Investigation on human adrenocortical cell response to adenovirus and adenoviral vector infection

ORIGINAL ARTICLE 45J o u r n a l o fJ o u r n a l o f

CellularPhysiologyCellularPhysiology
Investigation on Human
Adrenocortical Cell Response toAdenovirus and AdenoviralVector Infection
URSKA MATKOVIC, MONIA PACENTI, MARTA TREVISAN,
GIORGIO PALU,* AND LUISA BARZON*

Department of Histology, Microbiology, and Medical Biotechnologies, University of Padova, Padova, Italy

After systemic administration, adenoviral vectors (AdVs) are sequestered in the liver and adrenal glands. Adenoviral vector transductionhas been shown to cause cytopathic effects on human hepatocytes and to induce an inflammatory response, whereas the effect of AdVs onhuman adrenocortical cells has never been investigated. In this study, human adrenocortical carcinoma cell lines and primary cell cultureswere used to assess the effects of wild-type adenovirus (Ad5WT) and E1/E3-deleted AdVs on cell proliferation and steroidogenesis.Ad5WT could efficiently replicate in adrenocortical cells, leading to S phase induction, followed by cell death, whereas high titer AdVstransduction had only mild effects on adrenocortical cell proliferation, with accumulation of cells in G2/M. Both AdVs and Ad5WT inducedexpression of inflammatory cytokines, such as interleukin-6 and tumor necrosis factor-a, but, most importantly, they led to a marked anddose-dependent increase of cortisol and other steroid hormone production and consistently modulated expression of key steroidogenicenzymes and regulators of steroidogenesis. This effect, which was already apparent at 6 h post-infection, probably represented a responseto adenoviral entry and/or early phases of infection. The result of this study contribute to the understanding of host response to adenoviralvector administration.

J. Cell. Physiol. 220: 45–57, 2009. � 2009 Wiley-Liss, Inc.

Giorgio Palu and Luisa Barzon contributed equally to this work.

Contract grant sponsor: Ministero dell’Istruzione dell’Universita edella Ricerca (MIUR);Contract grant number: 2004063894_003.Contract grant sponsor: Veneto Region;Contract grant number: RSF 271/07.

*Correspondence to: Giorgio Palu and Luisa Barzon, Departmentof Histology, Microbiology, and Medical Biotechnologies,University of Padova; Via A. Gabelli 63; I-35128 Padova, Italy.E-mail: [email protected]; [email protected]

Received 10 November 2008; Accepted 9 January 2009

Published online in Wiley InterScience(www.interscience.wiley.com.), 6 February 2009.DOI: 10.1002/jcp.21727

A number of gene therapy clinical trials using recombinantadenoviral vectors (AdVs) have established a promisingtherapeutic potential of these vectors, which can be easilyproduced at high titer and can efficiently transduce a variety ofdividing and non-dividing cells in vivo (Thomas et al., 2003). But,a major obstacle to the clinical application of AdVs is the innateimmune response elicited in the host against the vector, whichlimits vector safety and efficacy (Thomas et al., 2003). Aftersystemic administration, adenoviral infection induces a rapidand marked innate and adaptive immune response, whichdepends on virus capsid interaction with host cells (Liu andMuruve, 2003). Studies in animal models and in humans haveshown that the innate immune response to adenovirus and AdVinfection is characterized by complement activation, secretionof proinflammatory cytokines (such as tumor necrosis factor[TNF]-a, interleukin-6 [IL-6], IL-1, IL-8, interferon-g [IFN-g],and type I IFNs a and b) and chemokines (such as macrophageinflammatory proteins 1 and 2) by dendritic cells andmacrophages, and activation of natural killer cells (Liu andMuruve, 2003). This innate immune response, which isresponsible for vector AdV toxicity and is characterized byvascular and tissue damage and even death (Mickelson, 2000),has been mainly ascribed to sequestration of adenoviralparticles into the liver with infection of Kupffer cells andhepatocytes (Shayakhmetov et al., 2004, 2005).

Besides liver targeting, adenoviruses have a natural tropismfor the adrenal gland, as shown after systemic administration inmice and in non-human primates (reviewed by Barzon et al.,2004). In particular, efficient transgene expression in theadrenal glands has been demonstrated after intravenous AdVinjection in mice (Groot-Wassink et al., 2002). Within theadrenal gland, zona fasciculata of the adrenal cortex, wherecortisol and corticosterone are synthesized, is most susceptibleto adenoviral infection (Wang et al., 2003).

While liver toxicity due to AdV infection has beenextensively investigated, there is scarce data about the effects ofadenoviruses and AdVs on the adrenal gland (Barzon et al.,2004). Severe morphological and ultrastructural changes were

� 2 0 0 9 W I L E Y - L I S S , I N C .

described in the adrenal glands of calves and rodents afterexperimental adenovirus infection (Hoenig et al., 1974;Margolis et al., 1974; Cutlip and McClurkin, 1975; Strauber andCard, 1978), as well as in infants who died after disseminatedadenoviral infection (Medvedev and Shastina, 1978). Morerecently, Alesci et al. (2002) showed that AdV transduction ofbovine adrenocortical cells in primary cultures increased cellproliferation and led to nuclear fragmentation and mitocondrialalterations. Moreover, AdV infection increased basal steroidhormone production, but decreased steroid hormone releaseafter adrenocorticotropin (ACTH) stimulation (Alesci et al.,2002).

Besides being a target of AdV toxicity, the adrenal gland couldbe involved in the innate immune response to systemicadenoviral infection. It is well known that activation of thehypothalamic pituitary adrenal (HPA) function, which results inincreased cortisol production, has an important role in hostresponse and is critical for host survival during acute andchronic stressful events such as sepsis and viral infections

46 M A T K O V I C E T A L .

(Arafah, 2006). During critical illness, in addition tohypothalamic hormones, inflammatory cytokines such as IL-1,IL-6, and TNF-a, acting at both pituitary and adrenocorticallevels, are capable of stimulating cortisol production, which athigh concentrations has antiinflammatory effects on theimmune system and can modulate hepatic acute phase response(Arafah, 2006).

The recent demonstration that human adrenocortical cellsexpress Toll-like receptors (TLRs) further supports the role ofthe adrenal gland in the early defense against infections(Bornstein et al., 2004b; Zacharowski et al., 2006; Tran et al.,2007). Among the TLR family members identified in humans,TLR9, which recognizes unmethylated CpG motifs present inbacterial as well as in viral dsDNA, has been demonstrated tomediate the innate immune response to adenovirus and AdVinfection in dendritic cells (Zhu et al., 2007) and macrophages(Cerullo et al., 2007), as well as in non-immune cells, such asrespiratory epithelial cells (Hartmann et al., 2007) and could beinvolved in adrenal response to viral infection. In fact, challengewith CpG synthetic oligonucleotides (CpG-ODN) resulted in asignificant increase of plasma corticosterone and inflammatorycytokine levels in wild-type but not in TLR-9 deficient mice(Tran et al., 2007), suggesting this receptor play a role in adrenalstress response in conditions in which microbial DNA ispresent.

To our knowledge, the effect of AdVs on humanadrenocortical cells, and in particular on TLR pathways,cytokine release, and steroid hormone production, has neverbeen investigated. In this study, we analyzed the direct effects ofwild-type adenovirus serotype 5 (Ad5WT) and first-generationAdVs on human adrenocortical cells. The study was performedin vitro to avoid the indirect effects of activation of the HPA axisand immune-inflammatory cells that typically occur in vivo. Inaddition to the examination of basic cell parameters such as cellproliferation, cell cycle profile, and cell death, particularattention was focused on adenovirus-mediated modulation ofadrenal steroidogenesis and immune response induced byTLR-9. We show here that both AdVs and Ad5WT infection ofhuman adrenocortical cells induced expression of inflammatorycytokines, but, most importantly, they led to a marked increaseof cortisol and other steroid hormone production andconsistently modulated expression of key steroidogenicenzymes and regulators of steroidogenesis.

Materials and MethodsCell lines

SW-13 and NCI-H295R cell lines, both derived from humanadrenocortical carcinomas, were obtained from the AmericanType Culture Collection (ATCC, Rockville, MD). SW-13 cellswere cultured in Leibovitz’s L-15 medium supplemented with10% fetal calf serum (FCS) and penicillin/streptomycin (P/S) 1% at378C in humidified incubator without CO2. The NCI-H295R cellline was grown in RPMI medium supplemented with 2% FCS,1% insulin, transferrin, selenium (ITS) and P/S 1% at 378C inhumidified incubator with 5% CO2. HEK 293 cells (ATCC) weregrown in DMEM supplemented with 10% FCS and P/S 1% at 378Cand 5% CO2. Media and supplements were purchased fromInvitrogen S.r.l. (Milan, Italy).

Primary human adrenocortical cell cultures

Primary cultures of human adrenocortical carcinoma wereprepared from five fresh biopsies obtained from surgically removedtumor masses, after informed consent by the patients and localethic committee approval. Briefly, tumor samples were cut intosmall pieces and digested at 378C for 90 min in DMEM medium,containing protease 1 mg/ml, DNAse 67 mg/ml, Amphotericin B1%, and P/S 1%. After centrifugation at 1,600 rpm for 10 min, cells

JOURNAL OF CELLULAR PHYSIOLOGY

were resuspended in DMEM medium containing glutamine 2 mM,Amphotericin B 1%, P/S 1%, ITS 1%, and FCS 10%. For theexperiments, cells were seeded on 24-well plates at a density of2� 105 cells per well. Cells were washed gently with phosphatebuffer saline and growth medium was replaced every 24 h. After1–2 days in culture, about 50% confluent cells were infected withAd5 and AdEGFP, at a multiplicity of infection (MOI) of about 100plaque forming units (pfu) per cell, to assess the susceptibility foradenoviral infection by fluorescent microscopy and to measuresteroid production in growth medium as below described.

Ad5WT and AdV production and titration

Ad5WT was obtained from ATCC. Replication-incompetent AdVsbased on the Ad5 genome and lacking the E1 and E3 regions wereconstructed by homologous recombination in E. coli using AdEasyvector system (Qbiogene, Carlsbad, CA). In these vectors, humancytomegalovirus promoter was used to drive expression of thetransgenes encoding herpes simplex virus thymidine kinase(AdHSV-TK) and green fluorescent protein (AdEGFP). The Adnullvector (Qbiogene), which is identical to the above AdVs but itcontains no transgene, was used as a control of transgene toxicity.AdVs were propagated in E1-complementing HEK 293 cells,purified by cesium chloride density centrifugation, and titrated byTCID50 cpe endpoint assay according to the AdEasy productionprotocol. Viral vector stocks were stored at 5� 109 pfu/mlconcentration in 10% glycerol at �808C until use. Viral infectionsare given as MOI, expressed as pfu per cell. In all cases, theuninfected mock controls were treated under the same conditionsas for infection but for the presence of the virus.

Adenovirus infectivity test

AdEGFP and Ad5WT were used to test adenovirus infectivity inboth adrenocortical cell lines. NCI-H295R and SW-13 cells wereplated on 6-well plates at a density of 5� 105 and 3� 105 cells perwell, respectively. After 24 h, cells were infected with increasingMOIs of AdEGFP, Ad5WT, or mock infected; at 48 h pi cells wereharvested, washed in PBS, and the percentage of EGFP-positivecells was analyzed by flow cytometry in the case of AdEGFPinfection or by immuno-fluorescence staining with a mousemonoclonal antibody for adenovirus hexon structural proteinincluded the VRK Bartels Viral Respiratory Screening andIdentification Kit (Trinity Biotech plc, Wicklow, Ireland) in the caseof infection with Ad5WT.

Analysis of adenovirus replication kinetics

NCI-H295R and SW-13 cells were seeded as above reported andinfected with Ad5WT at MOI 5 or mock infected. Media wereharvested at described time points pi and used to determine viraltiter by standard TCID50 plaque assay. In addition, viral replicationin NCI-H295R and SW-13 cells was evaluated by immuno-fluorescence staining against adenovirus hexon protein as abovereported.

Cell cycle analysis

SW-13 and NCI-H295R cells were disseminated at a density of2� 105 and 1� 106 cells per 25-cm2 flask, respectively. At thisdensity, cells reached about 70% confluence. To synchronize thecell population, growth medium was changed with serum-freemedium for 24 h before infection. Cells were mock infected andinfected with AdVs at different MOIs and harvested in time-courseexperiments. Cells were washed in PBS and fixed for 30 min in cold70% EtOH at�208C. After washing in phosphate citrate buffer andin PBS, fixed cells were treated with 0.1 mg/ml RNase in PBS at378C for 30 min. Thereafter, cells were stained with 0.1 mg/mlpropidium iodide (Sigma–Aldrich Srl, Milan, Italy) in PBS at roomtemperature for 30 min and analyzed by flow cytometry using aBecton-Dickinson FACScan (Becton-Dickinson, FranklinLakes, NJ).

A D R E N O C O R T I C A L R E S P O N S E T O A D E N O V I R A L I N F E C T I O N 47

Apoptosis detection

SW-13 and NCI-H295R cells were infected with Ad5WT and AdVsat different MOIs and harvested at 24, 48, and 72 h pi for annexin Vstaining using the Vybrant Apoptosis Assay Kit (Molecular Probes,Invitrogen S.r.l.). Percentages of annexin V-positive and propidiumiodide-positive cells were determined on a Becton-DickinsonFACScan.

Cell survival analysis

SW-13 and NCI-H295R cells were plated on 96-well plates at1� 103 and 5� 103 cells/well, respectively, to reach about70% confluence, and, after 24 h, infected with Ad5 and AdVs atMOIs ranging from 2 to 500. Cell survival was assayed intime-course experiments by MTT assay (Sigma–Aldrich) and byBrdU Cell Proliferation Assay (Calbiochem, Darmstadt, Germany).

Steroid hormone measurements

NCI-H295R cells were grown until approximately 80% confluenceon 24-well plates. After 1-day growth in serum-free medium, thecells were infected with AdVs and Ad5WT and mock-infected.Cortisol, aldosterone, and 17b-estradiol were measured in cellculture supernatant at 6, 12, 24, 48, 72, and 96 h pi by using EIA kits(Cayman, Ann Arbor, MI).

Quantitative real-time RT-PCR analysis of gene expression

Expression of mRNA encoding steroidogenic enzymes (CYP21,CYP19, CYP11B1, CYP11B2), regulators of steroidogenesis (StAR,SF-1, DAX), cytokines (IL-6, TNF-a, IFN-a, IFN-b), IFN receptors,TLR-9, and IRF7 was analyzed by quantitative real-time RT-PCR inNCI-H295R cells after infection with Ad5WT and AdVs andchallenge with CpG and LPS. Briefly, total RNA was purified fromcells and tissue samples using the RNeasy kit (Qiagen S.p.A., Milan,Italy). Random primed cDNA was synthesized from total RNAusing MuLV reverse transcriptase (Applied Biosystems, FosterCity, CA) and used for quantitative real-time RT-PCR, which wasperformed using SYBR Green PCR Master Mix or TaqMan MasterMix (Applied Biosystems) on an ABI PRISM 7900 HT SequenceDetection System (Applied Biosystems) as reported (Barzon et al.,2008). Absolute quantification was performed against a standardcurve obtained by amplification of correspondent DNA sequencessubcloned into the pCR2.1 vector (Invitrogen Life TechnologiesS.p.A, San Giuliano Milanese, Italy). mRNA copy number wascalculated automatically by 7900 ABI PRISM SDS software againstthe standard curve. mRNA values are reported as copies/mg totalRNA, after standardization against the housekeeping gene GAPDH,which was also absolutely quantified by real-time RT-PCR.Oligonucleotide primer and probe sequences and annealingtemperatures are reported in Table 1.

TABLE 1. Primers and probes used for real-time RT-PCR analysis of gene ex

Gene Forward primer (5(! 3() Reverse primer (5(!

StAR CCACCCCTAGCACGTGGA TCCTGGTCACTGTAGAGASF1 GGAGTTTGTCTGCCTCAAGTTCA CGTTCTTTCACCAGGATGDAX1 CCAAGGAGTACGCCTACCTCAA ACTGGAGTCCCTGAATGTCY11A TCCAGAAGTATGGCCCGATT CATCTTCAGGGTCGATGACYP21 TCAGGTTCTTCCCCAATCCA TCCACGATGTGATCCCTCCYP11B1 GGCAGAGGCAGAGATGCTG TCTTGGGTTAGTGTCTCCCYP11B2 GGCAGAGGCAGAGATGCTG CTTGAGTTAGTGTCTCCACYP19 TCACTGGCCTTTTTCTCTTGGT GGGTCCAATTCCCATGCATLR-9 TGTGAAGCATCCTTCCCTGT GAGAGACAGCGGGTGCAIRF-7 AGCTGTGCTGGCGAGAAG TGTGTGTGCCAGGAATGGIFN-a AGAATCTCTCHTTYCTCCTG TTCTGCTCTGACAACCTCIFN-b TCTAGCACTGGCTGGAATGAG GTTTCGGAGGTAACCTGTIFNAR-1 ATTTACACCATTTCGCAAAGC CACTATTGCCTTATCTTCAIFNAR-2 AACGTTGTTCAGTTGCTCACA TCTCAAACTCTGGTGGTTIL-6 GGGAAGGTGAAGGTCGG TGGACTCCACGACGTACTTNF-a CCCAGGGACCTCTCTCTAATC ATGGGCTACAGGCTTGTCGAPDH GAAGGTGAAGGTCGGAGTC GAAGATGGTGATGGGATT


Statistical analysis

Results are presented as mean� SD. Comparisons betweengroups were performed by two-sided unpaired Student’s t-test.Statistical significance was considered at P< 0.05.

ResultsHuman adrenocortical cells are susceptible toadenoviral infection

The SW-13 and NCI-H295R cells were employed to investigatethe effects of adenoviral infection on human adrenocorticalcells. SW-13 cells are derived from a poorly differentiatednon-functioning carcinoma carrying several chromosomalabnormalities and display fully malignant phenotype, with arapid growth rate (Leibovitz et al. 1973). NCI-H295R cellsderive from a functioning adrenocortical carcinoma, have aslow growth rate and, cytogenetically, are highly aneuploid(Gazdar et al. 1990). NCI-H295R cells express genes encodingall adrenal steroidogenic enzymes and retain the ability toproduce aldosterone, cortisol and C19 steroids and to respondto most physiologic stimuli, such as angiotensin II, potassiumions, and cAMP analogues (Rainey et al., 1994, 2004).

To test the susceptibility of human adrenocortical cells invitro to adenovirus infection and to compare transductionefficiency of first generation E1/E3-deleted AdVs with Ad5WT,SW-13 and NCI-H295R cells were transduced with Ad5WTand with AdEGFP at different MOIs and were analyzed byfluorescent microscopy and flow cytometry for Ad5 hexonprotein and EGFP expression, respectively. Efficiency ofAdEGFP and Ad5WT transduction was high in both cell linesand was increasing with higher MOIs (Table 2). In addition toadrenocortical carcinoma cell lines, Ad5 and AdEGFP efficientlyinfected primary cell cultures established from adrenocorticaladenomas and carcinomas, as shown by immuno-stainingagainst Ad5 hexon protein and by fluorescence microscopy(Fig. 1A). These results confirm the high susceptibility of humanadrenocortical cells to adenoviral infection. Moreover,efficiency of AdV transduction was at the similar level asefficiency of Ad5WT infection, indicating the internalizationmechanism of replication-incompetent AdVs remains intact.

To analyze adenovirus replication kinetics in adrenocorticalcells, Ad5WT production was measured in supernatant ofinfected cells over different time points pi. Ad5WT replicatedefficiently in both SW13 and NCI-H295R cells, as comparedwith control HEK 293 cells, but displayed different replicationkinetics in the two cells lines. In fact, the maximal viral titer wasreached at day 3 pi (1.3� 109 pfu/ml) and at day 7 pi (1.7�108 pfu/ml) in SW-13 and NCI-H295R cells, respectively

pression

3() TaqMan probe (5(! 3()Annealing

temperature (C)

GTCTCTTC 60TGGTT 60ACTTCC 60CATAAA 60TTC 60ACCTG TGCTGCACCATGTGCTGAAACACCT 58GGA CTGCACCACGTGCTGAAGCACT 68

60G 60

60C 58AAG 58GCTTCTA 59

CAAA 59CAG 60ACT 60TC CAAGCTTCCCGTTCTCAGCC 60

TABLE 2. Percentage of AdEGFP- and Ad5WT-positive SW-13 and NCI-H295R cells at 24 h after transduction with increasing MOIsM

Cell line/AdV

Mean percentage (WSD) of Ad-positive cellsa

MOI 5 MOI 10 MOI 15 MOI 25 MOI 50 MOI 100 MOI 300 MOI 500

SW-13/AdEGFP 60.2 W 7.3 70.1 W 8.4 75.5 W 7.2 76.6 W 10.1 82.0 W 9.6 91.3 W 8.6 96.0 W 5.3 96.6 W 4.3SW-13/Ad5WT 58.1 W 9.2 73.0 W 9.1 76.8 W 8.4 77.9 W 9.3 80.5 W 10.2 93.2 W 7.2 95.3 W 4.7 95.5 W 3.2NCI-H295R/AdEGFP 59.5 W 6.8 64.5 W 7.2 72.5 W 5.0 75.6 W 6.3 79.8 W 8.2 92.5 W 6.2 96.1 W 4.2 97.1 W 2.4NCI-H295R/Ad5WT 55.3 W 10.2 67.2 W 8.4 70.8 W 7.0 74.8 W 8.9 76.6 W 10.3 90.8 W 7.2 92.4 W 5.2 94.4 W 5.1

�MOIs are expressed as pfu/cell.aResults represent mean percentages� SD of data from experiments performed three times in duplicate.


(Fig. 1B). This result was confirmed by immunofluorescencestaining for adenovirus structural protein, which showed anincreasing amount of Ad5WT-positive cells with time,indicating production and spread of the virus (Fig. 1B).Infectivity tests and replication kinetics experiments enabled todesign time courses of subsequent experiments, consideringthe time of maximal virus production and growth rate of thetwo cell lines.

Cytopathic effects of adenoviral infection on humanadrenocortical cells

Infection with AdVs deleted in E1 and E3 regions has beenreported to provoke growth retardation of different cell types,microscopically seen as decreased cell confluence withrounded nonadherent cells (Brand et al., 1999). We examinedwhether human adrenocortical cells as well undergo typicalmorphological changes upon AdV transduction. In thisexperiments, AdVs carrying different transgenes (AdEGFP andAdHSV-TK) or without transgene (Adnull) were used toexclude the possibility that AdV-induced phenotypic changes ofinfected cells was specific to the transgene. In NCI-H295R cells,altered monolayer integrity with decrease in cell density andincrease in cell size was observed after infection with all threeAdVs, indicating that this effect was not restricted to thetransgene (Fig. 2). At variance, no marked changes in cellularmorphology were observed in SW-13 cells after infection(Fig. 2).

The effects of recombinant AdVs on human adrenocorticalcell proliferation were evaluated by both MTT and BrdU assays,which gave similar results. At low MOIs (from 2 to 50) AdVtransduction had no effect on SW-13 proliferation comparedwith uninfected control, whereas a slight decrease of cellviability was demonstrated in NCI-H295R cells in dose-dependent manner. When cells were infected with higher MOIs(MOIs 100 and 500), both cell lines showed reduced survival(about 20% reduction) as compared to uninfected control cells(Fig. 3). The effect on adrenocortical cell survival was alsoanalyzed after Ad5WT infection, which led to time- anddose-dependent decrease of cell viability. Time necessary forAd5WT to kill 50% of cell population at MOI 50 was 3 days inthe case of SW-13 cells and 7 days in the case of NCI-H295Rcells (Fig. 3). This result was consistent with replication kineticsof Ad5WT in both cell lines.

Cell cycle analysis after AdV infection at low MOI (from 15 to50) showed no alteration of cell cycle phases, whereas infectionat higher MOI (from 100 to 500) increased the G2/M cellfraction; this effect was most prominent at 2 days pi.Representative results with both NCI-H295R and SW-13 cellsare shown in Figure 4a. Cells were sub-confluent at the time ofinfection and had not yet reached the confluence at the time ofharvesting to rule out contact inhibition was the reason for cellcycle arrest. By annexin V/propidium iodide staining, asignificant increase of cell death was found only in NCI-H295Rcells, but not in SW-13 cells, after infection with both Adnull andAdV carrying transgenes at high MOI (100–500) (Fig. 4b). At


variance with non-replicating AdVs, infection with Ad5WT,even at low MOI (5–25), induced the S phase of cell cycle in bothNCI-H295R and SW-13 cells (Fig. 4c), followed by cell death asa result of viral replication. The maximal increase of cell deathwas observed at 72 h pi (Fig. 4d).

Adenoviral infection induce adrenal steroidogenesis

Adenoviral vector infection has been demonstrated to impairsteroidogenesis in bovine adrenocortical cells and to alter theircellular ultrastructure (Alesci et al., 2002), but no data areavailable on the effect of adenoviral infection onsteroidogenesis of human adrenocortical cells. To investigatethis issue, NCI-H295R cells (which can produce all adrenalmineralcorticoids, glucocorticoids, androgens, and estrogens)were infected with AdVs and with Ad5WT and steroidhormones were measured in culture medium. As shown inFigure 5a–c, dose-dependent increase of steroid hormonelevels was found 24 h pi with AdEGFP. Cortisol and 17b-estradiol were markedly increased, whereas aldosteroneresponse to AdEGFP infection was less pronounced.Production of steroid hormones was increased at both early(6 h) and late (24 h) time points pi (Fig. 5d–f) and was still evidentin later time points pi (72 and 96 h pi) with AdVs, whereassteroid hormone production decreased at 72 h pi inAd5WT-infected cells, probably due to cell death (data notshown). Both AdEGFP and Adnull vectors, as well as Ad5WT,demonstrated similar effects on the level of secreted hormonesin the early phases of infection, whereas incubation with LPS andCpG-ODN did not show marked effects on hormoneproduction (Fig. 5d–f). A three to fivefold increase of cortisolsecretion was also demonstrated in the primary cell culturesestablished from functioning adrenocortical carcinomas afterinfection with AdEGFP MOI 20.

To investigate the mechanism by which adenovirus infectionaffects steroidogenesis, expression of key steroidogenicenzymes and regulators of steroidogenesis was analyzed(Fig. 6). Expression of the gene encoding the steroidogenicacute regulatory protein StAR, a global activator ofsteroidogenesis, was significantly upregulated by both AdVs andAd5WT. StAR mRNA expression levels were highest at 6 h pi,but still markedly increased at 24 h pi. Transcript levels of DAX-1(dosage-sensitive sex reversal, adrenal hypoplasia criticalregion, on chromosome X, gene 1), which is a nuclear receptorthat acts as a negative regulator of StAR and steroidogenesis,were unaltered at 6 h pi but markedly downregulated at 24 h pi.On the contrary, mRNA expression of SF-1 (steroidogenicfactor 1), an inductor of StAR and of steroidogenesis, showed athreefold increase with respect to control cells already at 6 h pi(Fig. 6c). Notably, consistent with SF-1 and StAR induction,mRNA expression of the steroidogenic enzymes CYP21 (21-hydroxylase), CYP11B1 (11b-hydroxylase), CYP11B2(aldosterone synthase), and CYP19 (aromatase) wassignificantly induced at early time points pi. At variance, LPS andCpG-ODN had no significant effects on expression of genesinvolved in steroidogenesis.

Fig. 1. A: Human adrenocortical cell susceptibility to adenoviraltransduction. a: NCI-H295R and (b) SW-13 cells were transducedwith AdEGFP at MOI 50. After 48h pi, EGFP fluorescence inAdEGFP-infected live cells was observed by fluorescent microscopy.Original magnification: 400T. c,d: Immnunofluorescence detection ofadenovirus hexon protein in primary cell cultures established fromhuman adrenocortical carcinomas and infected with Ad5WT at MOI20. Original magnification: 400T. B: Kinetics of Ad5WT replication inhuman adrenocortical cells. HEK 293, SW13, and NCI-H295R cellswere infected with Ad5WT at MOI 5. Infected cells were harvested atthe indicated times, and virus production was quantified by TCID50

plaque assay (upper part) or, at different time points pi, were fixed andstained with an antibody against adenovirus hexon protein. [Colorfigure can be viewed in the online issue, which is available atwww.interscience.wiley.com.]

Fig. 2. Cytopathic effects of AdVs on human adrenocorticalcarcinoma cell lines. Photomicrographs of unstained NCI-H295R(a–d) and (e–g) SW-13 cells infected with AdVs at MOI 50 (a,e: mock;b,f: Adnull; c,g: AdEGFP; d,h: AdHSV-TK). Photos were taken at 72 hpi. Evident morphological changes were observed in NCI-H295R cells(b–d). Original magnification: 200T.



Adenoviral infection modulates cytokine expression inhuman adrenocortical cells

To elucidate the mechanism of adenovirus-mediated inductionof adrenal steroidogenesis, we investigated TLR pathway andcytokine response to adenoviral infection in NCI-H295R cells.Since production of steroid hormones may be regulated byseveral cytokines, produced either by adrenal cells or by intra-adrenal and circulating macrophages and blood cells (Bornsteinet al., 2004a), we wondered whether increased secretion ofsteroid hormones induced by adenoviral infection wasmediated by intraadrenal inflammatory cytokines and type IIFNs, activated through TLR-9 signaling (Benihoud et al., 2007;Zhu et al., 2007). Thus, we studied expression of TLR-9 and itsdownstream effector IRF7 (interferon regulatory factor 7,which is a master regulator of type I IFN response following viralinfection) in NCI-H295R cells after infection with AdVs andAd5WT (Fig. 7). Levels of TLR-9 mRNA were low inNCI-H295R cells, as also observed by Tran et al. (2007), and didnot show any significant modification by either adenovirusinfection or by CpG-ODN and LPS challenge. At variance, IRF7mRNA significantly increased after AdV and Ad5WT infection,

Fig. 3. Evaluation of adrenocortical carcinoma cell survival after AdV infection. NCI-H295R and SW-13 cells were transduced with AdEGFP andAd5WT at indicated MOIs and tested for cell viability by MTT assay at different time points pi. Results are represented as mean W SD ofpercent viability of infected cells relative to mock-infected cells. Experiments were performed two times in quadruplicate.


but not after CpG-ODN and LPS challenge. We also analyzedmRNA expression of type I IFNs and their receptor, IL-6, andTNF-a after infection with Ad5WT and AdVs at early (6 h) andlate (24 h) time points pi. Regarding IFN response, at baselineNCI-H295R cells expressed low levels of both type I IFNs(IFN-a and IFN-b) mRNAs as well as of type I IFN receptorsubunits IFNAR-1 and IFNAR-2, which did not significantly changeafter Ad5WT and AdVs infection nor after CpG-ODN and LPStreatment. Expression of IL-6 and TNF-a mRNA was also low inbaseline conditions, but it was markedly induced by adenovirusinfection (both AdVs and Ad5WT), but not by CpG and LPSchallenge. IFN-a, IFN-b, and TNF-a proteins were measured incell culture supernatants by ELISA, but their levels were verylow and not quantifiable both at baseline and after viralinfection.

Discussion

This in vitro study investigated for the first time the effects ofreplication-defective AdVs and replication-competent


wild-type adenovirus on human adrenocortical cell growth andsteroidogenesis. The data presented above show the highsusceptibility of human adrenocortical cells to adenoviraltransduction. While AdV infection had mild effects onadrenocortical cell morphology and proliferation, both AdVsand wild-type adenovirus led to a marked increase ofcortisol production and consistently modulated expression ofkey steroidogenic enzymes and regulators ofsteroidogenesis during the early phases of infection. Moreover,like cells of the immune system, adrenocortical cells respondedto adenovirus infection with production of inflammatorycytokines. These data suggest the adrenal cortex could beinvolved in the innate immune response to adenoviral infectionand represent the basis for further investigation in in vivomodels.

Regarding the analysis of cytopathic effects of adenoviralinfection on adrenocortical cells, the results of this study showthat Ad5WT induced the S phase, before the newly producedviral particles provoked cell death, in agreement with theliterature (Lowe and Ruley, 1993). The S phase is typically

Fig. 4. Effect of AdVs and Ad5WT on adrenocortical cell cycle and cell viability. a: G2/M arrest induced by Adnull infection of adrenocortical cells.Representative experiments of infection of NCI-H295R and SW-13 cells with Adnull MOI 100 and 500, followed by propidium iodide staining andFACS analysis at 48 h pi. b: Representative experiments of apoptosis and necrosis detection by annexin V/propidium iodide staining of NCI-H295RandSW-13cellsat48hpiwithAdnull atMOI100and500. c:Representativeexperiments showing inductionofSphasebyAd5WTinfection:SW-13cells were infected with Ad5WT at MOI 25, stained with propidium iodide and analyzed by FACS at 48 h pi. d: Apoptosis and necrosis detection byannexin V and propidium iodide staining in SW-13 cells infected with Ad5WT at MOI 25 and analyzed at 24, 48, and 72 h pi. [Color figure can beviewed in the online issue, which is available at www.interscience.wiley.com.]



Fig. 4. (Continued)



Fig. 5. Effect of adenoviral infection on adrenal steroid hormone production. a–c: Dose-dependent effect of AdEGFP infection on basalaldosterone (a), cortisol (b), and 17b-estradiol (c) production by transduced NCI-H295R cells. Steroid hormones were measured in cell culturemedium by EIA assays at 24 h pi. d–f: Basal secretion of aldosterone (d), cortisol (e), and 17b-estradiol (f) by NCI-H295R cells at 6 and 24 h pi withAdnull, AdEGFP, and Ad5WT at indicated MOIs and after challenge with LPS (100 ng/ml) and CpG ODNs (10 mM). M versus mock infected cells(ctr-); P < 0.05 by Student’s t-test.


induced by E1A adenoviral early protein to facilitate viralreplication. Adrenal tropism and lytic activity of wild-typeadenovirus represent beneficial characteristics that could beexploited to engineer oncolytic viruses against adrenocorticalcarcinoma.

At variance with the wild-type adenovirus, transduction withreplication-deficient AdVs at low titers had no significantcytopathic effects on adrenocortical cells. But, at high titers,


simulating the viral dose which might be received by cells after invivo systemic AdV administration for gene therapy, AdVinfection led to cytopathic changes, decreased cell proliferation,and provoked G2/M-arrest. These results in humanadrenocortical cell lines are at variance with observationsperformed on primary cell cultures obtained from bovineadrenal cortex, which increased their proliferation followingAdV infection (Alesci et al., 2002), but are in agreement with the

Fig. 6. Effect of adenoviral infection on adrenal steroidogenesis. a–g: Quantitative real-time RT-PCR analysis of expression of regulators ofsteroidogenesis (StAR, DAX-1, and SF-1) and steroidogenic enzymes (CYP19, CYP21, CYP11B1, and CYP11B2) in NCI-H295R cells aftermock-infection (ctr-), infection with different AdVs at MOI 100, infection with Ad5WT at MOI 100, and challenge with LPS (100 ng/ml) and CpGODNs (10 mM) at indicated time-points pi. h: Schematic representation of adrenal steroidogenesis: Steroidogenic enzymes are represented inboxes, while steroidhormonesandprecursors ofmineralocorticoid,glucocorticoid, andandrogenpathwaysare indicatedbyarrows. Upregulatedgenesarehighlighted ingrey.mRNAvaluesarereportedascopies/10ngtotalRNA,afterstandardizationagainstGAPDHmRNAexpression,whichwas also quantified by real-time RT-PCR. M versus mock infected cells (ctr-); P < 0.05 by Student’s t-test.



Fig. 7. Effect of adenoviral infection on TLR9 pathway and cytokine gene expression in adrenocortical cells. Quantitative real-time RT-PCRanalysis of expression of TLR9, IRF7, IFN-a, IFN-b, IFNAR-1, IFNAR-2, IL-6, and TNF-a mRNA expression in NCI-H295R cells after mock-infection(ctr-), infection with different AdVs at MOI 100, infection with Ad5WT at MOI 100, and challenge with LPS (100 ng/ml) and CpG ODNs (10mM) atindicatedtime-points pi.mRNAvaluesarereportedascopies/10ngtotalRNA,afterstandardizationagainstGAPDHmRNAexpression,whichwasalso quantified by real-time RT-PCR. M versus mock infected cells (ctr-); P < 0.05 by Student’s t-test.




cytopathic effects induced by E1/E3-deleted AdVs in other celltypes, for example, hepatocytes (Brand et al., 1999) and airwayepithelial cells (Hartmann et al., 2007). Induction of phenotypicchanges was not due to transgene expression, but probably toadenoviral structural components or residual gene expression(Walters et al., 2002), since they were observed also with theAdV carrying no transgene. The NCI-H295R cells showedhigher susceptibility to cytopathic effects than SW-13 cells. Thiscould be related to different features of the two tumor cell lines:the SW-13 cell line was established from a more aggressiveform of adrenocortical carcinoma mutated in p53 gene and haslost the ability to produce hormones, whereas NCI-H295Rcells contain wild-type p53, produce steroid hormones andretain slow growth rate.

With particular attention, we studied the effect of AdVs onsteroidogenesis. Steroid hormone production was induced inMOI-dependent manner by both AdVs and Ad5WT and theeffect was not related to the transgene. Moreover, treatmentwith LPS and CpG-ODN had no marked effect on hormoneproduction, indicating the effect was adenovirus-specific. Sinceincreased steroid hormone production was already observed at6 h pi, this effect might be related to adenovirus entry and/or itsearly gene expression. Indeed, recent studies using adenovirusempty capsids strongly suggest that cellular innate immuneresponse to AdV infection is most likely provoked by early stepsof virion infection, regardless of modifications to vectorgenome (Stilwell and Samulski, 2004). As observed in cells of theimmune system (Benihoud et al., 2007), adrenocortical cellsresponded to adenoviral infection with increased expression ofthe inflammatory cytokines TNF-a and IL-6, which representimportant players in the initial nonspecific immune response toviral infection, and with increased expression of IRF7 mRNA, animportant component of cellular IFN response. Besides withcytokine response, human adrenocortical cells participated inthe host response against adenoviral infection with an acutestress response characterized by markedly increased secretionof cortisol and other steroid hormones. Steroid hormonehypersecretion was related to a rapid upregulation of keysteroidogenic enzymes and regulators of steroidogenesis. Inparticular, expression of StAR was significantly induced by bothAdVs and Ad5WT. StAR is a global activator of steroidogenesisthat facilitates uptake and intramitochondrial transfer ofcholesterol to be further metabolized into steroid hormoneprecursors. Expression of the global negative regulator DAX-1and its antagonist SF-1 was also affected accordingly, with amarked downregulation of DAX-1 and upregulation of SF-1 atthe early times pi. The ratio between DAX-1 and SF-1influences the expression of StAR and steroidogenic enzymes.Consistent with SF-1 and StAR activation, expression of CYP21and CYP19 enzymes was significantly upregulated early pi,whereas mRNAs of CYP11B1 and CYP11B2, which catalyze thelast steps of aldosterone and cortisol production, respectively,displayed a marked upregulation at 24h pi.

We think induction of steroidogenesis, and in particular ofcortisol production, could represent a general mechanism ofresponse of the adrenocortical cell to viral infection. This issuggested by our analysis of human adrenocortical cell responseto other viruses, such as human cytomegalovirus (HCMV). Inthis regard, we recently demonstrated HCMV infects andreplicates in human adenocortical cells and induces steroidhormone production within the first hour pi. Moreover, StARand steroidogenic enzyme expression, as well as cytokineexpression, was induced in HCMV infected cells with a patternvery similar to that observed in adenovirus infected cells(Trevisan M. and Barzon L., unpublished observations). Thus,increased cortisol production and inflammatory cytokineexpression could represent the innate immune-endocrineresponse to viral infection of adrenocortical cells. AlthoughTLR-9 expression was low in our model, it cannot be excluded


that this response is mediated by TLR-dependent pathways,since IRF7 expression was induced after infection (Zhu et al.,2007).

In conclusion, this study demonstrates AdVs efficientlytransduce adrenocortical cells in vitro. At low-doses, AdVs didnot show any cytopathic change and had mild effects onsteroidogenesis. Low vector doses could reach the adrenalgland when AdVs are directly injected into the target tissue (e.g.,intratumor injection). The problem might arise in the case ofsystemic vector administration, when the injected viral dosemust be two- to fivefold higher to reach the target tissue atsufficient therapeutic concentration, due to dissemination ofparticles in different organs. At higher doses, AdVs and wildtype adenovirus infection provoked a marked increase ofsteroid hormone production, especially of cortisol. This effectwas related to induction of adrenal StAR and steroidogenicenzyme expression, probably as a response to adenoviral entryand/or early phases of infection. In the context of adenoviralvector use for gene therapy, this effect could be beneficialbecause of the anti-inflammatory and immunosuppressiveeffects of glucocorticoids at high concentrations, which couldcounteract host immune-inflammatory response to AdV oroncolytic adenovirus administration, even though pro-inflammatory effects have also been suggested (Arafah, 2006).The results of this study contribute to our understanding ofvirus-host interaction during natural adenovirus infection and inclinical trials of gene therapy using AdVs. Moreover, ourfindings further support the role of the adrenal cortex in hostinnate immune-endocrine response to infectious agents.

Acknowledgments

This work was supported by grant no. 2004063894_003 fromMIUR (Ministero dell’Istruzione dell’Universita e della Ricerca)to Luisa Barzon and by grant no. RSF 271/07 from VenetoRegion to Giorgio Palu.

Literature Cited

Alesci S, Ramsey WJ, Bornstein SR, Chrousos GP, Hornsby PJ, Benvenga S, Trimarchi F,Ehrhart-Bornstein M. 2002. Adenoviral vectors can impair adrenocortical steroidogenesis:Clinical implications for natural infections and gene therapy. Proc Natl Acad Sci USA99:7484–7489.

Arafah BM. 2006. Hypothalamic pituitary adrenal function during critical illness: Limitations ofcurrent assessment methods. J Clin Endocrinol Metab 91:3725–3745.

Barzon L, Boscaro M, Palu G. 2004. Endocrine aspects of cancer gene therapy. Endocr Rev25:1–44.

Barzon L, Masi G, Pacenti M, Trevisan M, Fallo F, Remo A, Martignoni G, Montanaro D, PezziV, Palu G. 2008. Expression of aromatase and estrogen receptors in human adrenocorticaltumors. Virchows Arch 452:181–191.

Benihoud K, Esselin S, Descamps D, Jullienne B, Salone B, Bobe P, Bonardelle D, Connault E,Opolon P, Saggio I, Perricaudet M. 2007. Respective roles of TNFa and IL-6 in the immuneresponse-elicited by adenovirus-mediated gene transfer in mice. Gene Ther 14:533–544.

Bornstein SR, Rutkowski H, Vrezas I. 2004a. Cytokines and steroidogenesis. Mol CellEndocrinol 215:135–141.

Bornstein SR, Zacharowski P, Schumann RR, Barthel A, Tran N, Papewalis C, Rettori V,McCann SM, Schulze-Osthoff K, Scherbaum WA, Tarnow J, Zacharowski K. 2004b.Impaired adrenal stress response in Toll-like receptor 2-deficient mice. Proc Natl Acad SciUSA 101:16695–16700.

Brand K, Klocke R, Possling A, Paul D, Strauss M. 1999. Induction of apoptosis and G2/Marrest by infection with replication-deficient adenovirus at high multiplicity of infection.Gene Ther 6:1054–1063.

Cerullo V, Seiler MP, Mane V, Brunetti-Pierri N, Clarke C, Bertin TK, Rodgers JR, Lee B. 2007.Toll-like receptor 9 triggers an innate immune response to helper-dependent adenoviralvectors. Mol Ther 15:378–385.

Cutlip RC, McClurkin AW. 1975. Lesions and pathogenesis of disease in young calvesexperimentally induced by a bovine adenovirus type 5 isolated from a calf with weak calfsyndrome. Am J Vet Res 36:1095–1098.

Gazdar AF, Oie HK, Shackleton CH, Chen TR, Triche TJ, Myers CE, Chrousos GP, BrennanMF, Stein CA, La Rocca RV. 1990. Establishment and characterization of a humanadrenocrtical carcinoma cell line that expresses multiple pathways of steroid biosynthesis.Cancer Res 50:5488–5496.

Groot-Wassink T, Aboagye EO, Glaser M, Lemoine NR, Vassaux G. 2002. Adenovirusbiodistribution and non-invasive imagin of gene expression in vivo by positron emissiontomography using the human sodium/iodide symporter as a reporter gene. Human GeneTher 13:1723–1735.

Hartmann ZC, Black EP, Amalfitano A. 2007. Adenoviral infection induces a multi-facedinnate cellular immune response that is mediated by the toll-like receptor pathway in A549cells. Virology 358:357–372.


Hoenig EM, Margolis G, Kilham L. 1974. Experimental adenovirus infection of the mouseadrenal gland. II. Electron microscopic observations. Am J Pathol 75:375–394.

Leibovitz A, McCombs WM III, Johnston D, McCoy CE, Stinson JC. 1973. New human cancercell culture lines. I. SW-13, small-cell carcinoma of the adrenal cortex. J Natl Cancer Inst51:691–697.

Liu Q, Muruve DA. 2003. Molecular basis of the inflammatory response to adenovirusvectors. Gene Ther 10:935–940.

Lowe SW, Ruley HE. 1993. Stabilization of the p53 tumor suppressor is induced byadenovirus 5 E1A and accompanies apoptosis. Genes Dev 7:535–545.

Margolis G, Kilham L, Hoenig EM. 1974. Experimental adenovirus infection of the mouseadrenal gland. I. Light microscopic observations. Am J Pathol 75:363–374.

Medvedev N, Shastina GV. 1978. Morphology of the adrenal cortex in infants with generalizedadenovirus infections. Arkh Patol 40:32–36.

Mickelson CA. 2000. Department of Health and Human Services National Institutes of HealthRecombinant DNA Advisory Committee. Minutes of meeting March 8–10,2000. HumGene Ther 11:2156–2192.

Rainey WE, Bird IM, Mason JI. 1994. The NCI-H295 cell line: A pluripotent model for humanadrenocrtical studies. Mol Cell Endocrinol 100:45–50.

Rainey WE, Saner K, Schimmer BP. 2004. Adrenocortical cell lines. Mol Cell Endocrinol228:23–38.

Shayakhmetov DM, Li ZY, Ni S, Lieber A. 2004. Analysis of adenovirus sequestration in theliver, transduction of hepatic cells, and innate toxicity after injection of fiber-modifiedvectors. J Virol 78:5368–5381.


Shayakhmetov DM, Gaggar A, Ni S, Li ZY, Lieber A. 2005. Adenovirus binding toblood factors results in liver cell infection and hepatotoxicity. J Virol79:7478–7491.

Stilwell JL, Samulski RJ. 2004. Role of viral vectors and virion shells in cellular gene expression.Mol Ther 9:337–346.

Strauber E, Card C. 1978. Experimental intraamniotic exposure of bovine fetuses withsubgroup 2, type 7 adenovirus. Can J Compar Med 42:466–472.

Thomas CE, Ehrhardt A, Kay MA. 2003. Progress and problems with the use of viral vectorsfor gene therapy. Nat Rev Genet 4:346–358.

Tran N, Koch A, Berkels R, Boehm O, Zacharowski PA, Baumgarten G, Knuefermann P,Schott M, Kanczkowski W, Bornstein SR, Lightman SL, Zacharowski K. 2007. Toll-likereceptor 9 expression in murine and human adrenal glands and possible implications duringinflammation. J Clin Endocrinol Metab 92:2773–2783.

Walters RW, Freimuth P, Moninger TO, Ganske I, Zabner J, Welsh MJ. 2002. Adenovirusfiber disrupts CAR-mediated intercellular adhesion allowing virus escape. Cell 110:789–799.

Wang Y, Groot-Wassink T, Lemoine NR, Vassaux G. 2003. Cellular characterization of thetropism of recombinant adenovirus for the adrenal glands. Eur J Clin Invest 33:794–798.

Zacharowski K, Zacharowski PA, Koch A, Baban A, Tran N, Berkels R, Papewalis C, Schulze-Osthoff K, Knuefermann P, Zahringer U, Schumann RR, Rettori V, McCann SM, BornsteinSR. 2006. Toll-like receptor 4 pays a crucial role in the immune-adrenal response tosystemic inflammatory response syndrome. Proc Natl Acad Sci USA 103:6392–6397.

Zhu J, Huang X, Yang Y. 2007. Innate immune response to adenoviral vectors is mediated byboth toll-like receptor-dependent and-independent pathways. J Virol 81:3170–3180.

Investigation on human adrenocortical cell response to adenovirus and adenoviral vector infection

Documents

Transcript of Investigation on human adrenocortical cell response to adenovirus and adenoviral vector infection