Decreased Interleukin-10 and IncreasedInterleukin-12p40 mRNA Are Associated

with Disease Activity and CharacterizeDifferent Disease Stages in Multiple Sclerosis

A. H. H. van Boxel-Dezaire, MSc,*† S. C. J. Hoff,* B. W. van Oosten, MD,† C. L. Verweij, PhD,‡A. M. Drager, PhD,§ H. J. Ader, PhD,i J. C. van Houwelingen, PhD,¶

F. Barkhof, MD,# C. H. Polman, MD,† and L. Nagelkerken, PhD*

It has been shown that proinflammatory and antiinflammatory cytokines correlate with disease activity in multiplesclerosis (MS). To establish whether such correlations depend on the disease stage, we assessed in a longitudinal fashionthe expression of interleukin (IL)-12 (p40 and p35), tumor necrosis factor-a, interferon-g, and IL-10 mRNA by com-petitive polymerase chain reaction in unstimulated peripheral blood mononuclear cells of relapsing–remitting (RR) andsecondary progressive (SP) MS patients, in relation to monthly clinical and magnetic resonance imaging monitoring. MSpatients had increased levels of IL-12p40 and decreased levels of IL-10 mRNA compared with controls; this differencewas most pronounced in SP patients. Both RR and SP patients had increased levels of IL-12p40 mRNA compared withcontrols during the development of active lesions. Moreover, in RR MS an increase was found before relapse. IL-12p35mRNA was decreased in both groups, and in relation to disease activity it showed a pattern different from IL-12p40mRNA. In RR MS, IL-10 mRNA was low 4 weeks before magnetic resonance imaging activity and 6 weeks beforerelapse; a significant increase to normal levels was noted when active lesions became apparent. In contrast, SP patientsshowed low IL-10 mRNA levels constitutively, suggesting that IL-10 plays an important role in the control of diseaseprogression.

van Boxel-Dezaire AHH, Hoff SCJ, van Oosten BW, Verweij CL, Drager AM, Ader HJ, van Houwelingen JC,Barkhof F, Polman CH, Nagelkerken L. Decreased interleukin (IL)-10 and increased IL-12p40

mRNA are associated with disease activity and characterize different disease stages inmultiple sclerosis. Ann Neurol 1999;45:695–703

In multiple sclerosis (MS), the inflammatory infiltratesin the brain are mainly CD41 T cells and macro-phages.1 Cytokines produced by these infiltrating cellscontribute to disease progression in MS; proinflamma-tory (tumor necrosis factor [TNF]-a, TNF-b, and in-terleukin [IL]-12), but also antiinflammatory (IL-4 andIL-10), cytokines can be detected in the lesions.2–4

Beck and colleagues5 were the first to describe that thesecretion of TNF-a and interferon (IFN)-g induced bymitogen stimulation of whole blood is enhanced beforeclinical exacerbation of disease. However, others re-ported contradictory results with regard to the presenceof these cytokines in serum or cerebrospinal fluid, orafter mitogen stimulation of blood cells.6–9 Cytokine

mRNA assessment appears to be more consistent and ithas been demonstrated that fluctuations in TNF-amRNA levels in peripheral blood mononuclear cells(PBMCs) precede clinical relapse in contrast to cyto-kine levels in serum.9–11 IL-10 mRNA was found to bedecreased before the occurrence of exacerbations.10,11

Brain magnetic resonance imaging (MRI) scanningvisualizes lesional activity and is regarded as a moresensitive approach to monitor disease activity. Variousstudies have been published regarding the correlationbetween cytokines and MRI measures of disease activ-ity.9,11,12–15 None of these studies demonstrated a re-lation between serum TNF-a9,12,14 and MRI activity.On the other hand, lipopolysaccaride-stimulated

From *TNO Prevention and Health, Division of Immunologicaland Infectious Diseases, and Departments of ‡Rheumatology and¶Medical Statistics, Leiden University Medical Centre, Leiden; andDepartments of †Neurology and §Hematology, and #MS-MRICentre and Department of Diagnostic Radiology, University Hos-pital “Vrije Universiteit” Amsterdam, and iDepartment of Epidemi-ology and Biostatistics, Faculty of Medicine, “Vrije Universiteit”Amsterdam, Amsterdam, The Netherlands.

Received Sep 21, 1998, and in revised form Dec 28. Accepted forpublication Jan 25, 1999.

Address correspondence to Dr Nagelkerken, Division of Immuno-logical and Infectious Diseases, TNO Prevention and Health, POBox 2215, 2301 CE, Leiden, The Netherlands.

ORIGINAL ARTICLES

Copyright © 1999 by the American Neurological Association 695

PBMCs showed enhanced IL-1b, TNF-a, and IFN-g,and decreased IL-10 and transforming growth factor-b(TGF-b) secretion in MS patients with active lesionscompared with MS patients without active lesions.13

At the mRNA level, TNF-a was found to be enhancedin PBMCs of MS patients with MRI activity11 and topredict lesional activity.9 Together, these data suggestthat alterations in the balance between proinflamma-tory and antiinflammatory mRNA are associated withchanges in disease activity.

So far no data have been published with respect toIL-12, as measured in a longitudinal fashion in relationto clinical and MRI activity. Because this cytokine is akey mediator in cellular immunity16 and has beendemonstrated to be associated with the development ofexperimental autoimmune encephalomyelitis (EAE),17

we studied the two IL-12 subunits IL-12p35 and IL-12p40 in addition to TNF-a, IFN-g, and IL-10. Thiswas done in a longitudinal fashion in unstimulatedPBMCs derived from 8 relapsing–remitting (RR) and5 secondary progressive (SP) MS patients, to establishthe relation with clinical relapse and lesional activity onbrain MRI. Further, we explored whether RR and SPpatients differed as far as the relation between cytokinemRNA profile and disease activity was concerned.

Subjects and MethodsPatients and ControlsMS PATIENTS. The MS patients participated in a random-ized, double-blind, placebo-controlled exploratory phase IItrial of the a-CD4 monoclonal antibody cM-T412. The 13MS patients who were analyzed in this study were the Am-sterdam placebo controls of this multi-Centre trial.18 Themost relevant inclusion criteria were clinically definite19 RRor SP MS; and activity of the disease as based on the pres-ence of two relapses within the last 12 months before thetrial or deterioration on Kurtzke’s Expanded Disability Statusscale20 of at least 1 point within the last 18 months before

the trial. Demographic and baseline characteristics of the pa-tients at inclusion are given in Table 1.

CLINICAL MONITORING. The clinical course of the diseasewas recorded by establishing clinical exacerbations and dete-rioration on Kurtzke’s Expanded Disability Status scale. TheSP MS patients did not experience relapses during thefollow-up of 18 months, whereas the average number of clin-ical exacerbations in the 8 RR MS patients was 2.34 6 2.13after 9 months (1 patient, 0 relapses; 3 patients, 1 relapse; 2patients, 2 relapses; 1 patient, 3 relapses; and 1 patient, 6relapses), and 3.88 6 2.36 after 18 months of study.

BRAIN MRI. On the 130 MRI scans performed during thefirst 9 months of follow-up, a total of 127 active lesions wasseen on 57 scans. Active lesions were defined as lesions thatshowed new enhancement on T1-weighted images, and asnew lesions on T2-weighted images that had not been de-tected by using gadolinium.18

BLOOD SAMPLING. Because these patients did not receiveactive treatment, except for occasional standard methylpred-nisolone treatment (1,000 mg intravenously for 3 consecu-tive days) in case of a relapse, it was possible to study thenatural course of the disease in relation to cytokine expres-sion in PBMCs. EDTA blood was collected monthly (for thefirst 9 months and thereafter every 3 months) by venapunc-ture over a period of 1.5 years and a gadolinium-enhancedMRI scan was performed on the same day. Seven percent ofthe blood samples were missing at the end of the follow-up,for several incidental reasons.

HEALTHY CONTROLS. To study the natural fluctuatingpatterns of cytokine mRNA in healthy controls, 7 monthlysamples of EDTA blood were obtained from 4 female and 2male healthy volunteers from our laboratory (mean age,35.2 6 10.3 years).

PBMC IsolationWithin 4 hours after puncture, PBMCs were isolated by His-topaque 1077 (Sigma, St Louis, MO) density gradient cen-trifugation, cryopreserved in Iscove’s modified Dulbecco’smedium (IMDM; GibcoBRL, Gaithersburg, MD) supple-mented with 20% fetal calf serum and 10% dimethyl sulfox-ide (Merck, Darmstadt, Germany), and stored at 2190°Cuntil RNA isolation.

RNA Isolation and cDNA SynthesisCryopreserved PBMCs were quickly thawed and pelleted bycentrifugation (15 seconds, 14,000g, 4°C). Total RNA wasisolated from the pellet by using RNAzolB (Campro Scien-tific, Veenendaal, The Netherlands) according to the manu-facturer’s instructions and stored at 280°C. Three micro-grams of RNA was reverse transcribed into cDNA by using areverse transcription system kit (Promega, Madinson, WI)and the products were subsequently stored at 220°C.

Competitive Polymerase Chain ReactionFor the quantification of mRNA on the cDNA level, thecDNA products were mixed with known amounts of multi-specific internal standards pQA-1 or pQB-321 (kindly pro-

Table 1. Demographic and Baseline Characteristics ofMultiple Sclerosis Patients (Placebo Controls)

Disease Characteristic RR SP

Number of patients 8 5Sex

Female 6 3Male 2 2

Mean age (years 6 SD) 32.4 6 7.2 43.4 6 5.8Disease duration (years 6 SD) 2.4 6 1.3 11.4 6 9.2Mean number of clinical relapses 2.5 6 0.9 0.8 6 1.1

in 12 months before entryEDSS progression 1.3 6 2.3 1.7 6 0.8

in 18 months before entryEDSS at inclusion 4.5 6 1.4 6.2 6 0.9

RR 5 relapsing–remitting; SP 5 secondary progressive; EDSS 5Kurtzke’s Expanded Disability Status scale.

696 Annals of Neurology Vol 45 No 6 June 1999

vided by Drs D. Shire and P. Legoux, Sanofi Recherche,Labege, France). To provide for an internal standard for IL-12p35 and IL-12p40, primer sites for these cytokines werecloned into pQA-1, as reported previously.22 These standardscompete with the cDNA for primer binding, yielding prod-ucts of a different size. When titrated sufficiently, the pointof equivalence can be assessed, at which the amount of un-known (sample) cDNA equals that of the standard. Table 2shows the primer sequences of the primers used and the cor-responding sizes of the amplified products of cell cDNA andstandard DNA. Primer pairs were used that cover a splicejunction and therefore amplify only cDNA and not genomicDNA. The 50-ml reaction mixture that was added per tube,contained 13 polymerase chain reaction (PCR) buffer (50mM KCl, 10 mM Tris-HCl, pH 8.3, 2 mM MgCl2, and 60ng/ml bovine serum albumin) when PQA-1 and PQB-3 wereused and 13 PCR buffer II (50 mM KCl, 10 mM Tris-HCl, pH 8.3, 100 ng/ml gelatin; Perkin-Elmer, Branchbury,NJ) with 2.5 mM MgCl2 (Perkin-Elmer) when PQA-1/IL-12 was used, 0.25 mM dNTPs (GibcoBRL), 12.5 pmolof sense and antisense primer (Isogen Bioscience, Maarssen,The Netherlands) and 1 U Taq DNA polymerase (Gibco-BRL). Cycling conditions were 2 minutes of denaturation at96°C at the start, 0.5 minutes of denaturation at 96°C, 1minute of annealing at 55°C, and 1 minute of elongation at72°C, repeated during 30 cycles for b-actin and 35 cycles forthe cytokines, and a final elongation step of 4 minutes at72°C (Perkin-Elmer 9600 PCR apparatus). The PCR prod-ucts were separated on a 2% agarose gel and stained withethidium bromide for b-actin–, TNF-a–, and IFN-g–amplified products. Visualization of the PCR products am-plified with IL-10, IL-12p40, or IL-12p35 specific primersrequired enhancement using SYBR Green I nucleic acid gelstain (Molecular Probes Europe BV, Leiden, The Nether-lands). The amount of PCR product was determined by den-sitometric imaging, using the Bio-1D digital imaging systemversion 6 (Vilber Lourmat, Marne la Vallee, France). To cor-rect for differences in initial cell numbers, as well as the ef-ficiency of mRNA isolation and cDNA synthesis, theamounts of cytokine cDNA are expressed in femtogram stan-dard equivalents per femtograms of b-actin standard equiv-alents; all shown data were normalized in this manner.

Statistical MethodsStatistical analysis was performed by using the SPSS 7.0package (SPSS Inc, Chicago, IL) for MS-Windows. The gen-eral linear model analysis of variance module was used tocompare the cytokine mRNA levels between MS patientgroups and healthy controls. To establish a normal distribu-tion of the data, a log transformation of the cytokine mRNAdata was performed and further used during general linearmodel analysis. In this analysis persons within groups aretaken as a random factor, groups and time of measurementas fixed factors. In the comparison of (RR and SP) MS pa-tient groups with healthy controls and the comparison be-tween patient groups (between subjects comparison) thisanalysis considers the dependence (correlation) between mea-surements of the same person. It can be regarded as a gen-eralization of the independent samples t test, using averagecytokine mRNA expression per person.

To get further insight into the relation between cytokinelevels and disease activity, a new time scale was introducedrelative to the moment of active lesion or clinical relapse;cytokine mRNA data before, at, and after disease activitywere pooled, as indicated in the legends to the Figures. TheFriedman test was used to test for changes of the cytokinelevels over time. When the Friedman test showed a differ-ence (p , 0.05), post hoc analysis was performed by usingthe Wilcoxon signed rank test to detect where the changestook place.

ResultsDifferences Between Cytokine mRNA Expression inPBMCs of Healthy Controls and MS PatientsFluctuating patterns were found for most cytokines inboth MS patients and healthy controls. Figure 1 showsan example of a follow-up of 1 MS patient over a pe-riod of 18 months, where disease activity was definedas the occurrence of clinical relapse and lesional activityon brain MRI scan. As a first approach to analyze thedata, the geometric means of the mentioned cytokinemRNAs were calculated for each individual (Fig 2),based on the 13 monthly collected samples from each

Table 2. Primer Sequences Used and Size of Corresponding Amplicons

cDNA Standard

b-Actin sense GGGTCAGAAGGATTCCTATG 237 bp 410 bpb-Actin antisense GGTCTCAAACATGATCTGGGIL-10 sense ATGCTTCGAGATCTCCGAGA 269 bp 410 bpIL-10 antisense AAATCGATGACAGCGCCGTATNF-a sense ACAAGCCTGTAGCCCATGTT 427 bp 370 bpTNF-a antisense AAAGTAGACCTGCCCAGACTIFN-g sense GCAGAGCCAAATTGTCTCCT 290 bp 370 bpIFN-g antisense ATGCTCTTCGACCTCGAAACIL-12p40 sense GGAGTACTCCACATTCCTAC 430 bp 390 bpIL-12p40 antisense CCATGGCAACTTGAGAGCTGIL-12p35 sense CAGCAACATGCTCCAGAAGG 602 bp 390 bpIL-12p35 antisense CCTAGTTCTTAATCCACATC

IL 5 interleukin; TNF-a 5 tumor necrosis factor-a; IFN-g 5 interferon-g.

van Boxel-Dezaire et al: IL-10 and IL-12 in MS 697

MS patient and on the 7 monthly collected samplesfrom each healthy control. TNF-a mRNA could al-ways be quantified in PBMCs from MS patients andcontrols; the mean levels of TNF-a mRNA in controlsand MS patients, established by averaging data col-lected over a prolonged period of time, were quite sim-ilar (see Fig 2). In contrast, IL-12p40 mRNA was al-ways below the detection limit in PBMCs of thecontrols, but was frequently detectable in 5 of 8 RRMS and in all SP MS patients. IL-12p40 mRNA ex-pression in the total group (RR and SP) of MS patientswas significantly enhanced (p 5 0.015) compared withcontrols. It is interesting that the 3 RR patients withundetectable IL-12p40 mRNA were younger (27.0 64.6 years) and had a shorter disease history (1.7 6 1.2years) than the 5 RR patients in which IL-12p40mRNA could be measured (mean age, 35.6 6 6.7years; mean disease duration, 2.8 6 1.3 years). As aconsequence, the total group of RR patients thereforeonly showed a trend (p 5 0.069), whereas the groupof SP patients showed significantly increased IL-12p40mRNA levels compared with controls (p # 0.0001).Figure 2 shows that IL- 12p35 mRNA levels were vari-able in the total group of MS patients and decreasedcompared with the controls (p 5 0.001). It is note-worthy that the RR patients showed decreased levelsnot only when compared with the controls (p #0.0001), but also compared with the SP patients (p 50.004). The mean IFN-g mRNA expression of the MSpatients was slightly diminished compared with thecontrols (p 5 0.046); this difference could neither beattributed to the RR patients nor to the SP patients.IL-10 mRNA was decreased in the total group of MSpatients compared with the controls (p # 0.0001); thisdecrease was obvious in both clinical groups (p #0.0001), but especially in the SP MS patients (SP versusRR, p 5 0.017). It is concluded that SP patients differmore from healthy controls than RR patients, with re-spect to their IL-10 and IL-12p40 mRNA levels.

Relation Between Clinical Exacerbations andCytokine Expression in Unstimulated PBMCsof RR MS PatientsRelapses did not occur in the SP patients, whereas 16relapses were noticed in the RR patients during thefollow-up period. Eighty-eight percent of these relapseswere preceded by lesional activity on MRI scans. Toinvestigate the difference in cytokine mRNA expressionbefore, during, and after these clinical exacerbations,longitudinal data of 7 RR patients were centeredaround the 16 relapses and the mean 6 SEM was cal-culated on each different time point. Figure 3 showsthe variation in the mean cytokine mRNA expressionfrom 6 weeks before until 6 weeks after the relapse.Levels of IFN-g or TNF-a mRNA did not show a sig-nificant change in relation to relapse. Although levels

Fig 1. Longitudinal cytokine profile of a relapsing–remittingmultiple sclerosis (MS) patient. RNA was isolated from un-stimulated peripheral blood mononuclear cells of MS Patient21. After cDNA synthesis, tumor necrosis factor-a (TNF-a),interferon-g (IFN-g), interleukin (IL)-12p35, IL-12p40, andIL-10 mRNA were quantified by competitive polymerase chainreaction. The samples were normalized for differences in ini-tial cell numbers, as well as the efficiency of mRNA isolationand cDNA synthesis, by calculating the ratio of cytokinemRNA (in femtogram standard equivalents) over b-actinmRNA (in femtogram standard equivalents). Clinical relapsesare indicated by an arrow and the number of active lesionsassessed by magnetic resonance imaging (MRI) is depicted atthe top of the figure.

698 Annals of Neurology Vol 45 No 6 June 1999

of IL-10 and IL-12p35 before relapse were low com-pared with controls, and some patients showed an in-crease after relapse to levels even higher than found inhealthy controls, changes in these cytokines were notsignificant. In contrast, changes in IL-12p40 mRNAcorrelated more strongly with relapse (p , 0.05). Posthoc analysis showed that IL-12p40 mRNA, which wasalready detectable 6 weeks before relapse, increased sig-nificantly (Wilcoxon, p 5 0.028) 2 weeks before thisevent; not until 6 weeks after the relapse was this ex-pression normalized in all patients. As indicated above,IL-12p40 mRNA could only be quantitated during sixrelapses in 4 RR patients, whereas it was below thelevel of detection during the 10 relapses observed in 3RR patients with a shorter disease duration. It is note-worthy that the latter patients demonstrated 10-foldhigher mean IL-10 mRNA levels 2 weeks before therelapse (p 5 0.016, data not shown).

Relationship Between Cytokine Expression inUnstimulated PBMCs and the Appearanceof Active Lesions on Brain MRI Scanningof RR and SP MS PatientsTo establish whether a relation exists between cytokinemRNA and the development of lesions, cytokinemRNA data before, at, and after the detection of MRIactivity were pooled. Because MRI activity was oftenpresent during subsequent months, only those series ofdata points were included where no lesional activitywas present 1 month before the occurrence of an MRIevent. Changes in TNF-a and IFN-g mRNA did not

show a predictive value in either of the subgroups (Fig4). Detectable levels of IL-12p40 mRNA were alreadyfound 8 weeks before the development of active lesionsin both RR and SP patients (data not shown) andthese remained present during the subsequent months.In contrast to relapse, changes in IL-12p40 mRNAwere not related to MRI active lesions. However, clearchanges in IL-12p35 mRNA occurred in relation toMRI lesions in the RR (p 5 0.025) and in the SP(p 5 0.022) patients. Post hoc analysis showed a de-cline in this mRNA during the development of activelesions in the SP patients (Wilcoxon, p 5 0.028). InRR patients the IL-12p35 mRNA expression was al-ready low at an earlier time point (see Fig 4). We ob-served an increase in IL-12p35 mRNA 1 month afterthe appearance of active lesions in both groups of pa-tients, RR patients in particular (Wilcoxon, p 50.019).

RR and SP MS patients were comparable in thatIL-10 mRNA was low 1 month before the appearanceof active lesions. It is noteworthy that MRI-relatedchanges in IL-10 mRNA could only be noted in theRR patients (p 5 0.0035); post hoc analysis showed anincrease in IL-10 mRNA (Wilcoxon, p 5 0.0052),which was related to the occurrence of active lesions.In contrast, the SP MS group demonstrated low levelsof IL-10 mRNA constitutively. This leads us to postu-late that low levels of IL-10 in association with in-creased IL-12p40 levels are permissive for the progres-sion of the inflammatory response and disease activityin SP MS patients.

Fig 2. Geometric means of cytokine mRNA expressed in serially collected peripheral blood mononuclear cells (PBMCs) of healthycontrols, relapsing–remitting (RR) multiple sclerosis (MS) patients, and secondary progressive (SP) MS patients. Cytokine mRNAwas quantified in unstimulated PBMCs from each person by competitive polymerase chain reaction and expressed as a ratio of cyto-kine mRNA over b-actin mRNA, both determined in femtogram standard equivalents. Each point in the figure represents the geo-metric mean of 7 monthly collected samples for each of the healthy controls (C) or 13 monthly samples for each of the RR and SPMS patients. Statistical analysis was done including all data of cytokine mRNA expressed in serially collected PBMCs. p values fordifferences between healthy controls and RR or SP patients are shown in the figure, as well as for differences between RR and SPMS. *p , 0.07, **p , 0.02, ***p , 0.005, ****p # 0.0001. IL 5 interleukin; TNF-a 5 tumor necrosis factor-a; IFN-g 5interferon-g.

van Boxel-Dezaire et al: IL-10 and IL-12 in MS 699

DiscussionThe aim of this exploratory study was to establishwhether a relation exists between proinflammatory or

antiinflammatory cytokines and disease activity. This isthe first longitudinal study that used a competitivePCR to quantitate cytokine mRNA expression in rela-tion to monthly clinical and MRI monitoring of RRand SP MS patients. We used unstimulated PBMCs toapproach the in vivo expression of cytokine mRNA asmuch as possible.

Six of the 16 relapses under investigation were fol-lowed by methylprednisolone treatment. Glucocorti-coids may have selective modulatory effects with re-spect to IL-10 and IL-12.22 Because treatments alwaystook place after the relapse, they could not be held re-sponsible for (lack of ) changes in cytokine mRNA oc-curring before development of MRI activity and re-lapse. However, it is likely that a transient change inthe cytokine mRNA occurred in the RR patients im-mediately after treatment and that such changes werenot noted as a consequence of our monthly samplingprocedure.

IL-12p40 mRNA was always below the detectionlimit of our competitive PCR in 6 healthy controls,whereas it was frequently quantified in PBMCs of 10of 13 MS patients. Moreover, increased IL-12p40mRNA expression occurred in relation to the develop-ment of active lesions and clinical relapses. Because IL-12p35 mRNA was also present in these MS patients, itis likely that the levels of functional IL-12 were in-creased as well. This is in accord with the observationthat serum levels of IL-12p70 are increased in SP MSpatients.23 Although IL-12p70 production by PBMCsfrom RR MS patients appeared normal after stimula-tion with a T cell–independent mitogen,24 an in-creased production could be demonstrated in a differ-ent study in progressive MS patients and attributed toan increased inducibility of CD40L on CD41 Tcells.25 Likewise, an increased expression of CD40L, ashas been demonstrated in MS lesions,26 may contrib-ute to a local IL-12 induction as well.3 Possibly, anti-CD40L inhibits EAE development,26 because of a re-duced IL-12 production. The importance of IL-12 inthis model appeared from its expression shortly beforethe onset of clinical signs of disease.27 Moreover, it hasbeen shown that IL-12 induces clinical exacerbation ofEAE28 and that it increases the severity and duration ofclinical disease.17 The importance of the IL-10/IL-12balance in the control of EAE was further substantiatedusing cytokine knock-out mice.29

In contrast to previous studies,6,9–11 our studyshowed no significant increase of TNF-a mRNA be-fore clinical exacerbation in RR patients. The lack ofcorrelation of IFN-g mRNA with active lesions or clin-ical relapse confirms a previous study performed in thesame patients, showing that IFN-g production after invitro stimulation of whole blood did not correlate withdisease activity.15 As far as the antiinflammatory cyto-kines were concerned, both the RR and the SP patients

Fig 3. High interleukin (IL)-12p40 mRNA and low IL-10mRNA levels precede clinical relapse in relapsing–remitting(RR) multiple sclerosis (MS) patients. For each cytokine, alldata points associated with a clinical relapse were pooled. Atotal of 16 relapses was recorded in 7 RR patients only duringthe first 9 months. The mean cytokine mRNA level 6 SEM isshown at 6 and 2 weeks before, at, and at 2 weeks after ex-acerbation. The dotted line represents the mean of the resultsobtained with peripheral blood mononuclear cells from 6healthy controls, 7 samples each (n 5 42). The occurrence ofa relapse is indicated by an arrow. **p , 0.05. TNF-a 5tumor necrosis factor-a; IFN-g 5 interferon-g.

700 Annals of Neurology Vol 45 No 6 June 1999

had significantly decreased levels of IL-10 mRNA com-pared with healthy controls. IL-10 mRNA in PBMCsof both RR and SP patients was decreased 4 weeks be-fore brain MRI scanning showed lesional activity and 6weeks before the occurrence of clinical exacerbations inthe RR patients. Others have previously demonstratedin RR patients that IL-10 mRNA expression10 andnumbers of IL-10 mRNA expressing cells30 are lowerduring active disease compared with stable disease.However, our data fit better with the observation thateven during stable disease IL-10 serum levels are de-creased compared with controls.31

Although MRI is regarded as a more sensitive ap-proach to monitor disease activity, a strict correlationwith clinical relapse is not always found. On average,

we found that MRI activity was accompanied by anincrease in IL-10 mRNA in RR MS only. Further-more, low IL-10 mRNA and high IL-12p40 mRNAlevels were associated with clinical exacerbations. Thesefindings suggest that the balance between IL-10 andIL-12p40 mRNA is important for the development ofclinical relapse. However, in 3 early RR patients IL-12p40 mRNA expression remained below the detec-tion limit even during clinical relapses. The possibilitythat low IL-10 mRNA levels in these patients are per-missive for enhanced IL-12p40 mRNA when diseaseprogresses remains to be established. The finding thatthe average IL-10 mRNA expression in the early RRpatients was also lower compared with controls (datanot shown), is in accord with the observation of a sub-

Fig 4. The appearance of activelesions is associated with an increasein interleukin (IL)-10 mRNA inrelapsing–remitting (RR) multiplesclerosis (MS), but not in secondaryprogressive (SP) MS. The meancytokine mRNA level 6 SEM isshown at 1 month before, at, or at1 month after active lesions onbrain magnetic resonance imaging(MRI). Because MRI activity wasoften present for subsequent months(see Fig 2, for example), only thosedata points were included where nolesional activity was present 1month before (number of datapoints used: RR MS 5 17 and SPMS 5 6) the occurrence of anMRI event, to avoid interferencewith existing events as much aspossible. The dotted line representsthe mean of the results obtainedwith peripheral blood mononuclearcells from 6 healthy controls, 7 sam-ples each (n 5 42). **p , 0.05,***p , 0.01. TNF-a 5 tumornecrosis factor-a; IFN-g 5interferon-g.

van Boxel-Dezaire et al: IL-10 and IL-12 in MS 701

stantial decrease in IL-10 mRNA at the onset of MS.32

The mean IL-10 mRNA expression, based on 13 serialsamples per patient, was significantly decreased in SPMS compared with RR MS patients. The ability of RRpatients, as opposed to SP patients, to express normalor even increased levels of IL-10 mRNA, extends pre-vious observations in cross-sectional studies.30,31 Theabsence of fluctuations in IL-10 mRNA in SP patientsmay be consistent with the lack of a remitting phaseand the development of progressive disease. Further-more, our data are suggestive of an important role forIL-12p40 mRNA in disease progression, because thepresence of this subunit was most prominent in RRpatients with a longer disease history and in MS pa-tients in the secondary progressive phase of the disease.It is concluded from this explorative study that in-creased IL-12p40 and decreased IL-10 mRNA may beuseful as markers of disease progression and couldfunction as predictors of disease activity. However, thestrength of these parameters in predicting disease activ-ity must be confirmed in a larger prospective study.

Questions that remain to be solved include whichimmunological processes are reflected by the altered cy-tokine mRNA levels. Most likely, the IL-12p40 mRNAthat was detected in unstimulated PBMCs comes frommonocytes33 that have been activated in vivo, and inthis state these cells are also capable of expressing IL-12p35 mRNA.16 However, it cannot be excluded thatB cells expressed these mRNAs as a consequence ofEpstein-Barr virus infection.34 We were surprised toobserve that the mean IL-12p35 mRNA levels werelower in patients compared with controls; levels in RRpatients were even lower than in SP patients. In NKand T cells, IL-12p35 mRNA is expressed constitutive-ly16; although its function in the absence of IL-12p40is unknown. The decreased expression of IL-12p35mRNA in PBMCs of MS patients compared with thecontrols may be in accord with the decreased numbersof NK and CD81 T cells that have been reported inMS.35,36 It remains to be established whether SP pa-tients express more IL-12p35 mRNA than RR patientsas a consequence of a higher state of activation of theirmonocytes. With respect to the decreased IL-10mRNA levels, further research is needed to clarifywhether this is associated with inactivity or decreasednumbers of a certain regulatory T cell or antigen-presenting cell subset.

This study was supported financially by the Dutch Foundation forthe Support of MS Research (Stichting Vrienden MS Research),grant 94-173, and by Zorg Onderzoek Nederland, grant 28-2625.

We are grateful to Dr C. Lucas for critically reviewing the manu-script and we are grateful to Christa de Veen, Natasja Kranenborg,and Margret Tielemans for excellent technical assistance.

References1. Prineas JW, Wright RG. Macrophages, lymphocytes, and

plasma cells in the perivascular compartment in chronic multi-ple sclerosis. Lab Invest 1978;38:409–421

2. Cannella B, Raine CS. The adhesion molecule and cytokineprofile of multiple sclerosis lesions. Ann Neurol 1995;37:424–435

3. Windhagen A, Newcombe J, Dangond F, et al. Expression ofcostimulatory molecules B7–1 (CD80), B7–2 (CD86), and in-terleukin 12 cytokine in multiple sclerosis lesions. J Exp Med1995;182:1985–1996

4. Selmaj K, Raine CS, Cannella B, et al. Identification of lym-photoxin and tumor necrosis factor in multiple sclerosis lesions.J Clin Invest 1991;87:949–954

5. Beck J, Rondot P, Catinot L, et al. Increased production ofinterferon gamma and tumor necrosis factor precedes clinicalmanifestation in multiple sclerosis: do cytokines trigger off ex-acerbations? Acta Neurol Scand 1988;78:318–323

6. Sharief MK, Hentges R. Association between tumor necrosisfactor-a and disease progression in patients with multiple scle-rosis. N Engl J Med 1991;325:467–472

7. Rudick RA, Ransohoff RM. Cytokine secretion by multiplesclerosis monocytes. Arch Neurol 1992;49:265–270

8. Drulovic J, Mostarica-Stojkovic M, Levic Z, et al.Interleukin-12 and tumor necrosis factor-a levels in cerebrospi-nal fluid of multiple sclerosis patients. J Neurol Sci 1997;147:145–150

9. Martino G, Consiglio A, Franciotta DM, et al. Tumor necrosisfactor-a and its receptors in relapsing-remitting multiple scle-rosis. J Neurol Sci 1997;152:51–61

10. Rieckmann P, Albrecht M, Kitze B, et al. Cytokine mRNAlevels in mononuclear blood cells from patients with multiplesclerosis. Neurology 1994;44:1523–1526

11. Rieckmann P, Albrecht M, Kitze B, et al. Tumor necrosisfactor-a messenger RNA expression in patients with relapsing-remitting multiple sclerosis is associated with disease activity.Ann Neurol 1995;37:82–88

12. Spuler S, Yousry T, Scheller A, et al. Multiple sclerosis: pro-spective analysis of TNF-a and 55 kDa TNF receptor in CSFand serum in correlation with clinical and MRI activity. J Neu-roimmunol 1996;66:57–64

13. Sarchielli P, Orlacchio A, Vicinanza F, et al. Cytokine secretionand nitric oxide production by mononuclear cells of patientswith multiple sclerosis. J Neuroimmunol 1997;80:76–86

14. Rovaris M, Barnes D, Woodrofe N, et al. Patterns of diseaseactivity in multiple sclerosis patients: a study with quantitativegadolinium-enhanced brain MRI and cytokine measurement indifferent clinical subgroups. J Neurol 1996;243:536–542

15. Van Oosten BW, Barkhof F, Scholten PE, et al. Increased pro-duction of tumor necrosis factor a, and not of interferon g,preceding disease activity in patients with multiple sclerosis.Arch Neurol 1998;55:793–798

16. Trinchieri G. Interleukin-12: a cytokine produced by antigen-presenting cells with immunoregulatory functions in the gener-ation of T-helper cells type 1 and cytotoxic lymphocytes. Blood1994;84:4008–4027

17. Leonard JP, Waldburger KE, Goldman SJ. Prevention of exper-imental autoimmune encephalomyelitis by antibodies againstinterleukin 12. J Exp Med 1995;181:381–386

18. Van Oosten BW, Lai M, Hodgkinson S, et al. Treatmentof multiple sclerosis with the monoclonal anti-CD4 antibodycM-T412: results of a randomized, double-blind, placebo-controlled, MR-monitored phase II trial. Neurology 1997;49:351–357

19. Poser CM, Paty DW, Scheinberg L, et al. New diagnostic cri-

702 Annals of Neurology Vol 45 No 6 June 1999

teria for multiple sclerosis: guidelines for research protocols.Ann Neurol 1983;13:227–231

20. Kurtzke JF. Rating neurologic impairment in multiple sclerosis:an expanded disability status scale (EDDS). Neurology 1983;33:1444–1452

21. Bouaboula M, Legoux P, Pessegue B, et al. Standardization ofmRNA titration using a polymerase chain reaction method in-volving co-amplification with a multi specific internal control.J Biol Chem 1992;267:21830–-21838

22. Visser J, van Boxel-Dezaire A, Methorst D, et al. Differentialregulation of interleukin-10 (IL-10) and IL-12 by glucocorti-coids in vitro. Blood 1998;91:4255–4264

23. Nicoletti F, Patti F, Cocuzza C, et al. Elevated serum levels ofinterleukin-12 in chronic progressive multiple sclerosis. J Neu-roimmunol 1996;70:87–90

24. Ferrante P, Fusi ML, Saresella M, et al. Cytokine productionand surface marker expression in acute and stable multiplesclerosis: altered IL-12 production and augmented signalinglymphocytic activation molecule (SLAM)-expressing lympho-cytes in acute multiple sclerosis. J Immunol 1998;160:1514–1521

25. Balashov KE, Smith DR, Khoury SJ, et al. Increased interleukin12 production in progressive multiple sclerosis: induction byactivated CD41 T cells via CD40 ligand. Proc Natl Acad SciUSA 1997;94:599–603

26. Gerritse K, Laman JD, Noelle RJ et al. CD40-CD40 ligandinteractions in experimental allergic encephalomyelitis and mul-tiple sclerosis. Proc Natl Acad Sci USA 1996;93:2499-2504

27. Issazadeh S, Ljungdahl A, Hojeberg B, et al. Cytokine produc-tion in the central nervous system of Lewis rats with experi-mental autoimmune encephalomyelitis: dynamics of mRNA ex-pression for interleukin-10, interleukin-12, cytolysin, tumor ne-

crosis factor alpha and tumor necrosis factor beta. J Neuroim-munol 1995;61:205–212

28. Smith T, Hewson AK, Kingsley CI, et al. Interleukin-12 in-duces relapse in experimental allergic encephalomyelitis in theLewis rat. Am J Pathol 1997;150:1909–1917

29. Segal BM, Dwyer BK, Shevach EM. An interleukin (IL)-10/IL-12 immunoregulatory circuit controls susceptibility to auto-immune disease. J Exp Med 1998;187:537–546

30. Navikas V, Link J, Palasik W, et al. Increased mRNA expres-sion of IL-10 in mononuclear cells in multiple sclerosis andoptic neuritis. Scand J Immunol 1995;41:171–178

31. Salmaggi A, Dufour A, Eoli M, et al. Low serum interleukin-10levels in multiple sclerosis: further evidence for decreased sys-temic immunosuppression? J Neurol 1996;243:13–17

32. Musette P, Benveniste O, Lim A, et al. The pattern of produc-tion of cytokine mRNAs is markedly altered at the onset ofmultiple sclerosis. Res Immunol 1996;147:435–441

33. Comabella M, Balashov K, Issazadeh S, et al. Elevatedinterleukin-12 in progressive multiple sclerosis correlates withdisease activity and is normalized by pulse cyclophosphamidetherapy. J Clin Invest 1998;102:671–678

34. Guery JC, Ria F, Galbiati F, et al. Normal B cells fail to secreteinterleukin-12. Eur J Immunol 1997;27:1632–1639

35. Munschauer FE, Hartrich LA, Stewart CC, et al. Circulatingnatural killer cells but not cytotoxic T lymphocytes are reducedin patients with active relapsing multiple sclerosis and little clin-ical disability as compared to controls. J Neuroimmunol 1995;62:177–181

36. Oksaranta O, Tarvonen S, Ilonen J, et al. T-cell subpopulationsin the cerebrospinal fluid and peripheral blood of patients withmultiple sclerosis: a follow-up study. Neurology 1996;47:1542–1545

van Boxel-Dezaire et al: IL-10 and IL-12 in MS 703