Fa

HPa

b

c

d

e

a

ARRA

KBASHF

1

Sttldquodta

MmeA

0d

Annals of Anatomy 194 (2012) 138ndash 145

Contents lists available at ScienceDirect

Annals of Anatomy

journa l h o mepage wwwelsev ier de aanat

inding the founder of Stockholm ndash A kinship study based on Y-chromosomalutosomal and mitochondrial DNA

elena Malmstroumlmalowast Maria Vretemarkb Andreas Tillmarc Mikael Brandstroumlm Durlingdontus Skoglunda M Thomas P Gilberte Eske Willersleve Gunilla Holmlundc Anders Goumltherstroumlma

Department of Evolutionary Biology Norbyvaumlgen 18D SE-752 36 Uppsala SwedenVaumlstergoumltlands Museum Box 253 SE-532 23 Skara SwedenNational Board of Forensic Medicine Department of Forensic Genetics and Forensic Toxicology Artillerigatan 12 SE-587 58 Linkoumlping SwedenDepartment of Forest Mycology and Pathology Swedish University of Agricultural Sciences Box 7026 SE-750 07 Uppsala SwedenCentre for GeoGenetics Natural History Museum of Denmark University of Copenhagen Oslashster Voldgade 5-7 1350 Copenhagen Denmark

r t i c l e i n f o

rticle historyeceived 31 December 2010eceived in revised form 27 March 2011ccepted 27 March 2011

eywordsirger jarlncient DNANPsVS1LX sequencing

s u m m a r y

Historical records claim that Birger Magnusson (died 1266) famous regent of Sweden and the founderof Stockholm was buried in Varnhem Abbey in Vaumlstergoumltland After being lost for centuries his putativegrave was rediscovered during restoration work in the 1920s Morphological analyses of the three indi-viduals in the grave concluded that the older male the female and the younger male found in the gravewere likely to be Birger his second wife Mechtild of Holstein and his son Erik from a previous marriageMore recent evaluations of the data from the 1920s seriously questioned these conclusions ultimatelyleading to the reopening and reexamination of the grave in 2002 Ancient DNA-analyses were performedto investigate if the relationship between the three individuals matched what we would expect if theindividuals were Birger Erik and Mechtild We used pyrosequencing of Y-chromosomal and autosomalSNPs and compared the results with haplogroup frequencies of modern Swedes to investigate paternalrelations Possible maternal kinship was investigated by deep FLX-sequencing of overlapping mtDNA

amplicons The authenticity of the sequences was examined using data from independent extractionsmassive clonal data the c-statistics and real-time quantitative data We show that the males carry thesame Y-chromosomal haplogroup and thus we cannot reject a fatherndashson type of relation Further asshown by the mtDNA analyses none of the individuals are maternally related We conclude that thegraves indeed belong to Birger Erik and Mechtild or to three individuals with the exact same kind ofbiological relatedness

Introduction

Birger Magnusson is one of the most prominent persons inwedish history and certainly one of the most well-known Evenhough he was never a king he practically ruled Sweden for nearlywo decades during the 13th century Since 1248 he had the titlejarlrdquo an old Scandinavian office approximately equal to earl or

ux in Latin (Lindkvist 2006) Being a ldquojarlrdquo meant that he washe closest man to the king Since the king was his own under-ged son Valdemar Birgerrsquos power became enormous He is so

lowast Corresponding author Tel +46 18 471 6310E-mail addresses hjmalmstromgmailcom (H Malmstroumlm)

ariaVretemarkvgregionse (M Vretemark) AndreasTillmarrmvse (A Till-ar) MikaelDurlingsluse (MB Durling) mtpgilbertgmailcom (MTP Gilbert)

willerslevsnmkudk (E Willerslev) GunillaHolmlundrmvse (G Holmlund)ndersGotherstromebcuuse (A Goumltherstroumlm)

940-9602$ ndash see front matter copy 2011 Elsevier GmbH All rights reservedoi101016jaanat201103014

copy 2011 Elsevier GmbH All rights reserved

intimately associated with his title that many actually believe hisname was Birger Jarl He had a crucial role in the consolidation ofSweden he enacted laws for the whole kingdom he was a skilledpolitician and mediator invoked changes in taxes and he foundedStockholm the capital of Sweden in 1252 During his days theformer loosely connected federations of chiefdoms became a mod-ern catholic kingdom under the supervision of one man ndash BirgerMagnusson (Harrison 2002)

Birger was the son of Magnus Minnesskoumlld and Ingrid Ylva Theybelonged to a powerful aristocratic dynasty from Oumlstergoumltland inthe south-east part of Sweden It is not known exactly when hewas born but we know that he married Ingeborg Eriksdotter thesister of the ruling king Erik Eriksson around 1235 Birger and Inge-borg had several children Valdemar the oldest son was elected

king when Erik Eriksson died in 1250 without any sons of his ownValdemar was only 12 years old at that time and Birger becamehis guardian Later on Valdemar was succeeded by his youngerbrother Magnus who conquered the throne from Valdemar in 1275

H Malmstroumlm et al Annals of Anatomy 194 (2012) 138ndash 145 139

FB

BybaopE(Boct(

dc

ig 1 The stone portrait of Birger in Varnhem Abbey (A) and the skull of the putativeirger photographed during the reopening of the grave in 2002 (B)

irger also fathered Erik called ldquoErik nobodyrdquo who died relativelyoung in 1275 Birgerrsquos wife Ingeborg died in 1254 when givingirth to their youngest son Bengt Birger remarried in 1261 prob-bly for political reasons to a Danish queen dowager Mechtildf Holstein (died 1288) (Harrison 2006) Birger jarl died in thearish of Vaumlstergoumltland on the 21st of October 1266 According torikskroumlnikan (written in the 1400s) he was buried in VarnhemJansson 1987) Mechtild and Erik were also buried in Varnhemirger had chosen a high status place for his grave just in frontf the laymenrsquos altar in the western part of the Cistercians abbeyhurch There is also a famous stone portrait of Birgerrsquos head inhe church reckoned as the oldest portrait in Sweden (Fig 1A)

Svanberg 1987)

After the reformation in the 1530s the abbey church was partlyestroyed by fire It was restored but most of the interior from theatholic era was ruined In this period the tombstone on Birgerrsquos

Fig 2 The Varnhem Abbey grave with the 13th century tombstone depicting Birgerhis son and his second wife

grave was removed and the grave was forgotten Because of thisnobody actually knew where in the church the grave was situated Itwas rediscovered at the beginning of the 20th century when exten-sive restoration work and excavations were performed in VarnhemThe grave was opened in 1920 and examined by the most famousSwedish anthropologist of that time Carl Magnus Fuumlrst He con-cluded that the two male and one female human skeletons in thegrave belonged to Birger Erik and Mechtild (Fuumlrst 1928) Thus thehigh rank grave was identified and the 13th century tombstone pic-turing Birger his son and second wife was replaced on the grave(Fig 2)

However the investigation was seriously questioned above allbecause of the sex assessments It was claimed that the femaleskeleton identified as the remains of Mechtild was in fact a male andif so the strong argument of identification connected to the personson the tombstone failed (Kyhlberg and Ahlstroumlm 1997) There-fore the grave was reopened in 2002 (Ahlstroumlm 2006 Vretemark2006) At this time improved methods could be used to carry outthe identification of the individuals Compared to the situation in1920 we could now use both skeletal morphology sex age of deathand diseases as well as ancient DNA techniques and combine theresults

Here we aim at investigating whether the biological relatednessbetween individuals in the Varnhem Abbey grave is in agreementwith the new osteological investigation and with what we wouldexpect if the remains belong to Birger Erik and Mechtild If so wewould expect to find two males with a fatherndashson relationship and afemale that is not related to any of the males The ancient DNA anal-yses involved pyrosequencing of autosomal and Y-chromosomalSNPs as well as FLX deep sequencing of mtDNA HVS1 amplicons

2 Materials and methods

21 Samples and DNA-extraction

One tooth sample was removed from the older male theyounger male and the female respectively (the putative Birger Erikand Mechtild according to Fuumlrstsrsquo definitions (1928)) during thereopening of the Varnhem grave in 2002 The sampling was per-formed using gloves and the teeth were placed in sterile test tubesAll pre-PCR work was conducted in a dedicated ancient DNA labora-tory at the Department of Forensic Genetics in Linkoumlping Sweden

The teeth were split into halves and decontaminated using 01 MHCl followed by treatment of the powderized teeth with 05 NaOCl(Malmstroumlm et al 2007) DNA was extracted using a silica-basedmethod (Yang et al 1998 Malmstroumlm et al 2007) modified by

1 of An

afis

2

bhbarmti

MastqcofwsehnaMi

ub

itbmcmswwswatmftngipc

H2O

pothpoth

40 H Malmstroumlm et al Annals

dding urea to the extraction buffer (Svensson et al 2007) DNArom each tooth-half was extracted at a separate occasion Twondependent extractions (called A and B) were carried out per toothample together with a total of nine negative extraction controls

2 mtDNA analyses and statistics

Mitochondrial DNA analyses were used to investigate possi-le maternal relations between any of the three individuals Firstowever we used real-time PCR to quantify an 80 bp and a 136p mtDNA fragment (for details see Malmstroumlm et al 2009) tossess the amount of initial DNA templates and to investigate theelationship between short and longer fragments The difference intDNA copy number between the samples and the negative con-

rols were compared using MannndashWhitney U test (as implementedn Statistica version 55 StatSoft Inc)

The first hypervariable region (HVS1) was targeted as inalmstroumlm et al (2009) using seven overlapping fragments (with

mplicon sizes ranging from 85 to 126 bp including primers) Inhort each DNA extract was amplified with a unique combina-ion of tagged primers All successful amplicons were purifieduantified using Nanodrop ND-1000 and pooled at equimolar con-entrations The pooled amplicons were subsequently sequencedn the Roche Genome Sequencer FLX platform following the manu-acturerrsquos guidelines and Binladen et al (2007) The sequence readsere based on the primers and their unique tags computationally

orted into one alignment file for each amplicon as in Malmstroumlmt al (2009) This time however we did not collapse reads withomopolymeric stretches of more than 3 bp The differences in theumber of FLX generated clones between the samples and the neg-tive controls for all seven HVS1 fragments were assessed by aannndashWhitney U test with a Bonferoni correction (as implemented

n Statistica version 55 StatSoft Inc)The clone sequences from each amplicon were investigated

sing the c statistic (Helgason et al 2007) as implementedy PhyloNet version 5 (Agnar Helgason unpublished) to help

dentify the authentic ancient sequence motif This method exploitshe most common form of post mortem nucleotide damage causedy cytosine deamination to help identify the original sequenceotif that gave rise to a damaged template Alignment files were

leaned prior to use with PhyloNet by computing the most com-on amount of gaps in the alignment and only keeping those

equences which had this exact number of gaps All sequencesere then re-aligned for each fragment using MUSCLE version 37ith default parameters (Edgar 2004) After running PhyloNet we

elected the sequence motif among clones from each amplicon thatere most probable of being authentic (with the best cMAX value

nd p lt 005) These sequences were aligned in BioEdit version 7o create 341 bp HVS1 consensus sequences We used PhyloNet to

anually check all clone sequences from a particular amplicon if weound discrepancies between replicate amplicons (deriving fromwo independent extractions) and if there was more than one sig-ificant sequence motif within one amplicon or if no significance orood cMAX was achieved In cases where several sequences includ-ng the one selected from the replicate amplicon where equallylausible we considered the one selected from the replicate ampli-on as authentic

PI = probability(observed DNA data|the hyprobability(observed DNA data|the hy

The haplogroup of each consensus sequence was assessed withaploGrep (httphaplogrepuibkacat Kloss-Brandstaumltter et al011) and PhyloTree Build 10 (httpwww phylotreeorg vanven and Kayser 2009) We further investigated how frequent

atomy 194 (2012) 138ndash 145

our three specific haplotypes were in the modern Swedish pop-ulation and in Europe by using EMPOP (httpempoporg version21 Release 3 Parsons and Dur 2007)

23 Nuclear SNP analyses and statistics

We investigated three Y-chromosomal and one autosomal SNPto assess possible biological relations between the older and theyounger male The primers were created in PSQ Assay Design v106(Biotage AB) We aimed at targeting short amplicons that could betyped using Pyrosequencing

The Y SNPs analyzed represent 702 of the male lineages foundin Sweden (Karlsson et al 2006) The primer sequences the poly-morphisms typed and annealing temperatures for Tat defining hgN1c (Zerjal et al 1997) M253 defining hg I1 (Cinnioglu et al2004) and M269 defining hg R1b1b2 (Cruciani et al 2002) canbe found in Table 1 The Y-chromosomal haplogroup nomencla-ture used is according to Karafet et al (2008) The autosomal SNPanalyzed was a CT polymorphism at position minus13910 in the lac-tase gene where the T allele is strongly associated with the abilityto digest lactose in adulthood (Enattah et al 2002) For primersequences and assay design see Malmstroumlm et al (2010) All fourSNPs were amplified using 5 l of DNA extract 300 nM of eachprimer and the Illustra Hot Start Ready-To-Go mix (GE HealthcareLife Sciences) The amplification protocol was 15 min at 95 C fol-lowed by 43 cycles of 30 s at 94 C 30 s at Tm

C (see Table 1 andMalmstroumlm et al 2010) and 30 s at 72 C with a final extensionstep of 15 min at 72 C The 25 l amplicons were sequenced as inKarlsson and Holmlund (2007) on a PSQTM 96MA using the PSQTM

96MA SNP Reagent kit (both from Biotage AB Uppsala Sweden)The dispensation order for each assay was automatically chosen bythe software

In order to test for a genetic relationship between the olderand the younger male the probability for paternity was calculatedbased on likelihood ratio principles (Gjertson et al 2007) Whentesting for paternity the likelihood ratio or paternity index (PI)can be expressed as

esis that the older man is the father of the younger man)esis that the older man is unrelated to the younger man)

The observed DNA data consisted of the Y-chromosomal hap-logroup and the lactase gene marker Assuming independencebetween the two markers the PI becomes

PI = 12 middot f (lac) middot f (Y)

where f(lac) is the population frequency of the shared lactosegene allele and f(Y) is the population frequency of the shared Y-chromosomal haplogroup The population frequencies where takenfrom population studies reflecting the contemporary Swedish pop-ulation (Kuokkanen et al 2005) and a Swedish male populationsampled in Skaraborg (Karlsson et al 2006)

3 Results

31 mtDNA quantification

The average mtDNA copy number (plusmnSE) per amplification were11089 plusmn 9529 3160 plusmn 954 and 946 plusmn 643 for the 80 bp fragmentand 760 plusmn 760 878 plusmn 408 and 150 plusmn 88 for the 136 bp fragmentfor the older male younger male and female sample respectively(Table 2) The degradation ratio (the relation between the shorter

80 bp fragment and the longer 136 bp fragment) was calculatedfrom the average copy number and were 146 for the older male 36for the younger male and 63 for the female (Table 2) Fifty percentof the 9 extraction blanks yielded low amounts of DNA (on average

H Malmstroumlm et al Annals of Anatomy 194 (2012) 138ndash 145 141

Table 1Y SNP primers

Primer name Primer sequence (5prime rarr 3prime) Amplicon length (bp) Polymorphism Tm (C)

M253F TATTGTTGATAGATAGCAAGTTGA 48 CT 52M253Rbio CATTCAATGAAGAACCTGGAGAM253Pyro TTGTTGATAGATAGCAAGTTM269F GGAATGATCAGGGTTTGGTTAAT 63 TC 54M269Rbio GCACATATGATAAAAAAAAAATTGm296Pyro AATGATCAGGGTTTGGTatF ATGGACTCTGAGTGTAGACTTGTGAA 61 TC 61TatRbio CTGTGCTCTGAAATATTAAATTAAAACAACTatPyro CTGAGTGTAGACTTGTGAAT

Y on lena

2ffTtf1

3

tatd(4acpzF

3

dasywnsweosecb

Tm

Tfd

chromosomal SNP primer information including pyrosequencing primers amplicnnealing temperature

plusmn 1 copies for the 80 bp fragment and 1 plusmn 1 copies for the 136 bpragment) as did 61 of the 18 PCR blanks (on average 5 plusmn 2 copiesor the 80 bp fragment and 1 plusmn 0 copies for the 136 bp fragment)here was significantly fewer mtDNA copies in the negative con-rols than in the DNA-extracts from the human samples (p lt 005or both fragments the 80 bp fragment displayed z = 376 and the36 bp fragment z = 287)

2 mtDNA FLX results

There were 3364 FLX generated clones that could be attributedo one of the seven HVS1 fragments by their primer sequencesnd further to individual DNA-extracts by the combination ofheir unique forward and reverse tags Sixty five percent of cloneserived from the three samples The average number of clonesplusmnSE) varied from 98 plusmn 35 to 22 plusmn 10 in the three samples and from2 plusmn 14 to 4 plusmn 3 in negative controls (Table 3) The difference inmount of clones between the two sample types remained signifi-ant for Fr2 Fr3 Fr4 and Fr5 after Bonferoni correction (Fr1 z = 228

= 0023 Fr2 z = 271 p = 00067 Fr2a z = 022 p = 083 Fr2b = 244 p = 00147 Fr3 z = 32 p = 00014 Fr4 z = 287 p = 00041r5 z = 282 p = 00048)

3 mtDNA sequence analyses and c statistics

Eighty-eight percent of the amplicons from the three samplesisplayed sequence types that were identified as being authenticnd endogenous based on their c statistic scores (Table 4) Seventy-even percent of the amplicons from the negative controls did notield any significant c scores (data not shown) When significanceas achieved it was typically sporadic and did not display phyloge-etic consistency between the sequences within a single negativeample These amplicons generally produced median-joining net-orks in PhyloNet that did not display starlike damage patterns

manating from an undamaged original template Often only onef the branches contributed to the c score and had damage-like

ubstitutions (either through C to T or G to A mutational differ-nces) An example of a median-joining network from a negativeontrol (an extraction blank) that yielded significant p-value cane seen in Fig 3A These substitutional patterns look more like

able 2tDNA and nuclear SNP results

mtDNA results

qPCR 80bp qPCR 136bp R

Older male 11089 plusmn 9529 760 plusmn 760 1Younger male 3160 plusmn 954 878 plusmn 408

Female 946 plusmn 643 150 plusmn 88

he average real-time PCR quantified copy number (plusmnSE) for a short (80 bp) and a longer (or each individual and the degradation ratio is displayed The mtDNA HVS1 and Y-chromisplayed for each individual Na indicates that no analyzable results were obtained

gth polymorphism investigated (where represent the ancestral allele state) and

mutational differences separating distinct sequence types ratherthan representing damage

Five amplicons from the three samples did not yield sequencemotifs with significant c scores (Younger maleB1 YoungermaleA2b Younger maleB2b FemaleB2b and FemaleB4Table 4) However the sequences still shared the consensus motifwith the other sequences from the overlapping amplicons Three ofthese cases involved the shortest amplicon in the study one casewas due to a massive loss of clone sequences in the gap cleaningstep and in the last case the clone sequences did not have enoughdamage-like substitutions (clear C to T or G to A substitutions) Forthis last case the network displayed a clear starlike pattern with the16270T substitution (which is also the motif of the replicate ampli-con) in the centre (see Fig 3C) There were also two cases wheresequences with significant c scores did not fit with the motif of thereplicates or with the overlapping fragments Younger maleB2chad the CRS motif as opposed to replicate and overlapping ampli-cons that all shared the 16185T substitution FemaleA2c displayedthe 16189C substitution that was also seen in the overlapping frag-ments but this sequence also an additional substitution and twoinsertions (16188T 161931C and a 161932C)

The clone sequences that were selected as authentic basedon the c statistic (as shown below) were aligned into consen-sus sequences (spanning np 16051ndash16391) for each of the threesamples These sequences displayed three distinct haplotypes thatdiffered from each other by two to six substitutions thus revealingthat none of the individuals shared a maternal ancestry (Table 4)The older male displayed significant sequence support for allseven HVS1 fragments in both replicates (Table 4) The consensussequence displayed no deviations from the rCRS and was thereforeassigned to hg H (Andrews et al 1999) Ten of the 14 ampliconsfrom the younger male yielded sequences with significant c scoresand consistent motifs (Table 4) All authentic substitutions in theconsensus sequence were supported by at least two replicates (twoamplicons deriving from two independent extractions) with sig-nificant c scores An example of a median-joining network from

a clone sequence from the younger male that yielded significantp-value can be seen in Fig 3B The substitutions were 16129A16185T 16223T 16224C 16260T and 16298C thus placing theyounger male in hg Z1a (Kong et al 2006 Metspalu et al 2006)

Nuclear SNP results

atio 80136bp HVS1 hg Y hg Lactose

46 H I1 TC36 Z1a I1 TT63 U5b1 Na TT

136 bp) mtDNA fragment from each of two independent extractions (A and B) madeosomal haplogroup designation and the allele status of the lactose SNP is further

142 H Malmstroumlm et al Annals of Anatomy 194 (2012) 138ndash 145

Table 3Amount of clones

1 2a 2b 2c 3 4 5

Human extracts 40 plusmn 21 98 plusmn 35 43 plusmn 14 61 plusmn 23 50 plusmn 16 27 plusmn 10 45 plusmn 15Extraction blanks 8 plusmn 4 16 plusmn 5 42 plusmn 14 28 plusmn 32 4 plusmn 3 8 plusmn 3 10 plusmn 8

T nine n

Ectt2

s5TvywF

TC

Ts(o

he average number of clones (plusmnSE) obtained from the three samples and from the

leven of the 14 amplicons for the female sample yielded signifi-ant and consistent sequence motifs (Table 4) The substitutions inhe consensus sequence for the female were 16189C and 16270Thus placing her in hg U5b1 (Achilli et al 2005 Malyarchuk et al010)

When searching EMPOP among 12247 world-wide mtDNAequences the exact haplotype of the older male (H) yielded17 matches across Europe and 35 of these were from Swedenhe U5b1 haplotype of Mechtild was found in 10 European indi-iduals of which two were from Sweden The haplotype of the

ounger male (Z1a) was the least abundant one with only twoorld-wide hits one from Sweden and one from the Russian

ederation

able 4 statistic applied to FLX clone sequences

Amplicon ID HVS1 motif (+16000)

Older maleA1 CRS

Older maleB1 CRSOlder maleA2a CRS

Older maleB2a CRS

Older maleA2b CRS

Older maleB2b CRS

Older maleA2c CRS

Older maleB2c CRS

Older maleA3 CRSOlder maleB3 CRS

Older maleA4 CRS

Older maleB4 CRS

Older maleA5 CRS

Older maleB5 CRS

Younger maleA1 129A

Younger maleB1 129AYounger maleA2a 129A 185T

Younger maleB2a 129A 185T

Younger maleA2b 129A

Younger maleB2b 129A

Younger maleA2c 185T

Younger maleB2c CRS

Younger maleA3 185T 223T 224C

Younger maleB3 185T 223T 224C

Younger maleA4 260T 298C

Younger maleB4 260T 298C

Younger maleA5 CRS

Younger maleB5 CRS

FemaleA1 CRS

FemaleB1 CRS

FemaleA2a 189CFemaleB2a 189C

FemaleA2b CRS

FemaleB2b CRS

FemaleA2c 188T 189C 1931C 1932C

FemaleB2c 189C

FemaleA3 189C

FemaleB3 189C

FemaleA4 270T

FemaleB4 270T

FemaleA5 CRS

FemaleB5 CRS

he c statistic results (observed and expected cMAX and p-values) obtained for each FLX

equences for the three samples The amplicon ID is based on the sample (older male youn1 2a 2b 2c 3 4 or 5) it derives from The sequence motifs are transitions compared to rbtained for that particular sequence type

egative controls for each of the seven HVS1 fragments

34 Nuclear SNP results and statistics

The older male was successfully typed eight times for the threeY SNPs He displayed the ancestral allele for Tat (T) and M269 (T)and the derived allele for M253 (T) (Table 2) The younger male wassuccessfully typed two times for M269 and M253 and also displayedthe ancestral allele for the former and the derived allele for thelatter marker This places both males in hg I1 (Cinnioglu et al 2004)The female sample was typed seven times for the three Y SNPs andyielded no result at any time The older male was heterozygote for

the autosomal lactose SNP He was typed four times showing boththe C and the T allele each time The younger male and the femalewere typed three times Both were homozygote for the T allele

Obs cMAX Exp cMAX p-Value

1450 401 lt00012133 683 lt00011650 764 00033667 967 lt0001533 227 0024617 331 lt00011100 533 lt00011403 638 lt00011100 551 00072583 672 lt00011050 272 00011033 406 00011383 408 lt00012067 403 lt00011918 503 lt0001Na Na Na1933 553 lt0001800 238 lt0001400 216 011500 328 016650 242 00051232 654 0003770 444 00241900 519 lt00011000 162 lt00011092 411 00011400 227 lt00012167 519 lt0001550 184 00171000 446 00191783 540 lt00011050 262 lt00011167 445 lt0001100 081 0811200 280 lt0001865 474 0004700 332 00181050 215 lt00011312 166 lt0001200 301 097500 288 0043900 241 lt0001

clone sequence type from each amplicon used to construct the 341 bp consensusger male or female) the extraction (A or B) and which of the seven HVS1 fragmentsCRS (Andrews et al 1999) Text in bold indicates that no significant p-values were

H Malmstroumlm et al Annals of Anatomy 194 (2012) 138ndash 145 143

Fig 3 Examples of median-joining networks from PhyloNet of sequence types found among FLX generated mtDNA clones The length of each branch is proportional to thenumber of mutational differences between sequence types and the numbers on the branch represent the nucleotide position that differ from the reference sequence Thicklines indicate which substitution patterns that are damage-like and that contribute to the c score of the reference sequence (A) The clones from a fragment 3 amplicond values 4 ampb

Nbe

tfnotpamb

4

4

tDtmfcmsstwcdttbmitist

eriving from an extraction blank where sequence 4 got a significant c score and p-equence 7 got a significant c score and p-value and (C) the clones from a fragment

ut had a sequence motif that was supported by the motif in the replicate amplicon

one of the negative controls yielded any results (nine extractionlanks and four PCR blanks typed between one to two times forach SNP assay)

No genetic inconsistencies were found when the DNA data forhe older man was compared with the data for the younger manor a fatherndashson relationship The weight of evidence for pater-ity expressed as the PI was calculated to be 19 based on thebserved DNA profiles and appropriate population frequencies forhe present Swedish population Thus assuming equal a priorirobabilities for and against paternity (Gjertson et al 2007) it islmost twice as likely that the genetic similarities between the twoale individuals was due to a paternal relationship compared with

eing unrelated

Discussion

1 Authentication

The genetic data was accepted as authentic based on several cri-eria We find a reverse correlation between fragment length andNA yield as seen in the degradation ratio (80136 bp) of the real-

ime quantified mtDNA (Malmstroumlm et al 2007) Also we rely onassive amounts of FLX clonal mtDNA data (Bower et al 2005)

rom which authentic sequence motifs were identified using the statistic (Helgason et al 2007) on replicate amplicons Furtherost substitutions in the three HVS1 consensus sequences were

upported by two to five replicate amplicons with significant ccores (see Table 4) There was one exception the 16270T substi-ution in the female sample which was supported by one ampliconith significant c score However even though the replicate ampli-

on was not authenticated by the c statistic its clone sequencesisplayed a clear starlike pattern with the 16270T polymorphism inhe centre (see Fig 3C) All consensus sequences displayed consis-ent haplotypes that made phylogenetic sense It should howevere noted that some negative controls yielded positive results foritochondrial amplifications In these cases the amount of start-

ng molecules were significantly lower than for the samples from

he three humans the negative controls generally yielded signif-cantly fewer synthetic clones than the three investigated humanamples and only in sporadic cases did any of the negative con-rols produce a c value of significance None of the nuclear negative

(B) the clones from a fragment 5 amplicon deriving from the younger male wherelicon deriving from the female where sequence 8 did not reach significant p-values

controls yielded positive results The results are based on indepen-dent DNA extractions from bleach pre-treated powderized teeth(Malmstroumlm et al 2007)

42 C statistics

The authentication is heavily based on the c statistic In mostcases the c statistic gave the cMAX and a significant p-value forthe authentic sequence automatically There were however somecases where another motif had a bit lower cMAX but was still sig-nificant and still fitted with replicate sequence motif One reasonwhy more than one sequence type may yield good c statistic scoresis that haplotypes near by the authentic ancient haplotype andwith damage-like substitutions leading to it sometimes parasiteon the c value of the authentic haplotype However by investi-gating the damage distribution pattern among the haplotypes inPhyloNet and by also having the replicate amplicon haplotype foreach fragment to rely on such cases were easily detected

The two shorter fragments (2b and 2c) that only yielded some 85and 93 bps of ancient sequence were more complicated to handlewith the c statistics The fragments do simply not contain enoughsites for retrieving a clearly visible damage pattern Sometimes ithelps with an increased number of pseudoclones but the c statis-tics never becomes as obvious for these fragments as it does forlonger fragments In several cases we did not reach significance forfragment 2b and in two cases we did get significant sequences forfragment 2c but with the wrong sequence motif Thus we reliedheavily on the full fragment 2a for this part of the mitochondria

An interesting observation is that when the magnitude ofpost-mortem damage is large the median-joining algorithm mayreconstruct an original template sequence even when no undam-aged templates are left (Bandelt et al 1999 Helgason et al 2007)We saw this in several cases where a median vector was cho-sen for one amplicon and matched the significant sequence motifdisplayed by the replicate amplicon

The younger male and the female samples displayed lesssequences with significant c scores and more heterogeneity in

sequence motifs between replicates compared to the ones fromthe older male This is most likely due to the fact that the extractsfrom the older male contained more DNA (see Table 2) and alsogenerated a larger number (34ndash75 more) of FLX pseudo clones

1 of An

tssis

4

hBmngbvSowottsinyDaptst

aameBett

fcshnhlbESmatsi(hoqIiww(

44 H Malmstroumlm et al Annals

hat could be used for the c statistics than the other samples As allamples are of the same age and from the same location somewhatimilar preservation could be expected The difference in DNA yields probably caused by differences in pulp size between the toothamples and by stochastic variation in DNA loss during extraction

3 Finding the founder of Stockholm

The major reason why the identity of the remains in the Varn-em Abbey grave was questioned with regards to belonging toirger Erik and Mechtild was a claim that all three individuals wereales (Kyhlberg and Ahlstroumlm 1997) However the results of the

ew osteological examination showed that the third skeleton in therave indeed was female and the disagreement in this matter coulde settled Further her age of death was around 65 years which goesery well with the historical records of queen dowager Mechtildome osteoarthrosis could be noticed in her skeleton as well assteoporosis due to Mechtildrsquos old age Her elevated social statusas reflected by the comparably low grade of tooth wear a result

f life-long access to high quality more easily chewed food Also inhe case of the two men the data from the osteological analyses andhe historical knowledge matched very well The older male pre-umably Birger died in about 55 years of age He had a healed scarn his right eyebrow probably a wound from one of the crusades toorth east Europe he led in the 1240s (Fig 1B) The skeleton of theounger man putative Erik revealed a death age around 25 yearsespite the young age the bones were marked by sickness He had

scoliosis in his spine and his sternum was malformed suggestingroblems with his chest Altogether the different disorders led tohe conclusion that Erik had a congenital sickness called Marfanrsquosyndrome (Ahlstroumlm 2006) His physical condition no doubt washe reason why he was given the nickname ldquoErik nobodyrdquo

The information we got from the osteological analyses was ingreement with the knowledge we had about these individualsccording to historical sources therefore strengthening the argu-ents about the identification Via ancient DNA analyses we got

ven further Although we could not do a direct identification ofirger based on DNA-analyses as we do not have any known ref-rence sample from him to compare with we could conclude thathe biological relatedness between the individuals in the grave fithe hypothesis that they were Birger Erik and Mechtild

First the three individuals had mtDNA HVS1 sequences that dif-ered from each other by two to six substitutions Therefore wean exclude maternal kinship between any of them This makesense since Birger and Erik were father and son and should notave the same mother It also fits with the fact that Ingeborgot Mechtild was the mother of Erik Although we do not knowow their mtDNA should look like we can conclude that the hap-

ogroup results do seem to make phylogenetic sense at least in aroad perspective Birgerrsquos haplogroup H is highly abundant acrossurope (Richards et al 1998 Simoni et al 2000) and also inweden (Tillmar et al 2010) Mechtilds haplogroup U5 exists inore moderate frequencies across Europe (Simoni et al 2000)

lthough we found 10 identical haplotype hits (U5b1) evenly dis-ributed across Europe when searching EMPOP What was mosturprising was to find that Erik belonged to haplogroup Z1 whichs rare in Europe and presumed to have an eastern Eurasian originTambets et al 2004) We did however get two exact matches tois haplotype in EMPOP one from Sweden (Tillmar et al 2010) andne from the Russian Federation (Grzybowski et al 2007) This isuite interesting since Eriksrsquo maternal ancestry involved his mother

ngeborg Eriksdotter (1212ndash1254) who was the daughter of a Dan-

sh princess Rikissa Valdemarsdotter (1178ndash1220) and her mother

ere Sofia Vladimirsdotter of Minsk (1140ndash1198) which in turnas the daughter of Rikissa Boleslavdotter of Polen (1106ndash1160)

Lagerqvist and Aringberg 2001) But it should be stressed that these

atomy 194 (2012) 138ndash 145

kind of screening results for single individuals are dependent uponsampling and density in studies and we can only claim that noth-ing in the mitochondrial motifs contradicts what we know aboutthe origin of Birger Mechtild and Erik

Second we could not exclude that the older male was the fatherof the younger male as the former was heterozygous and the latterhomozygous for the autosomal SNP Exclusion would have requiredthe older male to be homozygous for the opposite allele comparedto the younger male We could further conclude that both malesbelonged to the highly abundant Y chromosomal hg I1 which hasa frequency of 37 in modern Swedes (Karlsson et al 2006) Thesegenetic similarities are almost twice as likely due to a paternalrelationship as to chance However the calculation of the pater-nal index was based on population frequencies of contemporarySwedish populations We thus note that the frequencies may havebeen different during the 13th century Lastly the Y SNP analysesfurther supported the new osteological sex determinations of thetwo males and indirectly also of the female as she yielded no YSNP data

Due to restricted amounts of DNA extract only the older maleBirger was typed for all three Y SNPs When we had establishedwhich hg he belonged to the other samples (the younger male Erikand the female Mechtild) were typed using the M253 assay defininghg I1 As the other male sample also belonged to hg I1 we onlycontinued with one more Y SNP to make sure we would not findthe derived allele for this assay too

The combined information from the historical records the newosteological analyses and the ancient DNA analyses is all in accor-dance with what we would expect from a grave containing BirgerErik and Mechtild and thus strengthen the connection betweenthe historical persons and the Varnhem Abbey grave We havenot however anchored the conclusion by matching the DNA fromVarhem with DNA from other known relatives buried at other loca-tions Such investigations could be done by reopening samplingand analyzing the individuals buried in the Magnus Ladularings gravein Riddarholmskyrkan in Stockholm Here we find two of Birgersrsquosons and thus also Eriksrsquo brothers Magnus and Valdemar as wellas Magnusrsquo wife Helvig and their daughter Rikissa If the grave inthe Varnhem Abbey do contain Birger Erik and Mechtild as all evi-dence we have collected so far suggests the putative Birger andErik should have the same Y haplotype as Magnus and Valdemarand Erik should have the same mitochondrial haplotype as Magnusand Valdemar A request to reopen the grave was recently approvedand this project will start during 2011

Acknowledgement

We thank Agnar Helgason at deCODE Genetics in Iceland forletting us use his unpublished program PhyloNet version 5 AG wassupported by the Royal Swedish Academy of Science

References

Achilli A Rengo C Battaglia V Pala M Olivieri A Fornarino S Magri CScozzari R Babudri N Santachiara-Benerecetti AS Bandelt HJ Semino OTorroni A 2005 Saami and Berbers ndash an unexpected mitochondrial DNA linkAm J Hum Genet 76 883ndash886

Ahlstroumlm T 2006 Skeletten fraringn jarlen Birger Magnussons grav i Varnhemsklosterkyrka Skrifter fraringn Vaumlstergoumltlands museum nr 34 Vaumlstergoumltlands muse-ums foumlrlag Skara

Andrews RM Kubacka I Chinnery PF Lightowlers RN Turnbull DM How-ell N 1999 Reanalysis and revision of the Cambridge reference sequence forhuman mitochondrial DNA Nat Genet 23 147

Bandelt HJ Forster P Rohl A 1999 Median-joining networks for inferring

intraspecific phylogenies Mol Biol Evol 16 37ndash48

Binladen J Gilbert MPT Bollback JP Panitz F Bendixen C Nielsen R Willer-slev E 2007 The use of coded PCR primers enables high-throughput sequencingof multiple homolog amplification products by 454 parallel sequencing PLoSOne 2 e197

of An

B

C

C

E

E

F

G

G

H

H

H

JK

K

K

K

K

K

K

L

H Malmstroumlm et al Annals

ower MA Spencer M Matsumura S Nisbet RE Howe CJ 2005 How manyclones need to be sequenced from a single forensic or ancient DNA samplein order to determine a reliable consensus sequence Nucleic Acids Res 332549ndash2556

innioglu C King R Kivisild T Kalfoglu E Atasoy S Cavalleri GL Lillie ASRoseman CC Lin AA Prince K Oefner PJ Shen P Semino O Cavalli-Sforza LL Underhill PA 2004 Excavating Y-chromosome haplotype stratain Anatolia Hum Genet 114 127ndash148

ruciani F Santolamazza P Shen P Macaulay V Moral P Olckers A Modi-ano D Holmes S Destro-Bisol G Coia V Wallace DC Oefner PJ TorroniA Cavalli-Sforza LL Scozzari R Underhill PA 2002 A back migration fromAsia to sub-Saharan Africa is supported by high-resolution analysis of humanY-chromosome haplotypes Am J Hum Genet 70 1197ndash1214

dgar RC 2004 MUSCLE a multiple sequence alignment method with reducedtime and space complexity BMC Bioinform 5 113

nattah NS Sahi T Savilahti E Terwilliger JD Peltonen L Jarvela I 2002Identification of a variant associated with adult-type hypolactasia Nat Genet30 233ndash237

uumlrst C-M 1928 Birger jarls grav i Varnhems klosterkyrka Kungl Vitterhets His-torie och Antikvitets Akademiens Handlingar Del 382 Stockholm

jertson DW Brenner CH Baur MP Carracedo A Guidet F Luque JA LessigR Mayr WR Pascali VL Prinz M Schneider PM Morling N 2007 ISFGrecommendations on biostatistics in paternity testing Forensic Sci Int Genet1 223ndash231

rzybowski T Malyarchuk BA Derenko MV Perkova MA Bednarek JWozıniak M 2007 Complex interactions of the Eastern and Western Slavic pop-ulations with other European groups as revealed by mitochondrial DNA analysisForensic Sci Int Genet 1 141ndash147

arrison D 2002 Jarlens sekel In En beraumlttelse om 1200-talets Sverige OrdfrontFoumlrlag Stockholm

arrison D 2006 Birger jarl fraringn vaggan till graven In H Nilsson A Praesto MVretemark B Oumlster (Eds) Birger Magnusson ndash den siste jarlen Skrifter fraringnVaumlstergoumltlands museum nr 35 9ndash35 Vaumlstergoumltlands museums foumlrlag Skara

elgason A Paacutelsson S Lalueza-Fox C Ghosh S Sigurethardoacutettir S Baker AHrafnkelsson B Aacuternadoacutettir THORNorsteinsdoacutettir U Stefaacutensson K 2007 A statisti-cal approach to identify ancient template DNA J Mol Evol 65 92ndash102

ansson S-B 1987 Erikskroumlnikan TidensFoumlrlag Stockholmarafet TM Mendez FL Meilerman MB Underhill PA Zegura SL Hammer

MF 2008 New binary polymorphisms reshape and increase resolution of thehuman Y chromosomal haplogroup tree Genome Res 18 830ndash838

arlsson AO Wallerstroumlm T Goumltherstroumlm A Holmlund G 2006 Y-chromosomediversity in Sweden ndash a long-time perspective Eur J Hum Genet 14 963ndash970

arlsson AO Holmlund G 2007 Identification of mammal species using species-specific DNA pyrosequencing Forensic Sci Int 173 16ndash20

loss-Brandstaumltter A Pacher D Schoumlnherr S Weissensteiner H Binna R SpechtG Kronenberg F 2011 HaploGrep a fast and reliable algorithm for automaticclassification of mitochondrial DNA haplogroups Hum Mutat 32 25ndash32

ong QP Bandelt HJ Sun C Yao YG Salas A Achilli A Wang CY Zhong LZhu CL Wu SF Torroni A Zhang YP 2006 Updating the East Asian mtDNAphylogeny a prerequisite for the identification of pathogenic mutations HumMol Genet 15 2076ndash2086

uokkanen M Butzow R Rasinperauml H Medrek K Nilbert M Malander S Lubin-ski J Jaumlrvelauml I 2005 Lactase persistence and ovarian carcinoma risk in Finland

Poland and Sweden Int J Cancer 117 90ndash94

yhlberg O Ahlstroumlm T 1997 Garingnget ur min hand Riddarholmskyrkans stiftar-gravar Kungl Vitterhets- historie-och antikvitetsakademien Stockholm

agerqvist L Aringberg N 2001 Litet lexikon oumlver Sveriges regenter Vincent foumlrlagBoda

atomy 194 (2012) 138ndash 145 145

Lindkvist T 2006 Jarlar foumlre Birger jarl In H Nilsson A Praesto M Vretemark BOumlster (Eds) Birger Magnusson ndash den siste jarlen Skrifter fraringn Vaumlstergoumltlandsmuseum nr 35 43ndash55 Vaumlstergoumltlands museums foumlrlag Skara

Malmstroumlm H Svensson EM Gilbert MTP Willerslev E Goumltherstroumlm AHolmlund G 2007 More on contamination the use of asymmetric molecularbehavior to identify authentic ancient human DNA Mol Biol Evol 24 998ndash1004

Malmstroumlm H Gilbert MTP Thomas MG Brandstroumlm M Storaring J Molnar PAndersen PK Bendixen C Holmlund G Goumltherstroumlm A Willerslev E 2009Ancient DNA reveals lack of continuity between Neolithic hunter-gatherers andcontemporary Scandinavians Curr Biol 19 1758ndash1762

Malmstroumlm H Linderholm A Lideacuten K Storaring J Molnar P Holmlund G Jakob-sson M Goumltherstroumlm A 2010 High frequency of lactose intolerance in aprehistoric hunter-gatherer population in northern Europe BMC Evol Biol 1089

Malyarchuk B Derenko M Grzybowski T Perkova M Rogalla U Vanecek TTsybovsky I 2010 The peopling of Europe from the mitochondrial haplogroupU5 perspective PLoS One 5 e10285

Metspalu M Kivisild T Bandelt HJ Richards M Villems R 2006 The pioneersettlement of modern humans in Asia In Bandelt HJ Macaulay V Richards M(Eds) Human Mitochondrial DNA and the Evolution of Homo Sapiens Springer-Verlag Berlin

Parsons W Dur A 2007 EMPOP ndash a forensic mtDNA database Forensic Sci IntGenet 1 88ndash92

Richards MB Macaulay VA Bandelt HJ Sykes BC 1998 Phylogeography ofmitochondrial DNA in western Europe Ann Hum Genet 62 41ndash260

Simoni L Calafell F Pettener D Bertranpetit J Barbujani G 2000 Geographicpatterns of mtDNA diversity in Europe Am J Hum Genet 66 262ndash278

Svanberg J 1987 Furstebilder fraringn Vaumlstergoumltland Skrifter fraringn Skaraborgs laumlnsmu-seum 9 Vaumlstergoumltlands tryckeri Skara

Svensson EM Anderung C Baubliene J Persson P Malmstroumlm H Smith CVretemark M Daugnora L Goumltherstroumlm A 2007 Tracing genetic change overtime using nuclear SNPs in ancient and modern cattle Anim Genet 38 378ndash383

Tambets K Rootsi S Kivisild T Help H Serk P Loogvaumlli E-L Tolk H-V ReidlaM Metspalu E Pliss L Balanovsky O Pshenichnov A Balanovska E GubinaM Zhadanov S Osipova L Damba L Voevoda M Kutuev I Bermisheva MKhusnutdinova E Gusar V Grechanina E Parik J Pennarun E Richard CChaventre A Moisan J-P Barac L Pericic M Rudan P Terzic R MikereziI Krumina A Baumanis V Koziel S Rickards O De Stefano GF AnagnouN Pappa KI Michalodimitrakis E Feraacutek V Fuumlredi S Komel R BeckmanL Villems R 2004 The western and eastern roots of the saami ndash the story ofgenetic ldquoOutliersrdquo told by mitochondrial DNA and Y chromosomes Am J HumGenet 74 661ndash682

Tillmar AO Coble MD Wallerstroumlm T Holmlund G 2010 Homogeneity in mito-chondrial DNA control region sequences in Swedish subpopulations Int J LegalMed 124 91ndash98

van Oven M Kayser M 2009 Updated comprehensive phylogenetic tree of globalhuman mitochondrial DNA variation Hum Mutat 30 E386ndashE394

Vretemark M 2006 Att glaumlnta paring de doumldas doumlrr In H Nilsson A Praesto MVretemark B Oumlster (Eds) Birger Magnusson ndash den siste jarlen Skrifter fraringnVaumlstergoumltlands museum nr 35 57ndash65Vaumlstergoumltlands museums foumlrlag Skara

Yang DY Eng B Waye JS Dudar JC Saunders SR 1998 Technical noteimproved DNA extraction from ancient bones using silica-based spin columnsAm J Phys Anthropol 105 539ndash543

Zerjal T Dashnyam B Pandya A Kayser M Roewer L Santos FR Schiefen-houmlvel W Fretwell N Jobling MA Harihara S Shimizu K Semjidmaa DSajantila A Salo P Crawford MH Ginter EK Evgrafov OV Tyler-SmithC 1997 Genetic relationships of Asians and Northern Europeans revealed byY-chromosomal DNA analysis Am J Hum Genet 60 1174ndash1183