Ribozyme-Based Therapeutic Approaches for AutosomalDominant Retinitis Pigmentosa

Brian O’Neill, Sophia Millington–Ward, Mary O’Reilly, Gearoid Tuohy,Anna–Sophia Kiang, Paul F. Kenna, Peter Humphries, and G. Jane Farrar

PURPOSE. To design, generate, and compare in vitro a range of hammerhead ribozymes targetingretinal transcripts implicated in autosomal dominant retinitis pigmentosa (adRP) and therebyidentify ribozymes that may be valuable as therapeutic agents for adRP. To address mutationalheterogeneity in rhodopsin and peripherin-linked adRP using mutation-independent ribozyme-based therapeutic approaches.

METHODS. Ribozyme and cDNAs constructs were cloned into pcDNA3 and expressed in vitro fromthe T7 promoter. Cleavage reactions were separated on polyacrylamide gels, visualized by autora-diography, and quantified using an instant imager. Ribozymes targeting rhodopsin and peripherintranscripts in a mutation-independent manner (Rz9, Rz10, and Rz40) and a multimeric ribozyme(RzMM) targeting rhodopsin transcripts were evaluated for in vitro activity. Parameters such asVmax, Km, k2 and k21 were established for each ribozyme.

RESULTS. Four ribozymes targeting retinal transcripts were evaluated. Mutation-independent ri-bozymes targeting degenerate sites or untranslated regions in retinal transcripts resulted in cleavageproducts of predicted size, whereas transcripts from modified replacement genes remained intact.Detailed kinetic evaluation of ribozymes revealed substantial differences in cleavage rates betweenribozymes.

CONCLUSIONS. Mutation-independent hammerhead ribozymes targeting rhodopsin and peripherinhave been screened in vitro, and a number of extremely efficient ribozymes identified subsequentto detailed kinetic analyses, suggesting that these ribozymes may provide mutation-independentmethods of treating adRP. These are the first ribozymes reported that potentially will providebenefit for inherited retinopathies. (Invest Ophthalmol Vis Sci. 2000;41:2863–2869)

Amarked feature of many inherited disorders, includingrhodopsin- and peripherin-linked retinitis pigmentosa(RP), is the high level of genetic heterogeneity inherent

in them. More than 150 mutations have been identified to datein these genes,1 clearly suggesting a need for mutation-inde-pendent approaches for therapy. Therapies for dominant dis-orders such as autosomal dominant (ad)RP could be directed tothe primary genetic defect by eliminating or reducing themutant protein while maintaining expression of the wild-typeprotein. Alternatively, therapies could be directed toward mod-ulating secondary effects that contribute to the pathologiccourse of the disease, such as photoreceptor apoptosis. Thepresent study focuses on the former approach–that is, muta-

tion-independent hammerhead ribozyme-mediated suppres-sion of rhodopsin and peripherin transcripts in vitro.

Hammerhead ribozymes are RNA enzymes that can elicitsequence-specific cleavage of target RNAs at accessible NUXmotifs (N, any nucleotide; U, uracil; X, any nucleotide exceptguanine).2 To date, ribozyme-based gene therapies for domi-nant diseases have taken advantage of situations in which themutation creates a ribozyme cleavage site3 or the cleavage sitehas been artificially generated.4 However, most mutations donot create NUX target motifs and are not present in accessibleareas of target transcripts. Moreover, the immense intragenicheterogeneity associated with many dominant diseases makesmutation-specific therapies unattractive. To circumvent thesedifficulties, suppression strategies that are independent of thedisease mutation have been developed.5–6 In essence, muta-tion-independent approaches involve suppression of wild-typeand mutant alleles using sequences in untranslated regions(UTRs) or at degenerate (wobble) sites and concurrent intro-duction of replacement genes with modified UTRs or degen-erative sites that escape suppression but code for wild-typeprotein. Mutation-independent gene silencing should result ina significantly increased number of patients who could poten-tially benefit from a single therapeutic agent.

Mutation-independent hammerhead ribozymes (Rz9,Rz10, and Rz40), which target human rhodopsin and periph-erin transcripts, and a connected multimeric ribozyme7

From the Ocular Genetics Unit, Smurfit Institute of Genetics,Trinity College Dublin, Ireland.

Supported by grants from The Wellcome Trust, United Kingdom;The Foundation Fighting Blindness; The British RP Society; RP Ireland–Fighting Blindness, Dublin; and the Health Research Board of Ireland,Dublin.

Submitted for publication February 2, 2000; revised April 11,2000; accepted April 24, 2000.

Commercial relationships policy: P(PFK, PH, GJF), N(BO, SM-W,MO, GT, A-SK).

Corresponding author: Brian O’Neill, Ocular Genetics Unit, Smur-fit Institute of Genetics, Lincoln Place Gate, Trinity College Dublin,Dublin 2, Ireland. oneillbg@tcd.ie

Investigative Ophthalmology & Visual Science, September 2000, Vol. 41, No. 10Copyright © Association for Research in Vision and Ophthalmology 2863

(RzMM) that simultaneously targets four sites in human rho-dopsin RNA have been tested in vitro, and detailed kineticprofiles have been generated for these ribozymes. Kinetic pro-files of ribozymes in vitro can be used as broad predictors ofpotential efficiencies in vivo.2 Ribozymes follow Michaelis–Menten kinetics2,8; parameters such as Vmax (maximum veloc-ity of the reaction), Km (Michaelis–Menten constant), k2 (therate of the cleavage step), k21 (the dissociation rate), and t1/2

(the half-life of substrate RNA) can be determined. Kineticvalues obtained in the study indicate that some ribozymestested are extremely efficient in vitro and may be valuable inthe development of mutation-independent therapeutic ap-proaches for adRP.

MATERIALS AND METHODS

cDNA and Ribozyme Constructs

Human peripherin (M62958) and human rhodopsin (K02281)constructs were linearized with BstEII and BglII, respectively,and transcribed from a T7 promoter using Ribomax kits (Pro-mega, Eugene, OR) incorporating [a-32P] uridine triphos-phate.5 Resultant transcripts were gel purified. Hammerheadribozymes were designed to target accessible regions in targetmRNAs, as predicted by the computer program RNAPlotFOLD(Wisconsin Package, Madison, WI).9 The integrity of openloops was evaluated from the 15 most probable conformations.Rz10 and Rz40 were designed to cleave a GUC motif at posi-tions 475-477 of the human rhodopsin sequence. Both ri-bozymes are identical, except for a single-base mismatch in oneantisense arm of Rz10 (highlighted in bold). RzMM is a multi-meric ribozyme comprising four independent hammerheadmolecules linked in tandem that target degenerative sites inhuman rhodopsin RNA at positions 475-477 (GUCVal), 544-546(CUCLeu), 577-579 (CUCLeu), and 982-984 (GUCVal). Rz9 tar-gets a GUU motif at position 190-192 of the 59UTR of humanperipherin RNA. Hammerhead ribozymes were cloned into theHindIII, XbaI or XhoI sites of pcDNA3 or pcDNA3.1(2) (In-vitrogen, San Diego, CA). Constructs were linearized withXbaI, transcribed, and purified as described earlier. Ribozymesequences with antisense arms are in italic print:Rz9:59-CAAACCUUCUGAUGAGUCCGUGAGGACGAAACGAGCC39;Rz10: 59-GGUCGGUCUGAUGAGUCCGUGAGGACGAAACGUAGAG-39; Rz40: 59-GGACGGUCUGAUGAGUCCGUGAGGACGAAACGUAGAG-39; and RzMM: 59-GGACGGUCUGAUGAGUCCGUGAGGACGAAACGUAGAGUUCAGGCUACCUAUCCAUGAACUGAUGAGUCCGUGAGGACGAAAGGUCAGCCCAGUUUCGUCGAUGGUGUACUGAUGAGUCCGUGAGGACGAAAGGGUGCUGACCUGUAUCCCUCCUUCUGAUGAGUCCGUGAGGACGAAACGGUGAA-39.

Cleavage Reactions

Transcripts were quantified by scintillation counting, and mo-lar ratios were determined.5 Cleavage reactions were per-formed in 0 to 15 mM MgCl2, 50 mM Tris-HCl (pH 8.0) at 37°Cfor up to 3 hours. Time points were performed using optimalMgCl2 concentrations. Labeled transcripts were separated onpolyacrylamide gels (4%–8%) and analyzed by autoradiographyand instant imaging.8 Percentage cleavage was determined asfollows: % cleavage 5 (cpm P1 1 cpm P2)/(cpm target 1 cpm

P1 1 cpm P2) where cpm is counts per minute, and P1 and P2are cleavage products 1 and 2, respectively.

Determination of Steady State Intervals andRibozyme Saturation

Target and ribozyme RNAs were combined in molar ratios of1:0.2 to 1:100. RNAs were heated at 90°C for 3 minutes,incubated at 37°C and cleavage reactions initiated with 10 mMMgCl2. Linear time frames of reactions and ribozyme saturationwere determined from graphs of percentage cleavage versustime.

Single- and Multiple-Turnover Kinetics:Determining t1/2, k2, k21, Vmax and Km

Ribozyme and substrate RNAs were preannealed at 37°C for 5minutes in saturating conditions of ribozyme excess, therebyenabling determination of single-turnover parameters includ-ing the t1/2 of substrate RNA, k2, and substrate k21.

Kinetic Pathway for a Hammerhead Ribozyme

Rz 1 S ¢O¡k1

k21

RzS ¢O¡k2

k22

RzP1P2 7 Rz 1 P1 1 P2

where Rz is ribozyme; P1 and P2 are cleavage products 1 and2, RzS is the ribozyme–substrate complex, and S is the sub-strate.

The t1/2 was determined over two t1/2s from linear por-tions of a graph of the fraction of uncleaved target RNA versustime, k2 was calculated from k2 5 ln2/t1/2,8 and k21 wasdetermined using a pulse–chase experiment with saturatingmolar excesses of ribozyme and a trace of labeled substrate andchased with a 100-fold excess of unlabeled substrate.6,8 Multi-ple-turnover parameters such as Vmax (Vmax of reaction) andKm (affinity of ribozyme for target RNA) were determinedwithin steady state intervals under conditions of substrate

FIGURE 1. Structure of hammerhead ribozyme Rz40. The two anti-sense arms (stems 1 and 3) flanking the conserved catalytic core andthe double-stranded region (stem 2) of the ribozyme are shown. TheGUC target site 475-477 is italicized with an arrow indicating the exactposition of cleavage in human rhodopsin mRNA.

2864 O’Neill et al. IOVS, September 2000, Vol. 41, No. 10

excess. Vmax and Km were calculated using the followingequations.10

Vmax 5Sv2/a2Sv2 2 ~Sv2/a!2

Sv2/a2Sv 2 Sv2/aSv/a

Km 5Sv2Sv/a 2 Sv2/aSv

Sv2/a2Sv 2 Sv2/aSv/a

where a is substrate concentration, and v is the rate of reac-tion.

Reactions were also performed under multiple-turnoverconditions in the presence and absence of a 250-fold excess of

COS-7 cellular RNA to ribozyme RNA. Molar ratios of target toribozyme RNA ranged between 1.25:1 and 5:1.

Size Marker

MspI–cut pBR322 DNA was labeled with [a32P] dCTP. Frag-ment sizes were 622, 527, 404, 307, 242, 238, 217, 201, 190,180, 160, 147, 123, 110, 90, and 76 bases.

RESULTS

The computer program RNAPlotFOLD was used to identifysingle-stranded areas in rhodopsin and peripherin transcriptsthat may be accessible to hammerhead ribozymes.5,6,9 Three

FIGURE 2. Cleavage time points of(A) human peripherin RNA and Rz9and (B) human rhodopsin RNA andRz10. Graphs were used to determineribozyme saturation and also to iden-tify the linear component of the cleav-age reaction. Cleavage times were 0,5, 7.5, 10, 20, 30, 60, and 180 minutesfor Rz9 and Rz10. All reactions wereperformed with 10 mM MgCl2 at37°C. Right: Molar ratios of substrateto ribozyme RNA.

IOVS, September 2000, Vol. 41, No. 10 Ribozyme-Based Therapies for Retinitis Pigmentosa 2865

monomeric and one multimeric ribozyme were designed totarget large predicted open-loop structures in these two tran-scripts. Rz10, Rz40, and RzMM target degenerate sites in hu-man rhodopsin transcripts and Rz9 targets the 59UTR of thehuman peripherin transcript. The hammerhead structure of

Rz40, including the consensus sequence of the catalytic core,11

GUC cleavage motif, and flanking antisense sequences thatprovide specificity of the ribozyme for human rhodopsinmRNA, is presented in Figure 1. Kinetic profiles have beengenerated for all ribozymes in vitro.

FIGURE 3. Cleavage gels of humanrhodopsin RNA by Rz10 in the absence(A) and presence (B) of a 250-fold ex-cess of total cellular RNA. Lanes 1through 8: Molar ratios of substrateRNA to ribozyme of 1:0.2, 1:0.4, 1:0.5,1:0.6, 1:0.8, 1:2, 1:5, and 1:10, respec-tively. Rates of each multiple-turnoverreaction were used to determine Vmax

and Km parameters. Arrowheads: Hu-man rhodopsin RNA and 59 and 39cleavage products (584 and 277bases). (C) Lineweaver–Burk plot ofhuman rhodopsin RNA cleavage byRz10 under multiple- and single-turn-over conditions, in both the presenceand absence of total cellular RNA.

‹

FIGURE 4. Cleavage gels of human rhodopsin RNA by a 10-fold molar excess of Rz10 alone (A) and in the presence of a 100-fold excess ofnonradioactively labeled chase rhodopsin RNA (B). Lanes 1 through 7: Reaction time frames of 0.5, 1, 3, 5, 10, 15, and 20 minutes, respectively.Arrowheads: Target rhodopsin RNA, 59 and 39 cleavage products. (C, D) Percentage of cleavage of human rhodopsin RNA by (C) Rz10 and (D)Rz40 in the absence and presence of chase RNA. Control reactions are also indicated. Results were used to determine k2 and k21 parameters. (E)Cleavage gel of human peripherin RNA by a 50-fold molar excess of Rz9. Lanes 1 through 8: Cleavage times of 10 seconds and 5, 10, 20, 30, 60,120, and 180 minutes, respectively. Arrowheads: Intact peripherin target RNA (545 bases) and 59 and 39 cleavage products (194 and 295 bases).Notably, cleavage of the highly structured target RNA almost reached completion. (F) Cleavage profile of human rhodopsin RNA by the multimericribozyme construct. Lane 1: DNA ladder. Lanes 2 through 8: A 10-fold molar excess of RzMM and rhodopsin RNA for 0, 5, 10, 20, 40, 60, 90, and120 minutes. Reactions were performed in the presence of 10 mM MgCl2 at 37°C. Filled arrowheads: Target rhodopsin RNA and labeled ribozyme.Open arrows: Spectrum of cleavage products. Because any one or more of the monomeric ribozymes within the multimeric construct can functionat any given time, it was not possible to determine which cleavage products were the result of a specific ribozyme or combination of ribozymes.However, cleavage of the target RNA almost reached completion.

2866 O’Neill et al. IOVS, September 2000, Vol. 41, No. 10

IOVS, September 2000, Vol. 41, No. 10 Ribozyme-Based Therapies for Retinitis Pigmentosa 2867

Steady State Intervals and Ribozyme Saturation

Saturating levels of ribozyme over target transcripts were iden-tified using graphs of percentage cleavage versus time (Figs.2A, 2B). Saturation was deemed to have been achieved whenno additional substrate cleavage was observed regardless of themolar excesses of ribozyme used. Notably, molar excesses ofribozyme to substrate as low as 8:1 (Rz9 to human peripherinRNA) and 4:1 (Rz10 to human rhodopsin RNA) were sufficientto achieve saturation (Figs. 2A, 2B). Linear time frames for Rz9,Rz10, and Rz40 cleavage reactions were 30, 6, and 6 minutes,respectively, as determined using time points with varyingratios of substrate RNA to ribozyme (Fig. 2).

Multiple-Turnover Kinetics

Vmax and Km for Rz9, Rz10, and Rz40 were determined withinlinear time-frames under conditions of substrate excess. Rz10,despite its long target (861 bases), was found to be extremelyactive, achieving a Vmax of 0.71 min21, in the same range asthat observed for ribozymes targeting short, unstructured tran-scripts.12 The Km value for Rz10 was 8.3 nM. Similar Vmax andKm values of 0.55 min21 and 6.75 nM respectively were ob-tained with Rz40. The Km value for Rz40 suggests that thisribozyme may have a slightly higher affinity for rhodopsin RNAthan Rz10. This may be due to the single-base mismatchpresent in one antisense arm of Rz10 that is absent in Rz40.Given the lower Vmax value obtained with Rz40, it may be thatthe inclusion of such a mismatch should be given consider-ation in the future design of therapeutic ribozymes to increasetheir catalytic efficiencies. Data indicate that Rz9 (Vmax 5 0.23min21, Km 5 13.1 nM) is approximately three times less activethan Rz10 or Rz40 and has a reduced affinity for its target.Kinetic profiles suggest that these ribozymes are extremelyefficient in vitro and thus may be valuable as potential muta-tion-independent therapeutic agents for adRP.

Inhibition experiments were performed as described ear-lier but with a 250-fold excess of cellular RNA to Rz10 (Figs.3A, 3B, 3C). Cleavage of the target by Rz10, although reducedby approximately 25%, remained specific. Vmax in the absenceand presence of total RNA was similar: 0.71 min21 and 0.8min21, respectively (Fig. 3C), whereas Km values increasedfrom 8.3 nM to 26.55 nM, suggesting a reduction in binding ofRz10 to human rhodopsin RNA. Typically, competitive inhibi-tion results in an increased Km, and Vmax remains unaltered,whereas uncompetitive inhibition causes reduced Vmax valueswith unaltered Km.10 The data suggest that addition of cellularRNA to cleavage reactions with Rz10 causes competitive inhi-bition.

Single-Turnover Kinetics

The k2, substrate k21 and t1/2 of substrate RNA were deter-mined for Rz10 and Rz40 under single-turnover conditions.The t1/2s for human rhodopsin RNA, cleaved by Rz10 and Rz40,were 28 and 30 seconds, respectively (Figs. 4A through 4D).Similar k2s of 1.47 min21 and 1.38 min21 for Rz10 and Rz40,respectively, were generated from the t1/2s (Figs. 4A through4D). Rz10 and Rz40 were notably efficient. More than 50% ofthe 861-base rhodopsin target was cleaved in less than 30seconds (Fig. 4A). The single-base mismatch in Rz10 would bepredicted to increase the k[minus]1 because of possible desta-bilization of substrate and ribozyme binding.13 As predicted,

k21s for Rz10 and Rz40 showed that the k21 for Rz10 (0.55min21) was slightly greater than that for Rz40 (0.4 min21). Incontrast Rz9 was found to be significantly less efficient thaneither Rz10 or Rz40 under both single- and multiple-turnoverconditions (see earlier description). However, cleavage of hu-man peripherin RNA by Rz9 over time almost reached comple-tion under conditions of ribozyme excess (Fig. 4E).

Cleavage Profile of Multimeric Ribozyme RzMM

A multimeric ribozyme (RzMM) consisting of four hammerheadribozymes directed to degenerate sites in human rhodopsinRNA was generated and tested in vitro. Figure 4F illustrates thecleavage profile of RzMM. Because any single ribozyme ormultiple ribozymes within the multimeric cassette may poten-tially cleave the transcript, a number of cleavage products wereobserved. Using a 10:1 molar ratio of RzMM to target RNA,approximately 85% of target transcripts were cleaved (Fig. 4F).Because of the large number of potential cleavage productsgenerated by RzMM, kinetic parameters could not be accu-rately determined. However, RzMM does not appear, at least invitro, to be more efficient than Rz10 or Rz40.

DISCUSSION

Therapies for diseases such as RP could be targeted to specificmutations that give rise to pathologic changes in disease. Forexample, the Gly51Val rhodopsin mutation known to causeadRP creates a hammerhead ribozyme target NUX site thatfortuitously occurs in an accessible region of the human rho-dopsin RNA (determined by RNAPlotFold; data not shown).However, most mutations do not create NUX sites and are notsituated in accessible regions of target transcripts. In addition,given that more than 150 different rhodopsin and peripherinmutations can give rise to adRP and various photoreceptordegenerations,1 it is apparent that mutation-independent ap-proaches for therapy that circumvents genetic heterogeneitywould be highly preferable.5 Such approaches may be valuablenot solely for RP but for many other inherited diseases withsimilar high levels of genetic heterogeneity. Two mutation-independent approaches were adopted in the present studythat exploit inherent features of the genome, either the degen-eracy of the genetic code or UTRs of a transcript. For example,Rz10, Rz40, and RzMM target human rhodopsin transcripts atvarious wobble sites, thereby exploiting the degeneracy of thecode and enabling the introduction of a replacement gene withmodified sequences around wobble sites. For all mutation-independent ribozymes tested replacement genes coding forwild-type protein but with marginally altered sequencesaround the ribozyme target site have been shown to escaperibozyme cleavage in vitro.5 A connected multimeric ribozyme(RzMM) has also been evaluated for cleavage of human rho-dopsin transcripts. RzMM simultaneously targets four degener-ate sites in open-loop structures of human rhodopsin RNA.Studies have indicated that it may be advantageous to usemultimeric ribozymes to achieve efficient cleavage of targetRNAs.7 Populations of alternative RNA conformations may becleaved at one or multiple sites by different ribozymes in themultimeric cassette. RzMM cleaved human rhodopsin RNA intoa range of cleavage products as expected for a multimeric

2868 O’Neill et al. IOVS, September 2000, Vol. 41, No. 10

ribozyme and represents the first such multimeric ribozymedesigned to target a retinal transcript (Fig. 4F).

Kinetic profiles of ribozymes in vitro can be used as broadpredictors of activity in vivo.2 All ribozymes developed in thestudy elicited sequence-specific cleavage of retinal target tran-scripts, yielding cleavage products of predicted sizes. Detailedkinetic analyses showed that Rz10 and Rz40 were extremelyactive under all conditions tested. For example, the Vmax ob-tained for Rz10 targeting a degenerative site in an 861-baserhodopsin transcript was 0.71 min21 thereby achieving a Vmax

in the range obtained with ribozymes that target short, unstruc-tured RNAs (approximately 20 bases).12 The efficiency of Rz10is highlighted by the observation that typically reductions inVmax of 200- to 1000-fold have been observed for ribozymesdirected to long-structured RNAs.14 Although Rz9 was threetimes less active than Rz10 and had a slightly higher Km value,the ribozyme nevertheless was more active in vitro than manyother ribozymes (Fig. 4E).15 In addition, single-turnover kineticparameters were determined for Rz10 and Rz40. Values for k2

may vary considerably; however, it has been suggested that k2

typically ranges from 0.4 to 2.5 min21 for ribozymes that targetunstructured RNAs.15 It is of note that k2s for Rz10 and Rz40(1.47 min21 and 1.38 min21, respectively) were significantlygreater than their corresponding k21s (0.55 min21 and 0.4min21, respectively) contributing to the efficiency of bothribozymes.

Efficiencies of ribozymes in vitro only broadly predictpotential efficiencies in vivo.2 In this regard, a number ofmouse models of rhodopsin-linked retinal degenerations thatcould be used to test the functionality of these ribozymes–forexample, mice carrying human rhodopsin transgenes withPro23His Val20Gly, Pro27Leu, Gln344ter, Pro296Glu, orPro347Ser mutations–are available.16 Moreover, there are nowmany reports demonstrating that hammerhead ribozymes canbe functional in both cell and animal systems. One such studyused a ribozyme targeting a mutant human rhodopsin trans-gene in a rat model of a retinal degeneration.4 Given theefficiency of the ribozymes evaluated in the present study theyshould be valuable in the development of mutation-indepen-dent therapeutic approaches for inherited photoreceptor de-generations such as adRP.

In summary, hammerhead ribozymes Rz10, Rz40, andRzMM, which target human rhodopsin transcripts, and Rz9,which targets human peripherin transcripts, have been foundto be extremely efficient in vitro after detailed kinetic analyses.Comparative analyses with previously reported ribozymes sug-gest that, despite their longer and more structured targets,these retinal ribozymes achieve cleavage rates similar to many

ribozymes that target short, unstructured RNAs of 20 to 40bases. Moreover, the design of these ribozymes is such thatthey are the first therapeutically relevant ribozymes that willenable mutation-independent gene silencing of retinal genesimplicated in dominantly inherited retinopathies.

References

1. McKusick VA. On-line Mendelian Inheritance in Man, available athttp://ncbi.nlm.nib.gov/omim, entry 180380 and 179605; ac-cessed June 18, 1999.

2. Birikh KR, Heaton PA, Eckstein F. The structure, function andapplication of the hammerhead ribozyme. Eur J Biochem. 1997;245:1–16.

3. Grassi G, Forlino A, Marini JC. Cleavage of collagen RNA tran-scripts by hammerhead ribozymes in vitro is mutation-specific andshows competitive binding effects. Nucleic Acids Res. 1997;25:3451–3458.

4. Lewin AS, Dresner KA, Hauswirth WW, et al. Ribozyme rescue ofphotoreceptor cells in a transgenic rat model of autosomal domi-nant retinitis pigmentosa. Nat Med. 1998;4:967–971.

5. Millington–Ward S, O’Neill B, Tuohy G. et al. Stratagems in vitrofor gene therapies directed to dominant mutations. Hum MolGenet. 1997;6:1415–1426.

6. Millington–Ward S, O’Neill B, Kiang A-S, et al. A mutation-indepen-dent therapeutic stratagem for osteogenesis imperfecta. AntisenseNucleic Acids Drug Dev. 1999;9:537–542.

7. Ramezani A, Ding SF, Joshi S. Inhibition of HIV- 1 replication byretroviral vectors expressing monomeric and multimeric hammer-head ribozymes. Gene Ther. 1997;4:861–867.

8. Hendry P, McCall MJ, Lockett TJ. Characterising ribozyme cleavagereactions. In: PC Turner, ed. Ribozyme Protocols. Clifton, NJ:Humana Press; 1997.

9. Zuker M. Computer prediction of RNA structure. Methods Enzy-mol. 1989;180:262–288.

10. Cornish–Bowden A, Wharton CW. Simple enzyme kinetics. In:Rickwood D, ed. Enzyme Kinetics. Oxford, UK: IRL Press; 1990:14–45.

11. Haseloff J, Gerlach WL. Simple RNA enzymes with new and highlyspecific endoribonuclease activities. Nature. 1988;334:585–591.

12. Zaug AJ, Grosshans CA, Cech TR. Sequence-specific endoribo-nuclease activity of the tetrahymena ribozyme: enhanced cleavageof certain oligonucleotide substrates that form mismatched ri-bozyme-substrate complexes. Biochemistry. 1988;27:8924–8931.

13. Werner M, Uhlenbeck OC. The effect of base mismatches in thesubstrate recognition helices of hammerhead ribozymes on bind-ing and catalysis. Nucleic Acids Res. 1995;23:2092–2096.

14. Campbell TB, McDonald CK, Hagen M. The effect of structure in along target RNA on ribozyme cleavage efficiency. Nucleic AcidsRes. 1997;25:4985–4993.

15. Stage–Zimmerman TK, Uhlenbeck OC. Hammerhead ribozymekinetics. RNA. 1998;4:875–889.

16. Lem J, Makino CL. Phototransduction in transgenic mice. CurrOpin Neurobiol. 1996;6:453–458.

IOVS, September 2000, Vol. 41, No. 10 Ribozyme-Based Therapies for Retinitis Pigmentosa 2869