Induction of Retinoid Resistance in Breast Cancer Cells by Overexpression of cjun1

1997;57:4652-4661. Cancer Res LiMin Yang, HeeTae Kim, Deborah Munoz-Medellin, et al. Overexpression of cJunInduction of Retinoid Resistance in Breast Cancer Cells by

Updated version

http://cancerres.aacrjournals.org/content/57/20/4652

Access the most recent version of this article at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

[email protected] at

To request permission to re-use all or part of this article, contact the AACR Publications

on July 19, 2014. © 1997 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from on July 19, 2014. © 1997 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

http://cancerres.aacrjournals.org/content/57/20/4652

http://cancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]

mailto:[email protected]

http://cancerres.aacrjournals.org/


[CANCER RESEARCH 57. 4652-4661. October 15, 1997]

Induction of Retinoid Resistance in Breast Cancer Cells by Overexpression of cjun1

I,Â¡MinYang, HeeTae Kim, Deborah Munoz-Medellin, Praveen Reddy, and Powel H. Brown2

Division of Medicai Oncology, Department of Medicine, University of Texas Health Science Center at San Antonio, San Antonio, Texas 78284

ABSTRACT

To investigate the role of AP-1 transcription factors in mediatingretinoid-induced growth suppression of breast cells, we studied the sensitivity of MCF7 breast cancer cells with different levels of AP-1 activity toall-frans retinole acid (atRA). AP-1 activity was increased in MCF7 cellsby stably transfecting c-jun cDNA into these cells. Parental and vector-transfected MCF7 cells, which were sensitive to the growth-inhibitoryeffects of atRA, exhibited atRA-dependent retinole acid receptor (RAR)transactivation and transrepression of 12-O-tetradecanoylphorbol-13-ac-etate-induced AP-1 activity. The c-y'un-transfected MCF7 cells had in

creased basal AP-1 transactivation activity and increased expression ofAP-1-regulated genes but were resistant to the antiproliferative effects ofatRA. However, MCF7 cells transfected with a deletion mutant of c-jun,TAM-67, which lacks most of the ammo-terminal transactivation domainof r.liui and is unable to activate AP-1-dependent gene expression, weresensitive to the growth-inhibitory effects of atRA. These results suggest

that the transactivation domain of cjun is required for induction ofretinoid resistance in these breast cancer cells. atRA did not activateRAR-dependent gene transcription or transrepress 12-0-tetradecanoyl-phorbol-13-acetate-induced AP-1 activity in these cjun-overexpressing

cells. Investigation of the RAR and retinoic acid X receptor expressionlevel demonstrated that RARa and RARy KNA expression was reducedin the c-j'un-transfected MCF7 cells, whereas RAR/3 expression was up-

regulated. However, retinoic acid responsive element DNA binding activity was intact in c-y'un-transfected cells. Therefore, the mechanism by

which cjun overexpression induces resistance to the growth-inhibitoryeffect of atRA may be through interference with atRA-dependent RARtransactivation or AP-1 transrepression, possibly through titration of

essential coactivators. These results suggest that the antiproliferative effects of retinoids can be overcome by cjun overexpression.

INTRODUCTION

The vitamin A-derived retinoids play an important role in regulat

ing a broad range of biological processes including cell growth,differentiation, and development in variety of cell types and tissues(1). Retinoids also inhibit the growth and invasion of cancer cells (2,3) and are clinically useful for the treatment and prevention of cancer(4). In breast cells, retinoids inhibit breast cancer cell growth (5-7)and induce apoptosis (8). One synthetic retinoid, A/-(4-hydroxyphe-nyl)-retinamide, is being evaluated in a clinical trial for its ability to

inhibit breast cancer development (9, 10).Retinoids exert their effects by interacting with specific RAR3 and

RXR receptors (RARa, ÃŸand -y; RXRa, ÃŸand y) (11). Retinoid

receptors are ligand-dependent DNA-binding proteins which regulate

the expression of target genes by binding to the RAREs in the

Received 7/11/97; accepted 8/29/97.The costs of publication of this article were defrayed in part by the payment of page

charges. This article must therefore be hereby marked advertisement in accordance with18 U.S.C. Section 1734 solely to indicate this fact.

1This work was supported by San Antonio Cancer Institute Grant P30 CA 54174(L. M. Y.), Department of Defense Grant DAMD-17-96-1-6225 (to P. H. B. and

D. M. M.), and a grant from the V Foundation for Cancer Research.2 To whom requests for reprints should be addressed, at Division of Medical Oncology,

Department of Medicine. 7703 Floyd Curl Drive, Room 5.210S, University of TexasHealth Science Center at San Antonio, San Antonio, TX 78284. Phone: (210) 567-4777;Fax: (210)567-6687; E-mail: [email protected].

3 The abbreviations used are: RAR. retinoic acid receptor; RXR. retinoic acid Xreceptor; RARE, retinoic acid responsive element; atRA, all frcm.c-retinoic acid; CBP.cyclic AMP response element binding protein; RT-PCR, reverse transcription-PCR;GAPDH, glyceraldehyde-3-phosphate dehydrogenase; 0-gal, ÃŸ-galactosidase; TPA, 12-O-tetradecanoylphorbol-13-acetate.

promoters of these target genes. The RAR and RXR isotypes areexpressed differently during development and differentiation (12), andthese various isotypes can heterodimerize to produce a variety ofRAR:RXR complexes, which likely regulate different sets of retinoid-

induced genes. This complexity is increased further by activation ofthe RAR and RXR receptors by different retinoid ligands. atRA bindsand activates RARs, whereas 9-c;'s-retinoic acid binds and activates

both RARs and RXRs. RAR and RXR isotypes are expressed in breastcancer cells; however, their levels of expression vary widely. Ingeneral, RARa RNA expression is higher in ER+ cells than in ER~

cells (13). RARÃŸRNA is frequently undetectable or expressed at avery low level in ER+ cells (14) but is detectable in some ER~ cells(13). RAR7 is expressed at similar levels in both ER+ and ER~ cell

lines (13). RXRa, RXRÃŸ,and RXR-y RNAs have been detected inboth ER+ and ER" breast cancer cells (15).

Many breast cancer cells are sensitive to the growth-suppressive

effects of retinoids. The exact mechanism by which retinoids inhibittheir growth is not well understood. Depending on the cell type andthe specific retinoid ligand, retinoids have been shown to induceapoptosis, differentiation, or inhibit proliferation directly. Recentstudies suggest that certain retinoid ligands, especially those whichactivate RXRs, are potent apoptosis-inducing agents (16), whereas

other retinoids that activate RARs without activating RXR receptorsregulate differentiation (16).

Studies in breast cancer cells (17) and human bronchial epithelialcells (18) suggest that retinoids may inhibit proliferation throughinhibition of AP-1 transcription factor. The AP-1 transcription factor

consists of heterodimers formed between Jun and Eos family membersof protooncoproteins (19) or homodimers of Jun proteins. Activationof AP-1 transcription factors can regulate proliferation, differentia

tion, or apoptosis, depending on the cell type (19). In breast epithelialcells, AP-1 transcription factors likely regulate proliferation, because

many hormones mitogenic for these cells, such as epidermal growthfactor, transforming growth factor a, and insulin-like growth factors,

activate this family of transcription factors (20). Hormones such asglucocorticoids, estrogens, and retinoids have been shown to inhibitthe activity of the AP-1 transcription factor through transcriptionfactor interaction (21-24). The antagonism between AP-1 and these

nuclear hormone receptors may be mediated by competing or squelching essential coactivators such as CBP (25, 26). However, the exactmechanism of this transcription factor cross-talk is not fully under

stood, and more indirect mechanisms may also be involved. A recentstudy by Fanjul et al. (7) suggested that the ability of retinoids toinhibit AP-1 may be one mechanism by which retinoids inhibit breast

cell growth. These workers demonstrated that specific synthetic retinoids, which fail to activate retinoid receptor-dependent gene expression but which can transrepress AP-1, inhibited the proliferation of

several epithelial cell lines, including the T47D breast cancer cells.To investigate the role of AP-1 in mediating the growth-inhibitory

effects of retinoids, we have compared the sensitivity of breast cancercells with different levels of AP-1 activity to atRA. To generatecomparable breast cancer cells with different levels of AP-1 activity,we overexpressed the c-jun gene in the MCF7 breast cancer cell line,a retinoid-sensitive cell line which had previously been found to havelow basal AP-1 activity (20). The present studies demonstrate that

overexpression of cJun in breast cancer cells induces resistance to the

4652

on July 19, 2014. © 1997 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from


cJUN OVERKXPRKSSION INDUCES RETINOID RESISTANCE

1.8

OO)â€¢¿�*qQ.-c

2-"o>O

.15<ooc

1 23456

Days after treatment

atRA

TRA -atRA -

B

ITt;

qO

1â€”¿�"55

O0>

<DOC

1.6

1.4-

1.2-

1.0-

0.8-

0.6-

0.4-

0.2-

0.0O 1(T9M 1Q-8M 1CT7M 10-6M1fJ5M

Retinoid Concentration

10.0

2 .2 8.0-

6.0-

;= 5.0-

2.0-

10

0.0O 10-9M10'8M 10-7M10-6M10'5M


9.0

8.0-

7.0-

6.0-

5.0-

r-, 4.0-

3.0-

2.0-

1.0-

0.0O 10-9M10'8M10-7M10-6M10-5M


Fig. 1. A, atRA inhibits the growth of MCF7 breast cancer cells. MCF7 cells were exposed to 1 |iM alRA or vehicle only (ETOH), which was added to the cells every other day.CellTiter 96 AQueous assay was used to measure cell proliferation at different days after retinoid treatment. Bars, SE. B, suppression of MCF7 cell growth is dose dependent. MCF7cells were exposed to different doses of atRA (10 9 to 10~5 M and vehicle only), which was added every other day. Cell growth after 7 days of retinoid treatment was determined

by CellTiter 96 AQueous assay. Bars, SE. C activation of RAR-mediated transcription by atRA. MCF7 cells were transfected with a RARE luciferase reporter construct and thepCMV-ÃŸ-gal plasmid and exposed to 1 JÃŒMatRA for 8 h. Cells were lysed, and luciferase and ÃŸ-galassays were performed as described in "Materials and Methods." Bars. SE. D.

activation of RAR is dose dependent. MCF7 cells were transfected with a RARE luciferase reporter construct and the pCMV-/3-gal plasmid and exposed to different amounts of atRA(10~9 to 10~5 M) or vehicle (ETOH). Bars, SE. E, inhibition of AP-1 activity by atRA. MCF7 cells were transfected with the Col-Z-luciferase reporter construct containing an AP-1

binding site and the pCMV-ÃŸ-gal plasmid and exposed to TPA and 1 /Â¿MatRA for 8 h. Cells were lysed. and luciferase and ÃŸ-galassays were performed as described in "Materialsand Methods." Bars, SE. F. inhibition of AP-1 activity by atRA is dose dependent. MCF7 cells were transfected with the Col-Z-luciferase reporter construct and exposed to differentamounts of atRA (10~y to 10~5 M) or vehicle only. AP-1 activity was measured as in E.

4653



cJUN OVEREXPRESSION INDUCES RET1NOID RESISTANCE

growth-inhibitory effects of atRA and interferes with retinoic acid-

induced transactivation of retinoid receptors and transrepression ofAP-1.

MATERIALS AND METHODS

Cell Lines and Reagents. The MCF7 human breast carcinoma cell linewas obtained from Dr. Ken Cowan (National Cancer Institute, NIH). MCF7cells were transfected with either pRC/CMV-c-jun or the pRC/CMV vector

alone, and the stable clones were isolated after selection in G418 (1 mg/ml).Cells were grown in improved modified Eagle's medium (Life Technologies,

Inc., Gaithersburg. MD) with 10% PCS and 1% Pen/Strep antibiotics. Thetumor promoter, TPA, and atRA were obtained from Sigma Chemical Co. Allexperiments with retinoids were performed in reduced light.

Plasmids. The eukaryotic expression vector pRC/CMV-c-y'Â«nwas obtained

by cloning the human c-jun cDNA into the pRC/CMV vector (Clontech, PaloAlto. CA). The Col-Z-luciferase reporter construct, which contains a singleAP-I binding site in a portion of the human collagenase promoter (-1200 to

+63), was kindly provided by Dr. Jon Kurie (M. D. Anderson Cancer Center,Houston, TX; Ref. 27) and was used to determine AP-1 transactivationactivity. The RARE-luciferase reporter construct (28), which contains a por

tion of the RARÃŸpromoter including a typical DR5 RARE, was used todetermine RAR transactivation activity.

Cell Proliferation Assay. Breast cancer cell growth was measured usingCellTiter 96 AQueous Non-Radioactive Cell Proliferation assay (Promega

Corp., Madison. WI) according to the protocol provided by the manufacturer.Briefly, 1000-2000 cells in 100 /xl of medium were seeded in a 96-well plate.

One /XMatRA was added the next day and replaced every other day. Twentyjxl of 20:1 ratio of 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxy-methoxyphenyl)-2-(4-sulfophenyl)-2W-tetrazoIium and phenazine methosulfate was added tothe cells and incubated for 2 h at 37Â°C, and absorption at 490 nm was

determined. Each data point was performed in quadruplet, and the results werereported as mean absorption Â±SE.

RNA Extraction and Northern Blotting. RNA was extracted by cell lysisin buffer containing 4 M guanidine isothiocyanate, 25 mM sodium acetate, and0.12 M j3-mercaptoethanol and pelleted through a CsCl cushion (29). Three to

15 tig of total RNA were separated by gel electrophoresis and blotted ontonitrocellulose membranes by Northern blotting procedures (30). The membranes were then hybridized with 32P-labeled probes prepared by the random-

priming method (31). After washing with 2X SSC, 0.5% SDS for 10 min at42Â°C;0.5X SSC, 0.5% SDS for 15 min at 50Â°C;and 0.2X SSC, 0.5% SDS for30 min at 50Â°C,the membranes were exposed to X-ray film. The intensity of

hybridized bands were quantitated by Phosphorlmager (Molecular Dynamics,Sunnyvale, CA).

Western Analysis. Whole-cell extracts were prepared by suspending thecells in lysis buffer [250 mm Tris (pH 7.5), 60 mM KC1, 1 tiM phenylmethyl-

sulfonyl fluoride, 10 tiM leupeptin, 0.2 unit/ml aprotinin, and 10% SDS], andthe protein concentration was determined by BCA assay (Pierce. Rockford,Illinois). Thirty /xg of protein were fractionated on a 10% acrylamide denaturing gel and transferred onto a nitrocellulose membrane (Life Science,Amersham) by electroblotting. The membrane was blocked with 5% nonfat drymilk in TBST [50 mM Tris (pH 7.5), 150 mM NaCl, and 0.05% Tween 20]overnight at 4Â°Cand washed in TBST, and then the membrane was incubated

with rabbit anti-cJun antibody (Ab-1; Oncogene Science, Cambridge. MA) at

a 1:250 dilution for l h at room temperature. After washing with TBST, themembrane was incubated with horseradish peroxidase-conjugated secondary

antibody (Life Science, Amersham) at 1:4000 dilution for l h at room temperature. The membrane was washed in TBST and then developed using theenhanced chemiluminescence (ECL) procedure (Life Science, Amersham).

RT-PCR. cDNAs were synthesized from 1 tig of total RNA using Molo-

ney murine leukemia virus reverse transcriptase (Life Technologies, Inc.) witha random hexamer primer (Life Technologies, Inc.) as described (32). ThecDNAs were used as templates for PCR using primers (sense, 5'-AAGCTTGTCG ACGCC ACCAT GTTTG ACTGT ATGGA TG-3' and antisense,5'-AGCCC TTACA TCCCT CACAG-3' for RARÃŸ:and sense, 5'-CGGGAAGCTT GTGAT CAATG G-3' and antisense 5'-GGCAG TGATG GCATGGACTG-3' for GAPDH as an internal control). The 5' primers for PCR werefirst end-labeled with [y-'2P]ATP by T4 polynucleotide kinase (DuPont NEN,

RNA

B

endo cjunexo cjun

exo cJun

cJun Vector

Protein

cJun Vector

AP-1 Activity

cJun Vector

AP-1 Regulated GenesVimentln

uPA

tPA

28S

cJun Vector

Fig. 2. A and B, cjun expression in c-_/wn-transfected cells. Total RNAs and cell proteinswere extracted from c-yun-transfected cells (cJun I, cJun 2, and cJun 3) and vector(pRC/CMV)-transfected cells (Vector 1, Vector 2, and Vector 3). Northern and Westernblotting were performed as described in "Materials and Methods." The membrane was

hybridized with c-jun cDNA (A) or anti-cJun antibody (B). C AP-1 activity in c-jun-transfected cells, c-y'Â«n-transfectedcells and vector-transfected cells were transfected with

the Col-Z-luciferase reporter construct containing an AP-1 binding site. Cells were lysed,and luciferase and )3-gal assays were performed as described in "Materials and Methods."

Bars, SE. D, AP-1 regulated gene expression in c-ynn-transfecled cells. Total RNA wasextracted from c-ywn-lransfected cells (cjun 1, cjun 2. and cJun 3} and vector (pRC/CMV)-transfected cells ( Vector 1, Vector 2, and Vector 3), and Northern blot analysis wasperformed as described in "Materials and Methods." The membrane was hybridized with

vimentin, urokinase plasminogen activator (uPA), and tissue plasminogen activator (tPA)cDNAs.

Boston, MA) at 37Â°Cfor 30 min. PCR reactions were performed using 25

(GAPDH) or 30 (RARÃŸ)cycles. The PCR products were fractionated on a 4%polyacrylamide gel and detected by autoradiography.

Transient Transfection and Reporter Assays. Cells were transfectedwith 2-5 fig of plasmid DNA by calcium phosphate precipitation for 16 h and

were replaced with medium after washing with PBS twice to remove calciumphosphate precipitation. Ten nM TPA and 10~6 M atRA were added to the cells

for 8 h, followed by lysing the cells with lysis buffer containing 1 mM DTT,100 mM potassium phosphate (pH 7.8), and 1% Triton X-100. Luciferaseassays were performed by adding 10-100 /xl of cell lysate to 100 til of

substrate A and 100 til of substrate B using a standard protocol (LuciferaseAssay kit; Tropix. Inc., Bedford. MA), ÃŸ-galassays were performed by adding20 til of either diluted or undiluted cell lysate to 80 til of ÃŸ-galreagent buffer

containing 88 mM phosphate buffer (pH 7.3), 11 mM KC1, 1 mM MgCl2, 54.7tiM ÃŸ-mercaptoethanol, and 4.4 mM chlorophenol red-ÃŸ-D-galactopyranoside(Boehringer Mannheim. Mannheim, Germany) at 37Â°C.and the absorption at

600 nm was determined. The luciferase results were then normalized using theÃŸ-galassay results to control for transfection efficiency. All transient trans-

4654



cJUN OVEREXPRESSION INDUCES RETINOID RESISTANCE

CoO)

q0

oO"05

Ã¼o

CDCC

o.o01 2345678

2.5

2.0

1.5-

1.0

0.5

O.OÃ•

cJun1

-o- ETOH-o atRA

012345678

2.5

2.0

1.5-

1.0

0.5

0.0

2.5

2.0

1.5-

1.0-

0.5-

0.0

Vector2

ETOHatRA

-â€¢2-0

01 23456789

cJun2

ETOHatRA

01 23456789

Days after Treatment

012345678

2.5

2.0-

1.5-

1.0-

0.5-

cJun3

ETOHatRA

0123456789

Fig. 3. Resistance of c-;'un-transfected cells to atRA. Vector-transfected cells (top) and c-j'un-transfected cells (bottom) were exposed lo vehicle (ETOH) or I JÃŒMalRA, which was

added to the cells every other day. CellTiter 96 AQueous assay was used to measure cell proliferation at different days after retinoid treatment. Bars. SE.

fection studies were done in triplicates, and the data were plotted asmean Â±SE from at least two independent experiments.

Mobility Shift Assay. Cells were treated with 10~6 M atRA or vehicle

(DMSO) as control for 24 h. Nuclear extracts were prepared as described (30).Briefly, the cells were lysed in lysis buffer (10 mM HEPES, 1 mM EDTA, 60

mM KC1, 0.5 mM DTT, 0.5% NP40 and proteinase inhibitors), and the extractswere centrifuged at 5000 rpm to isolate nuclei. The isolated nuclei were

resuspended in nuclear suspension buffer [250 mM Tris (pH 7.8), 400 mM KC1,0.5 mM DTT, 20% glycerol, and proteinase inhibitors] and lysed by freezingand thawing. The protein concentration was determined by Bio-Rad assay(Bio-Rad Laboratories, Richmond, CA).

The DR5 RARE oligonucleotides (Life Technologies, Inc.) contains RARE

DR5 (response elements are underlined). Their sense and antisense sequencesand the sequences of mutated DR5 RARE are as follows: DR5 RARE sense,TCGAGGGTAGGGTTCACCGAAAGTTCACTCG; DR5 RARE antisense,

AGCTCCCATCCCAAGTGGCTTTCAAGTGAGC; mutated DR5 RAREsense, TCGAGGGTAGGCTTACCCGAAAGTTCACTCG: and mutated DR5RARE antisense, AGCTCCCATCCGAATGGGCTTTCAAGTGAGC.

The double-stranded oligomer probes were prepared by annealing sense andantisense oligonucleotides at 90Â°Cfor 10 min and at room temperature for 1 h,followed by 32P-end labeling with T4 polynucleotide kinase (Life Technolo

gies, Inc.). One hundred pg of probe were incubated with 10 /xg of nuclearprotein extract and 2 fig of poly(dl-dC) in binding buffer [20 mM HEPES (pH

7.9), 40 mM KC1, 1 mM MgCl2, 1 mM EGTA, 1 mM phenylmethylsulfonylfluoride, 5 mM DTT, and 1% glycerol] at 4Â°Cfor 30 min. The reaction mixture

was subjected to electrophoresis on 5% nondenaturing polyacrylamide gel at4Â°C.The gel was exposed to X-ray film for autoradiography, and the retarded

bands were quantitated by Phosphorlmager (Molecular Dynamics, Sunnyvale,CA).

RESULTS

atRA Activates RAR-dependent Gene Expression and InhibitsAP-l-dependent Gene Expression in atRA-sensitive Breast Can

cer Cells. To investigate the mechanism by which retinoids inhibitbreast cell growth, we studied the ability of atRA to affect RAR-dependent transactivation and AP-1-dependent transactivation in the

MCF7 breast cancer cell line, previously shown to be sensitive to thegrowth-inhibitory effects of atRA (33, 34). As seen in Fig \A, 1 /AM

atRA inhibited the growth of MCF7 by 50% (P < 0.05) at day 7. Fig.IÃŸdemonstrates that this inhibition is dose dependent, with an IC50 of3 X IO"8 M. To determine whether the ability of atRA to inhibit

growth correlates with activation of the RARs (transactivation) orsuppression of AP-1 activity (transrepression), we transfected MCF7cells with either a retinoid-responsive luciferase reporter construct(RARE-luciferase) containing an RARE linked to the luciferase geneor an AP-1-dependent reporter gene (Col-Z-luciferase) containing aportion of the collagenase promoter (-1200 to +73), which contains

an AP-1-dependent TPA-response element. Previous studies havedemonstrated that this AP-1 binding site is critical for TPA- andgrowth factor-induced activation of this portion of the collagenasepromoter (27). As shown in Fig. 1, C and D, atRA activates RARE-dependent gene expression in a dose-dependent manner in MCF7cells. One nM atRA induced a 4-fold increase in luciferase activity(P < 0.05), whereas maximum induction (a 9-fold increase) was seenat l /J.M atRA (P < 0.05; Fig. 1C). The EC50 of atRA-inducedtransactivation was 1 x 10~8 M (Fig ID). Using the AP-1-dependent

4655



OVI Ki:.\l'KHSSI()N INDITES RHT1NOID RESISTANCE

EcoO)Tfqo

Vector1

Vector2

Vector3

1.25

1.00

0.75

0.50

0.25

0.00

1.25

1.00

0.75

0.50

0.25

(M) O IO'9 10'8 10'7 10'6 100.00(M) O IO'9 IO'8 10'7 IO'6 IO'5

1.25

1.00

0.75

0.50

0.25

0.00

O(TjcJuncJunâ€”

12"o1-25-Ãœ<D

1.00-^^.â€”^

0.75,(Drr0.500.25-n

nn-J

T*T~^^-^JL-^^^^^^Ãi

i1.25-1.00-0.75-0.50-0.25-n

nn.~^V.

^^Â°-~~^JL_^y^*'

(M) O 10'9 10'8 10'7 10'6 10'5

cJun3

1.25

1.00-

0.75

0.50

0.25-

0.00(M) O 10'9 10'8 10'7 10'6 10 (M) O 10'9 10'8 10'7 10'6 10'5 (M) O 10'9 IO'8 IO'7 10'6 10'5

Fig. 4. alRA dose response in MCF7 transfectants. Vector-transfected cells and c-y'n/i-transfected cells were exposed to different doses of atRA (added to the cells every other day).

Cell proliferation was measured at day 7 after retinoid treatment. Bars, SE.

reporter construct, we demonstrated that atRA could also inhibit basaland TPA-induced AP-1 activity in MCF7 cells (Fig. l, E and F). OneÂ¡IMatRA inhibited basal AP-1 activity by 25% (P < 0.05) andTPA-induced AP-1 activity by 50% (P < 0.05), with IC50 of2 X 10~8 M(Fig. l, fand F). atRA also inhibited the growth of T47D

cells, activated RAR-dependent transactivation, and inhibited AP-1

activity in T47D cells (data not shown). These results demonstrate thatatRA activates RAR-dependent gene transcription and inhibits AP-1-

dependent gene transcription in breast cancer cells that are growthinhibited by atRA.

Construction of cjun-overexpressing MCF7 Cells. To addresswhether inhibition of AP-1 activity is necessary for atRA-induced

growth suppression, we overexpressed cJun in MCF7 cells and measured their proliferation in the presence of atRA. To isolate cJun-

overexpressing MCF7 cells, we transfected MCF7 cells with thehuman c-jun gene under the control of a strong constitutive promoter(pRC/CMV-c-jH/7). We obtained three independent cJun-overexpress-

ing cell lines, designated as cJun 1, cJun 2, and cJun 3. and threevector-transfected control cell lines (vector 1, vector 2, and vector 3).The c-jun transfected cell lines expressed a high level of cJun mRNA(Fig. 2A) and protein (Fig. 2B) and a high level of AP-1 activity, asdefined by transactivation of an AP-1-dependent reporter gene (Fig.2C) or as defined by increased expression of AP-1-regulated genessuch as vimentin, tissue plasminogen activator, and urokinase plas-

minogen activator (Fig. 2D), as compared to three MCF7 clonestransfected with vector alone (vector 1, vector 2, and vector 3).

cJun Overexpression Blocks atRA-induced Growth Suppres

sion of MCF7 Cells. We next measured the proliferation of thesecJun-overexpressing MCF7 cells in the presence of atRA. The growthrate of these cJun-overexpressing cells in the absence of retinoids isslightly slower than that of vector-transfected cells (Fig. 3). In thepresence of l JU.MatRA, the growth of the vector-transfected cells was

inhibited (Fig. 3). However, l /UMatRA failed to inhibit the growth ofeach of the c-y'Â«/7-transfectedMCF7 clones (Fig. 3).

Vector-transfected clones have an IC50 of approximately 1-2 X 10~8 MatRA (Fig. 4) and are equally sensitive to atRA as parental

MCF7 cells (compare with Fig. 1/4). However, the growth of thec-y'Mw-transfected cells was not inhibited (cJun clone 1) or was mini

mally inhibited (cJun clones 2 and 3) by atRA, even at the doses upto IO"5 M (Fig. 4).

To investigate whether expression of the full-length c-jun gene is

required to induce resistance to atRA, we transfected MCF7 cells witha deletion mutant of c-jun. TAM-67, which lacks most of the NH2-terminal transactivation domain of c-jun (amino acids 3-122 have

been deleted). This cJun mutant has been shown previously to beunable to activate AP-1-dependent gene expression (35) but able to

bind DNA and dimerize with cJun and cFos (36, 37). MCF7 cell lineswere stably transfected with pCMV-TAM-67, and three independentclones that have high expression of the TAM-67 protein (data not

shown) were tested for their sensitivity to atRA. The growth of thesecells in the presence of atRA is shown in Fig. 5. Each of the threeTAM-67-transfected MCF7 clones is sensitive to the growth-inhibi-

4656



i-JI-N (IVI Kl NI'RI.SSION INDICI.S RIHN(III) KISISIANC1

2.0

Tam673

1.5

1.0

0.5

O.OÃ•

-o- ETOH-t>- atRA

0 2 4 6 8 10 12 0 2 4 6 8 10 12 0 2 4 6 8 10 12

Days after TreatmentFig. 5. TAM67-transfected cells arc sensitive to utRA. Vector-transfected cells and mutant c-jun (TAM67)-transfecled cells were exposed to vehicle (ETOH) or 1 /AMatRA (added

lo the cells every other day). Cell prolifÃ©rationwas measured as described in Fig. 3. Bars, SE.

tory effects of atRA. These results suggest that the transactivationdomain of cJun is required for induction of retinoid resistance in thesebreast cancer cells.

atRA-induced RAR-dependent Transactivation and AP-1Transrepression Are Blocked in cJun-overexpressing Cells. Toinvestigate the mechanism by which cJun overexpression inducesresistance to atRA, we examined the ability of atRA to activateRAR-dependent gene expression in the cJun-overexpressing cells.The results shown in Fig. 6 demonstrate that atRA-induced RAR-dependent transactivation is blocked in cJun-overexpressing cells ascompared to either parental MCF7 cells (Fig. 1C) or vector-trans-fected MCF7 cells (Fig. 6). However, the basal level of RAR-dependent transactivation is not down-regulated in cJun-overexpressing cellswhen compared to the basal level in vector-transfected cells (data notshown).

atRA-induced AP-1 transrepression is also blocked in the c-jun-transfected MCF7 cells, as shown in Fig. 7. In all three c-jun-transfected clones, atRA failed to inhibit TPA-induced AP-1 activity,whereas it did inhibit TPA-induced AP-1 activity in each of the

vector-transfected cells by 50-60% (Fig. 7), just as was seen with theparental MCF7 cells (Fig. ID).

RARa and KAKy Expression Is Down-Regulated, and KVK/ÃŽExpression Is Up-Regulated in cjun-overexpressing Cells. To further investigate the mechanism by which cJun overexpressioninduces resistance to atRA, we next measured the expression ofRARs in the cJun-overexpressing cells. Fig. 8 shows Northern blotanalysis of RNA from vector- and c-jun-transfected cells treatedwith vehicle (DMSO) or atRA (1 X 10~6 M) for 24 h. The RNA

was then analyzed for expression of the RARs (RARa. RAR/3. andRARy) or RXRs (RXRa, RXRÃŸ.and RXR-y). As shown in Fig. 8,the expression of RARa mRNA is down-regulated in cJun-over-expressing cells (a 3-4-fold decrease as quantitated by Phospho-rlmager) as compared to vector-transfected cells, either in theabsence or presence of atRA. The expression of RARy and RXRamRNA is also decreased 2-fold in the c-yw/i-transfected cells ascompared to vector-transfected cells. RXRÃŸexpression is increased in two of three c-y'i//i-transfected clones, and RXR-y expression is increased in one of three c-y'i/n-transfected clones.

Fig. 6. atRA does noi induce RAR transactivating activity in c-juti-Iransfected cells. c-yw'i-transfected cells and vector-transfected cellswere transfecled with the RARE luciferase reporter construct and thepCMV-ÃŸ-gal plasmid and exposed to l Â¿IMatRA for 8 h. Cells werelysed. and luciferase and /3-gal assays were performed as described in"Materials and Methods." Bars, SE.

Cg ^^

Â¡;f"o"oto <C 03Â«!2.*- ro

â€¢¿�S=

IsQ) *3

Q J5

5Å’

10

9

8

7

6

5

4

3

2

1

0

Vector1 2

cJun

2 3

â€¢¿�â€¢â€¢¿�â€¢il ilatRA - +

4657




Fig. 7. atRA failed to inhibit AP-1 transactivating activity inc-jun-transfected cells. cJun-transfected cells and vector-trans-fected cells were transfecled with the Col-Z-luciferase reporterconstruct containing an AP-1 binding site and the pCMV-/3-gal

plasmid and exposed to TPA and l /J.MatRA for 8 h. Cells werelysed, and luciferase and /3-gal assays were performed as described in "Materials and Methods."

atRA - +

Therefore, there is no consistent change in the expression of theRXR/3 or RXRy in the c-y'wrc-transfected cells as compared to the

vector-transfected cells. In addition, we saw no induction ofRARa, RAR-y, or RXRa, RXR/3, RXR-y in response to atRA in

either the vector-transfected or the c-jw/Ã®-transfectedcells.

Because RARÃŸRNA was not detected by Northern blot analysis,we used RT-PCR to measure the expression of RARÃŸin these cells.As shown in Fig. 9, RARÃŸRNA is undetectable, even using RT-PCRin vector-transfected cells, but is detectable in c-yÂ«n-transfected cells(cJun 1, cJun 2, and cJun 3). Thus, RARÃŸexpression is up-regulatedin these cJun-overexpressing MCF7 cells.

RARE Binding Activity Is Intact in cJun-overexpressing Cells.

To investigate the mechanism by which cJun overexpression blocksatRA-induced RAR transactivation activity in cJun-overexpressing

cells, we used a mobility shift assay to determine whether the RARspresent in the vector- and c-yw/i-transfected cells can bind DNA

containing a RARE DR5 consensus sequence. Fig. 10A shows theRARE DNA binding activity present in one vector-transfected MCF7

clone (vector 2). As shown in this figure, band 1, band 2, and band 3

are RARE-specific binding complexes because the binding of thesecomplexes was competed by a nonradiolabeled wild-type RARE

oligonucleotide but was only minimally competed by a nonradiolabeled mutant RARE oligonucleotide. Fig. 105 shows the RARE DNAbinding activity of all vector- and c-yÂ«/i-transfected MCF7 clones inthe absence ( â€”¿�) or presence (+ ) of atRA. RARE-binding complexes

are present in all three cJun-overexpressing cells as well as in vector-transfected cells. The vector- and c-y'wrt-transfected cells had similar

RARE-DNA binding activity. Specifically, the amount of RARE

DNA binding activity in band 1 and band 3 was similar between thevector-transfected and c-JKH-transfected cells, whereas there was anapproximately 40% decrease in the amount of RARE-DNA bindingactivity in band 2 in the c-y'wn-transfected cells (relative amount in the

absence of atRA for: vector 1, 1.0; vector 2, 1.1; vector 3, 0.9; cJunl,0.6; cJun2, 0.6; cJun3, 0.6). atRA treatment did not increase RAREbinding activity in either vector- or c-yw/i-transfected cells. This de

crease expression in band 2 may be due to the decreased expression ofRARa or RARy shown above in Fig. 8. However, the total RAREDNA binding activity was only slightly decreased in c-^Mw-transfected

28S

RARÃŸ None Detected

RARy

288

RXRy

28SFig. 8. RAR RNA expression in cJun-overexpressing cells. Total RNA was extracted from c-ywn-transfected cells (cJun I. cJun 2, and cJun J) and vector (pRC/CMV)-transfected

cells (Vector 1, Vector 2, and Vector 3) treated with l /IM atRA or vehicle (DMSO) for 24 h. Northern blot analysis was performed as described in "Materials and Methods." The

membrane was hybridized with RARa, RARÃŸ,RARy, RXRa, RXRÃŸ.and RXRy cDNAs.

4658



cJUN OVF.RIvXI'RI'SSION INDUCES RETINOID RESISTANCE

Vector cJun

RARÃŸ

GAPDHFig. 9. RAR/3 RNA expression in cJun-overexpressing cells detected by RT-PCR.

cDNAs were synthesized from I fig of total RNA by Moloney murine leukemia virusreverse Iranscriptase with a random hexamer primer and were used as templates for PCRusing primers for RARÃŸand for GAPDH as an internal control. The 5' primers for PCRwere first end-labeled with (-/-"PJATP by T4 polynucleotide kinase. PCR reactions wereperformed as described in "Materials and Methods."

cells. These results demonstrate that the RARE binding activity doesnot correlate with RAR transactivation activity in these cJun-overex-pressing MCF7 cells because despite considerable levels of RARE-DNA binding activity, atRA failed to activate RAR-dependent

transcription.

DISCUSSION

The above results show that overexpression of cJun, which increases AP-1 activity, in breast cancer cells induces resistance to thegrowth-inhibitory effects of atRA and prevents retinoid-induced activation of RAR-dependent transactivation and transrepression of API-dependent transactivation. MCF7 cells transfected with a c-jun

mutant lacking the transactivation domain are sensitive to atRA,demonstrating that the transactivation domain of cJun is required forthis resistance. The results also suggest that inhibition of atRA-induced RAR-dependent transactivation in cJun-overexpressing cells

is not due to the loss of RARs/RXRs or the lack of RARE DNAbinding (although the expression of RARa and RAR-y receptors is

down-regulated). Therefore, a defect in atRA-induced RAR transactivation or AP-1 transrepression may contribute to retinoid resistance

in these cells.Previous studies have demonstrated that transient overexpression of

cJun can affect retinoid signaling in F9 mouse embryonal carcinomacells (23). Yang-Yen et al. (23) showed that transient transfection ofc-jun into F9 cells caused inhibition of retinoid-induced transactivation of a retinoid-dependent reporter gene. Conversely, hormones

such as glucocorticoids and retinoids have been shown to inhibit theactivity of the AP-1 transcription factor through transcription factor"cross-talk" (21-24). This transcription factor cross-talk is reciprocal

because AP-1 transcription factors have also been shown to inhibit the

activity of glucocorticoid receptor and retinoid receptors (22). Recentstudies suggest that the antagonism between AP-1 and RAR may bemediated through competitive binding or "squelching" of essential

coactivators such as CBP, which is required for both AP-1-dependentand RAR-dependent transcription (25, 26).

Other investigations using anti-AP-1 retinoid analogues have alsoshown that retinoid-induced inhibition of AP-1 can suppress the

growth of breast cancer cells. Fanjul et al. (7) showed that suchanti-AP-1 retinoid analogues, which inhibited AP-1 without activatingretinoid-dependent gene transcription, could inhibit the growth of

several different cancer cell lines, including the breast cancer cell line,T47D.

RARE (ng)mRARE (ng)

Bandi

Band 2

Band 3

5 10 25 - - -- - - 5 10 25

Probe

Fig. 10. RARE binding activity in cJun-overexpressing cells. Vector- and c-yun-transfected cells were treated with l /J.MatRA or vehicle (DMSO) for 24 h. Nuclear extracts wereprepared, and gel shift assays using the oligonucleotides containing a DR5 RARE were performed as described in "Materials and Methods." A, a gel shift assay was performed using

nuclear extracts from the vector-transfecled cell line (vector 2) incubated with a radiolabeled RARE oligonucleotide probe and different amounts of nonradiolabeled RARE and mutantRARE oligonucleotides. The three thin arrows show specific RAR/RXR-DNA binding complexes, because they are competed preferentially by the wild-type DR5 RARE. The unboundprobe is indicated by the broad arrow. B. a gel shift assay was performed using nuclear extracts from vector- and c-j'un-transfected cells treated with vehicle (DMSO; marked "-")or 1 (Â¿MatRA (marked " + ") for 24 h. The thin arrows show specific RAR/RXR-DNA binding complexes.

4659




Many of the previous studies investigating the mechanism of AP-1/RAR interaction have shown AP-l/RAR interaction at the level ofDNA binding using in vitro gel shift experiments or in cells trans-

fected with reporter genes. Such studies do not address the physiological importance of interaction between AP-1- and RAR-dependent

signal transduction pathways in controlling cellular processes such asproliferation. The results presented here demonstrate that overexpres-

sion of cJun can affect retinoid signal transduction pathways, leadingto resistance to the antiproliferative effects of retinoids.

The interaction between AP-1 and retinoid signaling pathways inthe cJun-overexpressing cells may be through either a direct or indi

rect mechanism. Because the RARE binding activity is present incJun-overexpressing cells, the direct inhibition of RAR/RXR DNA

binding through the binding of cJun to RAR/RXR is unlikely. Inaddition, the changes in RAR and RXR RNA levels did not abolishRARE binding activity, although the binding of one of the threeRARE-bound complexes was decreased. As discussed below, thisdecrease in one form of the RARE-bound complexes may be due to

decreased RARa or RARy expression.The present results also demonstrate that cJun overexpression in

hibits atRA-induced RAR-dependent transactivation and AP-1 tran-

srepression in these cells. One mechanism by which transactivation ortransrepression could be altered is through squelching of essentialcoactivators by increased cJun expression. One such essential cofactorrequired for both RAR-dependent and AP-1-dependent transactivationis the CBP (25, 26). Thus, the block of RAR-dependent transactivation seen in the cJun-overexpressing cells may be due to "squelching"

of CBP. In this case, cJun protein would bind CBP, making itunavailable for RAR-dependent transcriptional activation. To investigate this possibility, we attempted to restore atRA-induced RAR-dependent transactivation in the cJun-overexpressing cells by overex-pressing CBP. However, transfection of human CBP into the cJun-overexpressing MCF7 cells failed to restore atRA-induced RAR-

dependent transactivation in these cells (data not shown), suggestingthat the lack of responsiveness to retinoids is not due to a relative lackof CBP. However, coactivators other than CBP may be "squelched,"

leading to retinoid resistance. We are presently investigating the roleof other coactivators in mediating retinoid resistance in these cells.

Alternatively, increased AP-1 activity may indirectly affect RAR/RXR activity. This could occur by induction of AP-1-regulated pro

teins that inhibit the expression or function of RAR or RXR. Thepresent results demonstrating that the expression of RARa and RARyis down-regulated and RARÃŸis up-regulated in the retinoid-resistantc-y'un-transfected cells support such an indirect mechanism. The

RARE DNA binding data reported here show that one of the threeRARE binding complexes is decreased in the cJun-overexpressing

cells. If this complex is made up of retinoid receptors that areimportant mediators of the antiproliferative effects of retinoids, sucha decrease could account for the retinoid resistance seen in those cells.Indeed, previous studies suggest that the different RARs regulate theexpression of unique target genes (38, 39) and induce different biological effects (40, 41). These studies support the hypothesis thatalterations in specific RARs could induce resistance in these cells.Such results are consistent with recent findings reported by Sheikh etal. (42) and Dawson et al. (43), who showed that sensitivity toretinoids in breast cancer cells correlates with the expression of RARaand are consistent with an indirect mechanism by which overexpression of cJun leads to the changes in the expression of specific RARisotypes, ultimately leading to resistance to the antiproliferative effects of retinoids.

The present results have important implications for the treatmentand prevention of breast cancer using retinoids. A better understanding of the interactions between AP-1- and RAR-dependent pathways

in breast cancer cells may allow the development of specific antiproliferative retinoids that may be effective chemotherapeutic or chemo-

preventive agents. The observation that increased cJun expressioninduces retinoid resistance may also allow prospective identificationof tumors that will or will not respond to retinoid therapy based ontheir expression of AP-1 family members. Just as expression of the

estrogen receptor in breast tumors guides present therapy, expressionof retinoid receptors and/or AP-1 family members may guide future

therapy with retinoids.

ACKNOWLEDGMENTS

We thank Dr. Jon Kurie (M. D. Anderson, University of Texas HealthScience Center) for providing us with the Col-Z-luciferase and RARE-luc

plasmids, GAPDH, and RAR/3 PCR primers. We also specially thank Drs. JonKurie, Douglas Yee, and John Ludes-Meyers for helpful critiques of the

manuscript.

REFERENCES

10.

11.

12.

13.

14.

15.

16.

17.

Roberts, A. B., and Sporn. M. B. Cellular biology and biochemistry of the retinoids.In: M. B. Sporn, A. B. Roberts, and D. S. Goodman (ed.). The Retinoids, pp.209-286, 443-520. Orlando, FL: Academic Press. 1984.

Lotan, R. Effects of vitamin A and its analogs (retinoids) on normal and neoplasticcells. Biochim. Biophys. Acta, 605: 33-91, 1980.

Nakajima, M., Lotan. D., Baig, M. M., Carralero, R. M., Wood, W. R.. Hendrix.M. J. C., and Lotan, R. Inhibition by retinoic acid of type IV collagenolysis andinvasion through reconstituted basement membrane by metastatic rat mammaryadenocarcinoma cells. Cancer Res.. 49: 1698-1706, 1989.

Bollag. W., and Holdener, E. E. Retinoids in cancer prevention and therapy. Ann.Oncol., 3: 513-526, 1992.

Lacroix, A., and Lippman, M. E. Binding of retinoids to human breast cancer celllines and their effects on cell growth. J. Clin. Invest., 65: 586-590, 1980.Fontana. J. A.. Hobbs. P. D.. and Dawson, M. I. Inhibition of mammary carcinomagrowth by retinoidal benzoic acid derivatives. Exp. Cell Biol., 56: 254-263,

1988.Fanjul, A., Dawson, M. I., Hobbs, P. D., Jong, L., Cameron, J. F., Harlev, E.,Graupner. G., Lu, X-P., and Pfahl, M. A new class of retinoids with selectiveinhibition of AP-1 inhibits proliferation. Nature (Lond.), 372: 107-111, 1994.Seewaldt. V., Johnson, B. S.. Parker. M. B.. Collins, S. J., and Swisshelm, K.Expression of retinoic acid receptor ÃŸmediates retinoic acid-induced growth arrestand apoptosis in breast cancer cells. Cell Growth Differ., 7: 1077-1088, 1996.

Cobleigh. M. A., Dowlat. K.. Minn, F., Benson. A. B., Rademaker, A. W., Ashenhurst,J. B., and Wade. J. L. Phase I trial of tamoxifen (TAM) with or without fenretinide(4HPR), an analogue of vitamin A, in patients with melaslatic breast cancer. BreastCancer Res. Treat., 190: 142, 1991.Kelloff, G. J.. and Boone. C. W. Cancer chemopreventive agents: drug developmentstatus and future prospects. J. Cell. Biochem., 10: 176-196, 1994.Evans, R. M. The steroid and thyroid hormone receptor superfamily. Science (Washington DC), 240: 889-895, 1988.Gudas, L. J. Retinoids, retinoid-response genes, cell differentiation and cancer. CellGrowth Differ., 3: 655-662, 1992.Roman, S. D.. Clarke, C. L.. Hall, R. E., Alexander, I. E., and Sutherland, R. L.Expression and regulation of retinoic acid receptors in human breast cancer cells.Cancer Res., 52: 2236-2242, 1992.Swisshelm, K., Ryan, K., Lee, X., Tsou, H. C., Beacocke, M., and Sager, R.Down-regulation of retinoic acid receptor ÃŸin mammary carcinoma cell lines and itsup-regulation in senescing normal mammary epithelial cells. Cell Growth Differ., 5:133-141, 1994.Zhao, Z., Zhang, Z-P., Soprano, D. R., and Soprano, K. J. Effect of 9-c/j-retinoic acidon growth and RXR expression in human breast cancer cells. Exp. Cell Res., 2/9:555-561, 1995.Nagy, L., Thomazy, V. A., Shipley, G. L., Fesus, L., Lamph, W., Heyman, R. A.,Chandraratna, R. A., and Davis, P. L. Activation of retinoid X receptors inducesapoptosis in HL-60 cell lines. Mol. Cell. Biol.. /5: 3540-3551, 1995.van der Burg. B.. Slager-Davidov, R., van der Leede, B. M., de Laat, S. W., and vander Saag. P. T. Differential regulation of API activity by retinoic acid in hormone-dependent and -independent breast cancer cells. Mol. Cell. Endocrinol., 112: 143-

152, 1995.Lee. H-Y., Dawson, M. I., Walsh, G. L., Nesbitt, J. C., Eckert, R. L., Fuchs, E.. Hong,W. K., Lotan, R., and Kurie, J. M. Retinoic acid receptor- and retinoid X receptor-selective retinoids activate signaling pathways that converge on AP-1 and inhibitsquamous differentiation in human bronchial epithelial cells. Cell Growth Differ., 7:997-1004, 1996.Angel, P.. and Karin. M. The role of jun, fos and the AP-1 complex in cell-proliferation and transformation. Biochem. Biophys. Acta, 7072: 129-157, 1991.Chen, T. K., Smith, L. M., Gebhardt, D. K., Birrer, M. J.. and Brown, P. H. Activationand inhibition of the API complex in human breast cancer cells. Mol. Carcinog., 15:215-226, 1996.Nicholson. R. C.. Mader, S., Nagpal, S., Leid, M.. Rochette-Egly, C., and ChambÃ³n,

4660



cJUN OVKRKXPRhSSION INDUCES RET1NOID RESISTANCE

P. Negative regulation of the rat stromelysin gene promoter by relinoic acid ismediated by an API binding site. EMBO J., 9: 4443-4454. 1990.

22. Pfahl. M. Nuclear receptor/AP-1 interaction. Endocr. Rev.. 14: 651-658, 1993.23. Yang-Yen. H-F., Zhang. X-K.. Graupner. G.. Tzukerman. M.. Sakamoto. B.. Karin.

M., and Pfahl, M. Antagonism between retinoic acid receptors and AP-1 : implicationsfor tumor promotion and inflammation. New Biol.. 3: 1206-1219, 1991.

24. Schule. R., Rangarajan. P.. Yang. N.. Kliewer, S., Ransone, L., Bolado. J., Verma,I. M.. and Evans, R. M. Retinoic acid is a negative regulator of AP-1-responsivegenes. Proc. Nati. Acad. Sci. USA, 88: 6092-6096, 1991.

25. Kamei, Y., Xu, L., Heinzel, T., Torchia, J., Kurokawa, R., Gloss. B., Lin, S-C.,Heyman, R. A.. Rose. D. W.. Glass. C. K., and Rosenfeld. M. G. A CBP integratorcomplex mediates transcriptional activation and AP-1 inhibition by nuclear receptors.Cell, 85: 403-414. 1996.

26. Chakravarti, D.. LaMorte. V. J., Nelson, M. C, Nakajima, T.. Schulman, I. G.,Juguilon. H.. Montminy. M.. and Evans. R. M. Role of CBP/P300 in nuclear receptorsignalling. Nature (Lond.), 383: 99-103. 19%.

27. Schadlow, V. C., Barzilai, N., and Deutsch, P. J. Regulation of gene expression inPCI2 cells via an activator of dual second messengers: pituitary adenylate cyclaseactivating polypeptide. Mol. Biol. Cell, 3: 941-951. 1992.

28. Yu. V. C.. Delsert, C.. Andersen, B.. Holloway. J. M.. Devary. O. V., Naar, A. M.,Kim, S. Y., Boutin, J. M., Glass, C. K., and Rosenfeld. M. G. RXR beta: a coregulatorthat enhances binding of retinoic acid, thyroid hormone, and vitamin D receptors totheir cognate response elements. Cell, 67: 1251-1266. 1991.

29. Chirgwin. J. M.. Przybyla, A. E., MacDonald. R. J.. and Rutter, W. J. Isolation ofbiologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry, /8: 5294-5299, 1979.

30. Szabo. E., Preis. L. H., Brown. P. H.. and Birrer, M. J. The role of jun and/av genefamily members in 12-O-letradecanoylphorbol-13-acetate induced hemopoietic differentiation. Cell Growth Differ., 2: 475-482. 1991.

31. Feinberg, A. P., and Vogelstein, B. A technique for radiolabeling DNA restrictionendonuclease fragments to high specific activity. Anal. Biochem., 132: 6-13, 1983.

32. Yang, F., Fredrichs, W. E.. Cupples, R. L.. Bonifacio. M. L., Sanford, J. A., Morton,W. A., and Bowman, B. H. Human ceruloplasmin. Tissue-specific expression oftranscripts produced by alternative splicing. J. Biol. Chem., 265: 10780-10785, 1990.

33. Liu, Y., Lee, M-O., Wang. H-G., Li, Y., Hashimoto, Y., Klaus, M.. Reed, J. C., andZhang, X-K. Retinoic acid receptor ÃŸmediates the growth-inhibitory effect of retinoic

acid by promoting apoptosis in human breast cancer cells. Mol. Cell. Biol., 16:1138-1149, 1996.

34. van der Burg. B.. van der Leede. B. M.. Kwakkenbos-lsbrucker. L., Salverda, S., deLaat, S. W., and van der Saag. P. T. Relinoic acid resistance of estradiol-independentbreast cancer cells coincides with diminished retinoic acid receptor function. Mol.Cell. Endocrinol., 91: 149-157, 1993.

35. Alani. R., Brown. P. H., Binetruy, B., Dosaka. H.. Rosenberg. R. K., Angel. P.. Karin. M.,and Birrer. M. J. The transactivating function of the dun proto-oncoprotein is required forcotransformation of rat embryo cells. Mol. Cell. Biol., //: 6286-6295, 1991.

36. Brown, P. H., Alani, R., Preis, L. H., Szabo, E.. and Birrer, M. J. Suppression ofoncogene-induced transformation by a deletion mutant of c-jun. Oncogene, 8: 877-886. 1993.

37. Brown, P. H., Chen, T., Szabo, E.. and Birrer, M. J. Mechanism of action of adominant-negative mutant of c-jun. Oncogene, 9: 791-800, 1994.

38. Kastner. P., Mark, M.. and ChambÃ³n. P. Nonsteroid nuclear receptors: What aregenetic studies telling us about their role in real life? Cell. 83: 859-869. 1995.

39. Kastner, P., Grondona, J. M., Mark. M., Gansmuller, A., LeMeur, M., Decimo, D.,Vonesch, J. L.. Dolle. P., and ChambÃ³n. P. Genetic analysis of RXR alpha developmental function: convergence of RXR and RAR signaling pathways in heart and eyemorphogenesis. Cell, 78: 987-1003. 1994.

40. Ahn. M. J.. Langenfeld. J.. Moasser. M. M.. Rusch, V., and Dmitrovsky. E. Growthsuppression of transformed human bronchial epithelial cells by all-/rani-retinoic acidoccurs through specific retinoid receptors. Oncogene. //: 2357-2364, 1995.

41. Moasser, M. M.. Reuter. V. E., and Dmitrovsky. E. Overexpression of the retinoicacid receptor gamma directly induces terminal differentiation of human embryonalcarcinoma cells. Oncogene, 10: 1537-1543, 1995.

42. Sheikh, M. S., Shao, Z-M., Li, X-S.. Dawson, M., Jetten, A. M.. Wu. S., Conley.B. A.. Garcia. M., Rochefort. H., and Fontana. J. A. Retinoid-resistant estrogenreceptor-negative human breast carcinoma cells transfected with retinoic acid recep-tor-or acquire sensitivity to growth inhibition by retinoids. J. Biol. Chem.. 269:21440-21447. 1994.

43. Dawson, M. !.. Chao. W., Pine, P., Jong, L., Hobbs, P. D., Rudd. C. K., Quick, T. C.,Niles, R. M.. Zhang. X-K., Lombardo, A.. Ely, K. R., Shroot. B.. and Fontana. J. A.Correlation of retinoid binding affinity to retinoic acid receptor a with retinoidinhibition of growth of estrogen receptor-positive MCF-7 mammary carcinoma cells.Cancer Res., 55: 4446-4451. 1995.

4661



Induction of Retinoid Resistance in Breast Cancer Cells by Overexpression of cjun1

Documents

Transcript of Induction of Retinoid Resistance in Breast Cancer Cells by Overexpression of cjun1