Immunohistochemistry and in situ hybridization in thestudy of human skin melanocytes

Thierry Passeron, Sergio G. Coelho, Yoshinori Miyamura, Kaoruko Takahashi and Vincent J. Hearing

Pigment Cell Biology Section, Laboratory of Cell Biology, National Cancer Institute, National Institutes of Health, Bethesda, MD, USA

Correspondence: Dr Vincent J. Hearing, Laboratory of Cell Biology, National Cancer Institute, National Institutes of Health, Building 37, Room

2132, MSC 4256, Bethesda, MD 20892, USA, Tel.: +1 301 496 1564, Fax: +1 301 402 8787, e-mail: hearingv@nih.gov

Accepted for publication 7 December 2006

Abstract: Although keratinocytes are the most numerous type

of cell in the skin, melanocytes are also key players as they

produce and distribute melanin that protects the skin from

ultraviolet (UV) radiation. In vitro experiments on melanocytic

cell lines are useful to study melanogenesis and their progression

towards melanoma. However, interactions of melanocytes with

keratinocytes and with other types of cells in the skin, such as

fibroblasts and Langerhans cells, are also crucial. We describe two

techniques, immunohistochemistry (IHC) and tissue in situ

hybridization (TISH), that can be used to identify and study

melanocytes in the skin and their responses to UV or other

stimuli in situ. We describe a practical method to localize

melanocytic antigens on formalin-fixed, paraffin-embedded tissue

sections and in frozen sections using indirect immunofluorescence

with conjugated secondary antibodies. In addition, we detail the

use of TISH and its combination with IHC to study mRNA levels

of genes expressed in the skin at cellular resolution. This

methodology, along with relevant tips and troubleshooting items,

are important tools to identify and study melanocytes in the skin.

Key words: immunohistochemistry – melanocytes – tissue in situ

hybridization

Please cite this paper as: Immunohistochemistry and in situ hybridization in the study of human skin melanocytes. Experimental Dermatology 2007; 16:

162–170.

Introduction

Skin is a complex structure providing important critical

functions. Not only does it serve as an essential barrier from

environmental stress, but also as a key organ for contact and

exchange between the organism and its environment. Cells

in the skin are certainly the most exposed to external stimuli.

Therefore, they have developed complex communications

and tight regulations to respond to such stimulations.

Although keratinocytes are the most numerous type of cell in

the skin, melanocytes are also key players as they produce

and distribute melanin, which protects the skin from ultravi-

olet (UV) radiation. Melanocytes are also the type of cell

from which melanoma, one of the deadliest cancers, is

derived. In vitro experiments on melanocytic cell lines are

helpful to study melanogenesis and the progression of mel-

anocytes towards melanoma. However, interactions of mel-

anocytes not only with keratinocytes but also with other

types of cells in the skin, such as fibroblasts and Langerhans

cells, also appear to be crucial (1–4). Fortunately, thanks to

its superficial localization, the skin is relatively easy to biopsy

and thus allows for in vivo studies. However, since the first

description of pigment cells in 1819 by Sangiovanni, the

study of melanocytes within the skin was barely impossible

(see Ref. 5 for review). In 1917, Bloch introduced the 3,4-

dihydroxyphenylalanine (DOPA) reaction to analyse mel-

anin-producing cells. More than 30 years after, Fitzpatrick

et al. showed the activity of tyrosinase (TYR) in normal

human skin after UV irradiation in vivo using the DOPA

staining (6). Nowadays, the wide variety of specific antibod-

ies allows studying in vivo protein expressions using immu-

nohistochemistry (IHC). More recently, tissue in situ

hybridization (TISH) completes our technical tools to ana-

lyse RNA expression within the skin.

The aim of this review was to be very practical and to

outline approaches that can be used to specifically identify

melanocyte subpopulations in the skin. We focus on two

techniques that are commonly used in our laboratory to

identify and study melanocytes in the skin: IHC and TISH.

Interfollicular and follicular melanocytemarkers

Melanocytes are present not only in the epidermis and in

hair follicles but also in the eye, inner ear and leptomeninges.

They can also be found in the Harderian gland and even in

some mesenchymal tissues. However, we will limit this

review to melanocytes localized in the skin.

DOI:10.1111/j.1600-0625.2006.00538.x

www.blackwellpublishing.com/EXDMethods Review Article

ª 2007 The Authors

162 Journal compilation ª Blackwell Munksgaard, Experimental Dermatology, 16, 162–170

By virtue of their specific function (melanogenesis), mel-

anocytes can be identified by a growing number of markers

specifically expressed by those cells, which are usually

involved with that specific function. As examples, TYR and

microphthalmia-associated transcription factor (MITF) are

two of the most commonly used specific biomarkers for

evaluating the regulation of the melanogenic system after

environmental stimulation. TYR, a membrane glycoprotein,

was the first melanogenic enzyme identified as important

for melanin synthesis (7–9). In the melanin biosynthetic

pathway, TYR catalyses the rate-limiting step of hydroxylat-

ing the amino acid tyrosine to l-DOPA. Incubations of

fixed paraffin sections with DOPA can lead to melanin pro-

duction which is readily visible in tissue sections and is

quite useful to identify melanocytes (10). MITF is consid-

ered the principal transcription factor in charge of regula-

ting melanocyte function (11–13). It moderates several

melanocyte-specific genes that encode melanosomal pro-

teins such as TYR, dopachrome tautomerase (DCT) and

MART1 (melanoma antigen recognized by T cells). DCT is

the enzyme that catalyses the tautomerization of the mela-

nogenic intermediate DOPAchrome to 5,6-dihydroxyin-

dole-2-carboxylic acid (14). Importantly, DCT is one of the

earliest melanocyte markers expressed and is detected both

in melanocytes and in melanoblasts (15). MART1 is yet

another melanosomal protein that is also a melanoma-spe-

cific target for tumor-directed T lymphocytes and it contin-

ues to be studied as a potential target for immunotherapy

of melanoma (16). Thus, the expression of MART1 is use-

ful as a specific marker to localize melanocytes. MART1

forms a complex with gp100 (Pmel17/silver) and influences

its expression, therefore modifying the process necessary

for melanosome maturation and structure (17). Pmel17/

gp100 is an essential protein required for formation of the

structural matrix of stage II melanosomes (18).

Melanocytes located in the basal layer of the epidermis

are quite similar to those located in the basal layer of the

hair follicle infundibulum (Fig. 1a). They are also similar

to melanocytes located amongst the basal sebocytes of the

sebaceous gland, even if those are only weakly to moder-

ately pigmented. Another subpopulation of melanocytes is

located in the mid-portion of the hair follicle outer root

sheath (the so-called ‘bulge’ region). Melanocytes in this

region are poorly differentiated, non-pigmented, and are

usually considered melanocyte stem cells. The most prox-

imal follicular melanocyte subpopulation, which contri-

butes to pigmentation of the hair shaft, is located in the

hair bulb above and around the mid-upper follicular

papilla. Anagen hair bulbs also contain poorly differenti-

ated melanocytes. Those amelanotic hair bulb melanocytes

may represent ‘transient’ melanocytes that are migrating

from precursor melanocytes stored in the upper outer root

sheath (19). The antigenic expression patterns of markers

for these various melanocyte subpopulations have been

widely explored (20–24), and antibodies or specific RNA

probes can be used to define the subpopulations of

melanocytes in the epidermis and in hair follicles (summar-

ized in Fig. 1c). The subcellular localization of melanocyte-

specific antigens is summarized in Fig. 1b.

Immunohistochemistry

Localizing specific melanocyte subpopulations in murine

and human tissues can be accomplished using standard IHC

techniques. A practical method to localize melanocytic anti-

gens in formalin-fixed, paraffin-embedded tissue sections

and in frozen sections using indirect immunofluorescence

with conjugated secondary antibodies is presented schemati-

cally in Fig. 2 and is detailed in Table 1. Endothelin 1 has

been implicated in the response of UV and appears also to

play a role in pigmentation in basal cell carcinoma (25). Fig-

ure 3 shows an example of melanocyte staining (for MART1)

and endothelin 1 in UV-exposed skin and in unexposed skin.

A comparison of the effects of two methods of antigen retrie-

val to optimize staining is shown in Fig. 4.

Caveats/pitfallsStandardization and quality control within each laborat-

ory will minimize problems with IHC, but there are a

(a)

(b)

(c)

Figure 1. Schematic of melanocyte populations within the skin and

specific antigens. (a) Localization of melanocyte populations in the skin,

and (b) subcellular localizations of melanocyte-specific antigens. (c)

Table summarizing antigens and their expression patterns that allow

identification of melanocyte subpopulations.

Immunohistochemistry and tissue in situ hybridization

ª 2007 The Authors

Journal compilation ª 2007 Blackwell Munksgaard, Experimental Dermatology, 16, 162–170 163

number of important variables to keep in mind, as fol-

lows:

• For frozen sections, fixation with 4% paraformalde-

hyde is stronger and provides better conservation of the

shape of the cells. However, some antigens may be altered

by this fixation and cold methanol should then be used.

• The permeabilization of the membrane is more effect-

ive with triton X which allowed better staining of cytoplas-

mic and nuclear antigens. However, the cellular membrane

could be altered by triton X and incubation time with tri-

ton X should be carefully monitored. Use of cold methanol

is usually safer for skin tissues.

• Fixation of tissue in formalin followed by antigen

retrieval has been shown to provide optimal immunostain-

ing (26). Variations in fixation are improved by microwave

oven antigen retrieval (27).

• Adhesion coating of glass slides, such as silane coating

or polylysine coating, should be used to minimize section

peeling.

• The heating temperature and the time of heating seem

to be the most critical events during antigen retrieval

because they determine if the sections peel off the slide,

fold over or provide sufficient unmasking of the antigen

for optimal staining (28).

• If a commercial antigen unmasking solution is not

used, the pH value of the antigen retrieval solution for

EDTA (pH 8.0) or citrate buffer (pH 6.0) is important. A

report in the literature shows good results with low pH

antigen unmasking solutions for some nuclear antigens

(29). If a commercial antigen unmasking solution is used,

it is important to shake it well before using, as prolonged

storage at 4�C creates some precipitation of the buffer. It

has been reported that EDTA-heat antigen retrieval is more

sensitive than heat treatment with citrate (30).

• We have found that the sensitivity of staining for

melanocyte antigens is increased using heat treatment with

1 mm EDTA (Table 2). The concentration of antibodies

should be less than that used with citrate heat retrieval,

because EDTA antigen retrieval also increases non-specific

signals if one uses the same primary antibody concentra-

tion.

• It is important to place the slides in a humidified

chamber in order to prevent the samples from drying out

during the incubation with antibodies. In addition, semi-

automated systems, such as the Shandon CoverplateTM

Technology (Thermo Electron Corp., Waltham, MA, USA),

can prevent the primary antibody from evaporating and at

the same time allow for high throughput studies (31).

• One key step in achieving a good signal-to-noise

ratio is to pay special attention to making appropriate

blocking steps to avoid as much non-specific antibody

binding as possible. Depending on the detection system

used, additional blocking steps can be employed with the

traditional normal serum or bovine serum albumin

(BSA), such as a blocking step with H2O2 for peroxidase,

an avidin–biotin block for the avidin–biotin conjugate

method, or a biotin–streptavidin block for the biotin–

streptavidin method. In addition, it has been noted that

incomplete paraffin removal can lead to diffuse back-

ground staining, and in such cases additional blocking

steps are of little value (32).

• To avoid experimental error caused by the cross-reac-

tivity of antibodies, many commercially available secondary

antibodies can be pre-absorbed with immunoglobulin and/

or serum for other species. One should carefully check the

cross-reactivities of secondary antibodies in a pilot study.

For example, we have seen commercial goat anti-rabbit

cross-react with mouse IgG3 antibody, even though this

secondary antibody was pre-absorbed with mouse serum

and IgG. This phenomenon may depend on the low fre-

quency of IgG3 in normal mouse IgG.

• Anti-fade reagents should be used for immunofluores-

cence, because the intensity of many fluorescence products

is decreased by photo-bleaching. Mounting medium that

includes anti-fade reagents are commercially available. They

are characterized by different stabilities of the anti-fade

effect, fastness and hydrophobicity. For example, the anti-

fade effect of Prolong Gold (Invitrogen Corp., Carlsbad,

CA, USA) remains high for several months, although one

needs to wait 24 h after mounting for curing. In contrast,

microscopic observations can begin immediately if Slow

Fade Gold (Invitrogen Corp.) is used; however, in this case

the fluorescence intensity only lasts several weeks after

mounting. Another option is the product CytosealTM 60

(Richard-Allan Scientific, Kalamazoo, MI, USA), which is

suitable for Q-dot and sections that have been dehydrated

by ethanol and xylene.

Figure 2. Overview of immunohistochemistry.

Passeron et al.

ª 2007 The Authors

164 Journal compilation ª 2007 Blackwell Munksgaard, Experimental Dermatology, 16, 162–170

• The fluorescence excitation and emission wavelengths

of secondary antibodies must be suitable for the fluorescent

microscope filters used. Incorrect combinations of filters and

fluorophores can reduce signal intensity. It is important to

exclude fluorophores with overlapping emission spectra

when attempting multicolour staining (The Handbook

Tenth edition; Molecular Probes, Carlsbad, CA, USA).

• It is important to always include both a positive and a

negative control during each experiment to evaluate the

quality of the staining and whether the protocol has been

performed correctly (32). Although skin is a good positive

control for melanocyte-specific proteins as it contains many

diverse types of cells in the same section, tanned skin is a

better positive control compared with fair skin.

Many coat colour genes have been identified in mice and

a wide variety of mice mutant at one or more pigment loci

are available (33,34). Consequently, tissues from these

mutant mice can be used not only as good positive or neg-

ative controls, but also as good subjects to investigate the

role of melanocyte-specific markers. Previously, our group

co-stained agouti signal protein and TYR in mouse hair

follicles (35).

Sometimes there can be variable staining between sam-

ples from the same batch. We have checked to determine

whether this phenomenon is caused by operator error. In

our laboratory, we use an antibody that can serve as an

internal control for all sections, the DNA antibody AC-30-

10 (Millipore, Billerica, MA, USA). If such an internal con-

trol is not stained, one should check the fixation procedure

and the storage conditions of samples. Variability in stain-

ing can also result from bad sectioning with samples of dif-

ferent thicknesses and/or inadequate or excessive antigen

retrieval (32).

Table 1 Protocol for indirect immunofluorescence of melanogenic markers

For frozen sections

•Dry frozen sections for 45 min at room temperature (RT)

•Fixation with cold methanol or 4% paraformaldehyde for 20 min at 4�C (let air dry 20 min if cold methanol was used). Rinse in PBS (·3) for

5 min

•For permeabilization of cell membranes, add 0.01% Triton X for 3 min or cold methanol for 15 min at 4�C (let air dry 20 min if cold methanol

was used). Rinse in PBS (·3) for 5 min. Continue with the quench or pretreat steps described below

For paraffin-embedded sections

•Deparaffinize and rehydrate paraffin-embedded slides

•Xylene or xylene substitute for 5 min (·2)

100% EtOH for 3 min

95% EtOH for 3 min

70% EtOH for 3 min

50% EtOH for 3 min

•Rinse in PBS 3 min

•Antigen retrieval (AR): antigen unmasking solution (Vector Laboratories, Burlingame, CA, USA), 1 mM EDTA (pH 8) or 10 mM citrate buffer (pH

6). Heat in microwave oven for 10–12 min and cool down for 20 min. Rinse in PBS for 5 min

•Quench or pretreat (for peroxidase and/or biotin–streptavidin): incubate in 0.3% H2O2 in water for 30 min at RT and/or streptavidin/biotin block-

ing solution according to the manufacturer’s instructions. Rinse in PBS for 5 min

•Mark around samples with a hydrophobic barrier pen. Rinse in PBS for 5 min

•Blocking: incubate in 1–2% BSA, 10% normal serum/PBS or Image-IT FXTM Signal Enhancer (Invitrogen Corp.) for 60 min at RT

•If Image-IT FXTM Signal Enhancer was used as a blocking reagent, rinse in PBS (·3) for 5 min and blot excess solution from sections

•Primary antibody: anti-melanocyte specific protein antibody (or antisera) diluted in 1% BSA or in 5% normal serum/PBS (see Table 3) then put

100�300 ll antibody dilution on the sections

•Put glass slides in a humidified chamber and incubate at 4�C overnight

•Wash with 0.05% Tween-20/PBS (·4)

•Secondary antibody (conjugated): incubate in fluorescence conjugated anti-species IgG (H + L) (Molecular Probes) (1:500) in 5% normal serum/

0.05% Tween-20/PBS for 60 min at RT in the dark

•Wash with 0.05% Tween-20/PBS (·3) in dark

•Counter-stain with anti-fade medium with or without DAPI and mount

Alternate approach: if the above fluorescent method is too weak, one may try the following optional steps instead of the above secondary anti-

body steps

•Incubate in biotinylated anti-species IgG or universal secondary antibody (1:100)/5% normal serum/PBS for 60 min at RT

•Wash in PBS (·3) for 5 min

•Incubate in fluorescein streptavidin (1:100)/5% normal serum/PBS for 60 min at RT in dark

•Wash with PBS (·3) for 5 min in dark

•Counter-stain and mount as indicated above

Immunohistochemistry and tissue in situ hybridization

ª 2007 The Authors

Journal compilation ª 2007 Blackwell Munksgaard, Experimental Dermatology, 16, 162–170 165

In summary, high-quality specimens, specific antibodies

and optimized procedures are important essentials for suc-

cessful immunohistochemical studies.

Tissue in situ hybridization

Immunohistochemistry is a relatively easy and reliable

method to assess protein expression in the skin. However,

antibodies are not always available for the target protein

being studied. Therefore, it can be of interest to study the

transcriptional activity of any gene by assessing its RNA

expression in the skin. The TISH procedure allows for the

study of mRNA levels of genes in tissues at cellular resolu-

tion. The fact that one can avoid using radioisotopes via

the sensitive detection of chemically labelled nucleotides

makes TISH an attractive technique. TISH has been used

with success to study pigment cells in human (36–41) and

in mouse (42,43) tissues. Interestingly, TISH has proven

the existence of amelanotic melanocytes within the outer

root sheath of senile white hair (44).

TISH for melanogenic markersThe TISH procedure can be divided into three distinct

steps: (i) design of specific probes; (ii) labelling of the

probes, and (iii) hybridization of the probes onto the skin

samples. An overview of the TISH technique is shown in

Fig. 5 and a detailed procedure for TISH is presented in

Table 3. An example of melanocyte identification by TISH

using a probe for TRP1 is shown in Fig. 6a. Details of buf-

fer compositions used in TISH are shown in Table 4. The

sequences of several melanogenic probes that we have

designed and tried successfully are listed in Table 5.

Caveats/pitfalls• DNA, RNA and oligonucleotide probes can be used to

perform TISH. However, RNA probes usually perform bet-

ter because of their higher sensitivity.

Figure 3. Increased expression of MART1 and endothelin 1 after

ultraviolet (UV) exposure. Subjects were exposed to 10 sessions of UV

radiations (95% UVA and 5% UVB) in 5 weeks, total cumulative dose

4.3 kJ/m2. Samples were stained with antibodies against MART1 (green)

and endothelin 1 (red). (a) Unexposed skin; (b) UV-exposed skin; (c)

control (sample stained only with the secondary antibodies).

Figure 4. Example of improvement of antigen specificity by optimizing

antigen retrieval, blocking and antibody concentration. (a) Antigen

retrieval: Vector Unmasking solution & Microwave 12 min; blocking

buffer: 10% Goat Serum; antibody concentration: gp100 (aPEP13h)

1:700. (b) Antigen retrieval: 1 mM EDTA & Microwave 10 min increased

signal intensity. Blocking buffer: ImageIT Signal enhancer reduced

background fluorescent from second antibody; antibody concentration:

gp100 (aPEP13h) 1:10 000 decreased non-specific binding of antibody. Figure 5. Overview of TISH.

Passeron et al.

ª 2007 The Authors

166 Journal compilation ª 2007 Blackwell Munksgaard, Experimental Dermatology, 16, 162–170

• The length of probes is also an important considera-

tion. Whereas some groups have used cDNAs of more than

1 kb (45), we have obtained better results with cDNAs of

�500 bp (18,46).

• Typically, several different probes for each gene/protein

of interest are designed and then tested to screen for the best

ones. Sense probes also need to be designed to serve as negat-

ive controls. A competitive hybridization can be performed

using cold probes to serve as a negative control.

• A high fidelity enzyme should be used to perform the

PCR.

• Frozen tissues or paraffin-embedded tissues can be

used for TISH. However, we usually work with paraffin tis-

sues as they are easier to store.

• All instruments should be washed with ddH2O and

treated with RNAse before use. Every phase during pre-

hybridization and hybridization must be done in RNAse-

free conditions. In addition, it is very important to prevent

samples from drying completely.

• Similar to IHC, samples are placed in a humidified

chamber to prevent them from drying out during the over-

night incubation with the probes. Moreover, bubbles

should be avoided when applying the probe mixture to

samples as false negative or heterogeneous staining could

result.

• We generally use the tyramide signal amplification

reaction, but any signal amplification system designed for

IHC can be used for chemical detection in TISH. However,

we avoid DAB staining as the brownish colour can be diffi-

cult to distinguish from melanin. Fluorescent staining can

also be used.

• When the chemical reactants are added to samples, it

is very important to incubate all samples exactly for the

same time as longer incubation can lead to further increa-

ses in signal intensity. It is possible to monitor the change

in colour using a microscope after adding the VIP sub-

strate, however, the stain should not be developed for lon-

ger than 10 min.

• Finally, carefully dry the samples before adding the

mounting medium as remaining water can strongly

decrease the signal over the next 12–24 h.

Concluding remarks

The advent of an increased number of reliable melanocyte-

specific antibodies, improved TISH techniques, powerful

microscopes and superior software has allowed for the

identification and analysis of melanocytes in the skin under

in vivo conditions. Immunohistochemistry is an easy and

reliable technique. It allows the analysis of protein expres-

Table 2 List of melanocyte specific antibodies routinely used in our laboratory

Optimized antibody concentration with

different antigen retrieval techniques

Clone Host Name of clone Isotype

Commercial

unmasking solution

(citric acid and

proprietary salts) 1 mM EDTA (pH 8.0)

Human MITF N-terminal Monoclonal Mouse C5 + D5 IgG1 5 lg/ml 1 lg/ml

Human MART-1 recombinant Monoclonal Mouse M2-7C10 + M2-9E3 IgG2b 2 lg/ml 1–2 lg/ml

Tyrosinase Antiserum Rabbit aPEP7h N/A 1:700 1:8000

Pmel17/gp100 Antiserum Rabbit aPEP13h N/A 1:700 1:10 000

DCT/TRP2 Antiserum Rabbit aPEP8h N/A Not good 1:4000

Figure 6. Examples of TISH staining. (a) TISH with probes against

TYRP1: (left) antisense probes, (right) sense probes. (b) Combination of

TISH and IHC: (left) TISH with probes against Sox10, (right) TISH with

probes against Sox10 combined with IHC with antibody against

MART1. Note that the TISH reveals the presence of Sox10 RNA both in

melanocytes and in keratinocytes.

Immunohistochemistry and tissue in situ hybridization

ª 2007 The Authors

Journal compilation ª 2007 Blackwell Munksgaard, Experimental Dermatology, 16, 162–170 167

sions in vivo conditions and it is generally our first choice

to study a protein of interest. TISH technique is more

complicated to perform and requires the design and the

production of specific probes. However, it allows the study

of the mRNA expression and is very useful in complement

of the IHC or when good antibodies are not available. Both

of these techniques can be combined to identify melano-

cytes, e.g. with a melanocyte marker antibody (such as

TYR or MART1) after performing TISH with probes

against a gene expressed by keratinocytes and/or melano-

cytes. In such a case, the experiment must be stopped

before fixation and then standard IHC can follow as des-

cribed above, starting with the primary antibody incuba-

tion (Fig. 6b). The combination of IHC and TISH also

allows for the simultaneous evaluation of RNA and protein

levels of one gene of interest. Hopefully, in the coming

years, in vivo techniques, such as IHC, TISH, and DNA

microarray analysis after laser microdissection, will provide

crucial data on the relationships between all types of cells

in the skin. Such information will help us to better under-

stand the processes leading to pigmentation and/or to car-

cinogenesis.

Table 3 Protocol for tissue in situ hybridization of melanogenic markers

Design of probes

Oligonucleotide probes specific for the gene in question need to be designed first. Target sites are selected based on the analysis of sequence

matches and mismatches, BLAST (GenBank). Designed probes should not show evidence of cross-reaction with sequences of other genes. Com-

plementary DNA of a gene of interest is cloned into a plasmid that contains both Sp6 and T7 promoters on each side of the insertion site

Labelling of probes

The probes have to be tailed with digoxigenin-11-dUTP, e.g. DIG RNA labelling kit (Roche, Basel, Switzerland)

•Take 20–30 ng of DNA template (for 500 bp PCR product)

•Add 2 ll dNTP mix (mix of dATP, dCTP, dGTP, dUTP, DIG-11-UTP), 2 ll 10X transcription buffer, 1 ll RNAse inhibitor, 2 ll RNA polymerase (T7

or SP6, respectively, for antisense and sense probes), and nuclease free water for a total of 21 ll

•Incubate at 37�C for 2 h, then add 2 ll DNAse and incubate again for 15 min at 37�CAfter purification, the RNA probes can be stored at )20�C for 1 year.

Hybridization

•For combination with immunohistochemistry, the samples have to be deparaffinized and rehydrated. However, xylene should be used three times

and 5 min each, and then ethanol 100% four times 5 min each and finally a decreasing concentration of ethanol (90, 80, 70 and 50%) for

5 min each. Finally rinse with PBS for 10 min

•Put the slides in 2 ml Ag retrieval solution to 198 ml ddH2O. Heat in microwave for 12 min and cool for 20 min

•Circle the skin samples with a hydrophobic pen

•Wash slides in glycine solution (2 mg/ml in PBS) for 10 min with gentle shaking. Then wash in PBS (2·) for 3 min

•Put slides in 200 ml acetylation buffer, and add 500 ll acetic anhydride. Incubate at RT for 15 min with continuous agitation

•Wash twice in 4X SSC for 10 min also with continuous agitation

•Incubate in pre-warmed pre-hybridization solution (in a water bath at 47�C) for more than 30 min (45–60 min is optimal)

•During this time, prepare the probe mixture. 5 ll of probes and 2 ll of RNAmix are needed for each slide. First, mix and denature the probes at

65�C for 5 min. Then, cool the probe mixture on ice more than 5 min

If there is a lot of waiting time until the probes are used, leave them on ice to remain denatured.

•Add to the probes and RNAmix, 0.5 ll 10% NTS, 0.5 ll 10% SDS and 80 ll hybridization buffer and mix. Spin down to get rid of bubbles and

apply 80 ll of the prepared probe mixture per slide. Cover with cover glass and incubate in a humid hybridization tray overnight at 47�C•The following day, prepare three jars of pre-hybridization solution and leave them in a water-bath for 20–30 min at 47�C. Once the solution is

pre-warmed, drain away the probe, dip the slides for a quick wash in pre-hybridization solution and carefully remove the cover glasses. Then,

wash the samples (3·) for 20 min in a water bath (47�C) with the jars of pre-hybridization solution already warmed-up

•Wash samples in pre-warmed NTE buffer for 5 min (water bath at 37�C) and after keep the buffer. Treat the samples with pre-warmed RNase A

solution for 30 min in water bath at 37�C, then return the samples into NTE buffer and incubate for 3 min in a water bath at 37�C. Finally, wash

the samples with TBS for 1 min at RT

•Cover the samples with blocking solution [5% blocking agent (Roche) in TBS] and incubate for more than 30 min in a humidified chamber. Wipe

off all surrounding liquid before adding blocking solution

•Wash with TBS for 5 min with gentle shaking. Remove the slides and wipe off all surrounding liquid. Treat the samples with anti-DIG-HRP conju-

gate, 1:300 dilution in TBS (80 ll per sample). Incubate for 45 min in a wet box at RT

•Wash the samples in TBST (2·) for 3 min with smooth shaking. Add one to two drops of Biotinyl tyramide to the samples, and incubate at RT

for 15 min precisely

•Wash the samples with TBST (3·) for 3 min with gentle shaking. Add one to two drops of secondary avidin-HRP on the samples, and incubate at

RT for 15 min precisely

•Wash the samples with TBST (3·) for 3 min with gentle shaking then with TBS two times for 3 min with gentle shaking

•Wipe off all surrounding liquid and cover the samples with 15 ll of VIP substrate solution at RT for 5 min

•Use ddH2O to stop the reaction. Four to five quick washes then wash (3·) for 2 min with gentle shaking

Wipe off all surrounding liquid and add mounting medium

Passeron et al.

ª 2007 The Authors

168 Journal compilation ª 2007 Blackwell Munksgaard, Experimental Dermatology, 16, 162–170

Acknowledgements

This research was supported by the Intramural Research

Program of the NIH, National Cancer Institute. The men-

tion of commercial products, their sources, or their use in

connection with material reported herein is not to be con-

strued as either an actual or implied endorsement of such

products by the Department of Health and Human Services.

References

1 Luger T A, Scholzen T, Brzoska T, Becher E, Slominski A, Paus R.

Cutaneous immunomodulation and coordination of skin stress

responses by alpha-melanocyte-stimulating hormone. Ann N Y Acad

Sci 1998: 840: 381–394.

2 Imokawa G. Autocrine and paracrine regulation of melanocytes in

human skin and in pigmentary disorders. Pigment Cell Res 2004:

17: 96–110.

3 Yamaguchi Y, Hearing V J, Itami S, Yoshikawa K, Katayama I.

Mesenchymal–epithelial interactions in the skin: aiming for site-spe-

cific tissue regeneration. J Dermatol Sci 2005: 40: 1–9.

4 Yamaguchi Y, Itami S, Watabe H et al. Mesenchymal-epithelial

interactions in the skin: increased expression of dickkopf1 by

palmoplantar fibroblasts inhibits melanocyte growth and differenti-

ation. J Cell Biol 2004: 165: 275–285.

5 Westerhof W. The discovery of the human melanocyte. Pigment

Cell Res 2006: 19: 183–193.

6 Fitzpatrick T B, Becker S W Jr, Lerner A B, Montgomery H. Tyrosin-

ase in human skin: demonstration of its presence and of its role in

human melanin formation. Science 1950: 112: 223–225.

7 Lerner A B, Fitzpatrick T B. Biochemistry of melanin formation.

Physiol Rev 1950: 30: 91–126.

8 Hearing V J, Ekel T M. Mammalian tyrosinase: a comparison of tyro-

sine hydroxylation and melanin formation. Biochem J 1976: 157:

549–557.

9 King R A, Olds D P, Witkop Jr C J. Characterization of human hair-

bulb tyrosinase: properties of normal and albino enzyme. J Invest

Dermatol 1978: 71: 136–139.

10 Szabo G. The number of melanocytes in human epidermis. Br Med

J 1954: 1: 1016–1017.

11 Bertolotto C, Abbe P, Hemesath T J et al. Microphthalmia gene

product as a signal transducer in cAMP-induced differentiation of

melanocytes. J Cell Biol 1998: 142: 827–835.

12 Shibahara S, Yasumoto K, Amae S et al. Regulation of pigment cell

specific gene expression by MITF. Pigment Cell Res 2000: 13: 98–

102.

13 Levy C, Khaled M, Fisher D E. MITF: master regulator of melanocyte

development and melanoma oncogene. Trends Mol Med 2006: 12:

406–414.

14 Korner A M, Pawelek J. Dopachrome conversion: a possible control

point in melanin biosynthesis. J Invest Dermatol 1980: 75: 192–

195.

15 Steel K P, Davidson D R, Jackson I J. TRP2/DT, a new early melano-

blast marker, shows that steel growth factor (c-kit ligand) is a survi-

val factor. Development 1992: 115: 1111–1119.

16 Kawakami Y, Robbins P F, Wang R F, Parkhurst M R, Kang X,

Rosenberg S A. Tumor antigens recognized by T cells: the use

of melanosomal proteins in the immunotherapy of melanoma.

J Immunother 1998: 21: 237–246.

17 Hoashi T, Watabe H, Muller J, Yamaguchi Y, Vieira W D, Hearing V

J. MART-1 is required for the function of the melanosomal matrix

Table 4 Buffers used for TISH

Dionized formamide

Add 30 ml of resin + 105 ml of DNAse free formamide

Pre-hybridization buffer

1:1 of 4X SSC (made with DEPC water) and formamide

Acetylation buffer

TEA (triethylamine) 2.67 ml + DEPC water 144 ml + HCL

0.75 ml + DEPC water 32.58 ml

Please follow the same order

Hybridization buffer

1 m Tris–HCl, pH 7.4, 0.95 ml + 0.5 m EDTA, pH 8.0,

0.1 ml + 5 m NaCl 2.4 ml + formamide 23.8 ml + 50% dextran sul-

phate 9.52 ml + 50x Denhardt’s solution 0.95 ml + DEPC H2O

2.28 ml for a total of 40 ml

RNA mix ¼ salmon sperm DNA + ribonucleic acid + yeast tRNA

For 80 ll of RNA mix: salmon sperm DNA 20 ll, ribonucleic acid

25.04 ll, yeast tRNA 20 ll, H2O 15 ll

NTE buffer ¼ RNase A washing buffer

For 360 ml: H2O 324 ml, 5 m NaCl 36 ml, 1 m Tris–HCl pH 8.0

36 ml, 0.5 m EDTA 0.18 ml

Rnase A solution ¼ NTE buffer (see above) 180 ml + ribonuclease A

(20 lg/ml)

Table 5 Sequence of some riboprobes used for TISH experiments in

the skin

Human TRP1 (X51420)

HTRP1-T7 (1591–1612)

GCGCGTAATACGACTCACTATAGGG-CA-

AAAATGAGTGCAACCAGTAA

HTRP1-T3 (1091–1110)

CGCGCAATTAACCCTCACTAAAGG-GACCAATGGTGCAACGTCTT

Human tyrosinase (M27160)

HTyrosinase-T7 (1411–1432)

GCGCGTAATACGACTCACTATAGGG-TGGGGTTCTGGATTTGT-

CATGG

HTyrosinase-T3 (911–930)

CGCGCAATTAACCCTCACTAAAGG-TACCTCACTTTAGCAAAGCA

Human DCT (NM_001922)

HDCT-T7 (1101–1122)

GCGCGTAATACGACTCACTATAGGG-GCCAATGAGTCGCTGGA-

GATCT

HDCT-SP6 (601–620)

CATACGATTTAGGTGACACTATAG-GAGGTGCGAGCCGACACAAG

Human GP100 (NM_006928)

HGP100-3 T7 (1801–1822)

GCGCGTAATACGACTCACTATAGGG-CGGAACCTGCC-

CAAGGCCTGCT

HGP100-3 T3 (1301–1320)

CGCGCAATTAACCCTCACTAAAGG-GTGGAGACCACAGCTAGAGA

Human SOX10 (NM_006941)

SOX10T7 (861–882)

GCGCGTAATACGACTCACTATAGGG-TGCCTTGCCCGACTG-

CAGTTCT

SOX10SP6 (661–680)

CATACGATTTAGGTGACACTATAG-GGGAAGGCCGCCCAGGGCGA

Immunohistochemistry and tissue in situ hybridization

ª 2007 The Authors

Journal compilation ª 2007 Blackwell Munksgaard, Experimental Dermatology, 16, 162–170 169

protein Pmel17/gp100 and the maturation of melanosomes. J Biol

Chem 2005: 280: 14006–14016.

18 Valencia J C, Watabe H, Chi A et al. Sorting of Pmel17 to melano-

somes through the plasma membrane by AP1 and AP2: evidence

for the polarized nature of melanocytes. J Cell Sci 2006: 119:

1080–1091.

19 Nishimura E K, Jordan S A, Oshima H et al. Dominant role of the

niche in melanocyte stem-cell fate determination. Nature 2002:

416: 854–860.

20 Grichnik J M, Crawford J, Jimenez F et al. Human recombinant

stem-cell factor induces melanocytic hyperplasia in susceptible

patients. J Am Acad Dermatol 1995: 33: 577–583.

21 Horikawa T, Norris D A, Johnson T W et al. DOPA-negative melano-

cytes in the outer root sheath of human hair follicles express

premelanosomal antigens but not a melanosomal antigen or the

melanosome-associated glycoproteins tyrosinase, TRP-1, and TRP-2.

J Invest Dermatol 1996: 106: 28–35.

22 Tobin D J, Bystryn J C. Different populations of melanocytes are

present in hair follicles and epidermis. Pigment Cell Res 1996: 9:

304–310.

23 Commo S, Bernard B A. Melanocyte subpopulation turnover during

the human hair cycle: an immunohistochemical study. Pigment Cell

Res 2000: 13: 253–259.

24 Commo S, Gaillard O, Thibaut S, Bernard B A. Absence of TRP-2 in

melanogenic melanocytes of human hair. Pigment Cell Res 2004:

17: 488–497.

25 Lan C C, Wu C S, Cheng C M, Yu C L, Chen G S, Yu H S. Pigmen-

tation in basal cell carcinoma involves enhanced endothelin-1

expression. Exp Dermatol 2005: 14: 528–534.

26 Prento P, Lyon H. Commercial formalin substitutes for histopathology.

Biotech Histochem 1997: 72: 273–282.

27 Williams J H, Mepham B L, Wright D H. Tissue preparation for

immunocytochemistry. J Clin Pathol 1997: 50: 422–428.

28 Shi S R, Cote R J, Taylor C R. Antigen retrieval techniques: current

perspectives. J Histochem Cytochem 2001: 49: 931–937.

29 Shi S R, Imam S A, Young L, Cote R J, Taylor C R. Antigen retrieval

immunohistochemistry under the influence of pH using monoclonal

antibodies. J Histochem Cytochem 1995: 43: 193–201.

30 Pileri S A, Roncador G, Ceccarelli C et al. Antigen retrieval tech-

niques in immunohistochemistry: comparison of different methods.

J Pathol 1997: 183: 116–123.

31 Douwes Dekker P B, Boon M E, Vardaxis N J. Microwave immunoin-

cubations using coverplate units. Eur J Morphol 1993: 31: 298–

308.

32 Taylor C R. The total test approach to standardization of immunoh-

istochemistry. Arch Pathol Lab Med 2000: 124: 945–951.

33 Sturm R A, Teasdale R D, Box N F. Human pigmentation genes:

identification, structure and consequences of polymorphic variation.

Gene 2001: 277: 49–62.

34 Bennett D C, Lamoreux M L. The color loci of mice – a genetic cen-

tury. Pigment Cell Res 2003: 16: 333–344.

35 Matsunaga N, Virador V, Santis C et al. In situ localization of agouti

signal protein in murine skin using immunohistochemistry with an

ASP-specific antibody. Biochem Biophys Res Commun 2000: 270:

176–182.

36 Scott G, Stoler M, Sarkar S, Halaban R. Localization of basic fibro-

blast growth factor mRNA in melanocytic lesions by in situ hybridi-

zation. J Invest Dermatol 1991: 96: 318–322.

37 Fleming M G, Howe S F, Graf Jr L H. Expression of insulin-like

growth factor I (IGF-I) in nevi and melanomas. Am J Dermatopathol

1994: 16: 383–391.

38 Ciotti P, Pesce G P, Cafiero F et al. Intercellular adhesion molecule-

1 (ICAM-1) and granulocyte-macrophage colony stimulating factor

(GM-CSF) co-expression in cutaneous malignant melanoma lesions.

Melanoma Res 1999: 9: 253–260.

39 Duncan L M, Deeds J, Cronin F E et al. Melastatin expression and

prognosis in cutaneous malignant melanoma. J Clin Oncol 2001:

19: 568–576.

40 Suzuki I, Kato T, Motokawa T, Tomita Y, Nakamura E, Katagiri T.

Increase of pro-opiomelanocortin mRNA prior to tyrosinase, tyrosin-

ase-related protein 1, dopachrome tautomerase, Pmel-17/gp100,

and P-protein mRNA in human skin after ultraviolet B irradiation. J

Invest Dermatol 2002: 118: 73–78.

41 Motokawa T, Kato T, Katagiri T et al. Messenger RNA levels of mel-

anogenesis-associated genes in lentigo senilis lesions. J Dermatol Sci

2005: 37: 120–123.

42 Potterf S B, Mollaaghababa R, Hou L et al. Analysis of SOX10 func-

tion in neural crest-derived melanocyte development: SOX10-

dependent transcriptional control of dopachrome tautomerase. Dev

Biol 2001: 237: 245–257.

43 Watanabe K, Takeda K, Yasumoto K et al. Identification of a distal

enhancer for the melanocyte-specific promoter of the MITF gene.

Pigment Cell Res 2002: 15: 201–211.

44 Takada K, Sugiyama K, Yamamoto I, Oba K, Takeuchi T. Presence

of amelanotic melanocytes within the outer root sheath in senile

white hair. J Invest Dermatol 1992: 99: 629–633.

45 Suzuki I, Motokawa T. In situ hybridization: an informative tech-

nique for pigment cell researchers. Pigment Cell Res 2004: 17: 10–

14.

46 Takahashi K, Hoashi T, Yamaguchi Y et al. UV increases the nuclear

localization of apurinic/apyrimidinic endonuclease/redox effector

factor-1 in human skin. J Invest Dermatol 2006: 126: 2723–2726.

Passeron et al.

ª 2007 The Authors

170 Journal compilation ª 2007 Blackwell Munksgaard, Experimental Dermatology, 16, 162–170