www.elsevier.com/locate/intimp

International Immunopharmac

In vivo and in vitro modulation of MDR molecules

in murine thymocytes

Daniela F.P. Leite a,b, Juliana Echevarria-Lima a,b, Leonardo T. Salgado c,

Marcia A.M. Capella b, Joao B. Calixto d, Vivian M. Rumjanek a,*

a Instituto de Bioquımica Medica, Universidade Federal do Rio de Janeiro, Brazilb Instituto de Biofısica Carlos Chagas Filho, Universidade Federal do Rio de Janeiro, Brazil

c Departamento de Anatomia, Instituto de Ciencias Biomedicas, Universidade Federal do Rio de Janeiro, Brazild Departamento de Farmacologia, Universidade Federal de Santa Catarina, Brazil

Received 8 March 2005; received in revised form 28 April 2005; accepted 8 August 2005

Abstract

P-glycoprotein (Pgp/ABCB1) and multidrug resistance related protein 1 (MRP1/ABCC1) were first described in multidrug

resistant tumor cells. It is presently known that both proteins are also expressed in a variety of normal cells, including

lymphocytes. ABCB1 activity has already been detected in subpopulations of murine thymocytes, but there was little

information on the expression or activity of ABCC1 in these cells. The present work studied in mice the expression of both

proteins by RT-PCR and immunofluorescence. It was possible to identify the presence of ABCB1 and to detect the expression

of ABCC1 in these cells. The functional activities of these proteins were also studied in vivo and in vitro measuring the

extrusion of fluorescent dyes in association with MDR modulators. Cyclosporine A, verapamil and trifluoperazine inhibited the

activity of thymic ABCB1. Indomethacin, probenecid and MK571 were effective in inhibiting ABCC1 activity by thymic cells.

ABCB1 was only active in a small percentage of thymocytes being present in the immature double negative (not CD4 nor CD8)

subpopulation and the mature single positive (CD4 or CD8) subpopulations. The functional activity of ABCC1, on the other

hand, was more homogeneously distributed being found in all thymocyte subpopulations. Possible physiological roles for these

transporters on thymocytes are discussed.

D 2005 Elsevier B.V. All rights reserved.

Keywords: Thymocytes; ABCC1; ABCB1; Multidrug resistance; Modulators

1567-5769/$ - see front matter D 2005 Elsevier B.V. All rights reserved.

doi:10.1016/j.intimp.2005.08.005

* Corresponding author. Laboratorio de Imunologia Tumoral,

Instituto de Bioquımica Medica, ICB/Centro de Ciencias da

Saude, Universidade Federal do Rio de Janeiro, Cidade Universi-

taria, Ilha do Fundao, Rio de Janeiro, CEP 21941590, Brazil. Tel.:

+55 21 25626780; fax: +55 21 22701635.

E-mail address: vivian@bioqmed.ufrj.br (V.M. Rumjanek).

1. Introduction

The multidrug resistance (MDR) phenomenon was

first observed in tumor cells exposed to chemotherapy.

These cells presented cross-resistance to a number of

ology 6 (2006) 204–215

D.F.P. Leite et al. / International Immunopharmacology 6 (2006) 204–215 205

unrelated agents. Different mechanisms were shown

to be involved in this phenomenon, including the

overexpression of two transporter proteins, members

of the ATP Binding Cassette family: P-glycoprotein

(Pgp/ABCB1) and/or multidrug resistance related pro-

tein (MRP1/ABCC1). These proteins act as ATP-

dependent pumps with multiple binding sites, allow-

ing a high affinity interaction with many different

substrates [1]. These transporters mediate the efflux

of drugs from the interior of cells against concentra-

tion gradients, thereby reducing the cytotoxicity of

chemotherapic agents [2]. The transporter molecules,

ABCB1 and ABCC1, may be also expressed in nor-

mal cells were they seem to have an important role in

cellular detoxification [3–5].

The family of ABCC transporter molecules is com-

posed of at least nine different proteins. ABCC1, the

first member of this family described, recognizes

neutral and anionic hydrophobic natural products

and transports glucoronides, gluthatione and its con-

jugates [6]. On the other hand, three proteins in mice

and two in humans compose the ABCB family. This

protein binds to hydrophobic drug substrates that are

either neutral or positively charged [7,8].

The expression of ABCB1 and ABCC1 has been

described in normal cells [9,10]. Both proteins are

present in bone marrow hematopoietic precursor

cells (CD34+) [11–13], immature and mature lympho-

cytes [11–16], dendritic cells [17,18], monocytes and

macrophages [19,20]. Despite their wide distribution,

the physiological roles of ABCB1 and ABCC1 in the

immune system are not well understood. ABCC1 is

differently expressed in Th1 and Th2 lymphocytes

and its expression is linked to the activation process

[21,22].

It has also been suggested that ABCB1 and

ABCC1 are important transporters of inflammatory

mediators. ABCB1 is important for the secretion of

platelet activation factor and ABCC1 for the secretion

of leukotriene C4 and prostaglandins [23–26]. Further-

more, steroids are also transported by both molecules

[27–29] and play a major physiological role on thy-

mocyte selection. The subpopulation most sensitive to

these hormones, the double positive (DP) thymocyte

[30], does not seem to have ABCB1 activity [14],

whereas single positive (SP) thymocytes (CD4+ or

CD8+) present ABCB1 activity and are resistant to

glucocorticoids. On the other hand, ABCC1 expres-

sion was identified in human thymus by real time

PCR [31], and in human Hassal corpuscle by antibo-

dies [10] and nothing is known in relation to its

presence or physiological function in mouse thymo-

cytes. Modulators and substrates of these two proteins

such as cyclosporine A [32], indomethacin [33], meth-

otrexate [33] and glucocorticoids [27–29] are very

often used clinically and may modify the immune

system.

The present work investigated ABCB1 and

ABCC1 expression in thymocytes, their activity in

vitro and in vivo and their sensitivity to different

MDR modulators, in an attempt to comprehend their

physiological and pathological roles in the thymus.

2. Materials and methods

2.1. Animals

The experiments were carried out in 2–4 months old or

seven days old C3H/HeJ male mice, obtained from the

Animal House of the Department of Medical Biochemistry.

Animals had free access to food and water, and were housed

and handled according to institutional guidelines complying

with Brazilian legislation. Animals were sacrificed and

thymi and kidneys immediately removed.

2.2. Materials

Fetal calf serum (FCS) was obtained from Gibco and

RPMI 1640 medium, l-glutamine, 25 mM Hepes, bovine

serum albumin (BSA), rhodamine 123 (Rho 123), probene-

cid, indomethacin, verapamil and trifluoperazine were pur-

chased from Sigma-Aldrich. MK571 was gently donated by

Merk; carboxy-2V-7V-dichlorofluorescein diacetate (CFDA)

was purchased from Molecular Probes. MK571 and Rho

123 were first dissolved in distilled water in a stock solution

of 10 mM and 1 mg/ml, respectively. Trifluoperazine was

first dissolved in fetal calf serum and RPMI (1 :5) and kept

as stock solution of 15 mM; verapamil was dissolved in

phosphate-buffered saline (pH 7.4) and kept in as stock

solution of 50 mM. Cyclosporine A (Sandimun—100 mg/

ml) was diluted in RPMI. Probenecid was dissolved in

alkaline water and then the pH was adjusted to 8.0 in a

stock solution of 50 mM. Indomethacin was first dissolved

in DMSO in a stock solution of 100 mM. All drugs were

divided into aliquots and stored in the freezer until the

moment of use when they were further diluted in RPMI

1640 medium supplemented with 1 mM l-glutamine and 25

mM Hepes. Primary rat monoclonal antibodies anti-MRP1

D.F.P. Leite et al. / International Immunopharmacology 6 (2006) 204–215206

(ABCC1) was purchased from Alexis Biochemicals and

the goat anti-rat secondary (fluorescein conjugated) anti-

body was purchased from Sigma. The antibodies anti-

CD3, anti-CD8 and anti-CD4 were purchased from

R&D System or Pharmingen. Primary antibody goat

anti-Pgp (ABCB1), as well as anti-goat secondary rhoda-

mine conjugated antibody, was purchased from Santa

Cruz Biotechnologies.

2.3. Thymocyte suspension

The thymus was washed in FCS and disposed in an

individual Petri dish containing 5 ml of RPMI 1640 medium

with 10% FCS. The organ was softly macerated with the

help of a sterile rubber. Cells were washed with phosphate-

buffered saline (pH 7.4) and the pellet was gently suspended

in RPMI 1640 medium with 10% FCS.

2.4. Immunofluorescence

For the detection of ABCC1 at the single-cell level, 106

cells were incubated with antibodies anti-CD4 (PerCP) and

anti-CD8 (PE) for 30 min on ice and cells were then washed

in PBS. Cells were permeabilized with FACS lysing solu-

tion (Becton & Dickinson) for 10 min at room temperature.

Cells were washed with PBS and incubated with the pri-

mary mouse monoclonal antibody: anti-ABCC1 diluted in

PBS with 1% BSA (1 :20) for 30 min at room temperature.

This was followed by incubation with goat anti-rat second-

ary antibody conjugated with fluorescein for 20 min at room

temperature. Cells were then washed in PBS and analyzed

by flow cytometry. For those experiments data were

acquired in a mode of 100000 events, and a gate based

on forward scatter (FSC) and side scatter (SSC) parameters

was made to analyze only viable cells, other gates were

made to determine the subpopulations. Analyses were per-

formed by flow cytometry using a FACScalibur (Becton and

Dickinson, USA). The data were analyzed by WinMID

software.

For the detection of ABCB1 at the single-cell level,

5�105 cells were cyto-centrifuged (800 rpm for 1 min),

fixed and permeabilized with 100% cold methanol for 5

min. Fixed cells were re-hydrated with 50 mM NH4Cl for 3

min. Glass slides containing fixed cells were washed with

PBS and incubated with 5% BSA for 10 min. This proce-

dure was repeated and cells were washed once again with

PBS before incubating them with 5% BSA for a further 30

min. After the incubation time, cells were washed and

incubated overnight in a cold humidified chamber at 4 8Cwith the primary antibody goat anti-ABCB1 diluted in PBS

with 1% BSA (1 :50). After washing, cells were incubated

with bovine anti-goat secondary antibody conjugated with

rhodamine for 45 min at room temperature. Cells were then

washed twice in PBS and once in water and the cover slips

were mounted on glass slides with 50% glycerol in PBS.

The fluorescence was visualized under an Axiovert 100

microscope (Zeiss, Germany).

2.5. RT-PCR

Total RNA from thymocyte suspensions and from

kidney preparations was extracted using the TRizol pro-

tocol. The RT-PCR was performed essentially as in the

one-step protocol of the Retrotools kit (Biotools, USA).

Briefly 0.5 or 1.0 Ag/Al of total RNA was incubated for 1

h with 2 Al of RT buffer, 2 Al of MnCl2 (5 mM), 5 Al of amix DNTP (10 mM), 0.75 Al of Retrotools polymerase

and 7.5 Al H2O DEPC and 1 Al 0.01% (v/v). Antisense

primer (abcc1—5V CGCAGGTTGTGCAGGCCGAT 3V orabcb1—5V CTGATGTTGCTTCGTCCAG 3V) at 60 8C in

a final volume of 10 Al (40 pM). The product was

immediately put on ice and 3 Al of 5�DNA free buffer,

1 Al of MgCl2 (50 mM) and 10.5 Al of H2O and 1 Al (10pM) of the sense primer (abcc1—5V GTAGAGTTCCGG-GATTAC 3V or abcb1—5V CACAGCTGGGCATTGTGT

3V) were added. The conditions for PCR were 2 min at

94 8C and then 35 cycles with 15 s at 94 8C, 30 s at 50

8C and 1 min at 72 8C, using a DNA thermal cycler

(Perklin Elmer GeneAmp PCR systems 2400). The PCR

products were size fractionated in 1.8% agarose gels

stained with 2.5 Al ethidium bromide (10 mg/ml). DNA

Ladder (1 kb plus) was purchased from Invitrogen.

2.6. Rhodamine 123 and CFDA accumulation by flow

cytometry

To measure ABCB1 activity the substrate Rho 123 [34]

was used. For this 1�106 cells were incubated in RPMI

10% FCS at 37 8C for 30 min in the presence of 150 ng/ml

Rho 123 with or without reversors (80 nM cyclosporine A; 5

AM verapamil; 300 AM indomethacin or 2.5 mM probene-

cid). The cells were then washed with PBS and left at 37 8Cfor a further 30 min with or without reversors, washed,

suspended in cold PBS and kept on ice. To measure

ABCC1 activity the same protocol was used, but in this

case 0.5 AM of CFDA was the substrate and the reversors

probenecid, indomethacin and MK571 were used at differ-

ent concentrations.

For triple-fluorescence analyses Rho 123 cells or CFDA

cells were incubated with antibodies anti-CD4 (PE) and anti-

CD8 (CY5) for 30 min on ice. Rho 123 fluorescence was

acquired through the FL1 (FITC) channel, CD4 on FL2 (PE)

channel and CD8 on FL3 (PI) channel. For those experi-

ments data were acquired in a mode of 100000 events, and a

gate based on forward scatter (FSC) and side scatter (SSC)

parameters was made to analyze only viable cells, other

D.F.P. Leite et al. / International Immunopharmacology 6 (2006) 204–215 207

gates were made to determine the subpopulations. Analyses

were performed by flow cytometry using a FACScalibur

(Becton and Dickinson, USA). The data were analyzed by

WinMID software.

2.7. ABCB1 and ABCC1 activity in vivo

To study ABCB1 activity in vivo Rho 123 was

injected in association or not with cyclosporine A as

described before [35] with small modifications. Briefly,

2–4 months old mice received a single intraperitoneal

(i.p.) injection of cyclosporine A (25 mg/kg), followed

1 h later by a single i.p. injection of Rho 123 (1 mg/kg).

The volume of administration was 10 Al/g. After 1 h, the

animals were sacrificed, thymi removed, and the thymo-

cytes isolated as described above. To analyze ABCC1

activity, 7 days old mice were injected with CFDA in

association or not with probenecid as described by Sun et

al. [36]. Briefly, mice received a single i.p. injection of

probenecid (400 mg/kg) in a final volume of 10 Al/gimmediately after an intravenous injection of CFDA (15

mg/kg) in a final volume of 5 Al/g. The control group

was injected with the vehicle alone. One hour after the

administration animals were sacrificed, thymi were imme-

diately removed and cell suspensions prepared as

described above.

3. Results

3.1. Expression of abcb1 and abcc1 in the thymus

The expression of abcb1 and abcc1 mRNA in the

thymus was analyzed. As a positive control kidney, an

organ known to express these molecules, was used (Fig.

1A). The mRNA for both proteins could be detected in

the thymus. This result shows that abcc1 is expressed in

murine thymus.

To analyze the expression of ABCC1 on thymocytes,

the cells were stained with anti-CD4, anti-CD8 and anti-

ABCC1 antibodies and studied by flow cytometry (Fig.

1B). Virtually the whole population was positive for

ABCC1, the only exception was the DN subpopulation

in which 8% of the cells did not express this protein. The

ABCB1 expression was determined by immunofluores-

cence, 5.8% (ranging from 2.5–9.2%) of total population

were positive for ABCB1 (data not shown).

3.2. ABCB1 activity detected by flow cytometry

Our results showed that thymic cells express mRNA

and the proteins ABCC1 and ABCB1. Thus the activity

of these proteins was evaluated using fluorescent sub-

strates. P-glycoprotein has a large spectrum of substrates

and Rho 123 was used in these series of experiments. It

has been shown that efflux of this fluorescent dye from

pre-labeled cells correlates with ABCB1 activity [37].

Fluorescence intensity between 100 and 102 was consid-

ered rhodamine negative or rhodamine low cells (Rho neg

and Rho low) and fluorescence intensity above 102—

rhodamine high cells (Rho high) (Fig. 2A). The analysis

of various experiments indicated that less than 5% of the

thymocytes were Rho low or Rho neg. To test the sensi-

tivity of ABCB1 activity to different modulators/reversors,

thymocytes were treated with verapamil (5 AM), trifluo-

perazine (5 AM) and cyclosporine A (80 nM). The effi-

cacy of the reversors was not equal; cyclosporine A was

more efficient and potent than verapamil or trifluoperazine

(Fig. 2B). Some authors suggested that Rho 123 is also a

substrate for ABCG2 and ABCC1 [38,39]. There is rela-

tively little or no evidence that ABCG2 is expressed in

thymus [38]. To test the possibility that the effect

observed was due to ABCC1 activity, thymocytes were

treated with indomethacin or probenecid, but none of

these classical reversors of ABCC1 were able to enhance

Rho 123 accumulation (Fig. 2B). This result suggests two

possibilities: ABCC1 might not be active in these cells or

Rho 123 is not a good substrate for ABCC1 expressed in

thymocytes.

3.3. Thymocytes subpopulations and ABCB1 activity

The staining with anti-ABCB1 antibodies and the

functional ABCB1 assay suggested that the expression

of ABCB1 in thymocytes was heterogeneous. To define

whether the heterogeneity represented a differential

expression among the various thymocyte subpopulations,

these cells were stained with Rho 123 followed by drug

extrusion, and the cells were, subsequently, stained with

anti-CD4 and anti-CD8 monoclonal antibodies (Fig. 3A–

I). Our results are in agreement with those of MacDonald

et al. [14]. The double positive (DP) subpopulation

(CD4+CD8+) constituted more than 80% of the thymo-

cytes (Fig. 3A), but less than 1% of these cells lost their

fluorescence during the extrusion period (Fig. 3B) and

cyclosporine A did not modify the extrusion profile (Fig.

3C). Within the CD8+ single positive (SP) cells, the Rho

neg or Rho low cells constituted approximately 30% (Fig.

3D). Cyclosporine A treatment reduced the numbers of

CD8+ SP Rho 123 extruding cells more than 95% (Fig.

3E, black line), suggesting that almost 30% of CD8+ SP

had an active ABCB1. Within the CD4+ SP, approxi-

mately 10% of the cells were capable of reducing the

intracellular levels of Rho 123 (Fig. 3F) and cyclosporine

1 2 L 3 4

Rel

ativ

e ce

ll nu

mbe

r 92%

DN

MRP1 (Log)

MRP1 (Log)

Rel

ativ

e ce

ll nu

mbe

r

Total thymocytes

Rel

ativ

e ce

ll nu

mbe

r B 99.6%

MRP1 (Log)

MRP1 (Log)

Rel

ativ

e ce

ll nu

mbe

r 100%

DP

100%

CD8+ SP

99.4%

Rel

ativ

e ce

ll nu

mbe

r

CD4+ SP

MRP1 (Log)

A

250Kb

100

101

102

103

t104

100

101

102

103

104

100

101

102

103

104

100

101

102

103

104

100

101

102

103

104

012

8

010

00

20

010

05M1 M1

M1M1

M1

Fig. 1. Expression of ABCC1 and ABCB1 in thymocytes. (A) Expression of abcc1 (224 kb) and abcb1 (283 kb) in kidney and in thymus of

adult male mice. The expression was determined by RT-PCR, 0.5 Ag of total RNA was used to amplify abcc1 and 1 Ag of total mRNA to

amplify abcb1 in both organs. abcc1 expressed in the kidney (1) and in the thymus (2). abcb1 expressed in the thymus (3) and in the kidney (4).

(L) Ladder 250 kb. (B) ABCC1 detection in the various thymocytes subsets. Cells were permeabilized, and labeled with mAb anti-ABCC1.

Cells were labeled with anti-CD4 and anti-CD8 antibodies followed by permeabilization and incubation with anti-ABCC1 monoclonal antibody

and secondary antibody. Control was labeled only with the secondary antibody. DP—double positive (CD4+CD8+); DN—double negative

(CD4�CD8�); CD4 SP—single positive (CD4+CD8�); CD8 SP—single positive (CD4�CD8+).

D.F.P. Leite et al. / International Immunopharmacology 6 (2006) 204–215208

**

*

% I

nhib

itio

n

CSA VP TFP Prob Indo

B

-20

0

20

40

60

80

100

Fow

ard

scat

ter

Rho 123 fluorescence intensity

A10

230

100 101 102 103 104

Fig. 2. ABCB1 related activity in thymocytes. (A) Thymocyte

accumulation of rhodamine 123 (Rho 123). Thymocytes labeled

with Rho 123 for 30 min were allowed to extrude the dye for a

further 30 min. A gate based on rhodamine accumulation was

done. Fluorescence intensity between 100 and 102 was considered

Rho negative or Rho low and fluorescence intensity above 102

Rho high. Approximately, 4% of the total population of thymo-

cytes exported the dye. This figure is representative of 10 inde-

pendent experiments. (B) Inhibition of Rho 123 efflux by different

reversors: cyclosporine A—CSA (80 nM), verapamil—VP (5

AM), trifluoperazine—TFP (5 AM), probenecid—Prob (1 mM)

and indomentacin—Indo (300 AM). *p b0.001 different from

control. The results are the meanFSD of at least 4 independent

experiments.

D.F.P. Leite et al. / International Immunopharmacology 6 (2006) 204–215 209

A reversed around 85% of this population (Fig. 3G, black

line). The double negative thymocytes are the more

immature subpopulation and approximately 25% were

able to efflux Rho 123 (Fig. 3H) and cyclosporine A

reversed 95% of the ABCB1 activity (Fig. 3I, black

line). There was no difference between the sensitivities

of ABCB1 expressed on different subpopulations of thy-

mocytes to cyclosporine A, verapamil or trifluoperazine

(data not shown).

3.4. ABCB1 activity in vivo

To test if ABCB1 was active in vivo, mice were

injected (i.p.) with Rho 123 (1 mg/kg) following the

injection of cyclosporine A (25 mg/kg) or saline 1 h

previously, as described in Material and methods. The

mean of fluorescence intensity of the Rho low or negative

subpopulation of thymocytes triplicated in animals treated

with cyclosporine A, suggesting that this reversor was cap-

able of modulating ABCB1 activity in thymocytes in vivo

(data not shown).

3.5. ABCC1 activity by flow cytometry

As shown in Fig. 2B probenecid and indomethacin did

not reduce the number of Rho 123 extruding cells. To

verify if ABCC1 was active in thymocytes, these cells

were incubated with another fluorescent dye, CFDA,

which is transported by ABCC1 [40]. Other members of

ABCC family are expressed in much smaller amounts in

thymus [31] and therefore their activity is probably not

responsible for most CFDA extrusion. Although the accu-

mulation of CFDA in thymocytes was very small (Fig.

4A), treatment with the classical ABCC1 reversors:

MK571 100 AM (Fig. 4B), indomethacin 300 AM (Fig.

4C) or probenecid 2.5 mM (Fig. 4D), raised CFDA inten-

sity more than 10 times. Moreover, probenecid (0.5–2.5

mM), indomethacin (75–300 AM) and MK571 (25–100

AM) reversed ABCC1 activity in a dose dependent manner

(Fig. 5).

3.6. Thymocytes subpopulations and ABCC1 activity

To confirm that ABCC1 is active in all thymocyte

subpopulations, cells were incubated with CFDA with or

without 1 mM probenecid and after the extrusion period

cells were labeled with anti-CD4 and anti-CD8 mono-

clonal antibodies (Fig. 6). As expected, probenecid was

capable of increasing CFDA accumulation in all sub-

populations, showing that different from ABCB1,

ABCC1 activation does not seem to be developmentally

regulated.

3.7. ABCC1 activity in vivo

To test the activity of ABCC1 in vivo, young mice

were injected with CFDA (15 mg/kg) and probenecid

0

104 103102101100

A

B

D

F

H

C

E

G

I

CD

8

CD4

Rho 123 relative fluorescence (Log)

104

103

102

101

100

104 103102101100

0

104 103102101100

0

104 103102101100

0

104 103102101100 0

104 103102101100

0

104 103102101100

0

104 103102101100

0

104 103102101100

Rel

ativ

e c

ell

num

ber

0

Fig. 3. Rhodamine 123 efflux in thymocyte subsets. (A) Cells were stained with anti-CD4 and anti-CD8. Left panel (B, D, F, H) shows

thymocyte subsets labeled with Rho 123 and right panel (C, E, G, I) shows thymocytes subsets labeled with Rho 123 (shaded histograms) and in

the presence of 80 nM cyclosporine A (black line). (B–C) Represent double positive thymocytes (CD4+CD8+ DP) incubated with or without

cyclosporine A. (D–E) Represent CD8 single positive thymocytes (CD4�CD8+ SP) incubated with or without cyclosporine A. (F–G)

Represents CD4 single positive thymocytes (CD4+CD8� SP) incubated with or without cyclosporine A. (H–I) Represent double negative

thymocytes (CD4�CD8�). This figure is representative of 5 independent experiments.

D.F.P. Leite et al. / International Immunopharmacology 6 (2006) 204–215210

Indo + CFDA

CFDA

autofluorescence

CFDA

Prob + CFDA

CFDA

M

CFDA

C

A

CFDA

D

M

CFDA

B

MK571 + CFDA

145

0

100 101 102 103 104

CFDA fluorescence intensity

Rel

ativ

e ce

ll nu

mbe

r

145

0

100 101 102 103 104

145

0

100 101 102 103 104

145

0

100 101 102 103 104

Fig. 4. ABCC1 related activity in thymocytes. (A) Thymocytes were incubated with or without 0.5 AM CFDA. (B–D) Effect of reversors on

thymocytes incubated with CFDA. (B) 100 AM MK571. (C) 300 AM indomethacin (Indo). (D) 2.5 mM probenecid (Prob). Histogram analysis

is representative of six independent experiments.

D.F.P. Leite et al. / International Immunopharmacology 6 (2006) 204–215 211

(400 mg/kg) or saline (Fig. 7). As observed in vitro,

probenecid was capable of enhancing CFDA accumula-

tion homogeneously. This demonstrated that ABCC1 is

1

10

100

1000

Probenecid Indomethacin MK571

(mM) (µM) (µM)

0.5 1.0 2.5 75 150 300 25 50 100

CFDA

Mea

n o

f fl

uo

resc

en

ce i

nte

nsi

ty

Fig. 5. Dose dependent inhibition of ABCC1 activity. Mean fluor-

escence intensity of cells treated with different doses of ABCC1

reversors. Cells were labeled with 0.5 AM CFDA in the presence or

absence of probenecid (0.5–2.5 mM), indomethacin (75–300 AM),

or MK571 (25–100 AM) as described in Material and methods.

Representative of six independent experiments.

active in thymocytes and can be modulated in vivo

(Fig. 7).

4. Discussion

The present work describes the expression and

activity of ABCC1 in normal murine thymocytes,

results obtained are summarized in Table 1. Our

group has recently observed the expression of

ABCC1 in the murine thymona cell line EL4

[41]. In normal thymocytes ABCC1 was expressed

mainly in the plasma membrane (data not shown)

and similar to what has been reported in other cell

types it can be modulated by indomethacin, probe-

necid, and MK571 [33,36,41]. The accumulation of

CFDA, an ABCC1 fluorescent substrate, was homo-

geneously distributed among thymocytes, suggesting

that the expression of ABCC1 is similar among the

different subpopulations. This result was confirmed

when thymocytes were triple stained for anti-CD4,

anti-CD8 and CFDA in the presence or absence of

probenecid.

BA

DC

FE

HG

BA

DC

FE

HG HG

100 101 102 103 104 100 101 102 103 104

100 101 102 103 104 100 101 102 103 104

100 101 102 103 104100 101 102 103 104

100 101 102 103 104100 101 102 103 104

Rel

ativ

e ce

ll nu

mbe

r

CFDA flourescence intensity (Log)

Fig. 6. CFDA efflux from thymocytes subsets. Cells were stained with 0.5 AM of CFDA, anti-CD4 and anti-CD8. Left panel (A, C, E, G) shows

thymocyte subsets labeled with CFDA and right panel (B, D, F, H) shows thymocytes subsets labeled with CFDA (shaded histograms) in the

presence of 1 mM probenecid (black line). (A–B) CFDA accumulation in double positive (CD4+CD8+) thymocytes. (C–D) CFDA accumulation

in CD4+CD8� thymocytes. (E–F) CFDA accumulation in CD4�CD8+ thymocytes. (G–H) CFDA accumulation in double negative CD4�CD8�

thymocytes. This figure is representative of 3 independent experiments.

D.F.P. Leite et al. / International Immunopharmacology 6 (2006) 204–215212

ABCB1 was also observed in the thymus and this

observation is in agreement with the results of other

authors [14,15]. However, different from ABCC1, that

is active in all thymocyte subpopulations, ABCB1

seems to be developmentally regulated, as it was

only active in mature (single positive cells) and very

immature (duple negative cells) subpopulations.

The physiologic role of ABC transporters in the

thymus deserves further investigation. It is quite clear

from our results that both ABCB1 and ABCC1 activ-

ities may be modulated in vivo. These results suggest

that agents used quite often in the clinical setup, such as

cyclosporine A and indomethacin, may inhibit the

activity of ABCB1 and/or ABCC1 with unknown con-

sequences to the immune repertoire. Indeed, it has been

reported that cyclosporine A affects Tcell development

and repertoire selection in the thymus [42–44] and that

indomethacin induces T cell maturation in the EL4

thymoma cell line [45]. However, the possibility that

these effects might result from their action on ABC

transporters should be considered as probenecid and

indomethacin, both inhibitors of ABCC1, were shown

by us to induce differentiation of EL4 cells [41].

It has been described that leukotrienes, mainly

leukotriene C4, and prostaglandins, which may be

extruded via ABCC1, modulate immature thymocyte

proliferation, and alter the expression of surface mole-

cules, such as CD3, CD4 and CD8 [45–47]. ABCB1

has as natural substrates glucocorticoids [27,28] and

the subpopulation of thymocytes that is most sensitive

100

0

100 101 102 103 104

CFDA fluorescence intensity

Rel

ativ

e ce

ll nu

mbe

r

Fig. 7. ABCC1 related activity in vivo. Histogram depicting fluor-

escence intensity of thymocytes obtained from uninjected animals

(autofluorescence, shaded histogram), injected with 15 mg/kg

CFDA (second peak, - - -) and injected with CFDA and 400 mg/

kg of probenecid (third peak, —).

D.F.P. Leite et al. / International Immunopharmacology 6 (2006) 204–215 213

to these hormones, the double positive thymocytes

[30] do not present ABCB1 activity, suggesting a

role for this transporter on the control of intracellular

cortisol levels. In fact, when mice are treated with

Table 1

Summary of results

Pgp

mRNA detection +

Inhibitors (concentrations used) CSA (80 nM)

VP (5 AM)

TFP (5 AM)

Percent of the cells with transporter

expression

Total population—5.8

Within DN—nd

Within DP—nd

Within CD4 SP—nd

Within CD8 SP—nd

Percent of the total population with

transporter activity

Total population—4%

Determined with 80

Total population—2.5

Determined with 5 AMTotal population—2.8

Determined with 80

Percent of each thymocyte subset

with transporter activity

Within DN—23.7%

Within DPN1%

Within CD4 SP—8.5

Within CD8 SP—28.

Determined with 80

In vivo activity 5%

Determined with 25 m

Transporter activity was measured using rhodamine 123 as a substrate fo

substrate for MRP. CSA—cyclosporine A; VP—verapamil; TFP—trifl

negative (CD4�CD8�); DP—double positive (CD4+CD8+); CD4 SP—sin

nd—not determined.

hydrocortisone and the remaining thymocytes are

exposed to rhodamine in vitro, the percentage of

rhodamine extruding cells increase (data not shown).

There are however, evidences that ABCC1 is capable

of transporting corticosterone out of the cell [28]. Our

results indicate that all subpopulations of thymocytes

present an active ABCC1, making it unlikely that

physiologically the efflux of corticosterone by

ABCC1 is important for thymocyte survival.

Another possible role for ABCC1 in thymocytes

involves their migration within the thymus and to the

periphery. The expression of ABCC1 on dendritic

cells [17] and on mature T lymphocytes [48] was

shown to be important for their migration to lymph

nodes. Robbiani et al. showed that dendritic cell

migration involves leukotriene secretion, which is

mediated by ABCC1 [17]. Thymocyte emigration

involves a mechanism similar to the one described

in dendritic cells [49], suggesting that ABCC1 activ-

ity could participate in this process and might affect

the traffic of mature thymocytes. Furthermore,

MRP1

+

Indo (75–300 AM)

Prob (0.5–2.5 AM)

MK571 (25–100 AM)

% Total population—99.6%

Within DN—92%

Within DP—100%

Within CD4 SP—100%

Within CD8 SP—99.4%

Total population—90%

nM of CSA Determined with 1 mM of Prob

% Total population—97%

of VP Determined with 100 AM of MK571

% Total population—85%

nM of CSA Determined with 150 AM of Indo

Within DN—92%

Within DP—84%

% Within CD4 SP—97%

5% Within CD8 SP—84%

nM of CSA Determined with 1 mM of Prob

75%

g/kg of CSA Determined with 400 mg/kg of Prob

r Pgp and CFDA (carboxy-2V-7V-dichlorofluorescein diacetate) as a

uoperazine; Indo—indomethacin; Prob—probenecid; DN—double

gle positive (CD4+CD8�); CD8 SP—single positive (CD4-CD8+);

D.F.P. Leite et al. / International Immunopharmacology 6 (2006) 204–215214

ABCB1 was also reported to have a role on lympho-

cyte homing to lymph node [48] and may also play

role on thymocyte emigration.

In conclusion, the identification of the presence

and activity of ABCC1 and ABCB1 molecules in

thymocytes raises the question of whether these pro-

teins have a role in thymic differentiation and reper-

toire selection.

Acknowledgements

We would like to thank Dr. Franklin D. Rumjanek

and Daniel Rodrigues Furtado for technical support.

This work was supported by PRONEX, CNPq (Brazi-

lian National Research Council) and by Howard

Hughes Medical Institute (departmental sharing of

grant # 55003669). Daniela F.P. Leite was a recipient

of a PhD Fellowship from CNPq. Juliana Echevarria-

Lima and Leonardo T. Salgado were a recipient of a

PhD Fellowship from CAPES (Coordenacao de Aper-

feicoamento de Pessoal de Nıvel Superior).

References

[1] Neyfakh AA. Mystery of multidrug transporters: the answer

can be simple. Mol Microbiol 2002;44:1123–30.

[2] Gottesman MM, Pastan I. Biochemistry of multidrug resis-

tance mediated by the multidrug transporter. Annu Rev Bio-

chem 1993;62:385–427.

[3] Wijnholds J, Scheffer GL, Van Der Valk M, Van Der Valk P,

Beijnen JH, Scheper RJ, et al. Multidrug resistance protein 1

protects the oropharyngeal mucosal layer and the testicular

tubules against drug-induced damage. J Exp Med 1998;188:

797–808.

[4] Schinkel AH, Mayer U, Wagenaar E, Molca, Van Deemter L,

Smit JJ, et al. Normal viability and altered pharmacokinetics in

mice lacking mdr1-type (drug-transporting) P-glycoproteins.

Proc Natl Acad Sci U S A 1997;94:4028–33.

[5] Schinkel AH, Smit JJ, Van Tellingen O, Beijnen JH, Wagenaar

E, Van Deemter L, et al. Disruption of the mouse mdr1a P-

glycoprotein gene leads to a deficiency in the blood-brain

barrier and to increased sensitivity to drugs. Cell 1994;77:

491–502.

[6] Borst P, Elferink RO. Mammalian ABC transporters in health

and disease. Annu Rev Biochem 2002;71:537–92.

[7] Gottesman MM, Ambudkar SV. Overview: ABC transporters

and human disease. J Bioenerg Biomembr 2001;33:453–8.

[8] Borst P, Evers R, Kool M, Wijnholds J. A family of drug

transporters: the multidrug resistance-associated proteins.

J Natl Cancer Inst 2000;92:1295–302.

[9] Fojo AT, Ueda K, Slamon DJ, Poplack DG, Gottesman

MM, Pastan I. Expression of a multidrug-resistance gene

in human tumors and tissues. Proc Natl Acad Sci U S A

1987;84:265–9.

[10] Flens MJ, Zaman G.J, Van Der Valk P, Izquierdo MA, Schroei-

jers AB, Scheffer GL, et al. Tissue distribution of the multi-

drug resistance protein. Am J Pathol 1996;148:1237–47.

[11] Legrand O, Perrot JY, Tang RP, Simonin G, Gurbuxani S,

Zittoun R, et al. Expression of the multidrug resistance-asso-

ciated protein (MRP) mRNA and protein in normal peripheral

blood and bone marrow haemopoietic cells. Br J Haematol

1996;94:23–33.

[12] Laupeze B, Amiot L, Payen L, Drenou B, Grosset JM, Lehne

G, et al. Multidrug resistance protein (MRP) activity in normal

mature leukocytes and CD34-positive hematopoietic cells

from peripheral blood. Life Sci 2001;68:1323–31.

[13] Chaudhary PM, Roninson IB. Expression and activity of P-

glycoprotein, a multidrug efflux pump in human hematopoie-

tic stem cells. Cell 1991;66:85–94.

[14] MacDonald HPR, Bommhardt U, Cerottini JC. Developmen-

tally regulated expression of P-glycoprotein (multidrug resis-

tance) activity in mouse thymocytes. Eur J Immunol 1995;

25:1457–60.

[15] Pilarski LM, Paine D, Mcelhaaney JE, Cass CE, Belvh AR.

Multidrug transporter P-gycoprotein 170 as a differentiation

antigen on normal human lymphocytes and thymocytes: mod-

ulation with differentiation stage and during aging. Am J

Hematol 1995;49:332–5.

[16] Gupta S, Gollapudi SJ. The P-glycoprotein (MDR 1 gene

product) in cells of the immune system: its possible physiolo-

gic role and alteration in aging and human immunodeficiency

virus-1 (HIV-1) infection. J Clin Immunol 1993;13:289–301.

[17] Robbiani DF, Finch RA, Jager D, Muller WA, Sartorelli AC,

Randolph GJ. The leukotriene C(4) transporter MRP1 regu-

lates CCL19 (MIP-3beta, ELC)-dependent mobilization of

dendritic cells to lymph nodes. Cell 2000;103:757–68.

[18] Randolph GJ, Beaulieu S, Pope M, Sugawara I, Hoffman L,

Steinman RM, et al. A physiologic function for p-glycoprotein

(MDR-1) during the migration of dendritic cells from skin via

afferent lymphatic vessels. Proc Natl Acad Sci U S A 1998;

95:6924–9.

[19] Vellenga E, Tuyt L, Wierenga BJ, Muller M, Dokter W.

Interleukin-6 production by activated human monocytic cells

is enhanced by MK-571, a specific inhibitor of the multi-drug

resistance protein-1. Br J Pharmacol 1999;127:441–8.

[20] Puddu P, Fais S, Luciani F, Gherardi G, Dupuis ML, Romag-

noli G, et al. Interferon-gamma up-regulates expression and

activity of P-glycoprotein in human peripheral blood mono-

cyte-derived macrophages. Lab Invest 1999;79:1299–309.

[21] Lohoff M, Prechtl S, Sommer F, Roellinghoff M, Schmitt E,

Gradehandt G, et al. A multidrug-resistance protein (MRP)-

like transmembrane pump is highly expressed by resting mur-

ine T helper (Th) 2, but not Th1 cells, and is induced to equal

expression levels in Th1 and Th2 cells after antigenic stimula-

tion in vivo. J Clin Invest 1998;101:703–10.

[22] Prechtl S, Roellinghoff M, Scheper R, Cole SP, Deeley RG,

Lohoff M. The multidrug resistance protein 1: a functionally

D.F.P. Leite et al. / International Immunopharmacology 6 (2006) 204–215 215

important activation marker for murine Th1 cells. J Immunol

2000;164:754–61.

[23] Ernest S, Bello-Reuss E. Secretion of platelet-activating factor

is mediated by MDR1 P-glycoprotein in cultured human

mesangial cells. J Am Soc Nephrol 1999;10:2306–13.

[24] Leier I, Jedlitschky G, Buchholz U, Cole SPC, Deeley RG,

Kepper D. The MRP gene encodes an ATP-dependent export

pump for leukotriene C4 and structurally related conjugates.

J Biol Chem 1994;269:27807–10.

[25] Evers R, Cnubben NH, Wijnholds J, van Deemter L, van

Bladeren PJ, Borst P. Transport of glutathione prostaglandin

A conjugates by multidrug resistance protein 1. FEBS Lett

1997;419:112–6.

[26] Renes J, de Vries EG, Jansen PL, Muller M. The (patho)phy-

siological functions of the MRP family. Drug Resist Updat

2000;3:289–302.

[27] Farrell RJ, Menconi MJ, Keates AC, Kelly CP. P-glycopro-

tein-170 inhibition significantly reduces cortisol and cyclos-

porin efflux from human intestinal epithelial cells and T

lymphocytes. Aliment Pharmacol Ther 2002;16:1021–31.

[28] Webster JI, Carlstedt-Duke J. Involvement of multidrug resis-

tance proteins (MDR) in the modulation of glucocorticoid

response. J Steroid Biochem Mol Biol 2002;82:277–88.

[29] Gruol DJ, Bourgeois S. Expression of the mdr1 P-glycoprotein

gene: a mechanism of escape from glucocorticoid-induced

apoptosis. Biochem Cell Biol 1994;72:561–71.

[30] Cohen JJ. Glucocorticoid-induced apoptosis in the thymus.

Sem Immunol 1992;4:363–9.

[31] Langmann T, Mauerer R, Zahn A, Moehle C, Probst M,

Stremmel W, et al. Real-time reverse transcription-PCR

expression profiling of the complete human ATP-binding cas-

sette transporter superfamily in various tissues. Clin Chem

2003;49:230–8.

[32] Sorokin R, Kimura H, Schroder K, Wilson DH, Wilson DB.

Cyclosporine-induced autoimmunity. Conditions for expres-

sing disease, requirement for intact thymus, and potency esti-

mates of autoimmune lymphocytes in drug-treated rats. J Exp

Med 1986;164:1615–25.

[33] Duffy CP, Elliott CJ, O’Connor RA, Heenan MM, Coyle S,

Cleary IM, et al. Enhancement of chemotherapeutic drug

toxicity to human tumour cells in vitro by a subset of non-

steroidal anti-inflammatory drugs (NSAIDs). Eur J Cancer

1998;34:1250–9.

[34] Neyfakh AA. Use of fluorescent dyes as molecular probes for

the studies of multidrug resistance. Exp Cell Res 1988;

174:168–76.

[35] Marques-Santos L.F, Harab RC, de Paula EF, Rumjanek VM.

The in vivo effect of the administration of resistance-modulat-

ing agents on rhodamine 123 distribution in mice thymus and

lymph nodes. Cancer Lett 1999;137:99–106.

[36] Sun H, Johnson DR, Finch RA, Sartorelli AC, Miller DW,

Elmquist WF. Transport of fluorescein in MDCKII-MRP1

transfected cells and mrp1-knockout mice. Biochem Biophys

Res Commun 2001;284:863–9.

[37] Drach D, Zhao S, Drach J, Mahadevia R, Gattringer C, Huber

H, et al. Subpopulations of normal peripheral blood and bone

marrow cells express a functional multidrug resistant pheno-

type. Blood 1992;80:2729–34.

[38] Zhou S, Schuetz JD, Bunting KD, Colapietro AM, Sampath J,

Morris JJ, et al. The ABC transporter Bcrp1/ABCG2 is

expressed in a wide variety of stem cells and is a molecular

determinant of the side-population phenotype. Nat Med

2001;7:1028–34.

[39] Daoud R, Kast C, Gros P, Georges E. Rhodamine 123 binds to

multiple sites in the multidrug resistance protein (MRP1).

Biochemistry 2000;39:15344–52.

[40] Laupeze B, Amiot L, Courtois A, Vernhet L, Drenou B,

Fauchet R, et al. Use of the anionic dye carboxy-2V,7V-dichlor-ofluorescein for sensitive flow cytometric detection of multi-

drug resistance-associated protein activity. Int J Oncol

1999;15:571–6.

[41] Echevarria-Lima J, Kyle FC, Leite DFP, Capella LS, Capella

MAM, Rumjanek VM. Expression and activity of multidrug

resistance protein 1 in a murine thymoma cell line. Immunol-

ogy 2005;114:440–8.

[42] Urdahl KB, Pardoll DM, Jenkins MK. Cyclosporin A inhibits

positive selection and delays negative selection in alpha beta

TCR transgenic mice. J Immunol 1994;152:2853–9.

[43] Zadeh HH, Goldschneider I. Demonstration of large-scale

migration of cortical thymocytes to peripheral lymphoid tis-

sues in cyclosporin A-treated rats. J Exp Med 1993;178:

285–93.

[44] Cairns JS, Mainwaring MS, Cacchione RN, Walker JA,

McCarthy SA. Regulation of apoptosis in thymocytes. Thy-

mus 1993;21:177–93.

[45] Tomooka S, Serushago BA, Koga Y, Taniguchi K,

Nomoto K. Indomethacin-induced sialic acid-mediated

changes in surface markers from cortical type to medullary

type in murine thymoma line EL4. Immunobiol 1986;171:

345–56.

[46] Delebassee S, Gualde N. Effect of arachidonic acid metabo-

lites on thymocyte proliferation. Ann Inst Pasteur Immunol

1988;139:383–99.

[47] Daculsi R, Vaillier D, Carron JC, Gualde N. Effect of PGE2 on

the cell surface molecule expression in PMA treated thymo-

cytes. Immunol Lett 1998;60:81–8.

[48] Honig SM, Fu S, Mao X, Yopp A, Gunn MD, Randolph GJ, et

al. FTY720 stimulates multidrug transporter- and cysteinyl

leukotriene-dependent T cell chemotaxis to lymph nodes.

J Clin Invest 2003;111:627–37.

[49] Campbell JJ, Pan J, Butcher EC. Cutting edge: developmental

switches in chemokine responses during T cell maturation.

J Immunol 1999;163:2353–7.