 10m D.e 20m

Sponge/Depth (m)

Mea

n w

eigh

t ch

ange

(%

year

-1)

Mea

n w

eigh

t ch

ange

(%

year

-1)

-5

5

15

25

35

45

55

65

75

85

1-6 7-12 13-18

Time (Months)

10m 20m

21

1623

23

21

16

0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

0.9

1

m02e.Dm01e.DSponge/Depth (m)

Surv

ival

(pr

opor

tion

)

t0

t1

t2

t3

t4

23 23

a

b

c93=n93=n

Fig. 1 D. erythraenus mean weight change, growth dynamics, andcumulative survival at 10 and 20 m. a Mean percentage weight changeper year (± S.E.). The growth rate percentage for each individual wasdetermined by a comparison of final to initial weight. For statisticalanalysis, only fragments originating from the same individual (thatsurvived at both depths) were used. b Growth dynamics for each ofthree time intervals (6 months each) as mean percentage weight changeper year (± S.E.). c Cumulative survival in proportion for the differenttime intervals. The time intervals are consecutive; each lasted for6 months. The first column, t0, represents the onset of the experiment

1174 Mar Biotechnol (2011) 13:1169–1182

between the two depths (Tdf(22))= −1.618, P=0.12 (pairedt-test) nor between the time intervals inspected, spanning1.5 years (Fig. 1b) (Fdf(5))=1.613, P=0.162 (two-wayANOVA). The latter result indicates a constant growth ratewithout (statistically significant) different rates betweenseasons (Fig. 1b). These results are in the range found forother sponges. For example, Corriero et al. (2004) reportedgrowth rates of up to 120% year−1 with no significantdifference between seasons. A large variation was foundbetween individuals. That said, most reported experimentsare short-term studies (months) carried out in temperatewater, and growth rates and survival may vary according tosponge species. Growth rates of up to 150% year−1 andsurvival rates of 24–90% were found for Polymastiacroceus and Latrunculia wellingtonesis (Duckworth et al.2004). A large variation was found between seasons. Hadas etal. (2005) and Ferretti et al. (2009) examined the growth rate(at 10 and 20 m) of N. magnifica (180–324% year−1) andPetrosia ficiformis (−107% to 336% year−1) respectively..While no differences in depth were found for N. magnifica,in the case of P. ficiformis the growth rates were higher at20 m. It could be that in warmer waters such as the Red Seaspecies growing at 20 m are less affected than those grownin temperate waters. De Caralt et al. (2010) recently

published work on Dysidea avara that indicated the needto examine and evaluate each sponge species separately forits culture amenability and for determination of themethod best fit for its culture. The results of the currentlong-term culture experiment done in the Red Sea, usingexplants of D. erythraenus, indicate the potential amena-bility of this sponge for aquaculture in a marine-basedfacility.

Cultured Bacterial Isolates from D. erythraenus

A total of 88 bacterial isolates were obtained from sixspecimens of adult D. erythraenus. An additional 40isolates were cultivated from 60 larvae collected from twoadult sponge individuals. The isolates were identified basedon their 16S rRNA genes (Table 1). A large diversity ofgenotypes was cultured, including members of the phylaActinobacteria, Bacteroidetes, Firmicutes, Alphaproteobac-teria, and Gammaproteobacteria. Actinobacteria made upthe largest number and greatest diversity of cultured isolateswith 36.8% of total isolates, represented by nine differentgenera. Micrococcus sp. was the most abundant genuscultured (20% of total isolates). Firmicutes made up 24.2%of the total isolates and represented by six genera.

Table 1 Identity of the total cultured isolates from all D. erythraenus individuals based on 16S rRNA gene sequencing

D.eL D. erythraenus larvae, D.eF D. erythraenus frame, D.eW D. erythraenus wild, gray box no isolates of these species

Mar Biotechnol (2011) 13:1169–1182 1175

Gammaproteobacteria made up 19.7% of isolates andrepresented by five genera, Alphaproteobacteria made up17.8% and represented by four genera, and Bacteroideteswas the least represented comprising only 1.5% of the totaland consisting only of the genus Salinimicrobium. In total,25 genera were cultured from D. erythraenus individualsand larvae.

In the present study, wild-collected sponge individuals(DW) harbored the largest variety of cultivable micro-organisms, containing 21 of the 25 cultured genera. D.erythraenus larvae (DE) individuals, on the other hand,showed the smallest variety, with only 14 of the 25 generarepresented. Eleven genera were shared by both the larvaand adult wild D. erythraenus individuals, with only asmall number of bacterial phylotypes unique to each. Thissuggests that a substantial proportion of the bacterialcommunity associated with adult D. erythraenus spongesare vertically transferred from one generation to the next viathe larvae, as was found previously for the sponge M.laxissima (Enticknap et al. 2006).Other members of thebacterial community in adult sponges are likely acquired byhorizontal transmission from the surrounding water. Therewere also minute differences in the culturable actino-bacterial diversity between wild D. erythraenus individualsand sponges grown on a frame aquaculture setup (DF),which demonstrates that culturing in such a setup did notgreatly affect this component of the bacterial community. Achange in the bacterial diversity can be harmful and mightlead to deterioration in the sponge’s health (Hill 2004;Mohamed et al. 2008a). This finding further strengthens theassumption that the cultured sponges are in good health (asindicated by the survival and growth rates) and validates the

use of this system to propagate sponges for natural productresearch. In addition, as previously hypothesized, thepossibility that sponge-associated bacteria might producesome compounds exists. It is therefore important that theculturing system will not affect the bacterial diversity of thecultured sponges.

These data demonstrate that D. erythraenus offers avery good source of culturable bacteria, specificallyActinobacteria. Actinobacteria are known sources ofuseful natural products. Traditionally, Actinobacteria havebeen isolated from soils and sediments and are oftenpredominantly represented by Streptomyces sp. By focus-ing on marine samples, we hoped to isolate novel, non-streptomycete actinomycetes. The actinomycetes werespecifically targeted by using selective media. Therefore,the higher incidence of actinomycete isolation comparedto other bacterial groups cannot be taken as indicative ofthe former being the dominant component in the cultur-able bacterial community. Nonetheless, the fact that nineactinomycete genera were isolated from this spongespecies makes D. erythraenus an appealing source forfinding novel Actinobacteria and their potential naturalproducts.

DGGE Analysis of Bacterial Communities

In the DGGE profiles, there were on average 35.3 and 35.1bands present for wild and aquacultured sponges, respective-ly, indicating that D. erythraenus contains quite a diversebacterial community. Moreover, diversity was found to besimilar between wild sponges and sponges propagated inaquaculture.

Fig. 2 A similarity dendrogramof DGGE profiles from D.erythraenus individuals. a Sam-ples collected in 2005 and 2006.b Samples collected in 2007 and2008. The sample name includesinformation on the number ofthe individual (e.g., D1), thetime of collection (e.g., May05),and whether the sponge wascollected in the wild (W, redbars), from the aquacultureframe (F, green bars), or fromthe larva sample (blue bars).Two depths were used for theframe systems, 10 M (filled star)and 20 M (filled circle)

1176 Mar Biotechnol (2011) 13:1169–1182

Similarity dendrograms were constructed to determinewhether there is a significant difference in the bacterialcommunities of wild D. erythraenus versus sponges grownon the aquaculture frame system (Fig. 2). The greatestdifference was found between samples that were processedon different gels, with two major branches present on thedendrogram (Fig. 2a, b) resulting from these two differentgels. There was a small amount of variation between thebanding profiles of all sponge individuals. However, therewas no significant difference between the banding profiles ofwild and cultured sponges. Some of the branches containingsponge individuals from wild and aquaculture samples hadover 80% similarity (e.g., D2Jan08F and D1Jan08W),indicating that the bacterial community remained stablewhen a wild sponge was placed in the aquaculture setup. Inaddition, no significant difference was found between theDGGE banding profiles of sponge individuals collected ondifferent dates. For example, sample D2May05W collectedin 2005 has over 80% similarity with D1March06Wcollected in 2006. This suggests that bacterial communitieswithin this sponge remain stable over time. This finding,coupled with the similarity of the bacterial communitiesfound in different individuals, indicates that the bacterialcommunities in D. erythraenus are stable across both timeand space.

Within the frame system, no significant difference wasfound between the bacterial communities of the spongescultured at the two different depths (10 and 20 m). Oneexample of this is provided by samples D1July06F andD2July06F, cultured at 10 and 20 m, respectively, whichcontained bacterial communities sharing greater than 90%

similarity, based on DGGE banding patterns. It is possiblethat the differences in bacterial communities between thetwo depths resulted from different light intensities since thiswas the environmental parameter that varied the mostbetween the two depths. Further study would be required toconfirm this possibility. This finding supports the growthand survival results found in the farming experiment.

The banding profile for the larva sample was on aseparate branch of the dendrogram and was >75% similarto that of wild sponges, with many bands shared betweenthe larva and wild sponges (Fig. 3). The difference,however, was greater than that seen between spongeindividuals, suggesting that the bacterial community asso-ciated with the larvae is distinct from that found in adult D.erythraenus (Fig. 3). A likely explanation is that only asubset of the total bacterial community is transmitted in thelarvae of D. erythraenus and the remaining bacteria areacquired by the juvenile sponge via horizontal transmissionfrom the surrounding seawater.

Clone Library Bacterial Community Analysis

Two clone libraries were constructed, one representing thebacterial community of a wild sponge individual (numberof clones =37) and one representing the bacterial commu-nity associated with a D. erythraenus larva (n=38). Thesponge individual selected for clone library analysiscontained a bacterial community that was representativeof D. erythraenus, based on the DGGE analysis (Fig. 2). Asingle phylogenetic tree was constructed with all clones.This tree was divided into one tree representing Proteobac-

Lane number Sample Name 1 D1May05W 2 D2May05W 3 D1March06W 4 D1Oct06W 5 D2Oct06W 6 D3Oct06W 7 D1July06F 8 D2July06F 9 D3July06F 10 D1Oct06F 11 D2Oct06F 12 D3Oct06F 13 Larvae

1 2 2 3 4 5 6 7 8 9 10 11 12 13

Wild Aquaculture Larvae Fig. 3 A representative DGGEgel of wild and aquacultured D.erythraenus sponges demon-strating the similar DGGE pro-files present in all samples. Lane13 represents the DGGE band-ing profile of the larva sample.Both of the lanes labeled “2”contain the same sample

Mar Biotechnol (2011) 13:1169–1182 1177

teria (Fig. 4a) and one representing all other bacterial phyla(Fig. 4b). For the wild sponge, the bacterial community hada relatively low diversity when compared to the bacterialcommunities of some other sponge species (Taylor et al.2007). The community included members from five majorbacterial groups and was dominated by cyanobacteria(51%). This cyanobacterial group is represented by a singlegenotype that matches a cyanobacterial symbiont

(AY882559) previously identified in D. erythraenus throughmicroscopy and molecular analysis (Oren et al. 2005). Clonelibrary analysis is only semi-quantitative; however, itstrongly supports the suggestion that this cyanobacterialgenotype dominates the bacterial community of D.erythraenus. The remaining clones included members ofAlphaproteobacteria, Gammaproteobacteria, Poribacteria,and CFB group. In many cases, the closest relatives of

Alpha-

proteobacteria

Beta-

proteobacteria

Delta-

proteobacteria

Gamma-

proteobacteria

aFig. 4 Neighbor-joining phylo-genetic tree of partial 16S rRNAgene sequences of clones thatwere recovered from a wild D.erythraenus and a larva excisedfrom D. erythraenus. Clonesthat are boxed come from thewild sponge and clones in boldcome from the larva. a Clonesassociated with proteobacteriaand b clones associated withnon-proteobacterial groups. Thetree was constructed using ARB.Scale bar indicates 0.1 substitu-tions per nucleotideposition. E. coli AJ567617 wasused as the outgroup in theanalysis. Reference sequencesare shown with GenBankaccession numbers listed aftereach sequence name. The majorbacterial groups are indicated inbold on the right-hand side ofthe tree

1178 Mar Biotechnol (2011) 13:1169–1182

these clones are previously identified sponge symbionts, suchas Poribacteria and Cytophaga-Flavobacterium-Bacteroides(CFB) group sponge symbiont RSWS18.

A comparison of the isolates obtained in this study andthe clone libraries revealed only two shared isolates, oneeach in Alpha- and Gammaproteobacteria. The culturedisolates belonging to Actinobacteria class were not found inthe clone libraries. Media composition and culture con-ditions are among the most important factors influencingthe community of cultivable isolates. Thus, the cultivated

isolates do not reflect the true community compositionresident inside the sponges (Webster et al. 2001b; Imhoffand Stoehr 2003). The presence of diverse non-overlappingcultivable dependent and independent bacterial communi-ties has been shown in a number of studies. For example,Cassler et al. (2008) found that the cultivable and non-cultivable microbial communities of the sponge Vetulina sp.were non-overlapping. The two approaches (dependent andindependent cultivation) should thus be looked upon ascomplementary (Zhang et al. 2008).

Cyanobacteria

Chloroflexi

Acidobacter

Nitrospira

Poribacteria

CFB group

bFig. 4 (continued)

Mar Biotechnol (2011) 13:1169–1182 1179

The bacterial community associated with the larva wasfound to be more diverse in terms of the number of phylathan that of the adult sponge, and clones were more evenlydistributed among major bacterial groups, including clonesfrom the Alpha- (23.5%), Gamma- (15.5%), Delta- (13%),and Betaproteobacteria (10.5%), chloroflexi (21%), Poribac-teria (10.5%), Acidobacter (3%), Nitrospira (3%), and CFBgroup (3%). Interestingly, many genotypes are sharedbetween larva and adult D. erythraenus, such as membersof the CFB group and the Alphaproteobacteria, supportingprevious studies that demonstrated the vertical transfer ofbacterial symbionts in sponges. Poribacterial genotypes werefound to be vertically transmitted in D. erythraenus. ThePoribacteria candidate phylum, which has been shown inmany sponges, is believed to be sponge specific (Fieseler etal. 2004) and was previously shown to be verticallytransmitted in the sponges Aplysina aerophoba, Agelasconifera, and Corticium sp. (Schmitt et al. 2008). Almostall clone sequences obtained from the larvae are closelyrelated to previously identified sponge symbionts, suggestingthat sponges contain evolutionarily associated bacterialcommunities that are passed from an adult via its embryosto the next generation of developing sponge individuals. It isnoteworthy that the bacterial community associated with thelarva is more diverse than that of the adult, although theassessment of culturable diversity had shown a largernumber of cultured groups in the adult than in the larvae.If the bacterial community in the adult is dominated by largenumbers of particular genotypes such as the cyanobacterium,this could result in a smaller number of different clones.Sequencing of a larger number of clones might havedemonstrated communities with similar richness values.

Noticeably absent in the larvae is the cyanobacterialgenotype found in the adult D. erythraenus individual.Previous studies have demonstrated that this cyanobacte-rial genotype is passed vertically from adult to larvae, soit is surprising that it was not found in our clone library.There are several possible explanations for this anomaly.There may be a bias in the DNA extraction method usedto lyse cells found in each tissue. However, since we usedthe same DNA extraction method for all samples, thisseems unlikely. It is possible that the cyanobacterialgenotype is present in low numbers in the larvae, andonce the sponge begins to develop this genotype grows tohigh numbers, thus comprising a much larger proportionof the total community in the adult tissue. In this case, ifmore clones were to be processed from the larvae, wemight identify this cyanobacterial genotype and, con-versely, if larger fragments of adult sponges were to beused, we might identify clones representing the chloro-flexi, identified in the larva but absent in the library fromthe adult D. erythraenus. Another potential explanation isthat the cyanobacteria are transferred to the larva at a later

stage of its development, such as when the larva isreleased by the sponge and passes by the cyanobacteria-rich pinacoderm. Since the larvae retrieved in the presentstudy were obtained from within the sponge (versus self-released larvae), it could be that these larvae had notcompleted their development and therefore lacked thetypical cyanobacteria.

Natural Product Content

An examination of the 1H-NMR spectrum (400 MHz) ofthe extract of all the sponge samples contained six methylsignals (δ1. 06 s (2Me’s), 1.18 s, 1.23 d, 1.63 s, and 1.65 s)corresponding to the compound muqubilin. This naturalproduct was originally discovered in D. erythraenus (thenclassified as Prianos sp.) by Kashman and Rotem (1979)and was used here as a marker for the natural productcontent in the sponge fragments.

Conclusions

The sponge D. erythraenus was found to be suitable forlong-term cultivation in the open sea. In addition, it hostsa diverse bacterial community that is dominated by anassemblage of closely related cyanobacteria and includesmany additional bacterial groups frequently found to beassociated with other sponge species. Many members ofthis bacterial community are also present in the larvae ofthis sponge, suggesting vertical transmission. Importantly,the bacterial community associated with D. erythraenus isstably maintained and persists when the sponge is clonedand grown in an open-water aquaculture installation, asdemonstrated by both culture-dependent and culture-independent methods. The stable bacterial communityindicates that the sponges are probably in good healthand that the profiles of compounds produced or influencedby the bacterial community are likely to be similar inaquacultured and wild D. erythraenus. This bodes well forlarge-scale aquaculture as a good approach for the productionof bioactive compounds found in D. erythraenus.

Acknowledgements This research was supported by a grant fromthe US–Israel BARD foundation (UMBI/I: MB-8708-04). We thankthe many divers who assisted during the field work. The assistance ofthe personnel at the Interuniversity Institute for Marine Sciences inEilat is appreciated.

References

Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basiclocal alignment search tool. J Mol Biol 215:403–410

1180 Mar Biotechnol (2011) 13:1169–1182

Barthel D, Theede H (1986) A new method for the culture of marinesponges and its application for experimental studies. Ophelia25:75–82

Belarbi EH, Gomes AC, Chisti Y, Garcia Camacho FG, Grima EM(2003) Producing drugs from marine sponges. Biotechnol Adv21:585–598

Berdy J (1989) The discovery of new bioactive microbial metabolites:screening and identification. In: Bushell ME, Graefe U (eds)Bioactive microbial metabolites (Prog Ind Microbiol, vol 27).Elsevier, Amsterdam

Bewley CA, Faulkner DJ (1998) Lithistid sponges: star performers orhosts to the stars. Angew Chem Int Ed 37:2162–2178

Blunt JW, Copp BR, Munro MHG, Northcotec PT, Prinsep MR(2003) Marine natural products. Nat Prod Rep 20:1–48

Blunt JW, Copp BR, Hu WP, Munro MGH, Northcote PT, Prinsep MP(2009) Marine natural products. Nat Prod Rep 26:170–244

Cassler M, Peterson CL, Ledger A, Pomponi SA, Wright AE, WinegarR, McCarthy PJ, Lopez JV (2008) Use of real-time qPCR toquantify members of the unculturable heterotrophic bacterialcommunity in a deep sea marine sponge, Vetulina sp. MicrobEcol 55:384–394

Corriero G, Longo C, Mercurio M, Marzano CN, Lembo G, SpedicatoMT (2004) Rearing performance of Spongia officinalis on suspendedropes off the Southern Italian Coast (Central Mediterranean Sea).Aquaculture 238:195–205

De Caralt S, Sánchez-Fontenla J, Uriz MJ, Wijffels RH (2010) Insitu aquaculture methods for Dysidea avara (Demospongiae,Porifera) in the Northwestern Mediterranean. Mar Drugs8:1731–1742

Duckworth A (2009) Farming sponges to supply bioactive metabolitesand bath sponges: a review. Mar Biotechnol 11:669–679

Duckworth AR, Battershill CN (2003) Developing farming structures forproduction of biologically active sponge metabolites. Aquaculture217:139–156

Duckworth AR, Battershill CN, Schiel DR (2004) Effects of depthand water flow on growth, survival and bioactivity of twotemperate sponges cultured in different seasons. Aquaculture242:237–250

El Sayed KA, Hamann MT, Hashish NE, Shier WT, Kelly M, KhanAA (2001) Antimalarial, antiviral, and antitoxoplasmosis norse-sterterpene peroxide acids from the Red Sea sponge Diacarnuserythraeanus. J Nat Prod 64:522–524

Enticknap JJ, Kelly M, Peraud O, Hill RT (2006) Characterization of aculturable alphaproteobacterial symbiont common to manymarine sponges and evidence for vertical transmission via spongelarvae. Appl Environ Microbiol 72:3724–3732

Faulkner DJ (2002) Marine natural products. Nat Prod Rep 19:1–48Ferretti C, Vacca S, Ciucis CD, Marengo B, Duckworth AR, Manconi R,

Pronzato R, Domenicotti C (2009) Growth dynamics and bioactivityvariation of the Mediterranean demosponges Agelas oroides(Agelasida, Agelasidae) and Petrosia ficiformis (Haplosclerida,Petrosiidae). Mar Ecol 30:327–336

Fieseler L, Horn M, Wagner M, Hentschel U (2004) Discovery of thenovel candidate phylum “Poribacteria” in marine sponges. ApplEnviron Microbiol 70:3724–3732

Gaino E, Burlando B, Buffa P, Saraá M (1987) Ultrastructural study ofthe mature egg of Tethya citrina Sara and Melone (Polifera,Demospongiae). Gamete Res 16:259–265

Giovannoni SG, Rappe MS (2000) Evolution, diversity and molecularecology of marine prokaryotes. In: Kirchman DL (ed) Microbialecology of the ocean. Wiley, New York

Glaser KB, Mayer AMS (2009) A renaissance in marine pharmacology:from preclinical curiosity to clinical reality. Biochem Pharmacol78:440–448

Hadas E, Shpigel M, Ilan M (2005) Sea ranching of the marine spongeNegombata magnifica (Demospongiae, Latrunculiidae) as a first

step for latrunculin B mass production. Aquaculture 244:159–169

Hart JB, Lill RE, Hichford SJH, Blunt JW, Munro MHG (2000) Thehalichondrins: chemistry, biology, supply and delivery. In:Fusetani N (ed) Drugs from the sea. Karger, Basel

Hay M (2009) Marine chemical ecology: chemical signals and cuesstructure marine populations, communities, and ecosystems.Annu Rev Mar Sci 1:193–212

Hay M, Fenical W (1996) Chemical ecology and marine biodiversity:insights and products from the sea. Oceanography 9(1):10–20

Hentschel U, Hopke J, Horn M, Friedrich AB, Wagner M, Hacker J,Moore BS (2002) Molecular evidence for a uniform microbialcommunity in sponges from different oceans. Appl EnvironMicrobiol 68:4431–4440

Hentschel U, Fieseler L, Wehrl M, Gernert C, Steinert M, Hacker J,Horn M (2003) Microbial diversity of marine sponges. In: MullerWEG (ed) Mar Mol Biotech. Institute of Molecular Biotechnology,Wurzburg University, Germany. Springer, Berlin

Hill RT (2004) Microbes from marine sponges: a treasure trove ofbiodiversity for natural products discovery. In: Bull AT (ed)Microbial diversity and bioprospecting. ASM, Washington, DC

Imhoff JF, Stoehr R (2003) Sponge-associated bacteria: generaloverview and special aspects of bacteria associated withHalichondria panicea. In: Mueller WEG (ed) Sponges (Porifera).Springer, Berlin

Janssen PH, Schuhmann A, Mörschel E, Rainey FA (1997) Novelanaerobic ultramicrobacteria belonging to the Verrucomicro-biales lineage of bacterial descent isolated by dilution culturefrom anoxic rice paddy soil. Appl Environ Microbiol 63:1382–1388

Kashman Y, Rotem M (1979) Muqubilin, a new c24-isoprenoid from amarine sponge. Tetrahedron Lett 20(19):1707–1708

Kelly-Borges M, Vacelet J (1995) A revision of Diacarnus Burton andNegombata de Laubenfels (Demospongiae: Latranculiidae) withdescriptions of new species from the west central Pacific and theRed Sea. Mem Queensl Mus 38(2):447–503

Kemp PF, Aller JY (2004) Estimating prokaryotic diversity: when are16 S rDNA libraries large enough? Limnol Oceanogr Meth2:114–125

Kobayashi J, Ishibashi M (1993) Bioactive metabolites from symbioticmarine microorganisms. Chem Rev 93:1753–1769

Levi C, Levi P (1976) Embryogenese de Chondosia reniformis(NARDO) demosponge ovipare, et transmission des bacteriessymbiotiques. Ann Sci Nat 18:367–380

Li ZY, Liu Y (2006) Marine sponge Craniella austrialiensis-associatedbacterial diversity revelation based on 16S rDNA library andbiologically active Actinomycetes screening, phylogenetic analysis.Lett Appl Microbiol 43:410–416

Ludwig W, Strunk O, Westram R, Richter L, Meier H, YadhukumarBA, Lai T, Steppi S, Jobb G, Forster W, Brettske I, Gerber S,Ginhart AW, Gross O, Grumann S, Hermann S, Jost R, Konig A,Liss T, Lussmann R, May M, Nonho VB, Reichel B, Strehlow R,Stamatakis A, Stuckmann N, Vilbig A, Lenke M, Ludwig T,Bode A, Schleifer KH (2004) ARB: a software environment forsequence data. Nucleic Acids Res 32:1363–1371

Marchesi JR, Sato T, Weightman AJ, Martin TA, Fry JC, Hiom SJ,Wade WG (1998) Design and evaluation of useful bacterium-specific PCR primers that amplify genes coding for bacterial 16SrRNA. Appl Environ Microbiol 64:795–799

Mohamed NM, Enticknap JJ, Lohr JE, McIntosh SM, Hill RT (2008a)Changes in bacterial communities of the marine sponge Mycalelaxissima on transfer into aquaculture. Appl Environ Microbiol74:1209–1222

Mohamed NM, Rao V, Hamann MT, Kelly M, Hill RT (2008b)Monitoring bacterial diversity of the marine sponge Ircinia

Mar Biotechnol (2011) 13:1169–1182 1181

strobilina upon transfer into aquaculture. Appl Environ Microbiol74:4133–4143

Munro MHG, Blunt JW, Dumdei EJ, Hickford SJH, Lill RE, Li S,Battershill CN, Duckworth AR (1999) The discovery anddevelopment of marine compounds with pharmaceutical potential.J Biotechnol 70:15–25

Muyzer G, De Waal EC, Uitterlinden AG (1993) Profiling of complexmicrobial populations by denaturing gradient gel electrophoresisanalysis of polymerase chain reaction amplified genes coding for16S rRNA. Appl Environ Microbiol 59:695–700

Newman DJ, Cragg GM (2004) Marine natural products and relatedcompounds in clinical and advanced preclinical trials. J Nat Prod67:1216–1238

Okami Y, Hotta K (1988) Search and discovery of new antibiotics. In:Goodfellow M, Williams ST, Mordarski M (eds) Actinomycetesin biotechnology. Academic, San Diego

Oren M, Steindler L, Ilan M (2005) Transmission, plasticity and themolecular identification of cyanobacterial symbionts in the RedSea sponge Diacarnus erythraenus. Mar Biol 148:35–41

Osinga R (2003) Biotechnological aspects of marine sponges. JBiotechnol 100:91–92

Osinga R, Tramper J, Wijffels RH (1999) Cultivation of marinesponges. Mar Biotechnol 1:509–532

Piel J (2009)Metabolites from symbiotic bacteria. Nat ProdRep 26:338–362Piel J, Hofer I, Hui D (2004a) Evidence for a symbiosis island involved in

horizontal acquisition of pederin biosynthetic capabilities by thebacterial symbiont of Paederus fuscipes beetles. J Bacteriol186:1280–1286

Piel J, Hui D, Wen G, Butzke D, Platzer M, Fusetani N, Matsunaga S(2004b) Antitumor polyketide biosynthesis by an uncultivatedbacterial symbiont of the marine sponge Theonella swinhoei.Proc Natl Acad Sci USA 101:16222–16227

Proksch P, Ebel R, Edrada RA, Schupp P, LinWH, SudarsonoWV, SteubeK (2003) Detection of pharmacologically active natural productsusing ecology. Selected examples from Indopacific marine inverte-brates and sponge-derived fungi. Pure Appl Chem 75:343–352

Schmidt EW, Obraztsova AY, Davidson SK, Faulkner DJ, HaygoodMG (2000) Identification of the antifungal peptide-containingsymbiont of the marine sponge Theonella swinhoei as a novelδ-proteobacterium, Candidatus Entotheonella palauensis. MarBiol 136:969–977

Schmitt S, Angermeier H, Schiller R, Lindquist N, Hentschel U(2008) Molecular microbial diversity survey of sponge repro-ductive stages and mechanistic insights into vertical transmis-sion of microbial symbionts. Appl Environ Microbiol 74:7694–7708

Sciscioli M, Lepore E, Gherardi M, Scalera LL (1994) Transfer ofsymbiotic bacteria in the mature oocyte of Geodia cydonium

(Porifera, Demospongiae): an ultrastructural study. Cahier deBiol Mar 35:471–478

Sharp KH, Eam BE, Faulkner DJ, Haygood MG (2007) Verticaltransmission of diverse microbes in the tropical sponge Corticiumsp. Appl Environ Microbiol 73:622–629

Sipkema D, Osinga R, Schatton W, Mendola D, Tramper J, Wijffels RH(2005) Large-scale production of pharmaceuticals by marinesponges: sea, cell, or synthesis? Biotechnol Bioeng 90:201–222

Taylor MW, Schupp PJ, Baillie HJ, Charlton TS, de Nys R, KjellebergS, Steinberg PD (2004) Evidence for acylhomoserinelactonesignal production in bacteria associated with marine sponges.Appl Environ Microbiol 70:4387–4389

Taylor MW, Schupp PJ, de Nys R, Kjelleberg S, Steinberg PD (2005)Biogeography of bacteria associated with the marine spongeCymbastela concentrica. Environ Microbiol 7:419–433

Taylor MW, Radax R, Steger D, Wagner M (2007) Sponge-associatedmicroorganisms: evolution, ecology, and biotechnological potential.Microbiol Mol Biol Rev 71:295–347

Thoms C, Ebel R, Proksch P (2006) Activated chemical defense inAplysina sponges revisited. J Chem Ecol 32:97–123

Turon X, Marti R, Uriz MJ (2009) Chemical bioactivity of spongesalong an environmental gradient in a Mediterranean cave. SciMar 73:387–397

Wang G (2006) Diversity and biotechnological potential of thesponge-associated microbial consortia. J Ind Microbiol Biotechnol33:545–551

Webster NS (2007) Sponge disease: a global threat? Environ Microbiol9:1363–1375

Webster NS, Watts JEM, Hill RT (2001a) Detection and phylogeneticanalysis of novel crenarchaeote and euryarchaeote 16S ribosomalRNA gene sequences from a Great Barrier Reef sponge. MarBiotechnol 3:600–608

Webster NS, Wilson KJ, Blackall LL, Hill RT (2001b) Phylogeneticdiversity of bacteria associated with the marine sponge Rhopaloeidesodorabile. Appl Environ Microbiol 67:434–444

Webster NS, Negri AP, Webbb RI, Hill RT (2002) A spongin-boring

Barrier Reef sponge Rhopaloeides odorabile. Mar Ecol Prog Ser232:305–309

Webster NS, Negri AP, Munro M, Battershill CN (2004) Diversemicrobial communities inhabit Antarctic sponges. EnvironMicrobiol 6:288–300

Youssef DTA (2004) Tasnemoxides A–C, new cytotoxic cyclicnorsesterterpene peroxides from the red sea sponge Diacarnuserythraenus. J Nat Prod 67:112–114

ZhangH, ZhangW, Jin Y, JinM, YuX (2008) A comparative study on thephylogenetic diversity of culturable actinobacteria isolated from fivemarine sponge species. Antonie Leeuwenhoek 93:241–248

1182 Mar Biotechnol (2011) 13:1169–1182

α-proteobacterium is the etiological agent of disease in the Great