Acta Biomaterialia 7 (2011) 2883–2891

Contents lists available at ScienceDirect

Acta Biomaterialia

journal homepage: www.elsevier .com/locate /actabiomat

Flexible polymeric ultrathin film for mesenchymal stem cell differentiation

Virginia Pensabene a,⇑, Silvia Taccola a,b, Leonardo Ricotti a,b, Gianni Ciofani a, Arianna Menciassi a,b,Francesca Perut c, Manuela Salerno c, Paolo Dario a,b, Nicola Baldini c,d

a Istituto Italiano di Tecnologia, Center for MicroBioRobotics @ SSSA, Pontedera, Italyb Istituto di Biorobotica, Scuola Superiore Sant’Anna, Pontedera, Italyc Laboratory for Orthopaedic Pathophysiology and Regenerative Medicine, Istituto Ortopedico Rizzoli, Bologna, Italyd Department of Human Anatomy and Musculoskeletal Pathophysiology, Università di Bologna–Alma Mater Studiorum, Bologna, Italy

a r t i c l e i n f o

Article history:Received 19 December 2010Received in revised form 3 March 2011Accepted 10 March 2011Available online 21 March 2011

Keywords:Ultrathin nanofilmMesenchymal stem cellsBone repairCell differentiationPoly (lactic) acid

1742-7061/$ - see front matter � 2011 Acta Materialdoi:10.1016/j.actbio.2011.03.013

⇑ Corresponding author. Tel.: +39 050883104; fax:E-mail address: virginia.pensabene@iit.it (V. Pensa

a b s t r a c t

Ultrathin films (also called nanofilms) are two-dimensional (2-D) polymeric structures with potentialapplication in biology, biotechnology, cosmetics and tissue engineering. Since they can be handled inliquid form with micropipettes or tweezers they have been proposed as flexible systems for cell adhesionand proliferation. In particular, with the aim of designing a novel patch for bone or tendon repair andhealing, in this work the biocompatibility, adhesion and proliferation activity of Saos-2, MRC-5 andhuman and rat mesenchymal stem cells on poly(lactic acid) nanofilms were evaluated. The nanofilmsdid not impair the growth and differentiation of osteoblasts and chondrocytes. Moreover, nanofilm adhe-sion to rabbit joints was evident under ex vivo conditions.

� 2011 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

1. Introduction

Ultrathin polymeric films (also called ‘‘nanofilms’’) are quasi-two-dimensional (2-D) structures, characterized by a thickness often to hundreds of nanometers and a surface area of several squarecentimeters. Nanofilms have been studied for biomedical applica-tion as thin coatings on prostheses [1], as soft patches for cosmeticuse [2], and as innovative alternatives to traditional wire for sutur-ing wounds in open and minimally invasive surgery [3–5].

The successful design and development of a substrate for tissueregeneration should follow some basic requirements: the fabrica-tion process has to be highly versatile and controlled, a wide rangeof biocompatible materials should be available, while the struc-tural properties of the final substrate, including the mechanical,morphological, and chemical properties, must be tunable andadequate for the specific cell or tissue type.

Among techniques for the fabrication of thin films with nano-metric precision, the Langmuir–Blodgett (LB) method and self-assembling monolayers (SAMs) are noteworthy. As mentioned inTang et al. [1], even if control of the film thickness and the arrange-ment of the molecules are highly accurate, the constraints in termsof materials and limited stability raise the necessity of an easierand more versatile deposition method. Spin coated assisteddeposition, achieved with a single and basic microfabrication

ia Inc. Published by Elsevier Ltd. A

+39 050883497.bene).

instrument, the spin coater, is suited to producing nanofilms of sin-gle or multiple polymer layers [6]. Interestingly, 100 nm thick filmscan be prepared by casting and spinning a liquid solution of poly-mer on a silicon wafer covered with a water soluble layer (sacrifi-cial layer) [7]. This step allows the film to be detached from thesubstrate in water, to give a free-standing film easily handled withtraditional pipettes or syringes. An important issue is the possibil-ity of correlating the preparation process parameters with the finalfeatures of the nanofilm, e.g. the thickness, which depends on theselected spinning speed and time and on the solution concentra-tion [8]. In our previous studies poly(lactic acid) films have beentested as soft polymeric structures to be coupled with contractilecells [9]. Adhesion, proliferation and early differentiation ofC2C12 cells on these films were assessed. The evidence representsa first step towards the use of nanofilms as a building block of aninnovative hybrid structure, with contractility conferred by differ-entiated muscle cells [10].

An intriguing application of polymeric nanofilms is tissueregeneration, suggested by the possibility of manipulating andinjecting regenerative films into a damaged tissue using a needle.Due to the fabrication procedure, nanofilms can be considerednot only as a simple single layer coatings of substrates for biomed-ical devices, but can also be employed as flexible free-standingmembranes to be moved and released in liquid environments, oras nanometric plasters coupled with a supporting layer that allowsmanipulation in the dry state and deposition of the nanofilm onwet surfaces. This could be the case for bone or tendon lesions,

ll rights reserved.

2884 V. Pensabene et al. / Acta Biomaterialia 7 (2011) 2883–2891

where the inserted biocompatible ultrathin film could work as adrug carrier or as a scaffold for the tissue regeneration, favoringthe migration, growth and differentiation of cells.

Within this framework we have examined the in vitro behaviorof four different cell types, Saos-2, MRC-5 and human and rat mes-enchymal stem cells (MSC). Saos-2 cells are osteosarcoma bone-forming cells characterized by a mature osteoblast phenotypeand are widely used as models to investigate bone cell differentia-tion, proliferation and metabolism [11]. MRC-5 cells are humanfibroblasts, extensively used in biocompatibility testing of materi-als for tissue engineering [12–14]. MSC are multipotent progenitorcells, the plasticity and self-renewal capacity of which have gener-ated significant interest for application in tissue regeneration, dueto the ability to differentiate along tissue-specific lineages andsecretory activity at the site of tissue repair [15,16]. Human MSCare thought to have the potential to differentiate into multiple lin-eages, including bone, cartilage, muscle, tendon, ligament, fat and avariety of other connective tissues [17,18]. The complex interac-tions between MSC and polymeric materials have been analyzedin several studies [19–21]. MSC sensitively react to any chemical/topographical change in the surface [22], as usually occurs withprimary cells. The scaffold chemistry, geometry and manufacturingprocess play a pivotal role in directing MSC growth towards theosteoblast or the chondrocyte phenotype [23–25].

This study examines the use of PLA nanofilms produced by spincoated assisted deposition as substrates on which to culture sev-eral cell types in vitro. In order to correlate the film properties withthe cellular behavior a deep characterization is provided and theinteractions between the film surface and Saos-2 and MRC-5 cellsand MSC are evaluated. Finally, the adhesion of PLA nanofilms toexcised rabbit tissues has been studied.

2. Materials and methods

2.1. Nanofilm preparation and methods for characterization

The technique for synthesizing free-standing polymeric nano-films is spin coated assisted deposition [5]. Briefly, 1 cm2 supportswere cut from a silicon wafer (Si-Mat Silicon Materials, Landsbergam Lech, Germany) using a diamond blade, cleaned for 10 minwith a mixture of sulfuric acid and hydrogen peroxide (3:1) andthen rinsed with deionized water. In order to avoid contamination,all preparation of polymeric nanofilms fabrication was carried outin a class 1000 clean room. A 1 wt.% poly(vinyl alcohol) (PVA)(average Mw 13,000–23,000, 98% hydrolyzed, Sigma–Aldrich)aqueous solution was deposed by spin coating on the silicon wafer(4000 r.p.m.) forming the sacrificial layer. A 2 wt.% solution ofpoly(lactic acid) (PLA) (Mw �60,000, Sigma–Aldrich) in dichloro-methane was then spin-coated onto the first layer. After dryingthe sample (at 80 �C for 1 min) the PVA sacrificial layer was dis-solved in water, thus releasing the free-standing PLA nanofilm inliquid.

The film thickness and the surface roughness were measured byatomic force microscopy (AFM) (Veeco Innova Scanning ProbeMicroscope), collecting and drying the suspended films onto aclean silicon wafer. Thickness values were obtained by AFMcross-sectional analysis of the nanofilm edge (SPMLab software v.5.01) performed in tapping mode, with oxide sharpened siliconprobes (RTESPA-CP) at a resonant frequency of �300 kHz. Surfaceaverage roughness was evaluated on images over a scan area of100 lm2. The mechanical properties of the single layer nanofilmswere evaluated by a bulge test, as described in the literature[26]. The values of stress (r), strain (e) and elastic modulus (E)for the nanofilm were determined considering a geometrical corre-lation [3] and using the equation:

r ¼ Pa2

4hd; e ¼ 2d2

3a2 ; E ¼re

ð1Þ

where P is the applied pressure, a is the radius of the portion of filmunder test (3 mm), h is the nanofilm thickness and d is the deflec-tion of the nanofilm. The elastic modulus was evaluated consideringthe initial linear portion of the stress–strain curve.

The hydrophobic properties of the nanofilm surface wereassessed by static water contact angle measurements using thesessile drop technique. Droplets (5 ll) of ultra-pure deionizedwater were placed, using a calibrated micropipette, on the sur-face–air interface of the samples under environmental conditionsand observed with an optical microscope. The contact angle wascalculated assuming that the drop profile is represented by a partof a circle of defined radius and center. Measuring the length ofthe chord c (the baseline of the drop) and the height of the drophd, the value of the contact angle h was determined using the sim-ple geometrical correlation (tan(/2) = c/hd) [27]. This formula givesa value of h in agreement with the most common definition of theangle between a solid sample surface and a tangent to the dropletovate shape at the edge of the droplet.

2.2. Cell culture and assays for adhesion, proliferation anddifferentiation

2.2.1. Cell culture and seeding on nanofilmsSaos-2 (Istituto Zooprofilattico, Brescia, Italy) and MRC-5

(ATCC, Manassas, VA) cells were cultured in Iscove’s modifiedDulbecco’s medium (IMDM) and Dulbecco’s modified Eagle’smedium (DMEM), respectively, supplemented with 10 vol.%heat-inactivated fetal bovine serum (FBS), 1% penicillin–strepto-mycin and 2 mM L-glutamine in a 5% CO2 humidified atmosphereat 37 �C. Rat MSC (passage 2) were purchased from Lonza (Hopk-inton, MA) and cultured in DMEM supplemented with 10 vol.%heat-inactivated FBS, 100 IU ml�1 penicillin, 100 IU ml�1 strepto-mycin and 2 mM L-glutamine in a 5% CO2 humidified atmosphereat 37 �C. Human MSC were isolated from bone marrow samplesharvested from the medullary cavities of patients undergoing to-tal hip replacement, following local ethical research committeeapproval and informed consent. Freshly isolated human MSCwere maintained in a minimum essential medium (a-MEM) sup-plemented with 10 vol.% heat-inactivated FBS, 1% penicillin–streptomycin (basal medium). Prior to cell seeding sterilizationof the PLA films was performed by UV treatment for 45 min, fol-lowed by soaking in 1% antibiotic/antimycotic solution for 1 h.Saos-2 and MRC-5 cells and human and rat MSC were seeded atdensities of 4 � 104, 8 � 104, 2 � 105 and 2.5 � 104 cells cm�2,respectively. Briefly, 20 ll of cell suspension was added to thesamples and incubated at room temperature for 10 min, followedby incubation at 37 �C for 15 min in a wet chamber to allow cellattachment. One millilitre of basal medium was then added to thewell of a 6-well plate. As a control, 104 cells cm�2 rat MSC wereseeded on polystyrene (PS) wells. After 24 h the osteogenic andchondrogenic potential of MSC was induced using osteogenicmedium (a-MEM supplemented with 10% FBS, 50 lg ml�1 ascor-bate 2-phosphate, 10�8 M dexamethasone) or chondrogenic med-ium (serum-free a-MEM supplemented with 1% ITS + 3 LiquidMedia Supplement (Sigma, St Louis, MO), 100 lg ml�1 pyruvate,50 lg ml�1 ascorbate 2-phosphate, 10�7 M dexamethasone,10 ng ml�1 transforming growth factor b3).

2.2.2. Cell adhesion, morphology, and growth on nanofilmsCell adhesion to and density on PLA films were assessed using

a conventional inverted microscope (Nikon TE 2000-S). The cyto-skeleton of cells grown on films was stained with rhodamine–phalloidin [25] and visualized by fluorescence microscopy (Nikon

V. Pensabene et al. / Acta Biomaterialia 7 (2011) 2883–2891 2885

Eclipse E800). In order to highlight the membrane without cellfixation rapid staining of rat MSC was obtained by adding calceinacetoxymethylester (calcein AM, Invitrogen Carlsbad, CA). Briefly,72 h after cell seeding both PLA nanofilms and PS control sampleswere rinsed with phosphate-buffered saline (PBS) and treated for10 min at 37 �C with 2 lm calcein AM in PBS. Cells were finallyobserved with a fluorescence microscope.

MRC-5 cells grown on PLA films were fixed with 3% paraformal-dehyde in PBS for 15 min and permeabilized with 0.5% TritonX-100 in PBS for 5 min. Cells were stained for smooth muscle a-ac-tin (a-SMA) (anti-a-SMA, Sigma), with TRITC-conjugated rabbitanti-mouse IgG (Dako, Glostrup, Denmark) used as secondaryantibody.

DNA content was measured using a Quant-iT dsDNA PicoGreenkit (Invitrogen) according to the manufacturer’s protocol. Briefly,40 ll of ddH2O was added to each film/cell sample at the 24 hand 8 day time points. The samples were frozen, defrosted andthen vortexed. Equal quantities of the sample and PicoGreen dyewere added to a 96-well plate and incubated in the dark at roomtemperature for 15 min. A standard curve of 0–1 lg ml�1 DNAwas utilized. Samples and the standard curve were read in a fluo-rescence plate reader (Cytofluor 2350 fluorimeter) at 485 nm exci-tation and 535 nm emission.

Cell metabolic activity of rat MSCs on PLA nanofilms and on PSwas evaluated after 72 h culture with the WST-1 metabolic test(2-(4-iodophenyl)-3-(4-nitophenyl)-5-(2,4-disulfophenyl)-2H-tet-razoilium monosodium salt, provided as a pre-mix electro-couplingsolution by BioVision). Briefly, after rinsing the samples with PBS,500 ll of culture medium supplemented with 50 ll of WST-1reagent (1 mg ml�1, Invitrogen) were added to each sample,90 min before the 72 h time point. After incubation for 90 min at37 �C three aliquots (100 ll each) of medium were taken from eachsample and put in three different wells of a 96-wells plate. Absor-bance at 450 nm was read with a microplate reader (Victor3, PerkinElmer).

Table 1Real time polymerase chain reaction primers used in this study.

Primer Forward (50–30) Reverse (50–30)

BGLAP GGCGCTACCTGTATCAATGG TCAGCCAACTCGTCACAGTCCOL1A1 CCCCTGGAAAGAATGGAGAT AATCCTCGAGCACCCTGASOX9 GTACCCGCACTTGCACAAC TCGCTCTCGTTCAGAAGTCTCACAN TCACCAGTGAGGACCTCGT GGCGGTAGTGGAAGACGACPOSTN ATGGGAGACAAAGTGGCTTC CTGCTCCTCCCATAATAGACTCA

Fig. 1. (a) AFM image of the nanofilm edge (height channel, scan window 50 � 50 lm) uused to measure surface roughness by software analysis.

2.2.3. Human MSC differentiationThe expression of osteoblast- and chondrocyte-related genes

was assessed by real time polymerase chain reaction (PCR). TotalRNA was extracted at 8 days, reverse transcribed and the expressionof mRNA for BGLAP (NM_199173.2), COL1A1 (NM_000088.3), SOX9(NM_000346.3), ACAN (NM_013227.2) and POSTN (NM_006475.1)was evaluated using a Light Cycler instrument (Roche Diagnostics),amplifying 1 lg of cDNA, and the Universal Probe Library (RocheApplied Science). Probes and primers were selected using web-based assay design software (ProbeFinder http://www.rocheap-plied-science.com) and are reported in Table 1.

The protocol for amplification was as follows: 95 �C for 10 min;95 �C for 10 s, 60 �C for 30 s and 72 �C for 1 s for 45 cycles; 40 �C for30 s. The results were expressed as the ratio between the gene ofinterest and the GAPDH reference gene.

In order to induce calcium phosphate deposition 10 mM b-glyc-erophosphate (Sigma) was added to the medium 7 days after cellseeding on PLA films. After 10 days the mineral nodules werestained with Alizarin Red dye [28].

2.2.4. Ex vivo adhesion testEx vivo experiments were carried out using freshly excised rab-

bit tissues gathered from a slaughterhouse on the same days as thetrials. After an incision in the posterior leg the femur and ligamentwere exposed, gently removing blood from the operative area,while preserving the wet condition of the specimen. PLA nanofilms,detached from the wafer and free-standing in water, were aspi-rated and deployed directly onto the target tissues using a glassPasteur pipette and the excess water removed with blotting paper.The experiment was repeated three times for each tissue.

3. Results

3.1. Nanofilm characterization

Six samples were prepared and used to characterize the nano-film properties. The average thickness of the film, assessed byAFM analysis, was measured as the height profile of the edge(Fig. 1a). For the selected preparation parameters (2 wt.% PLA,20 s spinner rotation at 4000 r.p.m.) the final value was320 ± 27 nm.

Fig. 1b shows a topographical image of a square area of50 � 50 lm. The typical surface morphology of the PLA nanofilmshowed a remarkably crystalline structure of the assembledpolymer, which could be due to the final evaporation step on a

sed for the cross-sectional analysis of nanofilm thickness; (b) topographical image

2886 V. Pensabene et al. / Acta Biomaterialia 7 (2011) 2883–2891

hotplate. This profile is homogeneous and recurs over the entiresurface of the nanofilm. The average surface roughness variesaround 15 ± 2 nm, and can be correlated with the fabrication pro-cedure, in particular with the polymer concentration and viscosity.

Characterization of the film was completed with measurementof the elastic modulus, performed by bulge test experiments(Fig. 2a) which revealed an average value of 136 ± 44 MPa.

To determine the superficial properties of the PLA nanofilmswater contact angle measurements were performed, giving a valueof h = 79 ± 2� (Fig. 2b). This value suggests a low degree of wetting,

Fig. 2. (Top) Bulge test. A PLA nanofilm floating in water was removed and dried ona steel plate with a circular hole in the middle. Air pressure was applied from theback through the hole. The applied pressure was monitored by a digital manometerand deflection of the nanofilm was observed with an optical microscope, untildistortion was apparent and the deflection was measurable. (Bottom) The sessiledroplet method for measuring the hydrophobic properties of the PLA surface. Thecontact angle is highlighted in red.

Fig. 3. Nanofilm preparation and handling. After release from the polymeric solution, thelayer. It is then transferred for cell seeding in culture medium by aspiration with a micropthe film is finally ready for transfer or injection using a needle. As shown, the structure

confirming the hydrophobic properties of the PLA nanofilm, whichcan be directly observed when the PVA sacrificial layer is dissolvedin water.

The measured structural properties of the nanofilms in terms ofthickness, elasticity and transparency allow the basic steps re-quired for cell culture and make their manipulation feasible. Asshown in Fig. 3, once the nanofilm is prepared and dried it canbe detached from the wafer support by dissolving the PVA sacrifi-cial layer and thus be prepared for cell seeding by soaking in anaqueous antibiotic solution. In this step the nanofilm loses itshydrophobic nature and can be immersed in the liquid volume.This effect can be explained by changes in the electrostatic andVan der Waals forces affecting the nanofilm surface. Once free inthe culture medium the nanofilm can be transferred to the mostappropriate plate for cell seeding, allowing all the required ana-lyzes to be performed. Moreover, given the free-standing state ofthe nanofilm, the observable cell behavior is not affected by theproperties of bulk or supporting materials. As shown in the follow-ing section, the thin film is transparent and thus allows opticalobservation of the cultured cell.

3.2. Cell–composite interactions

Saos-2 cells attached to (Fig. 4a) and spread on (Fig. 4c) the filmsurface, on which they appear polygonal shaped and flattened. Theability of Saos-2 cells to proliferate on PLA film has been demon-strated by an increase in DNA level on day 8 (Fig. 4b). Rhoda-mine–phalloidin staining showed the cytoskeletal organization,with well-defined actin filaments and marked stress fibers ori-ented along the principal axis of the cell (Fig. 4c). Maintenance ofthe osteoblast phenotype on the PLA film was confirmed by theability of Saos-2 cells to deposit calcium phosphate, as shown byAlizarin Red staining (Fig. 4d).

Following the same protocol, MRC-5 adhesion and proliferationon the PLA film were assessed, as shown in Fig. 5a and b. Onceadhesion to the film was completed the cytoskeletal arrangementwas observed by detection of F-actin, as shown in Fig. 5c. Theinduction of a-SMA, a marker of myofibroblastic MRC-5 cells, isshown in Fig. 5d.

Cell staining with calcein of rat MSC cultured for 3 daysrevealed cell adherence and spreading on both the PS controlsand PLA substrates (Fig. 6).

film is formed by spin coating and then detached by dissolution of the PVA sacrificialipette. After the manipulation steps required for cellular growth and differentiationcan be moved between different dishes without damaging the nanofilm.

Fig. 4. Saos-2 cells grown on PLA nanofilm. (a) Adhesion and density after 72 h (representative picture obtained by conventional inverted microscopy, scale bar 100 lm); (b)DNA content; (c) cytoskeleton morphology stained with rhodamine–phalloidin (representative picture, scale bar 10 lm); (d) mineral nodule formation stained with AlizarinRed dye (representative picture, scale bar 100 lm).

Fig. 5. MRC-5 cells grown on PLA nanofilm. (a) Adhesion and density at 72 h representative picture obtained by conventional inverted microscopy, scale bar 50 lm; (b) DNAcontent; (c) cytoskeleton morphology stained with rhodamine–phalloidin representative picture, scale bar 20 lm; (d) a-SMA expression determined by immunofluorescentstaining (representative picture, scale bar 10 lm).

V. Pensabene et al. / Acta Biomaterialia 7 (2011) 2883–2891 2887

As shown by the quantitative measurements assessed with thePico-Green and WST-1 tests, no differences in DNA content and

metabolic activity were observed between rat MSC cultured onPLA and those cultured on PS plates (Fig. 7). Such results are a first

Fig. 6. Fluorescence images of rat mesenchymal stem cells stained with calcein after 72 h culture on (A) standard PS plates and (B) PLA nanofilms. Scale bar 100 lm.

Fig. 7. Rat mesenchymal stem cells after 72 h culture on PLA nanofilms and on standard PS plates. (a) Proliferation assessment by dsDNA quantification and (b) metabolicactivity evaluation using the WST-1 test.

Fig. 8. Human MSC adhesion on day 8 on the PLA nanofilm in (a) basal, (b) osteogenic and (c) chondrogenic medium. (d) DNA content of MSC grown on the PLA nanofilm inbasal, osteogenic and chondrogenic medium.

2888 V. Pensabene et al. / Acta Biomaterialia 7 (2011) 2883–2891

demonstration of the capability of PLA nanofilms to support adhe-sion, growth and metabolic activity, and constitute the basis for thefollowing experiments on human primary cells.

Adhesion of human MSC under non-differentiating (Fig. 8a),osteogenic (Fig. 8b) and chondrogenic (Fig. 8c) conditions wasdemonstrated on day 8, although a lower number of cells was ob-served in the latter case. An increase in proliferation levels was also

measured in all cases, as quantitatively shown by DNA measure-ments at 24 h and 8 days (Fig. 8d). The highest levels of cell prolif-eration on day 8 were detected under osteogenic conditions.

The ability of PLA films to support human MSC differentiationalong the osteogenic and chondrogenic lineages was confirmedby the expression of osteoblast- and chondrocyte-related genes(Fig. 9). The results obtained for cells seeded on PS dishes and

Fig. 9. Characterization of the osteoblast and chondrogenic differentiation of isolated cultures of human MSC. Real time PCR analysis of (a) BGLAP, POST and (b) COL1A1mRNA normalized to ACTB mRNA expression in MSC in osteogenic medium vs. the control (basal medium). Real time PCR analysis of (c) SOX9 and (d) ACAN mRNAnormalized to ACTB mRNA expression in MSC seeded in chondrogenic medium vs. the control (basal medium).

Fig. 10. Mineral nodule formation by human MSC cultured on the PLA nanofilmstained with Alizarin Red dye (representative picture, scale bar 100 lm).

V. Pensabene et al. / Acta Biomaterialia 7 (2011) 2883–2891 2889

cultured in differentiation medium are not reported as no signifi-cant differences were observed compared with the free-standingpolymeric substrates.

The bone-relevant markers BGLAP, POSTN, and COL1A1 wereexpressed at higher levels in human osteoblasts compared withundifferentiated MSC. SOX9, which plays a crucial role in boneand cartilage formation and chondrocytic differentiation, andaggrecan (ACAN), related to the chondrocyte phenotype, were ex-pressed at a higher level in MSC differentiated along the chondro-cyte lineage. Finally, calcium deposition was shown by Alizarin Redstaining in human MSC grown for 14 days on PLA films under oste-ogenic conditions (Fig. 10). This result confirms the ability of thePLA film to support the late osteoblast differentiation stage of hu-man primary cells.

Deployment of the nanofilm on joints was performed ex vivo ina rabbit model, typically used to test novel materials and proce-

dures for tendon or bone injury repair and healing [29,30]. Afterexposing the femur and ligament, first evidence of tight adhesionwas observed (Fig. 11). The nanofilm was spread on the tissue sur-faces, following the morphology of the bone without folds orbreaks. The absorption of excess water with blotting paper wassufficient to dry the tissue and nanofilm and did not impair nano-film adhesion and stability.

4. Discussion

In the development of materials and substrates that interactwith cells, particularly related to bone defect filling and tissuerepair systems, basic cellular events have to be checked in vitroat first, on differentiated osteoprogenitor cells and osteoblasts.First, cell adhesion should be tight, since it is the first cellular eventon contact between the cells and the substrate and it influences thefollowing proliferation and differentiation. The nanometric fea-tures of the PLA film substrate examined here do not exceed15 nm (measured as maximum peak height) on average and thusdo not hinder initial cell contact and spreading. Moreover, the lit-erature contains reports of good adhesion of different kinds of cellsto materials having average roughness values below hundreds ofnanometers [31,32]. These sizes are in fact typical of the constitu-ent molecules of the extracellular matrix (ECM), from collagen(1.5 nm) up to fibrils with diameters of 200–400 nm.

A second critical requirement for the nanofilm is that itsupports cell adhesion, viability and proliferation, which has beenproven with Saos-2 and MRC-5 cells and both rat and human MSC.Furthermore, differentiation should not be adversely affected. MSCcultured on nanofilms under osteogenic or chondrocyte lineagedifferentiation conditions exhibit an increase in the expression ofspecific markers of the mature phenotype. From these data wecan conclude that the PLA nanofilms do not have a negative influ-ence on cell behavior, resulting in undifferentiated and differenti-ated cells maintaining or assuming the characteristics ofmetabolically active osteoblasts, also showing calcium phosphatedeposition.

Fig. 11. Ex vivo adhesion tests on excised tissue. PLA nanofilms attached to and spread on (a) ligament and (b) exposed femur.

2890 V. Pensabene et al. / Acta Biomaterialia 7 (2011) 2883–2891

Due to the production process, the roughness and thickness ofthe nanofilm can be controlled, and thus the elastic modulus canbe tuned. The hydrophobicity of the film before detachment fromthe wafer should have a negative value for cell adhesion. At thesame time it is a key feature in improving and promoting proteinaffinity for the polymeric surface. After several washing steps withantibiotic solution and complete culture medium the film becomesfree-standing and can be suspended in a Petri dish. No addition ofadhesive proteins is required to trigger cell attachment to thenanofilm.

Different and more suitable biomaterials can be selected forusing nanofilm as scaffold for those cells with the essential speci-fication that they are soluble so that they can be spun. Naturalcomponents of the ECM could represent interesting alternatives,including collagen and hyaluronic acid, in order to produce a bio-compatible and absorbable nanofilm.

Moreover, not limiting the use of these films to in vitro condi-tions, implantation of these novel structures could be fostered forbone and tendon repair. As single layer polymeric structures nano-films have the unique propriety of injectability, which allows aminimally invasive surgical procedure for implantation. Withinthis framework the elastic modulus values suggest a high resis-tance of the nanofilm to applied forces, which can be exploitedin areas such as the muscular and skeletal systems, where mechan-ical stimuli are high and continuous. Moreover, since adhesion ofthe film to different tissues has already been assessed in vivo[2,3], in this work adhesion was tested considering the possibilityof implanting the polymeric film as a patch or scaffold in the treat-ment of severed or crushed tendons and ligaments. In parallel,since several studies have reported the successful implantation ofhydrogels and polymers encapsulating stem cells to replace degen-erate condyles or to regenerate synovial joints [33,34], the use ofnanofilms covered with adherent cells can be proposed. Becauseof their almost two-dimensional structure nanofilms favor the for-mation of layers of new cells, providing the appropriate mechani-cal support for cell growth. In this way implanted cells,differentiated along the chondrogenic and osteogenic lineages,could allow histogenesis of cartilaginous and osseous phenotypes,while the biocompatible scaffold can be gradually adsorbed by thetissue. Furthermore, drugs and specific molecules can be loaded onthe polymeric structure. Following this strategy, active compo-nents, such as piezoelectric nanoparticles, could be also insertedinto the matrix or bound on the surface in order to obtain wirelessactivation of the implanted film, and thus stimulation of the tissueto be regenerated.

5. Conclusions

The peculiar structural properties of a polymeric PLA nano-film have been analyzed and described in this work, enabling

its potential exploitation in cell culture procedures. The data pre-sented suggest that both immortalized cell lines and primarycells cultured on the polymeric films exhibit good morphologicaland metabolic features and the ability to fully differentiate. Itshould be noted that the reported structural features of PLAnanofilms fulfill important requirements of suitable scaffoldsfor tissue regeneration.

Jointly with our previous studies, the present results are prom-ising for the design of ultrathin films as substrates for cell cultureor as basic building blocks for scaffolds in autologous cell-basedskeletal tissue engineering.

Acknowledgements

The work was funded by the Istituto Italiano di Tecnologia andwas carried on in collaboration with the Istituto Ortopedico Rizzoli,Bologna, Italy. The authors would like to thank Prof. Shinji Takeoka,School of Science and Engineering, Waseda University (TWIns),Tokyo, Japan, for support during the early phase of researchactivity on nanofilms. In addition, they wish to thank Mr CarloFilippeschi for his technical support during the clean roomactivities.

References

[1] Tang Z, Wang YL, Podsiadlo P, Kotov NA. Biomedical applications of layer-by-layer assembly: from biomimetics to tissue engineering. Adv Mater2006;18:3203–24.

[2] Fujie T, Okamura Y, Takeoka S. Ubiquitous transference of a free-standingpolysaccharide nanosheet with the development of a nano-adhesive plaster.Adv Mater 2007;19:3549–53.

[3] Fujie T, Matsutani N, Kinoshita M, Okamura Y, Saito A, Takeoka S. Adhesive,flexible, and robust polysaccharide nanosheets integrated for tissue-defectrepair. Adv Funct Mater 2009;19:2560–8.

[4] Okamura Y, Kabata K, Kinoshita M, Saitoh D, Takeoka S. Free-standingbiodegradable poly(lactic acid) nanosheet for sealing operations in surgery.Adv Mater 2009;21:4388–92.

[5] Pensabene V, Mattoli V, Fujie T, Menciassi A, Takeoka S, Dario P. Magneticnanosheet adhesion to mucosal tissue. In: Proceedings of the ninthinternational conference on nanotechnology, IEEE Nano 2009, Piscataway, NJ,USA: IEEE Press; 2009. p. 403–407.

[6] Jiang C, Markutsya S, Tsukruk VV. Collective and individual plasmonresonances in nanoparticle films obtained by spin-assisted layer-by-layerassembly. Langmuir 2004;20:882–90.

[7] Mattoli V et al. Fabrication and characterization of ultra-thin magnetic filmsfor biomedical applications. Procedia Chemistry 2009;1:28–31.

[8] Zhao Y, Marshall JS. Spin coating of a colloidal suspension. Phys Fluids2008;20(4):043302–43317.

[9] Ricotti L, Taccola S, Pensabene V, Mattoli V, Fujie T, Takeoka S, et al. Adhesionand proliferation of skeletal muscle cells on single layer poly(lactic acid) ultra-thin films. Biomed Microdevices 2010;12:809–19.

[10] Feinberg W, Feigel A, Shevkoplyas SS, Sheehy S, Whitesides GM, Parker KK.Muscular thin films for building actuators and powering devices. Science2007;317(5843):1366–70.

[11] Ahmad M, McCarthy M, Gronowicz G. An in vitro model for mineralization ofhuman osteoblast-like cells on implant materials. Biomaterials1999;20(3):211–20.

V. Pensabene et al. / Acta Biomaterialia 7 (2011) 2883–2891 2891

[12] Ignjatovic N, Ninkov P, Kojic V, Bokurov M, Sridic V, Krnojelac D, et al.Cytotoxicity and fibroblast properties during in vitro test of biphasic calciumphosphate/poly-DL-lactide-co-glycolide biocomposites and differentphosphate materials. Microsc Res Techniq 2006;69(12):976–82.

[13] Campillo-Fernández AJ, Unger RE, Peters K, Halstenberg S, Santos M, SalmerónSánchez M, et al. Analysis of the biological response of endothelial andfibroblast cells cultured on synthetic scaffolds with various hydrophilic/hydrophobic ratios: influence of fibronectin adsorption and conformation.Tissue Eng Part A 2009;15(6):1331–41.

[14] Jacobs JP, Jones CM, Baille JP. Characteristics of a human diploid cell designatedMRC-5. Nature 1970;227:168–70.

[15] Caplan AI. Review: mesenchymal stem cells: cell-based reconstructive therapyin orthopedics. Tissue Eng 2005;11(7/8):1198–211.

[16] Caplan AI. New era of cell-based orthopedic therapies. Tissue Eng Part BReviews 2009;15(2):195–200.

[17] Pittenger MF, Mackay AM, Beck SC, Jaiswal RK, Douglas R, Mosca JD, et al.Multilineage potential of adult human mesenchymal stem cells. Science1999;284:143–7.

[18] Minguell JJ, Erices A, Conget P. Mesenchymal stem cells. Exp Biol Med2001;226:507–20.

[19] Schneider RK. The osteogenic differentiation of adult bone marrow andperinatal umbilical mesenchymal stem cells and matrix remodelling in three-dimensional collagen scaffolds. Biomaterials 2010;31:467–80.

[20] Chan CK, Liao S, Li B, Lareu RR, Larrick JW, Ramakrishna S, et al. Biomed Mater2009;4:35.

[21] Shi X, Wang Y, Ren L, Huang W, Wang DA. A protein/antibiotic releasingpoly(lactic-co-glycolic acid)/lecitin scaffold for bone repair applications. Int JPharm 2009;21:85–92.

[22] Kilpadi K, Sawyer AA, Prince CW, Chang PL, Bellis SL. Primary human marrowstromal cells and Saos-2 osteosarcoma cells use different mechanisms toadhere to hydroxylapatite. J Biomed Mater Res 2004;68:273–85.

[23] Chung C, Burdick JA. Influence of three-dimensional hyaluronic acidmicroenvironments on mesenchymal stem cell chondrogenesis. Tissue EngPart A 2009;15:243–54.

[24] Mendonca G, Mendonca DB, Simoes LG, Araujo AL, Leite ER, Duarte WR, et al.Nanostructured alumina-coated implant surface: effect on osteoblast-relatedgene expression and bone-to-implant contact in vivo. Int J Oral MaxillofacImplants 2009;24:205–15.

[25] Marletta G, Ciapetti G, Satriano C, Perut F, Salerno M, Baldini N. Improvedosteogenic differentiation of human marrow stromal cells cultured on ion-induced chemically structured poly-epsilon-caprolactone. Biomaterials2007;28:1132–40.

[26] Huang CK, Lou WM, Tsai CJ, Wu TC, Lin HY. Mechanical properties of polymerthin film measured by the bulge test. Thin Sol Films 2007;515(18):7222–6.

[27] Butt HJ, Graf K, Kappl M. Physics and chemistry of interfaces. Weinheim: Wiley–VCH; 2004.

[28] Cenni E, Perut F, Ciapetti G, Savarino L, Dallari D, Cenacchi A, et al. In vitroevaluation of freeze-dried bone allografts combined with platelet rich plasmaand human bone marrow stromal cells for tissue engineering. J Mater SciMater Med 2009;20:45–50.

[29] Chong AK, Ang AD, Goh JC. Bone marrow derived mesenchymal stem cellsinfluence early tendon healing in a rabbit Achilles tendon model. J Bone JointSurg 2007;89:74–81.

[30] Rosenbaum AJ, Grande DA, Dines JS. Review–the use of mesenchymal stem cellsin tissue engineering–a global assessment. Organogenesis 2008;4(1):23–7.

[31] Gentile F, Tirinato L, Battista E, Causa F, Liberale C, di Fabrizio EM, et al. Cellspreferentially grow on rough substrates. Biomaterials 2010;31:7205–12.

[32] Raffa V, Pensabene V, Menciassi A, Dario P. Design criteria of neuron/electrodeinterface. The focused ion beam technology as an analytical method toinvestigate the effect of electrode surface morphology on neurocompatibility.Biomed Microdevices 2007;9:371–83.

[33] Lee CH, Cook JL, Mendelson A, Moioli EK, Yao H, Mao JJ. Regeneration of thearticular surface of the rabbit synovial joint by cell homing: a proof of conceptstudy. Lancet 2010;376(9739):440–8.

[34] Spadaccio C, Rainer A, Trombetta M, Vadalá G, Chello M, Covino E, et al. Poly-L-lactic acid/hydroxyapatite electrospun nanocomposites induce chondrogenicdifferentiation of human MSC. Ann Biomed Eng 2009;37(7):1376–89.