Differentiation of Human Embryonic Stem Cells Encapsulated in Hydrogel Matrix Materials

IntroductionThe use of human embryonic stem cells (hESCs) as the

source of neural cells for transplantation therapies has sev-

eral advantages [1]. hESCs are a source of many well-charac-

terized human stem and progenitor cell types that correspond

to the cells found in a developing embryo. Recent studies

Differentiation of Human Embryonic Stem Cells to

Dopaminergic Neurons in Serum-Free Suspension Culture

Thomas C. Schulz,a Scott A. Noggle,b,c Gail M. Palmarini,a Deb A. Weiler,a

Ian G. Lyons,a Kate A. Pensa,eAdrian C.B. Meedeniya,e Bruce P. Davidson,a,e

Nevin A. Lambert,d,f Brian G. Condiea,b

aBresaGen Inc.,Athens, Georgia, USA; bDepartment of Genetics, University of Georgia,Athens, Georgia, USA;cInstitute of Molecular Medicine and Genetics and dDepartments of Pharmacology and Toxicology, Medical

College of Georgia,Augusta, Georgia, USA; eBresaGen Ltd., Thebarton,Adelaide,Australia; fMedical Research

Service,Augusta Veterans Affairs Medical Center,Augusta, Georgia, USA

Key Words. Embryoid bodies • ES cells • Differentiation • Neural differentiationSerum-free medium • Real-time RT-PCR

Abstract The use of human embryonic stem cells (hESCs) as asource of dopaminergic neurons for Parkinson’s diseasecell therapy will require the development of simple andreliable cell differentiation protocols. The use of cellcocultures, added extracellular signaling factors, ortransgenic approaches to drive hESC differentiationcould lead to additional regulatory as well as cell produc-tion delays for these therapies. Because the neuronal celllineage seems to require limited or no signaling for its for-mation, we tested the ability of hESCs to differentiate toform dopamine-producing neurons in a simple serum-free suspension culture system. BG01 and BG03 hESCswere differentiated as suspension aggregates, and neuralprogenitors and neurons were detectable after 2–4 weeks.Plated neurons responded appropriately to electrophysi-ological cues. This differentiation was inhibited by earlyexposure to bone morphogenic protein (BMP)-4, but a

pulse of BMP-4 from days 5 to 9 caused induction ofperipheral neuronal differentiation. Real-time poly-merase chain reaction and whole-mount immunocyto-chemistry demonstrated the expression of multiplemarkers of the midbrain dopaminergic phenotype inserum-free differentiations. Neurons expressing tyrosinehydroxylase (TH) were killed by 6-hydroxydopamine (6-OHDA), a neurotoxic catecholamine. Upon plating, thesecells released dopamine and other catecholamines inresponse to K+ depolarization. Surviving TH+ neurons,derived from the cells differentiated in serum-free sus-pension cultures, were detected 8 weeks after transplan-tation into 6-OHDA–lesioned rat brains. This work sug-gests that hESCs can differentiate in simple serum-freesuspension cultures to produce the large number of cellsrequired for transplantation studies. Stem Cells 2004;22:1218–1238

STEM CELLS 2004;22:1218–1238 www.StemCells.com

Correspondence: Thomas C. Schulz, Ph.D., BresaGen Inc., 111 Riverbend Rd.,Athens, Georgia, 30605, USA. Telephone: 706-613-9878; Fax: 706-613-9879; e-mail: [email protected]; and Brian G. Condie, Ph.D., Department of Genetics, Life Sci-ences Building, University of Georgia, Athens, GA 30602, USA. Telephone: 706-542-1431; Fax: 706-583-0691; e-mail:[email protected] Received May 14, 2004; accepted for publication July 2, 2004. ©AlphaMed Press 1066-5099/2004/$12.00/0 doi: 10.1634/stemcells.2004-0114

Original Article

Stem Cells®

Matthew Holt

have documented important advances in the culture of

hESCs for cell therapy. This work indicates that it will be

possible to propagate normal and undifferentiated hESCs

without feeder cells in highly defined and controlled culture

conditions, allowing the generation of master cell banks to

support cell transplants [2–4]. In addition to the ability to

propagate and expand hESCs in well-defined conditions, it

will be important to develop methods to differentiate the cells

using simple and well-defined culture conditions. Ideally,

differentiation should be carried out in a serum-free environ-

ment using approaches that can be easily scaled for the pro-

duction of large numbers of differentiated cell types. The

cells cultured in these conditions should respond to known

developmental modulators in a way predicted from their nor-

mal function in vivo or shown in other differentiation studies

of hESCs or nonhuman embryonic stem (ES) cells.

Previous studies have shown that grafts of fetal midbrain

dopaminergic neurons could survive, reinnervate, and func-

tion in patients with Parkinson’s disease (PD) and provide a

proof of principal for this approach [5]. However, two dou-

ble-blind controlled trials revealed significant issues that

need to be addressed before larger trials are warranted [6, 7].

One concern is the difficulty in standardizing the fetal mid-

brain tissue used for implantation, which will be critical for

consistent clinical outcomes. The generation of midbrain

dopamine neurons from hESCs would provide cell popula-

tions that could be expanded, characterized, and standard-

ized in vitro, providing optimal populations for studies in

animal models of PD [8]. This approach would also provide a

useful model for many aspects of human neurogenesis,

including examination of the molecular and developmental

controls of the midbrain lineage and functional analyses of

their cellular and physiological characteristics. Several

methods to generate midbrain dopaminergic neurons from

mouse and primate ES cells currently exist, some of which

have led to recovery of symptoms in rat models of PD after

cell implantation [9–11]. Many of these rely on complex

multistep protocols requiring the exposure of the cells to

stromal cell lines [12, 13], multiple growth factors [9, 14], or

expression of transgenes such as Nurr1 [11]. The utility of

these methods to direct differentiation from hESCs has not

yet been reported, and use of cocultures, added signaling fac-

tors, or transgenic approaches could lead to additional regu-

latory as well as cell production barriers that will complicate

their use in eventual therapies and increase their cost.

We have previously reported effective neural differentia-

tion of hESCs in serum-free conditions under the influence

of the HepG2-conditioned medium MedII [15]. In this study

we report the differentiation of hESCs to midbrain dopamin-

ergic neurons in a simple serum-free suspension system.

This occurred in the absence of added growth factors or neu-

ral-inducing agents, demonstrating that it was driven by sig-

naling within suspension aggregates. We showed that this

differentiation was initially inhibited by bone morphogenic

protein (BMP)-4, but later BMP signaling induced periph-

eral neuronal differentiation. These effects of BMP-4 were

the same as those previously observed in cultures of mouse or

nonhuman primate ES cells, demonstrating that cell fates can

be easily manipulated by the addition of exogenous factors in

our culture system. The differentiated tyrosine hydroxy-

lase–positive (TH+) neurons were susceptible to 6-hydroxy-

dopamine (6-OHDA), plated cultures released dopamine and

other catecholamines upon depolarization, and surviving

TH+ neurons were detected 8 weeks after transplantation to

the 6-OHDA–lesioned rat brain. Our approach represents a

simple and potentially scalable platform for the large-scale

derivation of dopaminergic neurons for studies in animal

models of PD and the molecular, cellular, and physiological

examination of this differentiation pathway.

Materials and Methods

Human Embryonic Stem Cell Culture The NIH-registered BG01 and BG03 cell lines were used in

this work (http://stemcells.nih.gov/index.asp). Microdissec-

tion-passaged hESCs were cultured and passaged as

described [15, 16], whereas collagenase/trypsin-passaged

hESCs were grown in 20% knockout serum replacer (KSR)

human ES medium. This medium consisted of 50/50 Dul-

becco’s modified Eagle’s medium (DMEM)/F12 (Invitro-

gen, Grand Island, NY, http://www.invitrogen.com) supple-

mented with 20% KSR (Invitrogen), ✕ 1 nonessential amino

acids (Invitrogen), 20 mM L-glutamine (Invitrogen), 0.5

U/ml penicillin/0.5 U/ml streptomycin (Invitrogen), 4 ng/ml

fibroblast growth factor (FGF)-2 (Sigma, St. Louis,

http://www.sigma-aldrich.com), and 0.1 mM β-mecap-

toethanol (Sigma) with or without 10 ng/ml human leukemia

inhibitory factor (LIF; Chemicon, Temecula, CA, http://

www.chemicon.com), which did not noticeably affect the

maintenance or differentiation of hESCs. Collagenase/

trypsin hESCs were passaged by treatment with 1 mg/ml col-

lagenase (Invitrogen) for 4 minutes, followed by 0.05%

trypsin/EDTA (Invitrogen) for 30 seconds and trituration to

single cells or small clumps. Fetal calf serum (FCS), 10%

(HyClone, Logan, UT, http://www.hyclone.com) in DMEM/

F12, was added to the hESC suspension, followed by cen-

trifugation, aspiration, and resuspension in culture medium.

hESCs were replated at 1.5 ✕ 105 cells, on 1.2 ✕ 106 mouse

embryonic fibroblasts (MEFs), per 35-mm dish and prolifer-

ated to 0.85 to 1.0 ✕ 106 hESCs after 3–4 days.

BG01 hESCs were also passaged as clumps using

EDTA-free trypsin (Invitrogen). Cells were grown on 1.2 ✕

Schulz, Noggle, Palmarini et al. 1219

106 MEFs per 35-mm dish in 20% KSR human ES medium

(without LIF) that had been conditioned on MEFs for 24

hours [4]. These cells were passaged by treating with 0.05%

EDTA-free trypsin (Invitrogen) for 30 seconds, removing the

feeder layer by pulling it off the plate with watchmakers for-

ceps, scraping the adherent hESC colonies off the dish, and

gently triturating with a P1000 pipette until the colonies were

disaggregated to clumps of ~10 to 100 cells. The trypsin was

neutralized with 10% FCS in DMEM/F12, and the colony

clumps were centrifuged and replated at a density to maintain

more than 200 colonies per 35-mm dish.

Derivation of Collagenase/Trypsin-Passaged and SSEA-4–Enriched BG01 CellsUndifferentiated BG01 hESCs were adapted to collagenase/

trypsin passaging and enriched by magnetic sorting using an

anti-stage specific embryonic antigen-4 (SSEA-4) antibody

(Developmental Studies Hybridoma Bank, University of

Iowa, Iowa City, IA, http://www.uiowa.edu/~dshbwww/) and

the MACS separation system (Miltenyi Biotec,Auburn, CA,

http://www.miltenyibiotec.com/) according to the manufac-

turer’s instructions. Differentiated colonies were excised

from a culture of microdissection-passaged BG01 hESCs.

The culture was maintained for 5 to 10 passages using colla-

genase/trypsin disaggregation as described above, before

SSEA-4 immunomagnetic enrichment. For enrichment, the

cells were harvested enzymatically as described, and the

enzymes were inactivated by adding 10% fetal bovine serum

(FBS)/10% KSR human ES medium and passed through a

cell strainer (Becton, Dickinson, Franklin Lakes, NJ,

http://www.bd.com). For blocking, cells were pelleted and

resuspended in staining buffer (SB) (5% FBS, 1 mM EDTA,

0.5 U/ml penicillin and 0.5 U/ml streptomycin, in Ca2+/Mg2+-

free phosphate-buffered saline [PBS]). The cells were pel-

leted and resuspended in 1 ml primary anti-SSEA-4 antibody

diluted 1:10 in SB and incubated at 4ºC for 15 minutes. SB, 9

ml, was then added, and the cells were pelleted and washed

(10 ml SB was added and repelleted). A total of 1 ✕ 107 cells

were resuspended in 80 µl SB and incubated with 20 µl mag-

netic goat anti-mouse immunoglobulin G (IgG) MicroBeads

at 4ºC for 10 minutes. SB, 1.9 ml, and then fluorescent-conju-

gated secondary antibody, 2 µl (Alexa-488 conjugated goat

anti-mouse IgG [Molecular Probes, Eugene, OR, http://www.

probes.com]), were added to enable fluorescent analysis of

the separation. The sample was incubated for 5 minutes at 4ºC

and then brought to 10 ml with SB, pelleted, washed, resus-

pended in 500 µl SB, and applied to a separation column that

had been equilibrated with 3 ✕ 500 µl SB and prepositioned on

the selection magnet. The flow-through and three washes

with 500 µl SB were collected, which presumably contained a

SSEA-4– population. The column was removed from the

magnet, 500 µl SB was forced through with a plunger, and the

presumed SSEA-4+ cell population was collected in a 15-ml

tube. A total of 9.5 ml 20% KSR human ES medium was

added, and the cells were pelleted and resuspended in 1 ml of

the same medium. A total of 105 SSEA-4–enriched hESCs

were plated on MEFs on 35-mm dishes, and the cells were

maintained in 20% KSR ES medium and passaged withcolla-

genase/trypsin as described above.

To examine the effectiveness of the enrichment, aliquots

of the starting population, the flow/wash sample, and SSEA-

4–enriched sample were analyzed by flow cytometry. Typi-

cally, 85% of the cells in the starting hESC populations were

SSEA-4+, which was enriched to >99% SSEA-4+ cells after

immunomagnetic selection. The nonretained flow through

exhibited ~60% SSEA-4+ cells. A secondary antibody alone

as negative control exhibited background staining on only

0.5% of cells.

Neural Differentiation of hESCsTrypsin/collagenase-passaged cultures were treated with col-

lagenase, and whole hESC colonies were removed from the

feeder layer using a fire-drawn Pasteur pipette needle, washed

with DMEM, and placed in suspension culture in differentia-

tion medium. Microdissection-passaged BG01 and BG03

cultures were harvested for differentiation by excising whole

colonies using glass needles. The differentiation media used

were either a MedII/FGF2 medium (DMEM/F12, 1 ✕ N2

[Invitrogen], 20 mM L-glutamine, 0.5 U/ml penicillin, 0.5

U/ml streptomycin, 4 ng/ml FGF-2, and 50% serum-free

MedII) or a DMEM/N2 medium (DMEM, 1 ✕ N2, 20 mM L-

glutamine, 0.5 U/ml penicillin, 0.5 U/ml streptomycin).

MedII was made as described previously [17], except the base

medium used for conditioning was DMEM/N2 medium

(above). Cultures were differentiated for 2–6 weeks in sus-

pension, and the media changed every 5–7 days. For adherent

culture, differentiated aggregates were cut into pieces with

glass needles or razor blades and were plated on dishes or Per-

manox slides coated with 20 µg/ml polyornithine (Sigma)

and 1 µg/ml laminin (Sigma) in MedII/FGF2 medium or Neu-

robasal medium (Invitrogen) containing 1 ✕ B27 (Invitrogen),

5% FCS (Hyclone), 2 ng/ml glial-derived neurotrophic factor

(GDNF) (R&D Systems, Minneapolis, http://www.rnd

systems.com/), 10 ng/ml brain-derived neurotrophic factor

(BDNF) (R&D Systems), 20 mM L-glutamine, 0.5 U/ml

penicillin, and 0.5 U/ml streptomycin.

Immunostaining and HistochemistryWhole-mount immunostaining of cell aggregates was per-

formed in 15-ml tubes using 200- to 500-µl volumes for anti-

body binding and 2- to 5-ml volumes for washes with 1✕

PBS. Immunostaining of adherent cells used the same solu-

1220 Dopaminergic Differentiation of hESCs

tions. Cultures were fixed in 4% paraformaldehyde (PFA)

(Fisher Scientific, Hampton, NH, http://www.fisherscien-

tific.com) and 4% sucrose (Sigma) in 1✕ PBS. Samples were

blocked with 3% goat serum (Invitrogen), 1% polyvinyl

pyrolidone (Sigma), and 0.3% Triton X-100 (Sigma) in 1✕

PBS (block buffer; Triton X-100 was omitted for cell-surface

immunostaining) and then incubated with primary antibody

diluted in block buffer for 1–2 hours at room temperature.

Samples were then washed and incubated for 1–2 hours in

secondary antibodies diluted 1:1,000 in block buffer, fol-

lowed by washing. The secondary antibodies were goat anti-

rabbit, anti-sheep, anti-rat, or anti-mouse antibodies (Molec-

ular Probes) conjugated with Alexa-350 (blue), 488 (green),

568 (red), or 647 (far red). Nuclei were stained with 5 ng/ml

4',6'-diamidino-2-phenylindole (DAPI; Sigma). Whole-

mount suspension immunostainings were mounted on glass

slides and gently flattened with a coverslip to enable visuali-

zation. Individual color channels were captured separately

with a Q Imaging digital camera on a NIKON E1000 or TE

2000E microscope and merged in Adobe Photoshop. Confo-

cal and 2-photon confocal imaging was performed using a

Leica TCS SP2 Spectral Confocal Microscope. Negative con-

trols using secondary antibody alone did not exhibit staining.

The primary antibodies (supplier, catalog number, and dilu-

tion) used were microtubule-associated protein 2 (MAP2)

(Sigma, M4403, 1:500), Nestin (Chemicon,AB5922, 1/200),

Nestin (Chemicon, MAB5326, 1:200),Vimentin (Chemicon,

CBL202, 1:200), OCT-4 (Santa Cruz Biotech, Santa Cruz,

CA, http://www.scbt.com; sc-5279, 1:100), βIII tubulin

(Sigma,T8660, 1:500), Neurofilament H (Sternberger Mono-

clonals, Lutherville, MD, http://home.att.net/~sternbmono

c/home.htm; SMI32, 1:500), HuC/D (Molecular Probes,

A-21271, 1:500), TH (Pel-Freez Biologicals, Rogers, AR,

http://www.pelfreez-bio.com; P60101-0, 1:100), TH (Pel-

Freez, P40101, 1:250), phospho-TH(Ser40) (Cell Signaling

Technologies, Beverly, MA, http://www.cellsignal.com;

2791, 1:250), dopamine transporter (DAT) (Chemicon, MAB

369, 1:50), aromatic amino acid decarboxylase (AADC)

(Pel-Freez, P40401-0, 1:200), Synapsin (Chemicon,

MAB355, 1:100), Synaptophysin (Chemicon, MAB5258-

20UG, 1:250), Tau (Chemicon, MAB361, 1:200), vesicular

monoamine transporter 2 (VMAT2) (Chemicon, AB1767,

1:500), SSEA-1 (DSHB, MC-480, 1:5), SSEA-3 (DSHB,

MC-631, 1:5), SSEA-4 (DSHB, MC-813-70, 1:5), Tra-1-60

(Chemicon, MAB4360, 1:100), Tra-1-81 (Chemicon,

MAB4381, 1:100), glial fibrillary acidic protein (GFAP;

Sternberger, SMI21, 1:100), dopamine β-hydroxylase (DβH)

(Chemicon, AB1536 1:100), and Peripherin (Chemicon,

AB1530, 1:100). The SSEA-1, -3, -4 monoclonal antibodies

developed by Davor Solter and Barbara Knowles were

obtained from the Developmental Studies Hybridoma Bank

developed under the auspices of the NICHD and maintained

by The University of Iowa, Department of Biological Sci-

ences. Embedding of suspension aggregates, sectioning,

staining, and counting of DAPI-stained nuclei were per-

formed as described [15].

6-Hydroxydopamine Treatment of Differentiated Aggregates 6-OHDA experiments were performed on cell aggregates

differentiated for 1 month in DMEM/N2. 6-OHDA (Sigma)

was prepared in 0.2 mg/ml ascorbic acid (Sigma) with 1✕

PBS, and DMEM/N2 aggregates were exposed to 0.2 mg/ml

ascorbic acid (negative control), 10 mM or 1 mM 6-OHDA,

or 10 mM and 1 mM 6-OHDA plus 100 mM dopamine

(Sigma) for 10 minutes. Aggregates were washed exten-

sively and incubated in MedII/FGF2 medium for a 5-hour

recovery. Aggregates were fixed and stained as whole-mount

preparations for βIII tubulin and TH.

Focused cDNA ArrayGEArray Q series cDNA array filters (HS-601; SuperArray,

Frederick, MD, http://www.superarray.com) were probed

nonradioactively with biotin dUTP-labeled cDNA, accord-

ing to the manufacturer’s protocol. Total RNA was prepared

from BG01 suspension aggregates differentiated in

DMEM/N2 for 6 weeks using the Trizol reagent (Invitrogen),

and 4 µg RNA was used to make a labeled cDNA probe for

each filter. Hybridizations were detected by chemilumines-

cence and exposure to x-ray film.

Electrophysiology Electrophysiology was performed as described previously

[18]. Whole-cell recordings were made from cells with

neuronal morphology (visible neurites) on the stage of an

inverted phase-contrast microscope using standard electro-

physiological techniques using a potassium gluconate–

based internal solution. Glutamate was applied via a large-

bore pipette positioned immediately in front of the cell under

study, which was continuously perfused with a physiological

saline.

Reverse Transcription–Polymerase ChainReaction and Real-Time ReverseTranscription–Polymerase Chain ReactionPrimers and probes used for polymerase chain reaction

(PCR) are listed in Table 1. RNA was isolated with the Trizol

reagent (Invitrogen) and treated with DNase I (Promega,

Madison,WI, http://www.promega.com). First-strand cDNA

was generated using a Superscript first-strand synthesis kit

(Invitrogen), according to the manufacturer’s protocols. A

total of 2.5 µg DNase I treated RNA was used in each cDNA


synthesis, in a total volume of 60 µl. The synthesis reaction

was heat inactivated and diluted to 200 µl, such that 5 µl of

template, or the equivalent of 62.5 ng RNA, was used in each

25-µl PCR reaction. Real-time PCR was performed in tripli-

cate using master mixes (Applied Biosystems, Foster City,

CA, http://www.appliedbiosystems.com) for the TaqMan

system or SYBR green incorporation and an ABI Prism 7700

detector. Mock reverse transcriptase minus cDNAs were


Table 1. Primers used in reverse transcriptase–polymerase chain reaction

Gene Primers F (top), R (bottom) Probe, or size, restriction site, cut products

GAPDH GAAGGTGAAGGTCGGAGTC 6FAM-CAAGCTTCCCGTTCTCAGCC-TAMRA

GAAGATGGTGATGGGATTTC

GAPDH TGAAGGTCGGAGTCAACGGATTTGGT 982 bp

CATGTGGGCCATGAGGTCCACCAC

SOX1 CACAACTCGGAGATCAGCAA 171 bp, BssHII digestion: 92,78

GTCCTTCTTGAGCAGCGTCT

MAP2 CAGGAGACAGAGATGAGAATTCCTT 6FAM-CCACCAGGTCAGAGCCAATTCGCA-TAMRA

GTAGTGGGTGTTGAGGTACCACTCTT

EN1 ACGTTATTCGGATCGTCCAT 6FAM-AGAAGGAGGACAAGCGGCCG-TAMRA

GAACTCCGCCTTGAGTCTCT

NURR1 CCCAGTGGAGGGTAAACTCA 151 bp, EcoRI digestion: 94,56

AATGCAGGAGAAGGCAGAAA

PITX3 GAGCTATGCAAAGGCAGCTT 6FAM-ACACCTCCTCGTAGGGCGGC-TAMRA

AGTTGAAGGCGAATGGAAAG

LMX1B AACTGTACTGCAAACAAGACTACC 292 bp

TTCATGTCCCCATCTTCATCCTC

TH AGCTGTGAAGGTGTTTGAGACGT 6FAM-TCCACCATCTAGAGACCCGGCCC-TAMRA

TCGAGGCGCACGAAGTACT

AADC CTCGGACCAAAGTGATCCAT 212 bp, SacI digestion:45,166

GTCTCTCTCCAGGGCTTCCT

VMAT2 CCGCCCTGGTACTCTTGGAT 6FAM-TTCAGCTCTTTGTGCTCCAGCCGTC-TAMRA

GGGTGTCCCCTTCTGACTCTCT

DAT CCAGGACTCGCGTGCAA 6FAM-AGAAGCACAGAATTCCTCAA-TAMRA

TGCTCTTACTCATGGGCACACT

GIRK2 AGCAAGGTTTCTGGTGCCTA 129 bp, BamHI digestion: 63,65

TGTAACTGCCACACCCACAT

DβH GCAGATCTCGTGGTGCTCT 146 bp, BamHI digestion: 83,62

AGCAGGGTCAGGCCTTCT

CHAT CGTGGACAACATCAGATCG 147 bp, HindIII digestion: 88,58

ATGGCCATGACTGTGTATGC

VGLUT1 ACCCTGCTCCTCTCTGTCCT 142 bp, PstI digestion: 109,32

GGGGAATTTGGGTATCCTTG

VGLUT2 GCGTCAAGTAGAGGCGACAT 149 bp, EcoRV digestion: 48,100

TTTGAGGACTAACAAAATATCTCACA

VGLUT3 GAGCTGCGCTCAGTTGATAA 133 bp, HincII digestin: 55,77

TTGAACAACATGGTATTGTCTCC

GAD67 TTTGTGAGCCAAAGAGAAAAGA 150 bp, EcoRI digestion: 97,52

AACAGGATTTGCCATGATTACT

GFAP TCATCGCTCAGGAGGTCCTT 353 bp (Vercovi, Exp Neurol(99) 156:71-83)

CTGTTGCCAGAGATGGAGGTT

Abbreviations:AADC, aromatic amino acid decarboxylase; DAT, dopamine transporter; DβH, dopamine β-hydroxylase; TH, tyro-sine hydroxylase; VMAT2, vesicular monoamine transporter 2.

used as negative controls for each primer set and were all

negative. The thermal parameters were 50°C for 2 minutes

and 94°C for 10 minutes, followed by 40 cycles of 95°C for

15 seconds and 60°C for 1 minute. The specificity of amplifi-

cation of products detected with SYBR green was demon-

strated by melting curve analyses as well as digestion at inter-

nal restriction sites and electrophoresis. Standard curves

were used to determine the amplification efficiency of each

primer set, and the REST software (http://www.gene-quan-

tification.info/) [19] was used to determine relative gene

expression from cycle crossing point data and statistical sig-

nificance using a pair-wise fixed reallocation randomization

test. These comparisons factor in primer efficiencies and nor-

malization to parallel glyceraldehyde-3-phosphate dehydro-

genase (GAPDH) reactions.

The following standard conditions were used with end-

point reverse transcription (RT)-PCR analysis: 25-µl reac-

tions using Taq DNA polymerase (Invitrogen) and cDNA

prepared as above; a first denaturation step of 95°C for 1

minute, followed by 35-cycle reactions of 95°C for 30 sec-

onds, 54°C for 1 minute, and 72°C for 2 minutes; agarose

electrophoresis; and detection with SYBR green staining.

For the LMX1B expression comparison, captured elec-

trophoretic images were compared and normalized to

GAPDH using ImageJ version 1.31 (http://rsb.info.nih.gov/

ij/upgrade/).

Evoked Release of Dopamine and HPLC Adherent cultures were depolarized with 56 mM KCl/

Hanks’ balanced salt solution (HBSS) for 15 minutes or

HBSS as a negative control, and metabisulfite and ortho-

phosphoric acid were added to stabilize the samples [20].

HPLC detection of dopamine was performed at the Neuro-

chemistry Analytical Core Laboratory, John F. Kennedy

Center, Vanderbilt University, Nashville, TN (http://www.

mc.vanderbilt .edu/root/vumc.php?site=neurosci&

doc=697). Briefly, samples were mixed with the internal

standard dihydroxybenzylamine, and catecholamines were

extracted by adsorption to solid Al203, washed, and dead-

sorbed with 0.1 N acetic acid. Samples were injected into a

HPLC system consisting of a Waters Model 515 pump,

Waters 717+ Autosampler, and an Antec Electrochemical

Detector. A calibration curve run along with the unknown

samples was used to calibrate the instrument.

Transplantation into 6-OHDA–Lesioned RatsAdult Sprague-Dawley rats (Harlan, IN) were lesioned uni-

laterally by injection of 4 µl of 6-OHDA (Sigma; 2 mg/ml in

0.2 mg/ml ascorbic acid [Sigma]/PBS) over 4 minutes into

the left medial forebrain bundle (coordinates:AP, –4.3 mm;

L, –1.5 mm; D, –8.8 mm; with a 1-mm correction for Dura

depth). Lesioning was verified by assessing the rotational

response of the animals to amphetamine. Two and 4 weeks

after lesioning, a subcutaneous injection of 5 mg/kg amphet-

amine (Sigma) was administered and rotations were assessed

in an automated rotometer (AccuScan, Columbus, OH). Rats

showing significant ipsilateral rotations (>3 rpm) were used

for implantations. Differentiated suspension aggregates

were dissected into pieces (~103 to 2 ✕ 103 cells per piece),

and 1 to 10 pieces were implanted in a 1- to 5-µl volume over

5 minutes per rat using a Kopf Stereotaxic frame and Hamil-

ton syringe. Cell clumps were implanted into the lesioned

striatum using the following injection coordinates:AP, +0.9;

L, –2.7; D, –6.0. The rats were given daily injections of

cyclosporin A (10 mg/kg) starting on the day before cell

implantation and for a period of 8 weeks before euthanasia

and collection of whole brains by cardiac perfusion with 4%

PFA. Animal research protocols (#A2002-10120-0) were

reviewed and approved by the University of Georgia,Athens,

GA, and experiments were conducted according to institu-

tional guidelines. A coarse section of the fixed rat brain

encompassing the injection site was isolated using a razor

blade and brain matrix, dehydrated through graded alcohols,

and permeabilized with dimethylsulfoxide before embed-

ding in a 3:1 mixture of polyethylene glycol 1,450:1,000.

Microtome sections of the brain 12- and 20-µm thick were

obtained, and hematoxylin and eosin staining was used to

locate the implant site. Verification that human cells were

found used a modified in situ hybridization detection method

[21] with two Biotin-tagged oligonucleotides to the human

genome-specific Alu repeat sequence. Immunohistochemi-

cal characterization of the surviving implanted cells was per-

formed using a sequential free-floating protocol, and sec-

tions were transferred among standard permeabilization,

blocking, and antibody-containing solutions in a multiwell

tray format with watchmakers forceps. Fluorescently conju-

gated secondary antibodies were detected using epifluores-

cence microscopy, whereas horseradish peroxidase–conju-

gated secondary antibodies were visualized with a diamino-

benzidine chromogenic reaction.

Results

Collagenase/Trypsin Passaging and SSEA-4 Enrichment of hESCsThe BG01 and BG03 hESC lines [16] were used in this study

and are listed on the NIH registry. Until the time of this study,

these cells had been maintained exclusively by manual

microdissection of individual undifferentiated colonies

(microdissection passaging). Because of the ability to selec-

tively passage morphologically undifferentiated cells,

microdissection passaging is currently the most appropriate


method to maintain long-term cultures of undifferentiated

hESCs and may contribute to the maintenance of a normal

karyotype [22]. However, this approach is laborious, and

scaling up cultures for experiments is difficult. Therefore, we

tested several enzymatic cell dissociation methods for main-

taining and expanding BG01 cells. After cell dissociation

with collagenase and trypsin, undifferentiated BG01 cells

were enriched by immunomagnetic-bead cell sorting using a

monoclonal antibody against SSEA-4, a cell-surface antigen

that is robustly expressed on pluripotent hESCs [23, 24].

Flow cytometric analysis of a representative experiment

detected SSEA-4 expression on 85% of the starting popula-

tion of cells, whereas 99.2% of the cells expressed SSEA-4

after immunomagnetic enrichment, with 60.7% of cells in

the flow-through being SSEA-4+. Cultures enriched for

SSEA-4–expressing cells (Fig. 1A) grew as colonies that

strikingly resembled those of mouse ES cells and other hESC

lines passaged with trypsin [25] and exhibited the character-

istic profile of the following pluripotent markers expressed

by hESCs: SSEA-1–, SSEA-3+, SSEA-4+, Tra-1-60+ (Figs.

1B–1E, respectively), Tra-1-81+ (not shown), and OCT-4+

(Fig. 1F). In addition, aggregates of SSEA-4+ cells allowed to

differentiate in a serum-containing medium formed cells

expressing ectodermal (Nestin, Sox1), endodermal (Amy-

lase, AFP), and mesodermal (Cardiac actin) markers, sug-

gesting that the SSEA-4–enriched cells could form lineages

of the three embryonic germ layers (not shown) and main-

tained their pluripotency. These hESCs also expressed the

neural progenitor markers nestin (Fig. 1F) and vimentin (Fig.

1G). Expression of vimentin has been detected in the H1

hESC line by RT-PCR and immunocytochemistry [26, 27],

whereas RT-PCR has detected nestin expression in some

lines but not others [27–29]. It is possible that nestin is

expressed in at least a subset of the cells within most other

established hESC lines.

To produce the numbers of cells required for these stud-

ies in a timely fashion, we used cultures of BG01 cells main-

tained by collagenase/trypsin dissociation and SSEA-4

enrichment unless otherwise noted. Because of the possibil-

ity of accumulating aneuploidies as well as spontaneously

differentiated cells in enzymatically passaged BG01 cul-

tures, these cells were not used beyond approximately 20

passages after SSEA-4 enrichment or 30 total passages with

collagenase/trypsin. Chromosome counting indicated that

under these culture conditions, up to 50% of cells had an

abnormal karyotype after a total of 33 passages with collage-

nase/trypsin (I. Nasonkin, unpublished data). Key experi-

ments (derivation and proliferation of neural progenitors in

DMEM/N2, the generation of large networks of TH+ cells but

rare DβH+ cells in suspension aggregates, and evoked release

of dopamine) were confirmed using karyotypically normal

BG01 and BG03 cells maintained by passaging as clumps of

cells, either with microdissection passaging or disaggrega-

tion using EDTA-free trypsin.

Neural Differentiation of hESCs in a Serum-Free Minimal MediumA summary of the neural and dopaminergic differentiation

observed in these experiments is outlined in Table 2. We per-

formed differentiation experiments using variations of two

basic conditions: 50% MedII-conditioned medium plus

FGF2 (DMEM/F12+N2+MedII+FGF2) and DMEM plus

N2 supplement (minimal medium). Experiments were typi-

cally analyzed after 1 month in suspension, and both of these

conditions supported the differentiation of large networks of

TH+ neurons. Because initial survival of cell aggregates was

lower in DMEM/N2 conditions, we also derived cell aggre-


Figure 1. Culture and neural differentiation of hESCs. (A): Col-lagenase/trypsin-passaged and SSEA-4–enriched BG01hESCs. BG01 cells were SSEA-1– (B), SSEA-3+ (C), SSEA-4+

(D), Tra-1-60+ (E), OCT-4+ and Nestin+ (F), and Vimentin+ (G).(H): βIII tubulin and (I) TH immunostaining of platedMedII/FGF2 differentiations. (J): Merged image of (H, I). TH(K), vesicular monoamine transporter 2 (L), and merged (M)immunostainings of plated MedII–/FGF2+ differentiations showcell body staining. Scale bars = 100 µm (A, H–J) and 50 µm(B–G, K–M). Abbreviations: DAPI, 4',6'-diamidino-2-phenylindole; FGF2, fibroblast growth factor 2; hESC, humanembryonic stem cell; TH, tyrosine hydroxylase .

gates into MedII/FGF2 for 3–5 days, followed by 1 month in

minimal medium, which also generated large networks of

TH+ neurons. We used minimal DMEM/N2 conditions as a

base to assess the role of additional factors on neural differ-

entiation. Finally, for some analyses, differentiated aggre-

gates were plated to adherent culture for approximately 1–2

weeks in either MedII/FGF2 or Neurobasal medium supple-

mented with B27, serum, BDNF, and GDNF, because mini-

mal DMEM/N2 conditions did not support effective attach-

ment of differentiated aggregates to adherent culture.

We initially tested the ability of the collagenase/

trypsin–passaged and SSEA-4–enriched BG01 cells to dif-

ferentiate in serum-free conditions in MedII/FGF2 medium

[17]. MedII-conditioned medium has been shown previously

to promote neural differentiation from mouse, rhesus mon-

key, and human embryonic stem cells [15, 18, 30]. Whole

hESC colonies were removed from the feeder layer and cul-

tured in suspension. Characteristic folds and rosettes of neu-

ral precursors were observed after 5–10 days of culture, as

observed in differentiations performed from microdissec-

tion-passaged hESCs [15]. Cell aggregates were plated on

polyornithine/laminin-coated chamber slides 2 or more

weeks after derivation and cultured for an additional 5–7

days before immunostaining. Stained cultures were highly

enriched for nestin+ neural precursor rosettes and large net-

works of βIII tubulin+ (Fig. 1H) neurons. Most of these neu-

rons also expressed TH (Figs. 1I, 1J). Scoring of isolated βIII

tubulin–expressing neurites in merged images showed that

approximately 75% (69 of 90, n = 5 fields) were TH+/βIII

tubulin+. This was strikingly different from our previous dif-

ferentiations from microdissection-passaged hESCs [15], in

which suspension cultures were plated after only approxi-

mately 1 week of culture and previous reports [29, 31, 32], in

which TH+ neurons were rare. MedII seemed to enhance

rather than induce neuronal differentiation, because signifi-

cant differentiation to TH+ and VMAT2+ neurons also

occurred in the same medium without added MedII (Figs.

1K–1M).

The ability of BG01 cell aggregates to differentiate into

neurons in serum-free suspension culture led us to test the

role of the added MedII and FGF2 in promoting early neural

lineage formation. In these experiments, hESC aggregates

were cultured in DMEM/N2. Unlike FGF2/MedII differenti-

ations, aggregates incubated in DMEM/N2 exhibited a very

high level of obvious cell death through their first approxi-

mately 2 weeks, indicating that MedII/FGF2 contributed sig-

nificantly to cell survival. This was consistent with our previ-

ous results, indicating that MedII provided a cell survival/

proliferation activity rather than a neural inducing factor

[15]. Only hESC aggregates that were initially larger than

approximately 150 µm were viable and proliferated in the

minimal medium, suggesting a community effect in the

delivery of essential growth factors and signaling within dif-

ferentiating aggregates. After differentiation for 2 weeks in


Table 2. Summary of neural differentiation experiments

Neural TH+

Treatmenta Growth differentiation neurons

MedII/FGF2 +++ +++ High

DMEM/N2 ++b +++c High

MedII/FGF2 for 3–5 days, +++ +++ Highthen DMEM/N2

DMEM/N2 + serum +++ ++d Raree

DMEM/N2 + BMP4 Poor Poor —

DMEM/N2 + BMP4 + serum +++ Poor Rare

DMEM/N2 + BMP4 days 5–9 +++ +++ Highf

aTypical 1-month suspension differentiations.bInitial high cell death and survival of aggregates larger than approximately 150 µm.cMinimal conditions seem to support neural precursor and neuronal differentiation at theexpense of other cell types.

dHigher degree of nonneural differentiation such as cysts.eRare TH+ cells by immunostaining.fHigh proportion of peripherin+ neurons indicative of neural crest–derived peripheral differ-entiation. Abbreviations: BMP, bone morphogenic protein; DMEM, Dulbecco’s modified Eagle’smedium; FGF2; fibroblast growth factor 2; TH, tyrosine hydroxylase.

DMEM/N2, aggregates seemed to be comprised largely of

neural precursor rosettes/neurectoderm structures (Fig. 2A).

As suspension aggregates were cultured further, there

appeared to be a gradual loss of this distinct morphology,

from approximately 2–4 weeks, possibly indicating a shift

away from neural progenitor proliferation to neuronal differ-

entiation (not shown). However, persistence of neural pre-

cursor rosettes could be detected even after 4 weeks of differ-

entiation. Sectioning, followed by toluidine blue or DAPI

staining (Fig. 2B), demonstrated that at 2 weeks, cell aggre-

gates cultured in DMEM/N2 were comprised of distinctly

organized regions of neural precursor rosettes and nonrosette

regions. Counts of DAPI-stained nuclei (Fig. 2B, inset) indi-

cated that rosette neural progenitor structures comprised 39.4

± 12.3% (14334/36663 nuclei, n = 11 sections) of the cells.

The nonrosette regions were demonstrated by whole-mount

analysis and counting of anti-HuC/D and DAPI-stained over-

layed images to contain 45.5 ± 7.2% HuC/D+ early postmi-

totic neurons (445/984 cells, n = 5 fields). DMEM/N2 aggre-

gates were also dense with βIII tubulin+ neuronal extensions

(Fig. 2C) and TH+ neurons (Fig. 3A). The rosettes exhibited a

characteristic structure with a core of tightly packed prolifer-

ating neural precursor cells, of which 7.3 ± 4.4% (30 of 376, n

= 7 fields) exhibited condensed mitotic chromosomes when

DAPI-stained nuclei in 1-µm confocal optical sections were

counted. Rosette cells expressed nestin (Figs. 2E, 2G) and


Figure 2. Neural differentiation of DMEM/N2 suspensionaggregates. (A): Suspension DMEM/N2 aggregates after 2weeks. Inset shows a higher magnification indicating a centralcavity (*), surrounded by the radial organization of the neuroep-ithelia. (B): Three-µm plastic section of DMEM/N2 aggregatesstained with toluidine blue or DAPI (inset), showing neural pre-cursor rosettes (arrows) and nonrosette regions (*). (C): Whole-mount βIII tubulin immunostaining and 1-µm confocal opticalsection of suspension DMEM/N2 aggregates. Rosette area isindicated (*). (D): Whole-mount DAPI staining and 2-photon,1-µm optical confocal section of DMEM/N2 aggregates. Con-densed chromosomes in the core regions of rosettes (arrows) andtwo adjacent rosettes (dashed lines) are indicated. (E): Nestinexpression in neural rosette cells. The arc of a rosette is indicated(dashed lines). (F, G): Coexpression of Vimentin and nestin inneural rosette cells. (H–J):Whole-mount HuC/D immunostain-ing and DAPI staining of DMEM/N2 aggregates. (H): DAPIstaining (in grayscale) showing a neural precursor rosette(dashed oval). (I, J): HuC/D was expressed in the cells immedi-ately surrounding the rosette structures. (K–M): Immunostain-ing of plated DMEM/N2 aggregates demonstrated that rosette-associated (dashed oval) early neurons were postmitotic, withno double-positive (K) phospho-HistoneH3 and (L) HuC/Dcells detected (M). Synapsin (N), synaptophysin (Synapt.) (O),and GFAP (P) expression in plated cultures is shown. (P): Inset,reverse transcription–polymerase chain reaction of GFAPexpression in DMEM/N2 suspension aggregates. (Q, R):DMEM/N2 differentiation-derived neurons plated inMedII/FGF2 possess the physiological characteristics of centralnervous system neurons. (Q): Leak-subtracted current (I) tracesevoked by a family of increasingly depolarizing voltage (V)commands (–50, –30, –10, +10 mV) from a holding potential of–70 mV are shown superimposed. Inward and outward currentscharacteristic of sodium and delayed-rectifier potassium cur-rents were evoked in 9 of 10 cells. (R): Inward membrane cur-rent and an increase in noise evoked by application of 1 mM glu-tamate (indicated by horizontal bar); holding potential was –70mV. Similar currents were evoked in 10 of 10 cells. Scale bars =100 µm (A, B, C, N), 50 µm (B inset, H–J, K–M), and 25 µm(D, E, F, G, P, O). Abbreviations: DAPI, 4',6'-diamidino-2-phenylindole; DMEM, Dulbecco’s modified Eagle’s medium;GFAP, glial fibrillary acidic protein.

vimentin (Figs. 2F, 2G), whereas expression of HuC/D, a

marker of early postmitotic neurons [33], was first observed

in the differentiating cells surrounding the rosettes (Figs.

2H–2J). Double immunostaining of plated cultures with

HuC/D and phospho-HistoneH3, a mitotic marker [34], was

used to confirm the postmitotic status of the neurons associ-

ated with neural precursor rosettes, with no phospho-

H3+/HuC/D+ cells being observed from >500 counted

HuC/D+ cells (Figs. 2K–2M). Expression of synapsin (Fig.

2N) and synaptophysin (Fig. 2O) was detected in plated neu-

rites, suggesting the formation of synaptic complexes. In

addition to the analysis of the cell aggregates with immuno-

cytochemistry, the expression of general neuron markers as

well as markers of neurotransmitter phenotypes was deter-

mined by RT-PCR analysis and a focused microarray screen.

We analyzed gene expression in BG01 DMEM/N2 suspen-

sion aggregates after 6 weeks of differentiation using a

focused array of 266 human genes, selected to represent dif-

ferent human stem cell populations [35, 36]. We compared

gene expression in hESCs and in differentiated aggregates

(Fig. 4) and found 14 transcripts that were upregulated in the

differentiated cells. Many of these genes have known or pre-

sumed function during neural development and differentia-

tion, including BMP signaling (BMPR2), FGF signaling

(FGF11, FGFR1, FGFR2), WNT signaling (FZD3), neuro-

genic functions (CXCR4, DLK1, VEGF), and neurotrophin

signaling (NTRK2). Of the 11 SOX-family transcription fac-

tors present on the array, only SOX1, 2, 3, and 4, which

exhibit neural tube/progenitor expression or function, were

detected. Common markers of neuronal cell function were

also upregulated such as neurofilaments (INA, NEFL),

MAP2, and NCAM1. The expression of FGF11 confirmed

that the differentiated aggregates contained neuronal pro-

genitors. In a previous analysis of rat central nervous system

(CNS) progenitors, it was found that FGF11 expression was

activated after neuronal precursors appeared within the CNS,

and cell sorting of the progenitors showed FGF11 expression

exclusively within the E-NCAM+ neuronal progenitor popu-

lation [37]. In addition, the focused array contained more

than 22 markers of differentiated nonneural lineages repre-

senting endoderm, mesoderm, and nonneural ectoderm.

Expression of most of these markers (20 of 22) was not

detected (Fig. 4), confirming enriched neural differentiation

in these aggregates. A previous characterization of the sensi-

tivity of similar focused microarrays showed a 96% corre-

spondence between the results of the arrays and RT-PCR

analysis [37]. This shows that these focused micro-

arrays are quite sensitive because of the use of gene-specific

primers in making the cDNA probe. The overall pattern of

expression in BG01 hESCs using this array was similar to

that reported previously [35]. Transcripts that were upregu-

lated in hESCs were CER1, FGF2, DNMT3B, FOXM1,

FZD7, ITGA6, PDGFA, POU5F1, and TERF1. RT-PCR

analysis of DMEM/N2 suspension aggregates at 4 weeks

detected expression of choline acetyltransferase, vesicular

glutamate transporters 1, 2, and 3, and the vesicular inhibi-

tory amino acid transporter (not shown), which are markers

of cholinergic, glutaminergic, and GABAergic/glycinergic

neurons, respectively. The expression of GAD67 was not

detected by immunostaining or RT-PCR analysis, suggesting

that few γ-aminobutyric acid (GABA)–producing neurons

were present. The capacity for glial differentiation was

demonstrated by the expression of GFAP (Fig. 2P, inset).


Figure 3. BMP-4 and serum affect neural and dopaminergic dif-ferentiation. BG01 hESC aggregates were differentiated underdifferent conditions and examined after 1 month. (A–C): BMP-4 inhibits neuronal differentiation of hESCs. (A): DMEM/N2aggregates and parallel cultures containing (B) 10 ng/ml BMP-4or (C) 10 ng/ml BMP-4 and 10% fetal calf serum generated 180,18, and ~300 viable aggregates 11 days after derivation, respec-tively. Aggregates were immunostained with βIII tubulin andTH, demonstrating dense neuronal networks (A) and nearlycomplete inhibition of neuronal differentiation (B). An exampleof maximal neuronal differentiation in +BMP-4 conditions isshown, with other aggregates exhibiting no neurons. (C):Recovery and enhanced overall aggregate viability, but neuronaldifferentiation was not restored. (D–F): Addition of BMP-4 toDMEM/N2 differentiations from days 5 through 9 inducedperipheral neuronal differentiation. (D): Rare peripherin+ cellsin DMEM/N2 differentiations. (E): High proportions of βIIItubulin+/TH+ cells generated with d5-9 BMP-4 treatment, but(F) large proportions of peripherin+ cells were induced. (G–I):Serum inhibits dopaminergic differentiation. Differentiations in10% serum showed an increase in nonneural differentiation (G,H) but still generated a large number of βIII tubulin+ neurons.Only rare TH+ neurons were observed. (I): RT–polymerasechain reaction for LMX1B expression in DMEM/N2 and 10%serum conditions. Scale bars = 100 µm (A–C, G) and 50 µm(D–F, H). Abbreviations: DMEM, Dulbecco’s modified Eagle’smedium; hESC, human embryonic stem cell; RT, reverse tran-scription; TH, tyrosine hydroxylase.

This analysis suggested that a range of neural lineages could

be generated in this system.

To physiologically verify the phenotype of hESC-

derived neurons, whole-cell voltage-clamp recordings were

made from DMEM/N2 differentiations plated to adherent

culture in MedII/FGF2 medium. Depolarizing voltage com-

mands from a negative holding potential evoked rapid inward

sodium currents and delayed outward potassium currents

(n = 9 of 10 cells; Fig. 2Q). Application of the excitatory and

inhibitory neurotransmitters glutamate (Fig. 2R) and GABA

(not shown) evoked rapidly desensitizing membrane cur-

rents consistent with the expression of ionotropic glutamate

and GABA receptors (n = 10). Therefore, these neurons

expressed the voltage- and ligand-gated ion channels that

would allow them to generate action potentials and receive

synaptic information.

Early Exposure to BMP-4 Antagonizes Neuronal Differentiation and Later Exposure Induces Peripheral NeuronsTo demonstrate that the cell aggregates cultured in minimal

medium would respond to extracellular factors, we tested the

effect on neural differentiation of early or late exposure to

BMP-4. We tested the ability of BMP signaling to antagonize

the formation of neuronal lineages in hESC aggregates cul-

tured in minimal medium. BMPs are a potent inhibitor of neu-

ral development and are known to induce nonneural ectoderm

at the expense of neural ectoderm [38–40]. We performed dif-

ferentiations from parallel dishes of BG01 hESCs using three

conditions: DMEM/N2 medium alone, DMEM/N2 + BMP-

4, and DMEM/N2 + BMP-4 + FCS. Addition of 10 ng/ml

BMP-4 to the DMEM/N2 minimal medium led to an approxi-

mately 10-fold reduction in aggregate viability and nearly

completely blocked the formation of βIII tubulin+ and

βIII tubulin+/TH+ neurons compared with aggregates in

DMEM/N2 (Figs. 3A, 3B). Addition of serum to BMP-4–

containing differentiations improved aggregate viability but

did not restore the neural differentiation observed in DMEM/

N2 conditions (Fig. 3C). These observations suggest that

BMP-4 blocked neural lineage formation from the hESCs and

instead stimulated the formation of nonneural serum-depend-

ent cell types when cells were exposed to BMP-4 from day 1

of the differentiation. This was consistent with the known role

of BMP-4 as an antagonist of neural lineage formation in

Xenopus embryos and mouse ES cells [40]. In later stages of

neural development, BMP signals induce the formation of

neural crest cells from the dorsal crest of the neuroepithelium

[41–43]. To examine the response of hESC differentiations to

a later BMP signal, we added 10 ng/ml BMP-4 to DMEM/N2

differentiations from days 5 through 9, followed by culture in

DMEM/N2 until 1 month after derivation. Unlike an early

BMP signal, late exposure to BMP-4 did not affect the viabil-

ity of aggregates. Whole-mount immunostaining using anti-

bodies to TH, βIII tubulin, and peripherin, a marker of neural


Figure 4. Focused array of gene expression in BG01 hESC and DMEM/N2 suspension aggregates differentiated for 6 weeks. The spotsand names of the transcripts that were upregulated in each condition are indicated (arrows). The bottom row shows the indicated controlcDNAs. Marker expression in DMEM/N2 differentiations: SOX genes expressed: SOX1,2,3 (neural tube/progenitors), SOX4 (differ-entiating neural progenitors, heart, B cells). SOX genes not detected: SOX5,6,10,13,15,17,18 (chondroblasts, neural crest, kidney,ovary, embryonic artery, testis, definitive endoderm, heart). Markers of nonneural lineages that were not detected: AFP, MYH11,CDH3,5,15, FABP4,6, GATA4, GCG, INSRR, ISL1, KRT8,14,15,17, MYH6, MYL4, NKX2.5, PECAM1, TNC (yolk sack, liver, smoothmuscle, placenta, mammary gland, vascular, endothelia, muscle, adipose, enterocyte, heart, gut, epithelia, pancreas, kidney, islet,platelets, endothelial cells, mesenchyme, cartilage, bone). Abbreviations: DMEM, Dulbecco’s modified Eagle’s medium; hESC,human embryonic stem cell.

crest–derived peripheral neurons [44, 45], detected a high

proportion of βIII tubulin+/TH+ cells (Fig. 3E) but also a large

number of peripherin+ cells (Fig. 3F), indicating the presence

of neural crest–derived neurons. In contrast, only rare periph-

erin+ neurons were found in aggregates differentiated in

DMEM/N2 (Fig. 3D), demonstrating that most of the βIII

tubulin+/TH+ neurons represented a neural tube/CNS lineage.

We also examined the effect that addition of serum

would have on differentiation within this system. In aggre-

gates differentiated in DMEM/N2 plus 10% serum, large net-

works of βIII tubulin+ neurons could still be detected after 1

month despite an increased amount of nonneural differentia-

tion, such as cysts, compared with aggregates in DMEM/N2.

The proportion of TH+ neurons was greatly reduced in

DMEM/N2 plus serum compared with DMEM/N2 (Figs.

3G, 3H). This indicated that although effective neuronal

differentiation was possible in serum, factors present in

these conditions may inhibit presumptive dopaminergic dif-

ferentiation. Consistent with this, the midbrain dopaminer-

gic marker LMX1B [46, 47] was expressed at elevated levels

in DMEM/N2 compared with serum-containing conditions

(Fig. 3I).

Neurons in the Cell Aggregates Express Multiple Markers Characteristic of Dopamine Neural Precursors and NeuronsBecause large networks of TH+ neurons were generated in

DMEM/N2 conditions, but not in the presence of added

serum, we examined gene expression in these conditions

using multiple neural and dopaminergic markers. Real-time

PCR was performed and gene expression was compared in

differentiated aggregates after 4 weeks using GAPDH–nor-

malized relative gene expression ratios (Table 3). Expres-

sion of SOX1 [48, 49] and MAP2 confirmed the presence of

neural precursors and differentiated neurons, respectively, in

both conditions. Higher expression of SOX1 in serum-free

conditions and MAP2 in serum-containing conditions sug-

gested that there was a bias toward proliferation of neural


Table 3. Real-time reverse transcription–polymerase chain reaction comparison of gene expression inaggregates differentiated in serum or serum-free conditions

Serum Serum-free

Gene EFFa Mean CPb SD Mean CPb SD Ratioc p value

GAPDHd 1.49 17.018 0.09 16.839 0.26 1.07 .706

SOX1 1.47 27.745 0.01 23.287 0.04 5.12 .001e

MAP2 1.72 19.091 0.17 22.369 0.21 0.21 .001e

EN1 1.61 31.397 0.14 28.104 0.01 5.84 .081

NURR1 1.91 24.248 0.05 23.244 0.03 1.78 .025e

PITX3 1.62 32.512 0.08 30.750 0.06 2.18 .001e

LMX1Bf 1.5f

TH 1.77 28.961 0.18 31.788 0.17 0.25 .033e

AADC 1.84 25.985 0.04 22.960 0.03 5.89 .001e

VMAT2 1.52 30.820 0.16 31.384 0.04 0.96 .783

DAT 1.59 32.182 0.08 33.366 0.01 0.54 .001e

GIRK2 1.87 26.755 0.50 23.194 0.01 7.11 .001e

DβH 1.90 27.579 0.12 28.635 0.16 0.47 .001e

Aggregates were differentiated for 1 month.aPrimer efficiencies.bTriplicate reactions.cRelative expression ratio (serum-free/serum), normalized with parallel GAPDH controls.dExample of one set of GAPDH control reactions, n = 3. Overall ratio was 0.95, n = 12. eStatistically significant.fDetermined by end-point reverse transcription–polymerase chain reaction and densitometry.Abbreviations: AADC, aromatic amino acid decarboxylase; CP, threshold crossing point; DAT,dopamine transporter; DβH, dopamine β-hydroxylase; EFF, primer efficiencies; SD, standard devia-tion; TH, tyrosine hydroxylase; VMAT2, vesicular monoamine transporter 2.

precursors in serum-free conditions and differentiation to

neurons under the influence of serum. Several transcription

factors that are involved in the specification of the midbrain

dopaminergic lineage, EN1, NURR1, PITX3, and LMX1B,

were all expressed at higher levels in serum-free conditions,

at approximately 5.8-, 1.8-, 2.2-, and 1.5-fold, respectively

[46, 47, 50–56]. The difference in expression of NURR1 and

PITX3 was statistically significant (p = .025 and .001,

respectively), whereas the difference in EN1 (p = .081)

expression was not significant in this analysis. The compari-

son of LMX1B expression was performed by densitometry of

end-point RT-PCR (Fig. 3I). Analysis of markers of differen-

tiated dopaminergic neurons demonstrated expression of

TH, AADC, VMAT2, and the DAT in both conditions. Only

AADC (p = .001) showed significant elevated expression in

serum-free conditions, with VMAT2 not being significantly

different and TH and DAT showing elevated expression in

serum-containing conditions. The GIRK2 channel protein is

a marker of A9 dopaminergic neurons [57], which are the

major dopamine neuron subtype depleted in Parkinson’s dis-

ease [58–60]. GIRK2 was expressed approximately 7.1-fold

higher in serum-free conditions (p = .001). Expression of

DβH, a more specific marker for other catecholaminergic

neurons, was upregulated in 10% serum (p = .001). This

expression analysis suggested formation of lineages express-

ing these markers in both conditions, with elevated expres-

sion of dopaminergic transcription factors and some markers

of differentiated neurons in DMEM/N2 conditions. How-

ever, because this was a population-wide analysis, we also

performed immunostaining to determine the relative distri-

bution of neurons expressing some of these markers.

To quantify the proportion of neurons in DMEM/N2 dif-

ferentiations that expressed TH, aggregates were plated in

adherent culture in MedII/FGF2 medium. Extensive net-

works of TH+ neurons were observed (Figs. 5A, 5B) at a far

greater abundance than reported previously [15, 29, 31, 32].

Scoring of isolated βIII tubulin+ neurites in overlayed

images showed that 73.9 ± 10.5% (46 of 64, n = 3 fields)

were TH+/βIII tubulin+ (Figs. 5A, 5B; panels 1, 2). To sup-

port the formation of mature neuron cell types, DMEM/N2

aggregates were plated in medium containing GDNF,

BDNF, and 5% serum, a formulation known to support the

survival of mouse ES cell–derived dopaminergic neurons

[61]. Counting of cell bodies demonstrated that TH+ neurons

comprised 63.8 ± 4.6% (689 of 1,085 cells, n = 3 wells) of

the MAP2+ population, whereas VMAT2+ neurons com-

prised 94.9 ± 2.9% (317 of 334 cells, n = 3 wells) of the

MAP2+ population. Figure 5C shows an example of the most

highly differentiated TH+ neurons observed in these cul-

tures, exhibiting a cell body, an approximately 580-µm den-

dritic extension and spines, and presumed growth cone.

Additional immunostaining analysis demonstrated expres-

sion of additional markers of the dopaminergic phenotype in

DMEM/N2 differentiations. Coexpression of the βIII tubu-

lin, TH, VMAT2, and DAT proteins was demonstrated in

aggregates in DMEM/N2 suspension cultures (Fig. 5D),

which is similar to what was seen in MedII/FGF2 suspen-

sion aggregates (Fig. 5E). Coexpression of TH and active

phospho-TH(Ser40) (Fig. 5F) [62], expression of the pan-

neuronal marker TAU [63] and AADC (Fig. 5G), and coex-

pression of TH and DAT (Figs. 5H, 5I) were also demon-

strated. Although RT-PCR analysis had detected DβH

message in DMEM/N2 aggregates, expression was signifi-

cantly lower than in 10% serum conditions. We used

immunostaining to detect DβH-expressing cells in 4-week

suspension aggregates. Only rare DβH+ cells were detected

in DMEM/N2 aggregates from trypsin-passaged BG01

cells, as well as from microdissection-passaged BG01 (Fig.

5J) and BG03 (Fig. 5K) cells that were differentiated with an

initial 5 days in MedII/FGF2 followed by 1 month in

DMEM/N2. These differentiations, as well as microdissec-

tion-passaged BG01 and BG03 that were differentiated in

only DMEM/N2, also generated large networks of βIII tubu-

lin+/TH+ neurons (Fig. 6A). We made several additional

observations during the course of these experiments. Unlike

embryoid body differentiations in serum, very few cysts

were formed in embryoid bodies in serum-free conditions.

Occasionally, pigmented epithelial cells were generated

(Fig. 6B), similar to that observed in stromal cell–mediated

differentiations of primate ES cells [13], although this was

not a common event. RT-PCR and protein expression analy-

ses therefore demonstrated the presence of the developmen-

tal and cellular factors that specify the midbrain dopa-

minergic lineage in suspension aggregates and mediate

dopamine biosynthesis, vesicle loading, and dopamine

reuptake after neurotransmitter release.

The use of MEF feeder layers to support hESC culture

will add regulatory complexity, because new clinical prod-

ucts derived using these feeder layers will be considered

xenotransplants. Although others have demonstrated the

maintenance of hESCs on human feeder cells [64–66] or in a

feeder-free environment [2, 4], it has not been determined

whether hESCs grown under these conditions can differenti-

ate to TH+ neurons. We therefore differentiated collagenase/

trypsin BG01 cells that had been maintained on a layer of

human keloid fibroblasts (I.L., unpublished data) as DMEM/

N2 aggregates and demonstrated that a high proportion of

TH+ neurons were also generated under these conditions

(Fig. 6C). Therefore, hESCs that retain appropriate develop-

mental potential may be able to be derived and maintained on

human feeder layers, avoiding stringent xenotransplantation

regulations.



Figure 5. Expression of dopaminergic markers in differentiated aggregates. Representative low-magnification images of DMEM/N2aggregates plated in MedII/FGF2 medium and immunostained with (A) βIII tubulin and (B) TH. Boxed regions are shown at highermagnification in 1 and 2, with βIII tubulin, TH, and merged panels. (C):A highly differentiated MAP2+/TH+ neuron observed whenDMEM/N2 aggregates were plated in medium containing GDNF, BDNF, and 5% serum. Insets are higher magnifications of the indi-cated regions showing (left to right) presumed growth cone, connections to other MAP2+ neurons, and cell body. The length of theextension from cell body to growth cone was ~580 µm. (D): Whole-mount four-color immunostaining of DMEM/N2 and (E)MedII/FGF2 suspension aggregates. βIII tubulin (visualized with a secondary antibody labeled with Alexafluor 350), TH (Alexafluor594),VMAT2 (Alexafluor 647), and DAT (Alexafluor 488) images were merged to the cyan, magenta, yellow, and black channels of aCMYK image, respectively. Coexpression in cell bodies is indicated by white staining (arrows). (F–I): Immunostaining for markers ofdopaminergic neurons in DMEM/N2 aggregates plated in MedII/FGF2 medium. (F): TH and phospho-TH(Ser40). (G): Aromaticamino acid decarboxylase and TAU. (H, I): DAT and TH. (J, K): Only rare DβH+ cells were detected in suspension aggregates. DβH(arrow) and TH (J) and DβH (arrow) and βIII tubulin (K) immunostaining of microdissection-passaged BG01 and BG03 suspensionaggregates, respectively. Scale bars = 100 µm (A, B), 50 µm (1, 2, C, F, G, J, K), 25 µm (E, H, I), 10 µm (D), and 5 µm (C insets).Abbreviations: BDNF, brain-derived neurotrophic factor; DAPI, 4',6'-diamidino-2-phenylindole; DAT, dopamine transporter;DMEM, Dulbecco’s modified Eagle’s medium; FGF2, fibroblast growth factor 2; GDNF, glial-derived neurotrophic factor; MAP2,microtuble-associated protein 2; TH, tyrosine hydroxylase; VMAT2, vesicular monoamine transporter 2.

6-OHDA is a catecholamine neurotoxin that is taken up

by dopaminergic cells expressing DAT and noradrenergic

neurons [67]. To examine whether the TH+ neurons present in

DMEM/N2 suspension aggregates were sensitive to 6-

OHDA, we exposed aggregates to 10 mM or 1 mM 6-OHDA

for 10 minutes, followed by a 5-hour recovery in MedII/

FGF2 medium, so that degenerating cells could be visual-

ized. Exposure to 6-OHDA led to widespread ablation

of TH+ neurons, which were rarely intact but exhibited

disrupted and punctuated staining (Figs. 7A, 7B, 7D, 7E).

βIII tubulin+/TH– neuronal extensions and nonneuronal

DAPI-stained nuclei appeared intact. Ascorbic acid–treated

controls (not shown) were comparable with untreated aggre-

gates (e.g., Fig. 3A). We used a 100- or 10-fold (Figs. 7C, 7F)

excess of dopamine to compete with 6-OHDA uptake. This

protected TH+ neurons from ablation, indicating that the cells

express functional dopamine or norepinephrine transporters.

The release of dopamine in response to depolarization is

a key indicator of the functional capacity of ES cell–derived

neurons to synthesize dopamine, load it into vesicles, and

release it in response to neurophysiological cues [11]. BG01

hESCs were expanded by passaging as clumps with EDTA-

free trypsin, followed by differentiation in serum-free sus-

pension culture for 3 days in MedII/FGF2 and then DMEM/

N2 until 1 month after derivation. Differentiated aggregates

were then plated to adherent culture in medium containing

GDNF, BDNF, and 5% serum, generating ~ 6.4 ✕ 106 cells

per 35-mm dish after 2 weeks. From these cultures, HPLC

analysis detected evoked release of 2,175 pg/ml dopamine

per 106 cells in response to a K+-depolarizing stimulus (Fig.

7G). Release of 4,475 pg/ml adrenaline and 3,404 pg/ml

noradrenaline per 106 cells could also be unambiguously

resolved as peaks by HPLC. The evoked release of dopamine

and other catecholamines was also detected in plated differ-

entiations of microdissection-passaged hESCs, as well as

collagenase/trypsin-passaged and SSEA-4–enriched BG01

hESCs, although in some experiments, only dopamine, but

not adrenaline or noradrenaline, was detected (not shown).

This indicates there is some variability in the proportions of

these lineages that can be generated using these techniques.

Although rare DβH+ cells were detected in suspension aggre-

gates, plating to adherent culture in medium containing

BDNF, GDNF, and serum clearly supported the differentia-

tion of adrenergic and noradrenergic lineages, as well as

dopaminergic neurons.

Survival and Differentiation of TransplantedHuman ES-Derived Neurons in the Striatum of a Rat Parkinson’s Disease Model To determine whether TH+ neurons derived from hESCs

could survive engraftment, we transplanted differentiated

aggregates into the striatum of rats with a unilateral lesion in

the substantia nigra, which ablates the dopaminergic neurons

projecting to the striatum. Aggregates that had been differen-

tiated in MedII/FGF2 for 3 weeks, or DMEM/N2 for 1

month, were implanted into 8 and 15 rats, respectively, and

rats were euthanized 8 weeks after implantation. Surviving

cells were detected histologically (Fig. 8A) in 6 of 8 rats

implanted with MedII/FGF2-differentiated aggregates and


Figure 6. (A): Whole-mount TH and βIII tubulin immunostain-ing of BG03 suspension aggregates differentiated inDMEM/N2. (B): Pigmented cells observed in some BG01DMEM/N2 suspension aggregates. (C): Differentiation ofBG01 cells maintained on human keloid fibroblasts. Scale bars= 50 µm (B) and 25 µm (A, C). Abbreviations: DMEM, Dul-becco’s modified Eagle’s medium; TH, tyrosine hydroxylase.

11 of 15 implanted with DMEM/N2 aggregates. Biotiny-

lated-human Alu repeat in situ hybridization probes were

used as a lineage marker to confirm the presence of human

cells (Fig. 8B). The implants varied considerably in size and

the degree of cell survival, and one obvious teratoma contain-

ing cartilaginous structures and glandular epithelium was

observed in a rat implanted with a DMEM/N2 cell popula-

tion, indicating that some residual pluripotent cells may per-

sist under these differentiation conditions. Survival of pre-

sumed neural rosettes was detected in some implants (Fig.

8A), and the expression of nestin (Figs. 8B, 8C) was also

detected in many of the surviving implants. In some cases,

regions of MAP2 expression were observed, and the expres-

sion of Ki67 indicated that proliferation was still occurring

(data not shown). In implants of DMEM/N2-differentiated

aggregates, we were able to detect the survival of rare TH+

cells in two animals and a more numerous survival of TH+

cells in a third (Figs. 8D, 8E). The data suggest that after an 8-

week period, neural progenitors, but not large numbers of

differentiated neurons, can survive and proliferate following

implantation of the cell aggregates.

DiscussionThe generation of midbrain dopaminergic neurons for cell

transplantation therapy of Parkinson’s disease is one of the

first clear objectives in the clinical application of hESCs [1].

We report here the differentiation of hESCs to form neurons

expressing markers of the midbrain dopaminergic lineage


Figure 7. Sensitivity to 6-OHDA and evoked release of catecholamines. (A–F): 6-OHDA selectively ablates TH+ neurons inDMEM/N2 suspension aggregates. βIII tubulin and TH whole-mount immunostaining of DMEM/N2 aggregates exposed to 10 mM(A, D) or 1 mM (B, E) 6-OHDA. (C, F): Addition of 100-mM dopamine to 10-mM and 1-mM (not shown) 6-OHDA exposures pro-tected TH+ neurons from ablation. (G): HPLC traces demonstrating evoked release of 2175 pg/ml DA, 4475 pg/ml adrenaline (A), and3404 pg/ml NA per 106 cells from DMEM/N2 differentiations plated in medium containing 5% serum, GDNF, and BDNF in responseto depolarization with 56-mM KCl. These catecholamines were not detected in parallel cultures treated with HBSS. The elution timesfor adrenaline, NA, and DA were 7.13, 7.84, and 17.77 minutes, respectively. DHBA was used as an internal standard. The amplitude ofelectrochemical detection (mV) is shown for the HBSS and KCl samples. Scale bars = 100 µm (A–C) and 50 µm (D–F). Abbreviations:6-OHDA, 6-hydroxydopamine; BDNF, brain-derived neurotrophic factor; DA, dopamine; DHBA, 3,4-dihydroxybenzyamine;DMEM, Dulbecco’s modified Eagle’s medium; GDNF, glial-derived neurotrophic factor; HBSS, Hanks’balanced salt solution; NA,noradrenaline; TH, tyrosine hydroxylase.

in a serum-free suspension culture system. The resulting

neurons coexpressed multiple markers of the dopamine neu-

rotransmitter phenotype and demonstrated functional char-

acteristics expected of neurons. Two independent hESC

lines, when cultured on mouse or human feeder layers, dis-

played a similar response to these differentiation conditions.

This represents a simple, robust, and potentially scalable

platform for the large-scale derivation of dopaminergic neu-

rons, a key step in development of a cell-based product

to treat PD.

The neuronal lineages formed by this method of differ-

entiation expressed SOX1, 2, and 3, which are specific mark-

ers of neural progenitors, and multiple transcription factors

that are involved in the specification of the midbrain

dopaminergic lineage. Expression of EN1, NURR1, PITX3,

and LMX1B was upregulated in serum-free conditions, indi-

cating that differentiation of hESC aggregates in a minimal

medium was sufficient for the specification of this lineage

and suggesting that appropriate signaling to induce and sup-

port dopamine neuron differentiation exists in these aggre-

gates. Also, long-term differentiation in large cellular aggre-

gates may provide a low-oxygen environment, a factor that

has previously been shown to significantly influence the

specification and differentiation of mouse ES cells to

dopaminergic neurons [68]. These variables are likely to

have contributed to the generation of much higher propor-

tions of TH+ neurons than we or others have observed previ-

ously from hESCs. We also demonstrated expression of

markers of the differentiated dopaminergic phenotype in

serum-free differentiations, including phospho-TH(Ser40),

AADC, VMAT-2, DAT, NTRK2 (BDNF receptor), and

GIRK2. We showed that most TH+/βIII tubulin+ neurons

generated in DMEM/N2 conditions were representative of

CNS lineages and not neural crest–derived peripheral neu-


Figure 8. Differentiation of cell clumps implanted into the lesioned rat brain. (A–C): Sections of implants from MedII/fibroblastgrowth factor 2–differentiated aggregates. (A): Hematoxylin and eosin staining of a section with a surviving implant. Putative neuralprecursor rosettes are indicated (arrows). (B): Implant detection using human-specific Alu probes and a human-specific nestin anti-body. (C): Nestin expression in a large implant. (D): Chromogenic detection of surviving TH+ cells derived from a DMEM/N2 trans-plant 8 weeks after implantation. The border of the graft is indicated (black dashed lines). (E): Higher magnification of the boxedregion (white dashed) in (D). Scale bars = 250 µm (A), 100 µm (B, C, D), and 50 µm (E). Abbreviations: COR, cortex; DMEM, Dul-becco’s modified Eagle’s medium; STR, striatum; TH, tyrosine hydroxylase.

rons. Only rare peripherin+ neurons were detected in

DMEM/N2 suspension differentiations, but addition of

BMP-4 during days 5 through 9 induced peripheral neuronal

differentiation, as measured by an increase in the proportion

of peripherin-expressing neurons. These conditions still

generated networks of TH+ neurons, confirming the impor-

tance of identifying TH+/peripherin– neurons [45]. Simi-

larly, although DβH mRNA was detected in DMEM/N2 sus-

pension differentiations by real-time RT-PCR, expression

was significantly lower than in serum-containing condi-

tions. Only rare DβH+ neurons were detected by immuno-

staining of multiple DMEM/N2 differentiations, suggesting

that a large proportion of TH+ neurons generated in suspen-

sion aggregates were dopaminergic. TH+/βIII tubulin+ neu-

rons in suspension aggregates were ablated by 6-OHDA but

were protected from ablation by an excess of dopamine.

This provided functional evidence that most TH+ neurons

in suspension aggregates were dopaminergic or noradrener-

gic. Although few cells in the aggregates expressed DβH,

differentiation to significant proportions of adrenergic

and noradrenergic neurons occurred when suspension aggre-

gates were plated into BDNF, GDNF, and serum, because

adrenaline and noradrenaline, as well as dopamine, were

released by depolarized cultures grown in these conditions.

Together with the response of patch-clamped plated neurons

to glutamate and GABA, the expression of synaptic compo-

nents and the capacity of these neural populations to respond

to neurophysiological stimuli, a functional neuronal pheno-

type was demonstrated. The proportions of other noncate-

cholaminergic neural lineages generated under these condi-

tions also still needs to be ascertained, although the presence

of cholinergic, glutaminergic, and GABAergic neurons was

suggested by the expression analysis.

Transplantable neural cells derived from hESCs have

been reported previously [29, 32]. However, the frequency of

TH+ neurons generated with these previous in vitro differenti-

ation approaches was low, and no engrafted TH+ cells were

detected after transplantation to newborn mice. We report

here one of the first examples of detection of surviving TH+

cells after transplantation in vivo. We successfully trans-

planted TH+ cells to the striatum of the lesioned adult rat brain

as cell clumps and could detect implanted cells 8 weeks after

implantation. However, poor viability of differentiated neu-

rons after transplantation may be the primary reason why rel-

atively few TH+ cells were detected in these experiments,

despite our efforts to minimize cell death by avoiding dissag-

gregation to single cells for implantation. Apoptosis of

90%–95% of implanted neurons has also been observed in

clinical transplants of fetal neural tissue [1, 6]. To counter this

problem, it may be possible to identify a window of develop-

ment in vitro, in which abundant neural precursors committed

to the dopaminergic fate are present and can be transplanted.

Conversely, transplanted hESC-derived neural progenitors

may require a longer time to differentiate after transplantation

than required with mouse ES cell–derived progenitors [10].

The differentiation system outlined in this study models

several events that occur during embryonic development.

The formation of early neural progenitor cells could be inhib-

ited by BMP signaling, a signal that can direct early embry-

onic cells to a nonneural ectodermal fate, whereas cells that

had progressed to a neural progenitor stage and exhibited

neural tube-like characteristics [15, 32] were apparently

induced to form peripheral neurons by a later addition of

BMP. Rosette structures formed during the differentiation of

hESC aggregates were reminiscent of the early neural tube in

that they formed a tightly packed radial array, exhibited mito-

sis at the central core, differentiated to HuC/D+ early postmi-

totic neurons as they exited this structure, and exhibited

ultrastructural characteristics of the neural tube (T.S. and J.

McDonald, unpublished data). These features suggest that

many early aspects of human neurogenesis may be accessi-

ble to study using hESCs and show that the cell types pro-

duced in our differentiations respond to developmental fac-

tors, as predicted from previous studies. Similarly, as with

mouse and primate ES cells, hESCs could also differentiate

effectively to TH+ neurons when cocultured with the PA6

stromal cell line [69]. This differentiation approach reflected

many of the features of our suspension differentiation sys-

tem, including differentiation to neural progenitors and neu-

rons that express the key transcription factors NURR1,

LMX1B, and PITX3, as well as multiple markers of the

dopaminergic phenotype. Cell fate in this differentiation

could also be altered by BMP-4 or serum, dopamine was

released in response to depolarization, and survival of TH+

cells implanted in the rat brain was demonstrated. Expres-

sion of a similar profile of neural markers was detected in

PA6 coculture differentiations [69] and in our suspension

differentiations using the same cDNA array. This included

CXCR4, FGFR1, FGFR2, DLK1, NTRK2, NCAM1, NEFL,

MAP2, INA, FZD3, and VEGF. This also indicates signifi-

cant overlap in the types of lineages generated in both condi-

tions; however, higher expression of markers such as ACTA2,

ACTG2, AFP, CTNNB1, CDH1, KRT8, IL6ST, and IGF1R

in PA6 differentiations suggests that there are also differ-

ences in the derived lineages. The similarities in these differ-

entiation outcomes may suggest that the signals that enable

differentiation to TH+ neurons provided by PA6 coculture

are also provided within differentiating aggregates in a mini-

mal medium in the absence of exogenous neural-inducing

factors.


ConclusionWe have developed a simple culture system for the differen-

tiation of hESCs to enriched neuronal populations of cells,

including those of the midbrain dopaminergic lineage, char-

acterized the expression of a variety of neuronal and dopa-

minergic markers, and demonstrated the functionality ex-

pected of differentiating neurons. This differentiation system

could provide a simple experimental model for developing

optimal cultures of midbrain dopaminergic populations

suitable for implantation studies in animal models of PD and

possible therapeutic applications.

AcknowledgmentsWe thank current and former members of the BresaGen Cell

Therapy Programs in Adelaide and Athens, Ray Johnson for

performing HPLC analysis, Clifton Baile and Diane Hartzel

and the Animal Facility of the University of Georgia,Animal

and Dairy Science Department for performing rat implanta-

tions, and Mahendra Rao for critically reading the manu-

script. This work was supported by BresaGen Inc. and the

Augusta Chapter of the American Legion (to N.A.L.). hESC

characterization work was also supported by NIH grant

R24DK063689 (to B.G.C., awarded to BresaGen Inc.).

Note Added in ProofRecent additional reports have also demonstrated the differ-

entiation of hESCs to dopaminergic neurons. These studies

induced differentiation by coculture with stromal cell layers:

Perrier AL, Tabar V, Barberi T et al. Derivation of midbrain

dopamine neurons from human embryonic stem cells. Proc

Natl Acad Sci U S A 2004;101:12543–12548; and Buytaert-

Hoefen KA, Alvarez E, CR Freed. Generation of tyrosine

hydroxylase positive neurons from human embryonic stem

cells after coculture with cellular substrates and exposure to

GDNF. Stem Cells 2004;22:669–674.


References

1 Freed CR. Will embryonic stem cells be a useful source ofdopamine neurons for transplant into patients with Parkin-son’s disease? Proc Natl Acad Sci U S A 2002;99:1755–1757.

2 Carpenter MK, Rosler ES, Fisk GJ et al. Properties of fourhuman embryonic stem cell lines maintained in a feeder-free culture system. Dev Dyn 2004;229:243–258.

3 Sato N, Meijer L, Skaltsounis L et al. Maintenance ofpluripotency in human and mouse embryonic stem cellsthrough activation of Wnt signaling by a pharmacologicalGSK-3-specific inhibitor. Nat Med 2004;10:55–63.

4 Rosler ES, Fisk GJ, Ares X et al. Long-term culture ofhuman embryonic stem cells in feeder-free conditions. DevDyn 2004;229:259–274.

5 Bjorklund A, Dunnett SB, Brundin P et al. Neural transplan-tation for the treatment of Parkinson’s disease. Lancet Neu-rol 2003;2:437–445.

6 Freed CR, Greene PE, Breeze RE et al. Transplantation ofembryonic dopamine neurons for severe Parkinson’s dis-ease. N Engl J Med 2001;344:710–719.

7 Olanow CW, Goetz CG, Kordower JH et al. A double-blindcontrolled trial of bilateral fetal nigral transplantation inParkinson’s disease. Ann Neurol 2003;54:403–414.

8 Isacson O, Bjorklund LM, Schumacher JM. Toward fullrestoration of synaptic and terminal function of the dopa-minergic system in Parkinson’s disease by stem cells. AnnNeurol 2003;53(suppl 3):S135–S146.

9 Barberi T, Klivenyi P, Calingasan NY et al. Neural subtypespecification of fertilization and nuclear transfer embryonicstem cells and application in parkinsonian mice. NatBiotechnol 2003;21:1200–1207.

10 Bjorklund LM, Sanchez-Pernaute R, Chung S et al. Embry-onic stem cells develop into functional dopaminergic neu-

rons after transplantation in a Parkinson rat model. ProcNatl Acad Sci U S A 2002;99:2344–2349.

11 Kim JH, Auerbach JM, Rodriguez-Gomez JA et al. Dopa-mine neurons derived from embryonic stem cells functionin an animal model of Parkinson’s disease. Nature 2002;418:50–56.

12 Kawasaki H, Mizuseki K, Nishikawa S et al. Induction ofmidbrain dopaminergic neurons from ES cells by stromalcell-derived inducing activity. Neuron 2000;28:31–40.

13 Kawasaki H, Suemori H, Mizuseki K et al. Generation ofdopaminergic neurons and pigmented epithelia from pri-mate ES cells by stromal cell-derived inducing activity.Proc Natl Acad Sci U S A 2002;99:1580–1585.

14 Lee SH, Lumelsky N, Studer L et al. Efficient generation ofmidbrain and hindbrain neurons from mouse embryonicstem cells. Nat Biotechnol 2000;18:675–679.

15 Schulz TC, Palmarini GM, Noggle SA et al. Directed neu-ronal differentiation of human embryonic stem cells. BMCNeurosci 2003;4:27.

16 Mitalipova MM, Calhoun JD, Shin S et al. Human embry-onic stem cell lines derived from discarded embryos. STEM

CELLS 2003;21:521–526.

17 Rathjen J, Lake JA, Bettess MD et al. Formation of a primi-tive ectoderm like cell population, EPL cells, from ES cellsin response to biologically derived factors. J Cell Sci1999;112:601–612.

18 Calhoun JD, Lambert NA, Mitalipova MM et al. Differenti-ation of rhesus embryonic stem cells to neural progenitorsand neurons. Biochem Biophys Res Commun 2003;306:191–197.

19 Pfaffl MW, Horgan GW, Dempfle L. Relative expressionsoftware tool (REST) for group-wise comparison and statis-tical analysis of relative expression results in real-time PCR.Nucleic Acids Res 2002;30:e36.

20 Studer L, Tabar V, McKay RD. Transplantation of expandedmesencephalic precursors leads to recovery in parkinsonianrats. Nat Neurosci 1998;1:290–295.

21 Brustle O, Choudhary K, Karram K et al. Chimeric brainsgenerated by intraventricular transplantation of fetal humanbrain cells into embryonic rats. Nat Biotechnol 1998;16:1040–1044.

22 Buzzard JJ, Gough NM, Crook JM et al. Karyotype ofhuman ES cells during extended culture. Nat Biotechnol2004;22:381–382.

23 Reubinoff BE, Pera MF, Fong CY et al. Embryonic stem celllines from human blastocysts: somatic differentiation invitro. Nat Biotechnol 2000;18:399–404.

24 Thomson JA, Itskovitz-Eldor J, Shapiro SS et al. Embryonicstem cell lines derived from human blastocysts. Science1998;282:1145–1147.

25 Cowan CA, Klimanskaya I, McMahon J et al. Derivation ofembryonic stem-cell lines from human blastocysts. N Engl JMed 2004;350:1353–1356.

26 Sato N, Sanjuan IM, Heke M et al. Molecular signature ofhuman embryonic stem cells and its comparison with themouse. Dev Biol 2003;260:404–413.

27 Ginis I, Luo Y, Miura T et al. Differences between humanand mouse embryonic stem cells. Dev Biol 2004;269:360–380.

28 Bhattacharya B, Miura T, Brandenberger R et al. Geneexpression in human embryonic stem cell lines: uniquemolecular signature. Blood 2004;103:2956–2964.

29 Reubinoff BE, Itsykson P, Turetsky T et al. Neural progeni-tors from human embryonic stem cells. Nat Biotechnol2001;19:1134–1140.

30 Rathjen J, Haines BP, Hudson KM et al. Directed differenti-ation of pluripotent cells to neural lineages: homogeneousformation and differentiation of a neurectoderm population.Development 2002;129:2649–2661.

31 Carpenter MK, Inokuma MS, Denham J et al. Enrichment ofneurons and neural precursors from human embryonic stemcells. Exp Neurol 2001;172:383–397.

32 Zhang SC, Wernig M, Duncan ID et al. In vitro differentia-tion of transplantable neural precursors from human embry-onic stem cells. Nat Biotechnol 2001;19:1129–1133.

33 Okano HJ, Darnell RB. A hierarchy of Hu RNA bindingproteins in developing and adult neurons. J Neurosci 1997;17:3024–3037.

34 Mahadevan LC, Willis AC, Barratt MJ. Rapid histone H3phosphorylation in response to growth factors, phorbolesters, okadaic acid, and protein synthesis inhibitors. Cell1991;65:775–783.

35 Zeng X, Miura T, Lou Y et al. Properties of pluripotenthuman embryonic stem cells BG01 and BG02. STEM

CELLS 2004;22:292–312.

36 Luo Y, Cai J, Ginis I et al. Designing, testing, and validatinga focused stem cell microarray for characterization of neuralstem cells and progenitor cells. STEM CELLS 2003;21:575–587.

37 Luo Y, Cai J, Liu Y et al. Microarray analysis of selectedgenes in neural stem and progenitor cells. J Neurochem2002;83:1481–1497.

38 Wiles MV, Johansson BM. Embryonic stem cell develop-ment in a chemically defined medium. Exp Cell Res1999;247:241–248.

39 Finley MF, Devata S, Huettner JE. BMP-4 inhibits neuraldifferentiation of murine embryonic stem cells. J Neurobiol1999;40:271–287.

40 Munoz-Sanjuan I, Brivanlou AH. Neural induction, thedefault model and embryonic stem cells. Nat Rev Neurosci2002;3:271–280.

41 Sasai Y, De Robertis EM. Ectodermal patterning in verte-brate embryos. Dev Biol 1997;182:5–20.

42 Jessell TM. Neuronal specification in the spinal cord: induc-tive signals and transcriptional codes. Nat Rev Genet2000;1:20–29.

43 Knecht AK, Bronner-Fraser M. Induction of the neuralcrest: a multigene process. Nat Rev Genet 2002;3:453–461.

44 Troy CM, Muma NA, Greene LA et al. Regulation ofperipherin and neurofilament expression in regenerating ratmotor neurons. Brain Res 1990;529:232–238.

45 Mizuseki K, Sakamoto T, Watanabe K et al. Generation ofneural crest-derived peripheral neurons and floor plate cellsfrom mouse and primate embryonic stem cells. Proc NatlAcad Sci U S A 2003;100:5828–5833.

46 Smidt MP,Asbreuk CH, Cox JJ et al. A second independentpathway for development of mesencephalic dopaminergicneurons requires Lmx1b. Nat Neurosci 2000;3:337–341.

47 Asbreuk CH,Vogelaar CF, Hellemons A et al. CNS expres-sion pattern of Lmx1b and coexpression with ptx genes sug-gest functional cooperativity in the development of fore-brain motor control systems. Mol Cell Neurosci 2002;21:410–420.

48 Bylund M,Andersson E, Novitch BG et al. Vertebrate neu-rogenesis is counteracted by Sox1-3 activity. Nat Neurosci2003;6:1162–1168.

49 Pevny LH, Sockanathan S, Placzek M et al. A role for SOX1in neural determination. Development 1998;125:1967–1978.

50 Saucedo-Cardenas O, Quintana-Hau JD, Le WD et al.Nurr1 is essential for the induction of the dopaminergic phe-notype and the survival of ventral mesencephalic latedopaminergic precursor neurons. Proc Natl Acad Sci U S A1998;95:4013–4018.

51 Simon HH, Saueressig H, Wurst W et al. Fate of midbraindopaminergic neurons controlled by the engrailed genes. JNeurosci 2001;21:3126–3134.

52 Zetterstrom RH, Solomin L, Jansson L et al. Dopamine neu-ron agenesis in Nurr1-deficient mice. Science 1997;276:248–250.

53 Castillo SO, Baffi JS, Palkovits M et al. Dopamine biosyn-thesis is selectively abolished in substantia nigra/ventraltegmental area but not in hypothalamic neurons in mice withtargeted disruption of the Nurr1 gene. Mol Cell Neurosci1998;11:36–46.


54 Nunes I, Tovmasian LT, Silva RM et al. Pitx3 is required fordevelopment of substantia nigra dopaminergic neurons.Proc Natl Acad Sci U S A 2003;100:4245–4250.

55 van den Munckhof P, Luk KC, Ste-Marie L et al. Pitx3 isrequired for motor activity and for survival of a subset ofmidbrain dopaminergic neurons. Development 2003;130:2535–2542.

56 Hwang DY, Ardayfio P, Kang UJ et al. Selective loss ofdopaminergic neurons in the substantia nigra of Pitx3-defi-cient aphakia mice. Brain Res Mol Brain Res 2003;114:123–131.

57 Schein JC, Hunter DD, Roffler-Tarlov S. Girk2 expressionin the ventral midbrain, cerebellum, and olfactory bulb andits relationship to the murine mutation weaver. Dev Biol1998;204:432–450.

58 Yamada T, McGeer PL, Baimbridge KG et al. Relative spar-ing in Parkinson’s disease of substantia nigra dopamineneurons containing calbindin-D28K. Brain Res 1990;526:303–307.

59 Gibb WR. Melanin, tyrosine hydroxylase, calbindin andsubstance P in the human midbrain and substantia nigra inrelation to nigrostriatal projections and differential neu-ronal susceptibility in Parkinson’s disease. Brain Res 1992;581:283–291.

60 German DC, Manaye K, Smith WK et al. Midbrain dopa-minergic cell loss in Parkinson’s disease: computer visuali-zation. Ann Neurol 1989;26:507–514.

61 Rolletschek A, Chang H, Guan K et al. Differentiation ofembryonic stem cell-derived dopaminergic neurons is

enhanced by survival-promoting factors. Mech Dev 2001;105:93–104.

62 Lew JY, Garcia-Espana A, Lee KY et al. Increased site-spe-cific phosphorylation of tyrosine hydroxylase accompaniesstimulation of enzymatic activity induced by cessation ofdopamine neuronal activity. Mol Pharmacol 1999;55:202–209.

63 Neve RL, Harris P, Kosik KS et al. Identification of cDNAclones for the human microtubule-associated protein tauand chromosomal localization of the genes for tau andmicrotubule-associated protein 2. Brain Res 1986;387:271–280.

64 Amit M, Margulets V, Segev H et al. Human feeder layersfor human embryonic stem cells. Biol Reprod 2003;68:2150–2156.

65 Cheng L, Hammond H, Ye Z et al. Human adult marrowcells support prolonged expansion of human embryonicstem cells in culture. STEM CELLS 2003;21:131–142.

66 Richards M, Fong CY, Chan WK et al. Human feeders sup-port prolonged undifferentiated growth of human inner cellmasses and embryonic stem cells. Nat Biotechnol 2002;20:933–936.

67 Deumens R, Blokland A, Prickaerts J. Modeling Parkin-son’s disease in rats: an evaluation of 6-OHDA lesions of thenigrostriatal pathway. Exp Neurol 2002;175:303–317.

68 Studer L, Csete M, Lee SH et al. Enhanced proliferation,survival, and dopaminergic differentiation of CNS precur-sors in lowered oxygen. J Neurosci 2000;20:7377–7383.

69 Zeng X, Cai J, Chen J et al. Dopaminergic differentiation ofhuman embryonic stem cells. STEM CELLS 2004;22:925–940.


Differentiation of Human Embryonic Stem Cells Encapsulated in Hydrogel Matrix Materials

Documents

Transcript of Differentiation of Human Embryonic Stem Cells Encapsulated in Hydrogel Matrix Materials