This article was downloaded by: [Universiti Putra Malaysia]On: 24 August 2012, At: 10:28Publisher: Taylor & FrancisInforma Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House,37-41 Mortimer Street, London W1T 3JH, UK

Canadian Journal of Plant PathologyPublication details, including instructions for authors and subscription information:http://www.tandfonline.com/loi/tcjp20

Development of a quantum dots FRET-based biosensorfor efficient detection of Polymyxa betaeHossein Safarpour a b , Mohammad Reza Safarnejad a c , Meisam Tabatabaei a , AfshinMohsenifar a d , Fatemeh Rad a b , Marzieh Basirat a , Fatemeh Shahryari d & FatemehHasanzadeh ea Nanosystems Research Team (NRT), Department of Microbial Biotechnology and Biosafety,Agricultural Biotechnology Research Institute of Iran (ABRII), Karaj, Iranb Department of Agricultural Biotechnology, Shahed University, Tehran, Iranc Department of Plant Viruses, Iranian Institute of Plant Protection, Tehran, Irand Tarbiat Modares University (TMU), Tehran, Irane Department of Plant Pathology, Science and Research Branch, IAU, Tehran, Iran

Accepted author version posted online: 09 Jul 2012. Version of record first published: 16Aug 2012

To cite this article: Hossein Safarpour, Mohammad Reza Safarnejad, Meisam Tabatabaei, Afshin Mohsenifar, Fatemeh Rad,Marzieh Basirat, Fatemeh Shahryari & Fatemeh Hasanzadeh (2012): Development of a quantum dots FRET-based biosensor forefficient detection of Polymyxa betae , Canadian Journal of Plant Pathology, DOI:10.1080/07060661.2012.709885

To link to this article: http://dx.doi.org/10.1080/07060661.2012.709885

PLEASE SCROLL DOWN FOR ARTICLE

Full terms and conditions of use: http://www.tandfonline.com/page/terms-and-conditions

This article may be used for research, teaching, and private study purposes. Any substantial or systematicreproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form toanyone is expressly forbidden.

The publisher does not give any warranty express or implied or make any representation that the contentswill be complete or accurate or up to date. The accuracy of any instructions, formulae, and drug doses shouldbe independently verified with primary sources. The publisher shall not be liable for any loss, actions, claims,proceedings, demand, or costs or damages whatsoever or howsoever caused arising directly or indirectly inconnection with or arising out of the use of this material.

Can. J. Plant Pathol. (2012), iFirst: 1–9

Biochemistry and cell biology/Biochimie et biologie cellulaire

Development of a quantum dots FRET-based biosensor forefficient detection of Polymyxa betae

HOSSEIN SAFARPOUR1,2 , MOHAMMAD REZA SAFARNEJAD1,3 , MEISAM TABATABAEI1,AFSHIN MOHSENIFAR1,4 , FATEMEH RAD1,2 , MARZIEH BASIRAT1, FATEMEH SHAHRYARI4 ANDFATEMEH HASANZADEH5

1Nanosystems Research Team (NRT), Department of Microbial Biotechnology and Biosafety, Agricultural Biotechnology Research Institute ofIran (ABRII), Karaj, Iran2Department of Agricultural Biotechnology, Shahed University, Tehran, Iran3Department of Plant Viruses, Iranian Institute of Plant Protection, Tehran, Iran4Tarbiat Modares University (TMU), Tehran, Iran5Department of Plant Pathology, Science and Research Branch, IAU, Tehran, Iran

(Accepted 4 July 2012)

Abstract: Rhizomania is the most destructive disease in sugar beet throughout the world. The disease is caused by Beet necrotic yellow veinvirus (BNYVV). Polymyxa betae (Keskin) is the only known vector of BNYVV, for transmission of the virus between the plants. Developingmolecular diagnostic methods has a major impact on forecasting and epidemiological studies as well as screening sugar beet plants used inresistance breeding programmes. In the present study, quantum dots (QDs) were biofunctionalized with a specific antibody against P. betae.The glutathione-S-transferase protein’s (GST) corresponding antibody (anti-GST) was effectively conjugated to Tioglicolicacid-modifiedCadmium-Telluride QDs (CdTe-QDs) synthesized in an aqueous solution via electrostatic interaction. The dye (Rhodamine) molecules wereattached to the GST. Donor–acceptor complexes (QDs-Ab-GST-Rhodamine) were then formed based on the antigen–antibody interaction.The mutual affinity of the antigen and the antibody brought the CdTeQDs and rhodamine together close enough to allow the resonancedipole–dipole coupling required for fluorescence resonance energy transfer (FRET) to occur. The immunosensor constructed showeda high sensitivity and specificity of 100%, acceptable stability and could be used for real sample detection with consistent results. Tothe best of our knowledge, this is the first report on designing a nano-based biosensing tool for the detection of plant pathogenicfungi.

Key words: biosensing, disease forecasting, FRET, Glutathione-S-transferase, Polymyxa betae, Quantum Dots (QDs)

Résumé: Rhizomania est la maladie de la betterave sucrière la plus destructrice au monde. La maladie est causée par le virus de la rhizomaniede la betterave sucrière (BNYVV). Polymyxa betae (Keskin) est le seul vecteur connu du BNYVV en ce qui a trait à la transmission entreplants. Le développement de méthodes de diagnostic moléculaire a eu une influence majeure tant sur les études prédictives etépidémiologiques que sur le dépistage des plants de betterave sucrière utilisés dans les programmes de sélection pour la résistance. Dans cetteétude, des points quantiques (PQ) ont été biofonctionnalisés contre P. betae avec un anticorps particulier. L’anticorps (anti-GST)correspondant de la protéine de la glutathione-S-transférase (GST) a été efficacement conjugué aux PQ en tellure de cadmium modifiés avecl’acide thioglycolique (CdTe-PQ), synthétisés dans une solution aqueuse par interaction électrostatique. Les molécules de la teinture(rhodamine) ont été attachées à la GST. Les complexes donneur-accepteur (PQ-Ab-GST-Rhodamine) ont par la suite été formés en fonction del’interaction antigène-anticorps. L’affinité réciproque qui existe entre l’antigène et l’anticorps a suffisamment rapproché les CdTe-PQ et larhodamine pour permettre le couplage dipolaire requis pour que le transfert d’énergie de fluorescence par résonance (FRET) se produise.L’immunosenseur produit a affiché une grande sensibilité et une spécificité de 100 % ainsi qu’une stabilité acceptable. Il pourrait par ailleurs

Correspondence to: M.R. Safarnejad. E-mail: mrsafarnejad@yahoo.com; M. Tabatabaei. E-mail: meisam_tab@yahoo.com.

ISSN: 0706-0661 print/ISSN 1715-2992 online © 2012 The Canadian Phytopathological Societyhttp://dx.doi.org/10.1080/07060661.2012.709885

Dow

nloa

ded

by [

Uni

vers

iti P

utra

Mal

aysi

a] a

t 10:

28 2

4 A

ugus

t 201

2

H. Safarpour et al. 2

être utilisé pour détecter de vrais échantillons et donner des résultats homogènes. À notre connaissance, il s’agit du premier rapport traitant dela conception d’un outil de biodétection basé sur la GST, destiné au dépistage de ce champignon pathogène.

Mots clés: biodétection, dépistage de la maladie, FRET, glutathione-S-transférase, points quantiques, Polymyxa betae

Introduction

Beet necrotic yellow vein virus (BNYVV), the causalagent of rhizomania, is an economically important viraldisease. The plasmodiophoromycete Polymyxa betaeKeskin (P. betae), is an obligate parasite of sugarbeet rootsand the vector of BNYVV (Putz et al., 1990; Tamadeet al., 1999). The yield losses due to this disease havepartially come under control by introducing resistant cul-tivars now used widely throughout the world. However,specific and accurate diagnostic methods are essential inorder to screen different cultivars to ensure resistance tothe rhizomania virus and its vector. Conventional methodsoften rely on identification of disease symptoms, isolationand culturing, and laboratory identification by morphol-ogy and biochemical tests, and immunoassay techniques(Mutasa-Gottgens et al., 1993; Kingsnorth et al., 2003;Ward et al., 2004). These techniques are generally costly,lengthen the detection time, and suffer from high detectionlimits. Among them, however, the immunoassay tech-nique takes advantage of the affinity binding betweenantibodies and the corresponding antigens to specifi-cally detect their presence in a mixture to be analysed.Moreover, antibodies recognize the overall shape of anepitope rather than particular residues, and can distinguishminor differences in the primary amino acid sequenceof antigens as well as differences in charge, optical, andsteric conformations (Van Regenmortel, 1997; Safarnejadet al., 2011). Combining the molecular specificity of abiological recognition entity such as an antigen/antibodywith an operationally simple transducer could lead toinnovating more advanced diagnostics.

Glutathione-S-transferase (GST), a specific immuno-genic protein, is a critical enzyme expressed in P. betaezoospores, sporangia and resting spores and could be agood candidate to develop the serological base of a diag-nostic technique (i.e. the biological recognition entity),for the pathogen (Kingsnorth et al., 2003). In fact, thepathogen expresses GST at high levels to overcomehost defence mechanisms (Mutasa-Gottgens et al., 2000).On the other hand, with the achievements of nanotechnol-ogy and nano-sciences, a wide variety of nanoscale mate-rials with unique features including size-dependent, brightand extremely stable emissions have attracted a great dealof attention as transducers. One of the most importantnanomaterials are fluorescent semiconductor nanocrys-tals, also known as quantum dots (QDs) which have been

widely used for disease diagnosis (Frasco & Chaniotakis,2009). QDs have a number of unique optical propertiesthat are advantageous in the development of bio-analysesbased on fluorescence resonance energy transfer (FRET)(Algar & Krull, 2007). These biosensors have been widelyused in immunoassay (Goldman et al., 2005), biomedicalsensors (Shi et al., 2006), detection of protein (Algar &Krull, 2007) and inter-molecular binding assays (Willardet al., 2001). QDs have been reportedly used as biosensorsby coating them with specific antibodies against variouspathogenic agents such as E. coli O157:H7 (Hahn et al.,2008).

The aim of this study was to conjugate QDs and aspecific antibody (Ab) against GST to develop a spe-cific and sensitive FRET-based QD-antibody biosensor forrapid, accurate, and cost-effective detection of P. betae,the vector of BNYVV.

Materials and methods

Polymyxa culture

A rather simple test to confirm the presence of Polymyxaspp. is planting the host in naturally infested soils (Abe,1987; Gerik, 1992). Ten-day-old sugarbeet (Beta vulgarisL.) and barley (Hordeum vulgare L.) seedlings were inoc-ulated with P. betae and P. graminis using dried root pow-der inoculum as previously described by Mutasa-Gottgenset al. (1993) and Thompson et al. (2011), respectively.Fifteen days after inoculation, microscopic examinationwas conducted to confirm the infection.

Detection and identification of Polymyxa spp

The DNA extraction from sugarbeet lateral roots grown inthe infested soils as well as barley roots was done accord-ing to Mutasa-Gottgens et al. (2000). A primer pair Psp1(5´ TAGACGCAGGTCATCAACCT 3´) and Psp2rev (5´AGGGCTCTCGAAAGCGCAA 3´), was used to amplifya 545 and 348 bp region of the nuclear ribosomal DNAof P. betae and P. graminis, respectively (Legrève et al.2002). This region contained the internal transcribedspacer 1 (ITS1), the 5.8S DNA and the internal tran-scribed spacer 2 (ITS2). The following PCR program wasconducted: 95 ◦C for 2 min, 36 cycles of 96 ◦C for 45 s,50 ◦C for 45 s and 72 ◦C for 1 min and final synthesis for

Dow

nloa

ded

by [

Uni

vers

iti P

utra

Mal

aysi

a] a

t 10:

28 2

4 A

ugus

t 201

2

Quantum-dot nanobiosensor against Polymyxa betae 3

10 min 72 ◦C. Barley roots free of P. graminis were usedas negative control.

Antibody specificity test

The specific polyclonal antibody against GST protein ofP. betae (kindly provided by M. Basirat, ABRII, Karaj,Iran) was used for detection of fungi in infected plants andbio-conjugation to quantum dots nano-particles. To eval-uate the specificity of the polyclonal antibody against thePolymyxa spp., double antibody sandwich (DAS)-ELISAwas performed for P. betae and P. graminis as describedby Clark & Adams (1977) with modifications. The plantroot sap samples were prepared by crushing 0.2 g freshroots in liquid nitrogen followed by 10-fold dilution in anextraction buffer (2% PVP 25, 0.2% skimmed dried milkin PBS). Microtiter plates (Maxisorp, Nunc) were firstincubated (3–4 h, 37 ◦C) with polyclonal rabbit antibod-ies (100-fold dilution with coating buffer). Subsequently,they were incubated with fungus-infected or healthy plantroot sap at 4 ◦C for 12–16 h. Then, the plates were washedthree times with phosphate buffer saline twin (PBST).After that, 100 µL of alkaline phosphatase conjugated togoat anti-rabbit IgG was added into each well, and theplates were incubated for 2 h at 37 ◦C. Subsequently,another three rounds of washing were performed. Finally,the plates were incubated for 30 min with alkaline phos-phatase substrate solution (1 mg mL−1 p-NPP, pH 9.8,100 µL per well) and ELISA readings (OD405nm) werecarried out by a Sunrise ELISA reader (Tecan, Austria).

CdTe quantum dots preparation

Tellurium powder (99.9%), cadmium chloride (CdCl2,99.9%) and thioglycolic acid (TGA, 98%) were purchasedfrom Tianjin Chemical Reagents Company (China).Water-soluble CdTe QDs were synthesized by using 5 mMof CdCl2–2.5 H2O dissolved in 110 mL distilled water,followed by the addition of 12 mM TGA under stirringand pH was adjusted to 11 by drop-wise addition of 1 MNaOH solution. The solution was then placed in a three-necked flask and desecrated by N2 bubbling for 30 min.Then, 2.5 mM of oxygen-free NaHTe solution, which wasfreshly prepared from tellurium powder and sodium boro-hydride (NaBH4, molar ratio of 1 : 2) in water at 0 ◦C, wasinjected into the three-necked flask under stirring. Finally,the resultant mixture was refluxed at 100 ◦C for 4 h.

Bioconjugation of CdTe QDs with antibodies

One hundred µL of QDs (2 mg mL−1) and 50 µL of thepurified GST antibodies (3.5 mg mL−1) were mixed, pH

7.4. Then 150 µL of the freshly prepared 4.2 mg mL−1

1-ethyl-3-(3 dimethylaminopropyl)-carbodiimide EDC(44 mM in borate buffer) was added to the mixture. Thesamples were then incubated for 2 h at room temperatureunder shaking in the dark and stored at 4 ◦C overnight.The overnight QDs-labelled antibodies were then cen-trifuged at 15 700 g for 20 min (TOMY, Japan). Afterthe lower phase was removed, the upper phase contain-ing QDs-antibody conjugates was decanted, diluted by1.5 mL Tris-HCl, and then 0.5 mL of 50 mM Tris-HClcontaining 1% BSA was added. Finally, the QDs-labelledantibodies were dispersed in Tris-HCl and stored at 4 ◦Cuntil use.

Conjugation of GST with rhodamine as a quencher

In order to conjugate the GST with rhodamine, initially360 µL glutaraldehyde (GLA) 10% (100 g L−1) wasadded to 100 µL GST (5 µg mL−1). Subsequently, 2 µLof dinitropyridine was added whilst stirring and mixedfor 30 min. In the next step, 1 mg of NaBH4 was addedand the mixture was stored for 1 h at room tempera-ture. GST-GLA conjugates were then separated from theexcess GLA via dialysis using Tris-HCl 50 mM for 16 h.After that, 3 mg of rhodamine dissolved in 5 mL ddH2Owas added to the dialysed GST-GLA solution. Finally,the rhodamine-GLA-GST conjugates were separated fromfree rhodamine by dialysis as explained earlier.

Fluorometry instrumentation

Fluorescence spectra were obtained using a Shimadzu1501 ultraviolet-visible (UV-VIS) spectrophotometer(Shimadzu, Japan). The fluorometer was operated as fol-lows: the excitation wavelength was set at 350 nm (theexcitation wavelength of CdTe QDs) and the emissionspectra were recorded between 540 and 640 nm as thequencher’s (rhodamine) emission was located at the rangeof 580 to 600 nm. The excitation and emission bandwidthof 5 nm was used.

Kit construction and evaluation

The kit constructed consisted of (1) rhodamine-antigen(GST) solution, (2) QDs-labelled antibodies and (3) Tris-HCl buffer. The test was conducted by first adding 3 mLof Tris-HCl buffer into the fluorometer cell. Then, 50 µLof the rhodamine-antigen solution was added. This wasfollowed by addition of 50 µL of the QDs-labelled anti-bodies solution. The baseline curve was then evaluatedby the fluorometer. This revealed the baseline emis-sion of rhodamine quenching the emission caused by

Dow

nloa

ded

by [

Uni

vers

iti P

utra

Mal

aysi

a] a

t 10:

28 2

4 A

ugus

t 201

2

H. Safarpour et al. 4

the QDs. At the detection stage, the suspicious roots(0.1–0.5 mm thick) were mashed in Tris-HCl buffer (1 gplant material/500 µL buffer). Twenty µL of the preparedextract was then added to the same fluorometer cell andthe second curve was obtained. If no or negligible base-line shift (negative) was observed, the sample was markedas free of P. betae but significant baseline downwardshift (positive) would reveal that the sample contained thepathogenic agents.

Sensitivity and specificity

In order to determine the sensitivity and the specificityof the constructed QD FRET-based biosensor kit, 20 P.betae-infected and 10 healthy samples (positive and nega-tive samples, respectively), were tested by the fluorometerin triplicate. In order to compare the immunoassay testwith the nanobiosensor, serial dilutions of recombinantGST 3500 µg mL−1 (10 to 0.5 µg mL−1 Tris-HClbuffer) were tested in triplicate with both techniques.Furthermore, the specificity of the nanobiosensor wasalso checked using 10 P. graminis-positive samples. Thebaseline shift measured for Immunodominant MembraneProtein (IMP) as the negative control (X ± 3 SD), wasused in differentiating healthy and infected samples.

Stability

Fourier Transform Infrared (FT-IR) spectroscopy analy-sis was used to investigate the stability of the existingchemical bonds such as those between the QDs andantibody molecules as well as between rhodamine and

antigens. To achieve that, 150 µL of each QD, QD-Ab andrhodamine-antigen were first freeze-dried. The dried sam-ples were then used to make a tablet for FT-IR analysis byusing Nicolet IR100 FT-IR (Madison, WI, USA).

Results

Identification of Polymyxa spp

After microscopic confirmation of infection (Fig. 1a), P.betae presence as well as that of P. graminis in the rootsof plants grown in the soil samples tested was verifiedby PCR assay. The primer set Psp1 and Psp2rev pro-duced PCR fragments of about 545 and 348 bp using DNAextracts obtained from P. betae-infected sugarbeet and P.graminis-infected samples, respectively (Fig. 1b).

Antibody specificity

The results of the DAS-ELISA assay conducted to deter-mine the specificity of the produced antibody showeda high specificity for recombinant GST protein andP. betae-infected sugar beet samples. Moreover, it alsoshowed a little cross reactivity to P. graminis (Fig. 2).

QDs synthesis and bioconjugation with antibodies

The synthesized CdTe QDs were surface-modified withTGA and their mean particle diameter was measured at8.2 nm. The purified antibody was immobilized on theprepared TGA-modified CdTe QDs. This was achieveddue to the hydrophilic nature of the QDs leading to the

M

(a) (b)

545 bp

348 bp

1 2 3

Fig. 1. (a) Presence of resting spores was confirmed by staining and microscopy studies. (b) PCR amplification of P. betae and P. graminisrDNA ITS1+5.8S+ITS2 gene. M: 100 bp plus ladder, 1: Sugar beet contaminated P. betae, 2: Barley contaminated P. graminis. 3: Barleyhealthy root.

Dow

nloa

ded

by [

Uni

vers

iti P

utra

Mal

aysi

a] a

t 10:

28 2

4 A

ugus

t 201

2

Quantum-dot nanobiosensor against Polymyxa betae 5

Samples

0

0.5

1

1.5

Ab

so

rb

an

ce

in

40

5 n

m

2

2.5

3

Beta vulgaris healthy root

Hordeum vulgare healthy root

Beta vulgaris contaminated Polymyxa

betae

Hordeum vulgare contaminated P.

graminis

Recombinant GST protein (10 mg ml–1

)

(Positive control)

Fig. 2. Analysing plant materials with ELISA test. Each measurement is an average over three replicates.

attraction of the Ab molecules on their surfaces (Zhou &Ghosh, 2006). The Ab-QDs conjugates showed the maxi-mum fluorescence radiation at approximately 545 nm.

Conjugation of GST with rhodamine and fluorometryanalysis

The GST was successfully conjugated to rhodamine usingthe 19 free amine groups (lysine) of GST linked to

Fig. 3. The reproduced fluorometric peak of Ab-QDs conjugatesand the complex of QD-Ab-GST-rhodamine.

GLA. The two conjugates, i.e. Ab-QDs and rhodamine-GST, were further conjugated based on the antibody–antigen interaction phenomenon. Herein, the fluorescenceemission wavelength of the Ab-QDs was obtained at131 AU; however, the emission spectrum of the solu-tion showed an upward shift peaking at 2522 AU whenthe rhodamine-GST/Ab-QD conjugates were investigated(Fig. 3).

Sensitivity and specificity

The average downward baseline shift measured for IMPas the negative control (−41 ± 30) was used to differen-tiate the healthy and infected samples (Table 1). All 20P. betae positive samples were successfully detected and10 out of 10 P. betae negative samples were found healthyby the nanobiosensor method (Table 2). Based on theseresults, the assay has sensitivity and a specificity of 100%.Moreover, the results obtained showed that the devel-oped nanobiosensor failed to differentiate P. betae andP. graminis. This was in agreement with the results of theELISA method which indicated cross reactivity (Fig. 2).Table 1 also presents the comparison of the ELISA tech-nique and the nanobiosensor. The detection limit of theELISA technique in the present study was measured at2 µg mL−1 recombinant GST protein. The nanobiosensorshowed a far lower detection limit of lower than0.5 µg mL−1 recombinant GST protein.

Dow

nloa

ded

by [

Uni

vers

iti P

utra

Mal

aysi

a] a

t 10:

28 2

4 A

ugus

t 201

2

H. Safarpour et al. 6

Table 1. Comparative study to determine sensitivity of the ELISA and the nanobiosensor techniques.

Sample Concentration (µg ml−1) ELISA (A405 nm) Nanobiosensor (Baseline shifta)

GST recombinant protein 10 2.45 −10938 2.10 −9416 1.74 −8114 1.25 −7393 0.78 −5902 0.23 −4291 0.09 −337

0.5 0.11 −243Negative control (IMPb) 10 0.12 −41±30c

aChange= Second run−First run.bImmunodominant Membrane Protein.cX ± 3 SD.

Stability

The stability of the TGA-surface modified CdTe QDs,QD-Ab and rhodamine-GST conjugates were determinedby FT-IR spectra as shown in Fig. 4. The peak obtained at1630 cm−1 for QDs (Fig. 4a) should be coincident withcarbonyl stretching vibration, indicating that the CdTeQDs were successfully bound to the carboxylic acid func-tional group of TGA. The same peak (1630 cm−1) wasobserved for QD-Ab; however, it resulted from the –CO–NH mode or in other words, the contributions ofC–N stretching vibration and N–H bending vibrationin the CdTe QDs and the antibody molecules, respec-tively. As for the GST-rhodamine conjugates, the peakobtained at 1550 cm−1 should be coincident with theamine stretching vibration, indicating that amine groupsof the rhodamine were successfully bound with the alde-hyde functional group (-CHO) of glutaraldehyde. Theobtained results were successfully reproduced over thecourse of time. Therefore, the overall FT-IR analysis ofthe constructed conjugates revealed their stability.

Discussion

The results of the identification of Polymyxa spp. isolatesin the present study using the nuclear rDNA 18S, 5.8S andinternal transcribed spacers (ITS1 and ITS2) regions werein agreement with those of the previous studies (Legrèveet al., 2002; Vaïanopoulos et al., 2007).

The reported detection methods for rhizomania so farrequire multiple steps, and therefore, the present studywas set to apply luminescent semiconductor nanocrystalsor QDs coupled with FRET analysis to be used as an accu-rate, cost-effective and rapid immunoassay technique.Traditionally, QDs have been used in imaging techniquesacting as fluorescent labels. At the same time, FRET hasbeen used to study the interaction of macromolecules

labelled with organic fluorophores. The combination ofthese two techniques, therefore, could pose several advan-tages in studying macromolecular interactions (Younet al., 1995).

The synthesis of QDs is a relatively simple process andonce synthesized they have a relatively long shelf life.Moreover, minor modifications to the synthetic methodlead to a wide range of variations in the dot size and resul-tant optical properties. On the other hand, QDs are provedto be effective FRET donors due to their broad excitationspectra and tunable, narrow and symmetric photoemission(Youn et al., 1995). Therefore, they could enhance FRETas an effective technique for the application in molecu-lar binding event studies, protein conformation change,and biological assays. One of the most important signif-icance of the combination of QDs and FRET system istheir application as the QD-FRET based biosensors indesigning biomolecule detection systems specially usedfor pathogen detection in the samples of interest.

In principle, the antibody–antigen attachment is not ofrobust type. This fact was used in developing the detec-tion basis as when the free GST of P. betae origin wasadded to the solution, including the rhodamine-GST/Ab-QD conjugates, the rhodamine-GST domain was replacedby the free GST based on the concentration of the freeGST in the suspicious sample. This led to a downwardshift of the fluorometer curve in comparison with thecurve previously obtained for the rhodamine-GST/Ab-QD conjugates (Table 1). This could be explained throughthe optical quenching mechanism of the QD-antibodydomain by the rhodamine-antigen domain based on theForster dipole–dipole interaction model (Zhou & Ghosh,2006). In other words, the inorganic dye i.e. rhodamine(a fluorescence acceptor) conjugated to the antigen (GST)occupies the peptide-binding pocket of the antibodyi.e. anti-GST polyclonal antibody resulting in a 3-foldFRET signal. Therefore, when free GST derived from

Dow

nloa

ded

by [

Uni

vers

iti P

utra

Mal

aysi

a] a

t 10:

28 2

4 A

ugus

t 201

2

Quantum-dot nanobiosensor against Polymyxa betae 7

Table 2. Analysing real samples (20 P. betae-infected, three healthy sugarbeet and 10 P. graminis infected barley samples) with theconstructed bio-nanosensor.

Sample status Sample no. First run a (AU) Second run b (AU) Change c

P. betae-infectedsugarbeet 1 2944 d 2343 −6012 2715 2114 −6013 3039 2465 −5744 2448 1898 −5505 2428 1900 −5286 2658 2134 −5247 2474 1960 −5148 2608 2159 −4499 2382 1958 −424

10 2904 2493 −41111 2401 2006 −39512 2382 2018 −36413 2313 1993 −32014 2486 2170 −31615 2575 2263 −31216 2350 2096 −25417 2217 1964 −25318 2470 2225 −24519 2292 2103 −18920 2361 2175 −186

Healthy sugarbeet 21 2501 2442 −5922 2496 2437 −5923 2388 2335 −5324 2459 2410 −4925 2423 2376 −4726 2731 2700 −3127 2467 2436 −3128 2530 2501 −2929 2336 2314 −2230 2634 2620 −14

P. graminis-infected barley 31 2481 2220 −26132 2632 2383 −24933 2325 2092 −23334 2577 2345 −23235 2463 2256 −20736 2698 2499 −19937 2367 2183 −18438 2524 2365 −15939 2640 2496 −14440 3011 2876 −135

aFirst run at 580 nm [Buffer + (QDs-Ab) + (Rhodamine-GST)].bSecond run at 580 nm [Buffer + (QDs-Ab) + (Rhodamine-GST) + sample].cThe baseline shift (−41 ± 30 AU) associated with IMP has been used as a criterion to decide whether a sample is P. betae-infected.dEach measurement is an average over three replicates.

the pathogenic agent was added, it displaced the GST-rhodamine domain in the rhodamine-GST/Ab-QD con-jugates, resulting in a fluorescence recovery from theconjugated QD-Ab domain. More specifically, the higherthe concentration of the free GST, the GST-rhodaminedomain/free GST distribution on the surface of the anti-body molecules would shift in favour of the free GST.In another word, higher GST concentrations are translatedinto the fluorometer curves obtained peaking at lowerphotoluminescence (PL) intensities.

When using antibodies in a detection system, theirspecificity against closely related species is of great con-cern. The cross reactivity observed between the antibodyproduced against P. betae-GST in this study, and theclosely related species P. graminis has also been reportedin previous studies where Polymyxa-specific antibodieswere developed (Delfosse et al., 2000; Mutasa-Gottgenset al., 2000). This is due to the high level of homologybetween the two fungal species. However, fortunately, thetwo are well-distinguished by their host range, decreasing

Dow

nloa

ded

by [

Uni

vers

iti P

utra

Mal

aysi

a] a

t 10:

28 2

4 A

ugus

t 201

2

H. Safarpour et al. 8

Fig. 4. FT-IR spectra of (a) CdSe QDs, (b) Ab-QDs conjugates, (c)GST-Rhodamine conjugates.

the risk of false-positive results in the nanobiosensorsystem developed.

In the nanobiosensor assay, only 20 µL of sample isrequired, which is critical in cases where sample volumesare small and limited. The detection limit for GST pro-tein using this assay was far lower than 0.5 µg mL−1,which was much better than that of the conventionalELISA (2 µg mL−1). From an economic point of view,the cost of QD synthesis is the sole difference between theELISA method and the developed nanobiosensor, whichis negligible. However, in terms of large-scale operation

costs, the nanobiosensor is more economical due to itsspeed.

Acknowledgement

We greatly appreciate the financial support provided bythe Agriculture Biotechnology Research Institute of Iran(ABRII).

References

ABE, H. (1987). Studies on the ecology and control of Polymyxa betaeKeskin, as a fungal vector of the causal virus (Beet necrotic yellowvein virus) of Rhizomania disease of sugar beet. Rept. No. 60: 80–99.Hokkaido: Hokkaido Prefect. Kitami Agric. Exp. Stn.

ALGAR, W.R., & KRULL, U.J. (2007). Quantum dots as donors influorescence resonance energy transfer for the bioanalysis of nucleicacids, proteins, and other biological molecules. Anal. Bioanal. Chem.,391, 1609–1618.

CLARK, M.F., & ADAMS, A. N. (1977). Characteristics of the microtiterplate method of enzyme linked immunosorbent assay for the detection ofplant viruses. J. Gen. Virol., 34, 475–483.

DELFOSSE, P., REDDY, A.S., LEGERVE, A., DEVI, K.T., ABDURAHMAN,M.D., MARAITE, H., & REDDY, D.V.R. (2000). Serological methods fordetection of Polymyxa graminis, an obligate root parasite and vector ofplant viruses. Phytopathology, 90, 537–545.

FRASCO, M.F., & CHANIOTAKIS, N. (2009). Semiconductor quantum dotsin chemical sensors and biosensors. Sensors, 9, 7266–7286.

GERIK, J.S. (1992). Zoosporic obligate parasites of roots. In L.L.Singleton, J.D. Mihailand C.M. Rush (Eds.). Methods for Research onSoilborne Phytopathogenic Fungi (pp. 18–24). St. Paul, MN: AmericanPhytopathological Society Press.

GOLDMAN, E.R., MATTOUSSI, H., ANDERSON, P., MEDINTZ, I., &MAURO, M. (2005). Fluoroimmunoassays using antibody-conjugatequantum dots. Methods Mol. Biol., 303, 19–34.

HAHN, M.A., KENG, P.C., & KRAUSS, T.D. (2008). Flow cytometric anal-ysis to detect pathogens in bacterial cell mixtures using semiconductorquantum dots. Anal. Chem., 80, 864–872.

KINGSNORTH, C.S., ASHER, M.J.C., KEANE, G.J.P., CHWARSZCZYNSKA,D.M., LUTERBACHER, M.C., & MUTASA-GOTTGENS, E.S. (2003).Development of a recombinant antibody ELISA test for the detectionof Polymyxa betae and its use in resistance screening. Plant Pathol., 52,673–680.

LEGRÈVE, A., DELFOSSE, P., & MARAITE, H. (2002). Phylogenetic anal-ysis of Polymyxa species based on nuclear 5.8S and internal transcribedspacers ribosomal DNA sequences. Mycol. Res., 106, 138–147.

MUTASA-GOTTGENS, E.S., WARD, E., ADAMS, M.J., COLLIER, C.R.,CHWARSZCZYNSKA, D.M., & ASHER, M.J.C. (1993). A sensitive DNAprobe for the detection of Polymyxa betae in sugar beet roots. Physiol.Mol. Plant Pathol., 43, 379–390.

MUTASA-GOTTGENS, E.S., CHWARSZCZYNSKA, D.M., HALSEY, K., &ASHER, M.J.C. (2000). Specific polyclonal antibodies for the obligateplant parasite Polymyxa – a targeted recombinant DNA approach. PlantPathol., 49, 276–287.

PUTZ, C., MERDINOGLU, D., LEMAIRE, O., STOCKY, G., VALENTIN, P.,& WIEDEMANN, S. (1990). Beet necrotic yellow vein virus, causal agentof sugar beet rhizomania. Rev. Plant Pathol., 69, 247–254.

SAFARNEJAD, M.R., SALEHIJOUZANI, G.R., TABATABAIE, M., TWYMAN,R.M., & SCHILLBERG, S. (2011). Antibody-mediated resistance againstplant pathogens. Biotechnol. Adv., 29, 961–971.

SHI, X., HONG, T., WALTER, L.K., EWALT, M., MICHISHITA,E., HUNG, T. et al. (2006). ING2 PHD domain links histone

Dow

nloa

ded

by [

Uni

vers

iti P

utra

Mal

aysi

a] a

t 10:

28 2

4 A

ugus

t 201

2

Quantum-dot nanobiosensor against Polymyxa betae 9

H3 lysine 4 methylation to active gene repression. Nature, 442(7098),96–99.

TAMADE, T., UCHINO, H., KUSUME, T., & SAITO, M. (1999). RNA 3 dele-tion mutants in necrotic yellow vein virus do not cause rhizomania diseasein sugar beets. Phytopathology, 89, 1000–1006.

THOMPSON, J.P., CLEWETT, T.G., JENNINGS, R.E., SHEEDY, J.G.,OWEN, K.J., & PERSLEY, D.M. (2011). Detection of Polymyxagraminis in a barley crop in Australia. Austral. Plant Pathol., 40,66–75.

VAÏANOPOULOS, C., BRAGARD, C., MOREAU, V., MARAITE, H., &LEGRÈVE, A. (2007). Identification and quantification of Polymyxagraminis f. sp. temperate and P. graminis f. sp. tepida on barley and wheat.Plant Dis., 91, 857–864.

VAN REGENMORTEL, M.H.V. (1997). The antigen antibody reaction.In C.P PRICE and D.J. NEWMAN (Eds.). Principles and Practice ofImmunoassay (pp. 14–34). London: Macmillan Press.

WARD, L.I., FENN, M.G.E., & HENRY, C.M. (2004). A rapid method fordetection of Polymyxa DNA in soil. Plant Pathol., 53, 485–490.

WILLARD, D.M., CARILLO, L.L., JUNG, J., & ORDEN, A.V. (2001). CdSe-ZnS Quantum Dots as resonance energy transfer donors in a modelprotein-protein binding assay. Nano Lett., 1, 469–474.

YOUN, H.J., TERPETSCHNIG, E., SZMACINSKI, H., & LAKOWICZ, J.R.(1995). Fluorescence energy transfer immunoassay based on a long-lifetime luminescent metal-ligand complex. Anal. Biochem., 232, 24–30.

ZHOU, M., & GHOSH, I. (2006). A bright future together. Pept. Sci., 88,325–339.

Dow

nloa

ded

by [

Uni

vers

iti P

utra

Mal

aysi

a] a

t 10:

28 2

4 A

ugus

t 201

2