Diversity of Bacterial Photosymbionts in Lubomirskiidae Sponges from Lake Baikal

Research ArticleDiversity of Bacterial Photosymbionts in LubomirskiidaeSponges from Lake Baikal

Nina V Kulakova Natalia N Denikina and Sergei I Belikov

Limnological Institute Siberian Branch of the Russian Academy of Sciences Ulan-Batorskaya Street 3 Irkutsk 664033 Russia

Correspondence should be addressed to Nina V Kulakova kulakovalinirkru

Received 26 May 2014 Revised 28 October 2014 Accepted 10 November 2014 Published 20 November 2014

Academic Editor Alexandre Rosado

Copyright copy 2014 Nina V Kulakova et al This is an open access article distributed under the Creative Commons AttributionLicense which permits unrestricted use distribution and reproduction in any medium provided the original work is properlycited

Sponges are permanent benthos residents which establish complex associations with a variety of microorganisms that raiseinterest in the nature of sponge-symbionts interactions A molecular approach based on the identification of the 16S rRNA andribulose-15-bisphosphate carboxylaseoxygenase large subunit genes was applied to investigate diversity and phylogeny of bacterialphototrophs associated with four species of Lubomirskiidae in Lake Baikal The phylogeny inferred from both genes showed threemain clusters of Synechococcus associated with Baikalian sponges One of the clusters belonged to the cosmopolitan Synechococcusrubescens group and the two other were not related to any of the assigned phylogenetic groups but placed as sister clusters to Srubescens These results expanded the understanding of freshwater sponge-associated photoautotroph diversity and suggested thatthe three phylogenetic groups of Synechococcus are common photosynthetic symbionts in Lubomirskiidae sponges

1 Introduction

Sponges are an important component of the marine andfreshwater benthos ecosystems that establish associationswith a great diversity of unicellular and multicellular organ-isms [1] At the photosynthetic zone sponges can benefit fromphototrophic symbionts which fix carbon using the Calvin-Benson cycle and provide products of photosynthesis to thehost [2ndash4]

Photosynthetic symbionts are prevalent in marinesponges of coastal regions worldwide where they contributesignificantly to net primary production [5 6] From one-third to more than half of the sponges of tropical and tem-perate regions harbor a high level of photosynthetic symbi-onts [7 8] In Lake Baikal sponges are necessary componentsof the benthos and ubiquitous on rocky grounds in the littoralzone Sponges from the endemic family Lubomirskiidaeare widely distributed in Lake Baikal and often harborphotosynthetic symbionts From 14 described species ofLubomirskiidae [9] there are three common species amongwhich photosynthetic Lubomirskia baicalensis (L baical-ensis) and Baikalospongia bacillifera (B bacillifera) are widely

distributed in the photic zone of Lake Baikal In contrast tomarine sponges there is not a lot of data on photosyntheticsymbionts of freshwater sponges although associations withunicellular green algae including Chlorella spp Choricystisminor yellow-green algae and Chloroflexi have been shownin cosmopolitan sponges [4 10ndash13] and cyanobacterialsequences detected in L baicalensis [14] Nevertheless theidentification and diversity of sponge-associated phototrophsin Lake Baikal are undetermined to date

We analysed 16S rRNA and ribulose-15-bisphosphatecarboxylaseoxygenase large subunit (rbcL) genes to identifyand assess the diversity of photosynthetic symbionts inBaikalian sponges Both molecular markers are widely usedfor analysis of genetic diversity [15ndash21]

2 Materials and Methods

Four species of sponges from the family LubomirskiidaeL baicalensis Lubomirskia abietina (L abietina) B bacil-lifera and Baikalospongia martinsoni (B martinsoni) andwater samples were collected from the Southern Basin

Hindawi Publishing CorporationInternational Journal of BiodiversityVolume 2014 Article ID 152097 6 pageshttpdxdoiorg1011552014152097

2 International Journal of Biodiversity

of Lake Baikal at depths of 10ndash20m by scuba diving(Table S1 see Supplementary Material available online athttpdxdoiorg1011552014152097) Sponge tissue samples(3ndash5 cm3) were rinsed twice in 96 ethanol and stored at4∘C until DNA extraction Species identification was basedon external morphological characteristics and morphologyof spicules according to the guides of Rezvoi (1936) andEfremova (2001) [22 23]

Chlorophyll concentration was measured after 96ethanol extraction as described by Bergmann and Peters [24]and Webb et al [25] from fresh frozen (minus20∘C) samples (tworeplicates) Spectral absorbance scans were performed from300ndash800 nm using a UV-visible spectrophotometer (Cintra-10E GBC Australia)

Total DNA was extracted using the RiboSorb kit(AmpliSens Russia) according to the manufacturerrsquos proto-col The RbcL gene was amplified in 15120583L of PCR reactionmix (Screen Mix Evrogen Russia) with 10 pmol of eachprimer cbbL 595f (51015840-GACTTCACCAAAGACGACGA-31015840) and 1387r (51015840-TCGAACTTGATTTCTTTCCA-31015840) asdescribed by Elsaied and Naganuma [16] Touchdown PCRwas done in four repeats and mixed for each tissue sampleThe amplification profile consisted of an initial denaturationat 95∘C for 3min followed by 5 touchdown cycles of 94∘C for20 s 55∘C for 20 s and 72∘C for 1min and then 20 cycles of94∘C for 20 s 52∘C for 20 s and 72∘C for 1min and 10 cyclesof 94∘C for 20 s 50∘C for 20 s and 72∘C for 1min 35 PCRcycles were followed by a final extension at 72∘C for 15minThe 16S rRNA gene was amplified with primers CYA106Fc(51015840 CGGACGGGTGAGTAACGCGTGA 31015840) and CYA781R(51015840 GACTACWGGGGTATCTAATCCCWTT 31015840) [26] Theamplification profile consisted of an initial denaturation at95∘C for 3min followed by 30 cycles of 94∘C for 20 s 60∘C for20 s 72∘C for 1min and a final extension at 72∘C for 15min

The PCR products were detected by electrophoresis in08 agarose gel and purified using a DNA purificationkit (Cytokine Russia) and cloned into the pAL-TA vector(Evrogen Russia) Inserts were detected by amplificationwithM13 primers and digested with endonucleases HhaI andHaeIII Clone inserts with different restriction profiles weresequenced using ABI 3130xl Genetic Sequencer (AppliedBiosystem USA) (Table S1) Sequences were checked forchimeras with the Decipher tool [27]

The basic local alignment search tool (BLAST httpblastncbinlmnihgov) was used to compare sample sequences toclosely related sequences from the NCBI database Pairwisealignment was accomplished using BioEdit alignment editorversion 7090 [28] and phylogenetic reconstructions wereperformed in Mr Bayes 321 and Mega 5 programs [29 30]

For phylogenetic tree reconstruction maximum parsi-mony (MP) maximum likelihood (ML) and Bayesian anal-ysis were performed Kimura 2-parameter model was usedfor estimating of genetic distances [31] The first two codonpositions were used for analysis of rbcL dataset (MP ML)Bootstrap analysis was performed with 1000 replicates In theBayesian analysis the MCMC chain was run for 1000000sampled every 100th step

Sequences were deposited in the GenBank databaseunder the following accession numbers JX570937ndashJX570966 KF856235ndashKF856242 and JX570967ndashJX571009and KF856243ndashKF856253 for the 16S rRNA and rbcL genesrespectively

3 Results

Clone library screening was performed to identify pho-totrophs associated with Baikalian sponges The 16S rRNAand rbcL gene fragments were analysed in L baicalensis LabietinaB bacillifera andBmartinsoniThe chlorophyll levelwas estimated for three of these species and chlorophyll Awas detected in L baicalensis (122 plusmn 32 120583gg) B bacillifera(37 plusmn 12 120583gg) and L abietina (20 plusmn 05 120583gg)

In total 71 and 126 inserts were sequenced from the16S rRNA and rbcL clone libraries respectively Identicalsequences were removed from further analysis and 38 16SrRNA and 54 rbcL gene sequences were deposited in theGenBank database Sequences obtained from 16S rRNA genewere 95ndash100 identical while sequences obtained fromthe rbcL gene were more heterogeneous (83ndash100) RbcLsequences with nucleotide identities greater than 90 werecombined into operational taxonomic units (OTUs) Therewere three 120572-cyanobacteria OTUs resolved from analysis ofthe 733 bp rbcL gene alignment The first OTU was 98identical to Synechococcus rubescens (AM701775) while themaximum nucleotide sequence identities from two otherOTUs were 87 and 89 similar to Cyanobium gracile 6307(CP003495) and closer relatives could not be found in theGenBank database

The phylogenetic analysis inferred from 16S rRNA andrbcL genes showed three main clusters for Synechococcuswhich included sequences from all species of sponges andlake water analysed (Figures 1 and 2) Better resolved treeswere based on rbcL in comparison with 16S rRNA basedphylogeny The phylogenetic reconstruction inferred fromboth genes showed that phylogenetic positions for twoof three clusters were similar There was a fully resolvedcluster of S rubescens that combined highly identical (99)sequences from Lake Baikal as well as Synechococcus strainsfrom European lakes The two other groups were placed assister clusters to S rubescens (Figure 1) Clusters BL1 and BS1included sequences from Lake Baikal only (Figures 1 and 2)

The phylogenetic positions of identified clusters wereslightly different from the 16S rRNA based phylogeny Using16S rRNA data there was a cluster related to the S rubescensphylogenetic lineage that included the clade of 23 Syne-chococcus sequences (intragroup identity 98-99) from LakeBaikal sequences from lakes in Mongolia and high altitudeoligotrophic lakes of the Tibetan plateau and the Pyreneeswhile rbcL-based phylogeny showed a specific cluster of 25sequences that was sister to S rubescens cluster (Figures 1and 2) The rest of the sequences (16S rRNA tree) formedsingle branches or were clustered within Baikalian clades ofpicocyanobacteria from lake water (Figure 2)

The only rbcL sequence from B bacillifera (JX570973)that showed a low-level nucleotide identity (lt83)with other

International Journal of Biodiversity 3

Prochlorococcus marinus str MIT 9211


Synechococcus sp WH 8102

Synechococcus sp CC9605


Synechococcus sp PCC 7009


Cyanobium gracile PCC 6307

Pseudanabaena sp PCC 7403

Synechococcus rubescens cluster

BL1

B bacillifera clone 21

BL2 25 sequences of sponges and water

23 sequences from sponges and water

5 sequences of sponges and water

99100100

Marine Synechococcus

C gracile cluster

002

8180100

9890100

7176100

6471100 8790100

9679100

9999100

6462100

Oscillatoria tenuis CCAP 14594

120572-C

yano

bact

eria

(RuB

isCO

form

IA)

120573-C

yano

bact

eria

(RuB

isCO

form

IB)

72lowast96

lowastlowast100

lowastlowast100lowastlowast73

lowast86100

Figure 1 Phylogenetic tree of cyanobacteria associated with photosynthetic sponges from Lake Baikal Consensus tree inferred from 733nucleotide positions of the rbcL gene Clusters from Lubomirskiidae sponges are colored in grey Bootstrap support values and posteriorprobability () are shown at the nodes (Maximum ParsimonyMaximum LikelihoodBayesian analysis) Values below 50 are not shownScale bar represents 002 substitutions per site

sequences from the GenBank database formed a distinctbranch within the 120573-cyanobacteria (Figure 1)

Thus the majority of sequences from sponges andwater belonged to 120572-cyanobacteria with form IA RuBisCOSequences from Baikalian sponges did not form distinctphylogenetic clusters and no major sponge-specific clustershave been found

4 Discussion

The phylogeny inferred from 16S rRNA and rbcL genesgenerally agrees that three main phylogenetic clusters forchlorophyll IA-containing picocyanobacteria are present inBaikalian sponges The only one sequence belonging toOscillatoriawas detected in B bacilliferaThe finding of Syne-chococcus and Oscillatoria groups in freshwater sponges issimilar to the results obtained frommarine sponges [7 8 17ndash19] In contrast withmarine sponges no specific phylogeneticgroups for sponge species or sponges with various levelsof chlorophyll A were found and sequences derived fromsponges (as well as from lake water) were dispersed across theclusters described

The different levels of chlorophyll A in sponges are alsodemonstrated in marine environments where the major rolefor sponge-specific Synechococcus in ecology and primaryproductivity of sponges with high level of chlorophyll A hasbeen described [7] The highest level of chlorophyll A we

found in L baicalensis may be dependent on better lightcondition available to branched structures that grow up toone meter high in comparison to fully attached cushion-and crust-like sponges (L abietina B bacillifera and B mar-tinsoni) though the presence of eukaryotic photosymbiontscould also be significant

The S rubescens cluster detected in Baikalian sponges wasaffiliated with widely distributed Subalpine cluster I (groupB) [20] proving high ecological plasticity of this group Thepresence of phylogenetic clusters that included only Baikaliansequences as well as clusters with no attribution to theSynechococcus phylogenetic group described confirms theresults of Pommier et al [21] suggesting that endemic clustersare formed in the local bacterioplankton community inresponse to their adaptation to unique ecological conditions

These results give a new insight into biodiversity ofphototrophs associated with Baikalian sponges that could befurther used for purpose of ecosystem monitoring This isespecially important with regard to increasing anthropogenicpressure as a result of tourism development in the Baikalianregion

5 Conclusions

Molecular detection of 16S rRNA and rbcL genes from clonelibraries were performed for the identification of phototrophsassociated with four species of Lubomirskiidae from Lake


Prochlorococcus marinus str MIT 9211 (AF115270)Prochlorococcus marinus str MIT 9303 (AF053397)

23 sequences from sponges and water BaikalUncultured bacterium Pyrenees Tibet Mongolia

Baikal BM17 (JX570942)Baikal BB4 (JX570947)

Baikal BB37 (JX570955)Uncultured Synechococcus (DQ297459) Baikal

Baikal BB30 (JX570953) Baikal BM6 (JX570938)

Baikal BM11 (JX570941)

Synechococcus sp BAC 22 (DQ399906) BaikalSynechococcus rubescens (AF317076) Lake ZurichSynechococcus sp BO8807 (AF317074) Lake ConstanceSynechococcus sp BO9404 (AF317075) Lake ConstanceSynechococcus sp LM94 (AF330248) Lake MaggioreBaikal BM8 (JX570940)

Baikal BB6 (JX570949)Baikal BB27 (JX570944)

Baikal BB35 (JX570954)Uncult (DQ297459) Baikal


Uncultured Cyanobacterium KWK6S90 (JN656827) pond CanadaBaikal BM34 (JX570946)

Synechococcus sp BO 8801 (AF317071) Lake ConstanceSynechococcus PCC 6307 (AF001477) lake water USA

Cyanobium sp Suigetsu-CG3 (AB610892) Lake SuigetsuSynechococcus sp PCC 7920 (AF216948) pond Tosla Finland

Synechococcus sp PCC 7009 (AF216945) low salinity pond USASynechococcus sp BO 0014 (AF330251) Lake Constance

Synechococcus sp BO 8805 (AF317073) Lake ConstanceUncult (AY945292) pool UK

6 sequences from sponges and water Baikal Uncultured Synechococcus sp hub-5 (DQ297464) Mongolia

Synechococcus sp BAC 106-1 (DQ407518) BaikalSynechococcus sp BAC 103 (DQ407515) Baikal

Synechococcus sp BAC 104 (DQ407516) BaikalSynechococcus sp BAC 69 (DQ407510) Baikal


Synechococcus sp BAC 9984 (DQ407511) Baikal

Synechococcus PCC9005 (AF216950) Japan Synechococcus sp PCC 7001 (AB015058) intertidal waters USA

Synechococcus spBiwa-GO (D50615) Lake Biwa Synechococcus sp Biwa-BO (D50614) Lake Biwa

Cyanobium sp Suigetsu-CR2 (AB610886) Lake SuigetsuCyanobium sp Suigetsu-CR1 (AB610885) Lake Suigetsu

Cyanobium sp Suigetsu-CG4 (AB610893) Lake SuigetsuSynechococcus sp BAC 08 (DQ401110) Baikal

Synechococcus sp BAC 41 (DQ407507) Baikal Synechococcus sp BAC 11 (DQ401110) Baikal Synechococcus sp BAC 16 (DQ403805) Baikal

Synechococcus sp BAC 18 (DQ403806) Baikal Synechococcus sp BAC 26 (DQ403807) Baikal


Synechococcus sp BAC 9950 (DQ407508) Baikal Synechococcus sp BAC 9990 (DQ407512) Baikal Baikal BM27 (JX570952)

Baikal BB7 (JX570950)Baikal BM34 (JX570946)

99100

100 100

95

63

73

67

95

73

76

90

100

69

78

10095

100 92

87

98

94

98

6096

67

Baikal A

C gracilecluster

BS1

S rubescenscluster

BS2

Synechococcus sp WH 8102 (NC 005070)

Cyanobium gracile PCC6307 (NR 102447) lake water USA

002

Figure 2 Phylogenetic tree of cyanobacteria associated with photosynthetic sponges from Lake Baikal inferred from 522 nucleotide positionsof the 16S rRNA gene Sequences from this study and reference sequences of S rubescens and C gracile are shown in bold Bayesian posteriorprobability () is shown at the nodes Scale bar represents 02 substitutions per site GenBank accession numbers are given in the parenthesesAccession numbers for 6 sequences from sponges and water Baikal JX570937 JX570945 JX570948 KF856235 KF856236 and KF85623723 sequences from sponges and water Baikal JX570939 JX570957ndashJX570966 KF856238ndashKF856242 and uncultured bacterium (PyreneanTibetan Mongolian lakes) HE857287 HE857263 HM129960 DQ297463 DQ422951 DQ297460 and DQ297461 In the Bayesian analysisthe MCMC chain was run for 2000000 sampled every 100th step

Baikal The phylogeny inferred from both genes showedthat S rubescens and two specific clusters of Synechococcuswere associated with sponges and also found in lake waterThree major clusters of Synechococcus that did not formsponge-specific groups were detected in all studied speciesof Baikalian sponges These results added to the understand-ing of symbiotic associations in freshwater photosyntheticsponges and could be further applied to the assessment ofecological impacts on the ecosystems in Lake Baikal

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Authorsrsquo Contribution

Nina V Kulakova designed the study identified the speci-mens did molecular experiments analysed sequences and


has written the paper Natalia N Denikina helped with thesamples collections Sergei I Belikov helped with the studydesign

Acknowledgments

The authors thank the diving team of the LimnologicalInstitute the SB RAS Genomics Core Facility and Centre forCollective Use of LIN SB RAS for equipment and facilitiesThey are very grateful toOlgaMaikova for helpwithmorpho-logical identification of sponges This work was supported byGovernment Contract no VI5014 ldquoMolecular Ecology andEvolution of the Life Systems in Central Asia in theModels ofFishes Sponges andMicroorganismsAssociatedwithThemrdquo

References

[1] C RWilkinson ldquoMicrobial associations in sponges I Ecologyphysiology and microbial populations of coral reef spongesrdquoMarine Biology vol 49 no 2 pp 161ndash167 1978

[2] C R Wilkinson and J Vacelet ldquoTransplantation of marinesponges to different conditions of light and currentrdquo Journal ofExperimental Marine Biology and Ecology vol 37 no 1 pp 91ndash104 1979

[3] T M Frost and C E Williamson ldquoIn situ determination of theeffect of symbiotic algae on the growth of the freshwater spongeSpongilla lacustrisrdquo Journal of Ecology vol 61 pp 1361ndash13701980

[4] A A Venn J E Loram and A E Douglas ldquoPhotosyntheticsymbioses in animalsrdquo Journal of Experimental Botany vol 59no 5 pp 1069ndash1080 2008

[5] C R Wilkinson ldquoNet primary productivity in coral reefspongesrdquo Science vol 219 no 4583 pp 410ndash412 1983

[6] K M Usher ldquoThe ecology and phylogeny of cyanobacterialsymbionts in spongesrdquo Marine Ecology vol 29 no 2 pp 178ndash192 2008

[7] P M Erwin and R W Thacker ldquoIncidence and identityof photosynthetic symbionts in Caribbean coral reef spongeassemblagesrdquo Journal of the Marine Biological Association of theUnited Kingdom vol 87 no 6 pp 1683ndash1692 2007

[8] M-L Lemloh J Fromont F Brummer and K M UsherldquoDiversity and abundance of photosynthetic sponges in temper-ate Western Australiardquo BMC Ecology vol 9 article 4 2009

[9] S M Efremova ldquoNew genus and new sponge species of thefamily Lubomirskiidae Rezvoy 1936rdquo in Index of Animal SpeciesInhabiting Lake Baikal and Its Catchment Area vol 1 book 2 pp1261ndash1278 Nauka Novosibirsk Russia 2004

[10] C R Wilkinson ldquoNutrient translocation from green algal sym-bionts to the freshwater sponge Ephydatia fluviatilisrdquo Hydrobi-ologia vol 75 no 3 pp 241ndash250 1980

[11] T M Frost L E Graham J E Elias M J Haase D W Kretch-mer and J A Kranzfelder ldquoA yellow-green algal symbiontin the freshwater sponge Corvomeyenia everetti convergentevolution of symbiotic associationsrdquo Freshwater Biology vol 38no 2 pp 395ndash399 1997

[12] C Gernert F O Glockner G Krohne and U HentschelldquoMicrobial diversity of the freshwater sponge Spongilla lacus-trisrdquoMicrobial Ecology vol 50 no 2 pp 206ndash212 2005

[13] S Handa M Nakahara H Tsubota H Deguchi Y Masudaand T Nakano ldquoChoricystis minor (Trebouxiophyceae Chloro-phyta) as a symbiont of several species of freshwater spongerdquoHikobia vol 14 no 4 pp 365ndash373 2006

[14] O V Kaliuzhnaia A A Krivich and V B Itskovich ldquoDiversityof 16S rRNA genes in metagenomic community of the freshwa-ter sponge Lubomirskia baicalensisrdquoGenetika vol 48 no 8 pp1003ndash1006 2012 (Russian)

[15] H E Elsaied H Kimura and T Naganuma ldquoComposition ofarchaeal bacterial and eukaryal RuBisCO genotypes in threeWestern Pacific arc hydrothermal vent systemsrdquo Extremophilesvol 11 no 1 pp 191ndash202 2007

[16] H Elsaied and T Naganuma ldquoPhylogenetic diversity ofribulose-15-bisphosphate carboxylaseoxygenase large-subunitgenes from deep-sea microorganismsrdquo Applied and Environ-mental Microbiology vol 67 no 4 pp 1751ndash1765 2001

[17] L Steindler D Huchon A Avni and M Ilan ldquo16S rRNAphylogeny of sponge-associated cyanobacteriardquo Applied andEnvironmental Microbiology vol 71 no 7 pp 4127ndash4131 2005

[18] U Hentschel J Hopke M Horn et al ldquoMolecular evidencefor a uniform microbial community in sponges from differentoceansrdquoApplied and Environmental Microbiology vol 68 no 9pp 4431ndash4440 2002

[19] R L Simister P Deines E S Botte N S Webster and MW Taylor ldquoSponge-specific clusters revisited a comprehensivephylogeny of sponge-associatedmicroorganismsrdquo Environmen-tal Microbiology vol 14 no 2 pp 517ndash524 2012

[20] N D Crosbie M Pockl and T Weisse ldquoDispersal and phy-logenetic diversity of nonmarine picocyanobacteria inferredfrom 16S rRNA gene and cpcBA-intergenic spacer sequenceanalysesrdquo Applied and Environmental Microbiology vol 69 no9 pp 5716ndash5721 2003

[21] T Pommier B Canback L Riemann et al ldquoGlobal patternsof diversity and community structure in marine bacterioplank-tonrdquoMolecular Ecology vol 16 no 4 pp 867ndash880 2007

[22] P D Rezvoi ldquoFreshwater sponges of the USSRrdquo in The Faunaof the USSR D P Rezvoi Ed vol 2 pp 21ndash41 Academy ofSciences Moscow Russia 1936

[23] S M Efremova ldquoPoriferardquo in An Annotated List of the Fauna ofLake Baikal and Its Catchment Area O A Timoshkin Ed vol1 pp 177ndash190 Nauka Novosibirsk Russia 2001 (Russian)

[24] M Bergmann and R H Peters ldquoA simple reflectance methodfor themeasurement of particulate pigment in lake water and itsapplication to Phosphorus-Chlorophyll-Seston RelationshipsrdquoCanadian Journal of Fisheries and Aquatic Sciences vol 37 pp111ndash114 1980

[25] D J Webb B K Burnison A M Trimbee and E E PrepasldquoComparison of chlorophyll a extractions with ethanol anddimethyl sulfoxideacetone and a concern about spectrophoto-metric phaeopigment correctionrdquoCanadian Journal of Fisheriesand Aquatic Sciences vol 49 pp 2331ndash2336 1992

[26] U Nubel F Garcia-Pichel and G Muyzer ldquoPCR primers toamplify 16S rRNA genes from cyanobacteriardquo Applied andEnvironmental Microbiology vol 63 no 8 pp 3327ndash3332 1997

[27] E S Wright L S Yilmaz and D R Noguera ldquoDECIPHER asearch-based approach to chimera identification for 16S rRNAsequencesrdquo Applied and Environmental Microbiology vol 78no 3 pp 717ndash725 2012

[28] T A Hall ldquoBioEdit a user-friendly biological sequence align-ment editor and analysis program for Windows 9598NTrdquoNucleic Acids Symposium Series vol 41 pp 95ndash98 1999


[29] F Ronquist M Teslenko P van der Mark et al ldquoMrbayes32 efficient bayesian phylogenetic inference and model choiceacross a large model spacerdquo Systematic Biology vol 61 no 3 pp539ndash542 2012

[30] K Tamura D Peterson N Peterson G Stecher M Nei andS Kumar ldquoMEGA5 molecular evolutionary genetics analysisusing maximum likelihood evolutionary distance and max-imum parsimony methodsrdquo Molecular Biology and Evolutionvol 28 no 10 pp 2731ndash2739 2011

[31] M Kimura ldquoA simple method for estimating evolutionary ratesof base substitutions through comparative studies of nucleotidesequencesrdquo Journal ofMolecular Evolution vol 16 no 2 pp 111ndash120 1980

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of


Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology


Molecular Biology International

GenomicsInternational Journal of


The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014


BioinformaticsAdvances in

Marine BiologyJournal of



Signal TransductionJournal of


BioMed Research International

Evolutionary BiologyInternational Journal of



Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014


Genetics Research International


Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational



Enzyme Research



Microbiology


of Lake Baikal at depths of 10ndash20m by scuba diving(Table S1 see Supplementary Material available online athttpdxdoiorg1011552014152097) Sponge tissue samples(3ndash5 cm3) were rinsed twice in 96 ethanol and stored at4∘C until DNA extraction Species identification was basedon external morphological characteristics and morphologyof spicules according to the guides of Rezvoi (1936) andEfremova (2001) [22 23]

Chlorophyll concentration was measured after 96ethanol extraction as described by Bergmann and Peters [24]and Webb et al [25] from fresh frozen (minus20∘C) samples (tworeplicates) Spectral absorbance scans were performed from300ndash800 nm using a UV-visible spectrophotometer (Cintra-10E GBC Australia)

Total DNA was extracted using the RiboSorb kit(AmpliSens Russia) according to the manufacturerrsquos proto-col The RbcL gene was amplified in 15120583L of PCR reactionmix (Screen Mix Evrogen Russia) with 10 pmol of eachprimer cbbL 595f (51015840-GACTTCACCAAAGACGACGA-31015840) and 1387r (51015840-TCGAACTTGATTTCTTTCCA-31015840) asdescribed by Elsaied and Naganuma [16] Touchdown PCRwas done in four repeats and mixed for each tissue sampleThe amplification profile consisted of an initial denaturationat 95∘C for 3min followed by 5 touchdown cycles of 94∘C for20 s 55∘C for 20 s and 72∘C for 1min and then 20 cycles of94∘C for 20 s 52∘C for 20 s and 72∘C for 1min and 10 cyclesof 94∘C for 20 s 50∘C for 20 s and 72∘C for 1min 35 PCRcycles were followed by a final extension at 72∘C for 15minThe 16S rRNA gene was amplified with primers CYA106Fc(51015840 CGGACGGGTGAGTAACGCGTGA 31015840) and CYA781R(51015840 GACTACWGGGGTATCTAATCCCWTT 31015840) [26] Theamplification profile consisted of an initial denaturation at95∘C for 3min followed by 30 cycles of 94∘C for 20 s 60∘C for20 s 72∘C for 1min and a final extension at 72∘C for 15min

The PCR products were detected by electrophoresis in08 agarose gel and purified using a DNA purificationkit (Cytokine Russia) and cloned into the pAL-TA vector(Evrogen Russia) Inserts were detected by amplificationwithM13 primers and digested with endonucleases HhaI andHaeIII Clone inserts with different restriction profiles weresequenced using ABI 3130xl Genetic Sequencer (AppliedBiosystem USA) (Table S1) Sequences were checked forchimeras with the Decipher tool [27]

The basic local alignment search tool (BLAST httpblastncbinlmnihgov) was used to compare sample sequences toclosely related sequences from the NCBI database Pairwisealignment was accomplished using BioEdit alignment editorversion 7090 [28] and phylogenetic reconstructions wereperformed in Mr Bayes 321 and Mega 5 programs [29 30]

For phylogenetic tree reconstruction maximum parsi-mony (MP) maximum likelihood (ML) and Bayesian anal-ysis were performed Kimura 2-parameter model was usedfor estimating of genetic distances [31] The first two codonpositions were used for analysis of rbcL dataset (MP ML)Bootstrap analysis was performed with 1000 replicates In theBayesian analysis the MCMC chain was run for 1000000sampled every 100th step

Sequences were deposited in the GenBank databaseunder the following accession numbers JX570937ndashJX570966 KF856235ndashKF856242 and JX570967ndashJX571009and KF856243ndashKF856253 for the 16S rRNA and rbcL genesrespectively

3 Results

Clone library screening was performed to identify pho-totrophs associated with Baikalian sponges The 16S rRNAand rbcL gene fragments were analysed in L baicalensis LabietinaB bacillifera andBmartinsoniThe chlorophyll levelwas estimated for three of these species and chlorophyll Awas detected in L baicalensis (122 plusmn 32 120583gg) B bacillifera(37 plusmn 12 120583gg) and L abietina (20 plusmn 05 120583gg)

In total 71 and 126 inserts were sequenced from the16S rRNA and rbcL clone libraries respectively Identicalsequences were removed from further analysis and 38 16SrRNA and 54 rbcL gene sequences were deposited in theGenBank database Sequences obtained from 16S rRNA genewere 95ndash100 identical while sequences obtained fromthe rbcL gene were more heterogeneous (83ndash100) RbcLsequences with nucleotide identities greater than 90 werecombined into operational taxonomic units (OTUs) Therewere three 120572-cyanobacteria OTUs resolved from analysis ofthe 733 bp rbcL gene alignment The first OTU was 98identical to Synechococcus rubescens (AM701775) while themaximum nucleotide sequence identities from two otherOTUs were 87 and 89 similar to Cyanobium gracile 6307(CP003495) and closer relatives could not be found in theGenBank database

The phylogenetic analysis inferred from 16S rRNA andrbcL genes showed three main clusters for Synechococcuswhich included sequences from all species of sponges andlake water analysed (Figures 1 and 2) Better resolved treeswere based on rbcL in comparison with 16S rRNA basedphylogeny The phylogenetic reconstruction inferred fromboth genes showed that phylogenetic positions for twoof three clusters were similar There was a fully resolvedcluster of S rubescens that combined highly identical (99)sequences from Lake Baikal as well as Synechococcus strainsfrom European lakes The two other groups were placed assister clusters to S rubescens (Figure 1) Clusters BL1 and BS1included sequences from Lake Baikal only (Figures 1 and 2)

The phylogenetic positions of identified clusters wereslightly different from the 16S rRNA based phylogeny Using16S rRNA data there was a cluster related to the S rubescensphylogenetic lineage that included the clade of 23 Syne-chococcus sequences (intragroup identity 98-99) from LakeBaikal sequences from lakes in Mongolia and high altitudeoligotrophic lakes of the Tibetan plateau and the Pyreneeswhile rbcL-based phylogeny showed a specific cluster of 25sequences that was sister to S rubescens cluster (Figures 1and 2) The rest of the sequences (16S rRNA tree) formedsingle branches or were clustered within Baikalian clades ofpicocyanobacteria from lake water (Figure 2)

The only rbcL sequence from B bacillifera (JX570973)that showed a low-level nucleotide identity (lt83)with other












BL1





99100100


C gracile cluster

002

8180100

9890100

7176100

6471100 8790100

9679100

9999100

6462100


120572-C

yano

bact

eria

(RuB

isCO

form

IA)

120573-C

yano

bact

eria

(RuB

isCO

form

IB)

72lowast96

lowastlowast100


lowast86100




4 Discussion






5 Conclusions
































99100

100 100

95

63

73

67

95

73

76

90

100

69

78

10095

100 92

87

98

94

98

6096

67

Baikal A

C gracilecluster

BS1

S rubescenscluster

BS2



002









Acknowledgments


References








































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology












BL1





99100100


C gracile cluster

002

8180100

9890100

7176100

6471100 8790100

9679100

9999100

6462100


120572-C

yano

bact

eria

(RuB

isCO

form

IA)

120573-C

yano

bact

eria

(RuB

isCO

form

IB)

72lowast96

lowastlowast100


lowast86100




4 Discussion






5 Conclusions
































99100

100 100

95

63

73

67

95

73

76

90

100

69

78

10095

100 92

87

98

94

98

6096

67

Baikal A

C gracilecluster

BS1

S rubescenscluster

BS2



002









Acknowledgments


References








































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology































99100

100 100

95

63

73

67

95

73

76

90

100

69

78

10095

100 92

87

98

94

98

6096

67

Baikal A

C gracilecluster

BS1

S rubescenscluster

BS2



002









Acknowledgments


References








































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology



Acknowledgments


References








































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology












Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology

Diversity of Bacterial Photosymbionts in Lubomirskiidae Sponges from Lake Baikal

Documents

Transcript of Diversity of Bacterial Photosymbionts in Lubomirskiidae Sponges from Lake Baikal