Cyclosporine A-Induced reduction of bile salt synthesis associated with increased plasma lipids in...

The Enterohepatic Circulation of Bile Salts

in Health and Disease.

A Kinetic Approach.

RIJKSUNIVERSITEIT GRONINGEN

The Enterohepatic Circulation of Bile Saltsin Health and Disease.

A Kinetic Approach.

Proefschrift

ter verkrijging van het doctoraat in deMedische Wetenschappen

aan de Rijksuniversiteit Groningenop gezag van de

Rector Magnifi cus, dr. F. Zwarts,in het openbaar te verdedigen op

woensdag 27 oktober 2004 om 14.45 uur

door

Christian Victor Hulzebos

geboren op 13 februari 1970te Stadskanaal

Promotores: Prof. dr. F. Kuipers Prof. dr. P.J.J. Sauer

Co-promotor: Dr. H.J. Verkade

Beoordelingscommissie: Prof. dr. M.J.H. Slooff

Prof. dr. R.J.A. Wanders

Prof. dr. B. Staels

“Toutes les grandes personnes ont d’abord été des enfants. (Mais peu d’entre elles s’en souviennent.)”

Alle grote mensen zijn eerst kinderen geweest. (Maar alleen een héél enkele herinnert het zich.)

Antoine de Saint-ExupéryUit: Le Petit Prince

Voor Daniël, Marleen en Hannah.

Paranimfen: Theresia M. Hulzebos-Bosma

Onno L. de Klerk

© 2004 by C.V. Hulzebos.

All rights served. No part of this book may be reproduced or transmitted in any form or by

any means without written permission of the author and the publisher holding the copyright

of the published articles.

Reprinted with permission of Lipid Research, Inc. (Chapter 2), the American Society for

Pharmacology and Experimental Therapeutics (Chapter 3), the American Association for the

Study of Liver Diseases (Chapter 4), the American Society for Biochemistry and Molecular

Biology, Inc. (Chapter 5).

ISBN: 90-6464-885-9

Cover: M.C. Escher’s “Waterfall” © the M.C. Escher Company B.V.-Baarn-The Netherlands.

Page layout: P. van der Sijde, Groningen, The Netherlands

Printed by: Ponsen & Looijen B.V., Wageningen, The Netherlands

Printing of this thesis was supported by: Abbott, Altana Pharma, AstraZeneca, Dräger

Medical, Ferring, Friso Kindervoeding, Groningen University Institute for Drug Exploration,

Hope Farms, J.E. Jurriaanse Stichting, Mead Johnson, Nederlandse Vereniging voor

Hepatologie, Nestlé, Novartis, Novo Nordisk, Nutricia, Tramedico, Zambon.

TABLE OF CONTENTS

Chapter 1 General introduction and scope of the thesis 9

Chapter 2 Measurement of parameters of cholic acid kinetics in 35

plasma using a microscale stable isotope dilution technique:

application to rodents and humans.

Journal of Lipid Research 2001;42:1923-9.

Chapter 3 Cyclosporin A and enterohepatic circulation of bile salts 51

in rats: decreased cholate synthesis but increased

intestinal reabsorption.

Journal of Pharmacology and Experimental Therapeutics

2003;304:356-63.

Chapter 4 Cyclosporin A-induced reduction of bile salt synthesis 67

associated with increased plasma lipids in children after

liver transplantation.

Liver Transplantation 2004;10:872-80

Chapter 5 Enterohepatic circulation of bile salts in farnesoid 83

X receptor-defi cient mice: effi cient intestinal bile salt

absorption in the absence of ileal bile acid-binding protein.

Journal of Biological Chemistry 2003;278:41930-41937

Chapter 6 Effects of pharmacological FXR activation on the 105

enterohepatic circulation of bile salts in rats: inhibition of

cholate synthesis rate and reduced cholate pool size despite

increased expression of the ileal bile acid-binding protein

Submitted

Chapter 7 Bile duct proliferation associated with bile salt-induced 119

hypercholeresis in Mdr2 P-glycoprotein-defi cient mice.

Liver International 2004 (in press)

Chapter 8 General discussion 135

Summary 150

Nederlandse samenvatting 154

Dankwoord 158

Curriculum Vitae 161

List of publications 162

Abbreviations

Abc adenosine triphosphate-binding cassette

Asbt apical sodium-dependent bile salt transporter

Bsep bile salt export pump

CA cholate

CDCA chenodeoxycholate

Cftr cystic fibrosis trans-membrane regulator

CsA cyclosporin A

Cyp7a1 cholesterol 7α-hydroxylase

Cyp8b1 sterol 12α-hydroxylase

Cyp27 sterol 27-hydroxylase

FTR fractional turnover rate

FXR farnesoid X receptor

GLC-MS gas liquid chromatography-mass spectrometry

[2H4] tetradeuterated

Ibabp or Ilbp ileal bile acid-binding protein, ileal lipid binding protein

LDL low-density-lipoprotein

ln APE natural logarithm of atom percent excess

LRH-1 liver receptor homologue-1

Mdr2 multidrug resistance-2 P-glycoprotein

Mrp multidrug resistance protein

Ntcp Na+-taurocholate cotransporting polypeptide;

Oatp1 organic anion transporting polypeptide 1

PCR polymerase chain reaction

PFB-TMS pentafluorobenzyl-trimethylsilyl

rs Spearman rank correlation coefficient

tAsbt truncated apical sodium-dependent bile salt transporter

Shp small heterodimer partner

TUDC tauroursodeoxycholate

VLDL very low-density-lipoprotein

9

Chapter 1

General introduction and scope of the thesis

10

Chapter 1

Introduction

The production of bile is an important function of the liver. Bile salts, which

are the major organic constituents of bile, are essential for a number of

physiologically important functions of bile1. Bile salts are biological detergents

and solubilize biliary lipids (phospholipids, cholesterol) into mixed micelles. In

addition, hepatobiliary excretion of bile salts provides the main driving force for

generation of bile fl ow1;4. Hepatic bile formation is crucial for the hepatobiliary

secretion of many insoluble or protein-bound substances (e.g., bilirubin, heavy

metals) and drug metabolites, which can subsequently be eliminated in the

feces. In the intestine, bile salts facilitate intestinal absorption of dietary fats,

including fat-soluble vitamins (A,D,E,K)1: in the absence of intestinal bile salts,

e.g., during cholestasis, a signifi cant percentage of dietary lipids is lost into the

feces5-7. Intestinal bile salts also infl uence release of gastrointestinal peptides,

e.g., cholecystokinine8-10. Bile salts are effi ciently conserved in the enterohepatic

circulation, implying that after hepatobilary secretion in the intestine, the majority

of bile salts is reabsorbed, return to the liver and subsequently rescreted into

bile.

Bile salts are essential in cholesterol homeostasis. Only a small fraction

(~10%) of cholesterol is excreted in unmetabolized form and even less is

converted into steroid hormones. Conversion of cholesterol into bile salts and

their subsequent fecal excretion provides the major route for elimination of excess

cholesterol (~90%). Recent studies indicate that bile salts also modulate hepatic

triglyceride metabolism and the clearance of triglyceride-rich lipoproteins from the

circulation11-13. Disturbances in bile salt metabolism have been found to underlie

diseases as diverse as cholestasis and familial hypertriglyceridemia in humans.

Conversely, patients with liver disease may present with abnormalities in bile salt

metabolism, including a reduced bile salt synthesis, altered bile salt composition

and bile salt pool size14. Bile salt kinetic parameters, i.e., pool size (the amount

of bile salts in the body), fractional turnover rate (the portion of the pool

that is newly synthesized per day), and synthesis rate may represent markers

that refl ect hepatocellular function and serve as a sensitive diagnostic tool to

detect liver disease even before the onset of other symptoms. Measurement

of bile salt kinetics can thus provide information on liver graft function after

liver transplantation as well as on effects of various drugs suspected to interfere

with bile formation. In previous studies, such measurements required invasive

procedures including monitoring of bile fl ow15 and radioactive isotope techniques16.

Isotope dilution techniques have been accepted as the preferred method to

study bile salt metabolism in vivo and have contributed signifi cantly to the

present knowledge of bile salt (patho)physiology in humans17-24. Without the

need to interrupt the enterohepatic circulation, this method allows simultaneous

determination of kinetic parameters. The conventional stable isotope approaches

required a number of relatively large plasma samples which precludes its use

in children or in commonly used laboratory animals. Introduction of novel

derivatisation modalities and analytical procedures, described in this thesis,

requires only minute amounts of plasma and thus opens the possibility to study

bile salt kinetics in children as well as in small animal models. The newly

11

The enterohepatic circulation of bile salts

developed stable isotope technique uses [2H4]-cholate as labeled bile salt. Cholate

is a major primary bile salt species and comprises 30 to 50% (humans) or

50 to 80% (rodents) of the total bile salt pool. Therefore, cholate pool size,

fractional turnover rate (FTR) and synthesis rate are kinetic parameters that allow

description of whole body bile salt kinetics. Application of this novel procedure

allows to study the effects of diseases and drugs, as well as the physiological

importance of newly identifi ed proteins on the kinetics of the enterohepatic

circulation of bile salts in humans and (genetically modifi ed) laboratory animals.

Research described in this thesis addresses various aspects of bile salt

metabolism in animal models and in children after liver transplantation. Animal

studies were conducted in various genetically-modifi ed mouse models, with special

reference to hepatic (farnesoid X receptor, multidrug resistance 2 P-glycoprotein)

and intestinal proteins involved in enterohepatic circulation of bile salts. Moreover,

we determined effects of established and potentially novel drugs on bile salt and

lipid metabolism in rodents (cyclosporin A, FXR ligand) and in children after liver

transplantation (cyclosporin A).

In the following paragraphs a condensed overview of current knowledge

relevant for this research is provided.

Bile formation

Primary bile is formed by the hepatocytes or liver parenchymal cells. Hepatocytes

are clustered in acines within so-called hepatic lobules (Figure 1). These lobules

are functionally divided in a periportal zone (around the vena portae), an

intermediate zone, and a pericentral zone (around the central vein). Bile is

secreted into a complex system of bile canaliculi which coalesce into progressively

larger ducts, fi nally reaching the common hepatic bile duct. Together with the

cystic bile duct , the hepatic bile duct forms the common bile duct which delivers

the bile into the duodenum. Approximately 600 to 1200 mL of bile is produced

per day in adult humans25. Hepatic bile formation involves canalicular and ductular

processes. Canalicular secretion of bile salts generates the bile salt-dependent

bile fl ow (BSDF) whereas canalicular and ductular secretion processes provide the

driving force for the bile salt-independent fl ow (BSIF)1;26. Primary hepatic bile can

be manipulated during its passage through the ductular system; the formation

of secondary bile. Hepatobiliary secretion of bile acids into the canaliculi induces

the fl ow of plasma water and solutes across apical membranes of hepatocytes

and epithelial cells lining the biliary tree, i.e., the cholangiocytes, and their tight

junctions until iso-osmolality is restored. Because bile salts are concentrated

up to 1000-fold in bile, active transport by hepatocytes occurs against a steep

concentration gradient. This active transport mechanism represents the major

driving force for BSDF and ultimately for hepatic bile formation. The BSIF is driven

by the canalicular secretion of glutathione disulfi de and inorganic electrolytes and

ductular secretion of inorganic electrolytes, inducing movement of water across

apical membrane of cholangiocytes, putatively mediated by aquaporins27;28. Some

of these transport proteins, involved in water and ion transport, are located in

vesicles and redistribute to the apical membrane of cholangiocytes in response to

choleretic stimuli28.

12

Chapter 1

In the common hepatic bile duct, bile contains water (82 w/v %), bile salts

(12 w/v %), lecithin and other phospholipids (4 w/v %) and unesterifi ed

cholesterol (0.7 w/v %). Quantitatively minor constituents are conjugated

bilirubin (responsible for the green-yellowish colour), electrolytes (with a plasma-

like composition, but lower in chloride and bicarbonate), proteins (e.g., IgA,

hormones), and depending on on their use, drugs and their metabolic products.

Figure 1. Hepatic lobules are hexagonal in shape and histologically centered around a

terminal hepatic venule (central vein), an intermediate zone, and a periportal zone (around

the vena portae). The portal tracts are positioned at the angles of the hexagon and consists

of an hepatic artery, a portal vein and a bile duct. The hepatic acinus concept is more

functionally defi ned. It is centred on a portal tract and is located between 2 or more terminal

hepatic venules. The acinus is divided into three zones (1,2 and 3) based on the metabolic

function. Blood fl ows from the portal tracts through the sinusoids to the venules. Zone 1 is

closest to portal tract and receives the most oxygenated blood while zone 3 is pericentral

localized, receiving the least amount of oxygenated blood. In contrast to blood fl ow, bile fl ow

is directed from zone 3 to 1, and collected into the bile duct in the portal tract (reprinted with

permission from Elsevier: Wheater’s Functional Histology. A Text and Colour Atlas p275).

13


Biosynthesis of bile salts

Bile salts are synthesized from cholesterol in the liver1. In the biosynthesis of bile

salts, the side chain of cholesterol is truncated and hydroxylgroups are added

to the nucleus by the actions of a series of enzymes. This cascade of enzymatic

catabolism of cholesterol to bile salts, which occurs only in the liver, can be

divided into two pathways (Figure 2)2. In the “neutral” or classical pathway,

modifications of the steroid nucleus precede those of the side chain. In this

pathway, cholesterol 7α-hydroxylase (CYP7A1), which is exclusively expressed

in the liver, catalyzes the conversion of cholesterol into 7α-hydroxycholesterol.

This is generally considered the rate-controlling step in bile salt biosynthesis

and subject to negative feedback of enterohepatic cycling of bile salts3. In

the “acidic” or alternative pathway, sterol-27-hydroxylase (CYP27A1), which is

ubiquitously expressed, catalyzes oxidation of the side chain of cholesterol to

27-hydroxycholesterol prior to changes in the steroid nucleus. Finally, both pathways

merge and C27-3ß-steroid dehydrogenase converts the 7α-hydroxycholesterol

formed via both pathways into cholate (a 3αOH,7αOH,12αOH-trihydroxy bile salt)

or the less hydrophylic species chenodeoxycholate (a 3αOH,7αOH-dihydroxy bile

salt). Pericentral hepatocytes are probably the major site of de novo bile acid

synthesis1; CYP7A1 is expressed at a higher level in the hepatocytes surrounding

the central vein compared to hepatocytes in the periportal zone29. In healthy

humans, the classical pathway contributes for ~80% to total bile salt synthesis,

whereas in rodents the contribution of the alternative pathway may be larger

(~45%)30;31. Yet, proteins of the classic pathway also quantitatively regulate

bile salt synthesis in mice since disruption of the cholesterol 7α-hydroxylase

gene (Cyp7a1) in mice results in reduced bile salt synthesis, whereas disruption

of Cyp7b1, encoding oxysterol 7α-hydroxylase, a key enzyme essential in the

alternative pathway only minimally affects bile salt synthesis32;33.

The primary bile salts thus synthesized, cholate and chenodeoxycholate,

contain hydrophobic and hydrophylic domains which render these molecules

amphipathic in nature. After synthesis, more than 99 % of primary bile acids

is conjugated with either the amino acid taurine (predominantly in rodents)

or glycine (predominantly in humans), at the terminal (C24) carboxyl group34.

Hydrophylicity of bile salts is hereby increased, which promotes aqueous solubility

at intestinal pH1.

The majority of biliary bile salts, associated into mixed micelles (composed

of bile salts, cholesterol, and phosphatidylcholine), are stored in the gallbladder.

Upon gallbladder contraction, bile is released into the small intestine where bile

salts act as detergents to solubilize dietary fats and lipid-soluble vitamins. In the

intestine, particularly in the colon, conjugated cholate and chenodeoxycholate

may undergo deconjugation and are subjected to dehydroxylation by bacterial

fl ora, resulting in so-called secondary bile acids, deoxycholate and lithocholate,

respectively, and a tertiary species, ursodeoxycholate35-37. The majority of bile

salts is reabsorbed in the ileum, transported into the portal blood and returns to

the liver to complete an effi cient enterohepatic circulation (Figure 3)38.

De novo bile salt biosynthesis compensates for fecal bile salt loss to maintain

pool size under steady state conditions. Bile salt synthesis has a minor contribution

14

Chapter 1

to total biliary bile salt secretion: bile salt synthesis rate is ~0.02 mmol/h,

whereas bile salt secretion after a meal may be as high as ~5 mmol/h1. Bile

formation is mainly dependent on the feedback inhibition of the enterohepatic

circulation of bile salts1. The bile salt pool (approximately 1.5-4 g in size in human

adults) recirculates 10 to 20 times per day in the enterohepatic circulation25. The

frequency of bile salt cycling is partly depending on the amount of dietary fat in

the intestine; the bile salt pool may circulate several times during and after a fatty

meal.

Figure 2. The cascade of enzymatic catabolism of cholesterol to bile salts can be divided

into two pathways2. In the “neutral” or classical pathway, modifi cations of the steroid

nucleus precede those of the side chain. In this pathway, cholesterol 7α-hydroxylase

(CYP7A1) catalyzes the conversion of cholesterol into 7α-hydroxycholesterol which is con-

sidered the rate-limiting step in bile salt synthesis3. In the “acidic” or alternative pathway,

sterol-27-hydroxylase (CYP27A1) catalyzes oxidation of the side chain of cholesterol to 27

hydroxycholesterol before changes in the steroid nucleus. Finally, both pathways merge and

cholate or the less hydrophylic species chenodeoxycholate is formed.

15


Figure 3. Bile salt transporters in hepatocytes, cholangiocytes and enterocytes. Ntcp is

the major uptake protein, which mediates the sodium-dependent uptake of conjugated

bile salts at the sinusoidal, i.e., basolateral, plasma membrane of hepatocytes. Oatps are

multispecific organic substrate carriers, which mediate hepatocellular uptake of conjugated

and mainly unconjugated primary or secondary bile salts, but also of other substrates

(e.g., bilirubin, steroids, or drugs) in exchange with efflux of an intracellular compound.

Canalicular secretion of bile salts is mediated by the canalicular bile salt export pump, Bsep,

whereas sulfated or glucuronidated bile salts are transported by the multidrug resistant

protein2, Mrp2. Biliary excretion of phospholipids is mediated by Mdr2 (MDR3 in humans).

Asbt facilitates uptake of conjugated bile salt species in cholangiocytes and enterocytes.

Bile salt efflux from the basolateral membrane of cholangiocytes may involve a truncated

isoform of Asbt (t-Asbt) and/ or the multidrug-resistance protein 3 (Mrp3) or the organic

anion transporting polypeptide OATP-A. According to cholehepatic shunt concept (small

circle), cholangiocytes absorb (un)conjugated bile salts. Subsequently, these bile salts

return to the liver via the periductular capillary plexus to be resecreted into the biliary tree.

The majority of conjugated bile salts are retained in the small intestine and require active

sodium-dependent reabsorption. Absorption of conjugated (trihydroxy) bile salts, which are

the least able to diffuse across the apical membrane of the enterocyt in the terminal ileum

is, to a large extent, mediated by Asbt. In the cytosol of enterocytes, bile salts interact with

Ibabp. Basolateral efflux of bile salts from enterocytes may be mediated by t-Asbt, Mrp3 and

Ostα/β and forms the last step before the (un)conjugated bile acids enter the mesenteric

venous blood to the portal system and return to the liver, which completes the enterohepatic

circulation (large circle).

16

Chapter 1

Bile salt transport in the liver

Hepatobiliary transport involves uptake of bile salts across the sinusoidal or baso-

lateral membrane, intracellular bile salt transport through a variety of mecha-

nisms, and then active canalicular (re)secretion of bile salts into the canalicular

space between hepatocytes.

Sinusoidal bile salt uptake

After their appearance in the portal circulation the majority of bile salts is, depen-

ding on their hydrophobicity and charge, effi ciently taken up by one of several

transport proteins encoded by the solute carrier gene family (Slc)39.

The Na+-taurocholate cotransporting polypeptide (Ntcp; Slc10a1) is an

unidirectional uptake system, which mediates the sodium-dependent uptake

of conjugated bile salts at the sinusoidal plasma membrane of hepatocytes

(Figure 3)40. Coupled transport with sodium and potassium (Na+/K+-exchange)

provides the energy required for bile salts to traverse across the lipid bilayer of

the hepatocyte. The fact that Ntcp is homogeneously distributed along the liver

acinus, while bile salt transport is predominantly localized to the periportal zone

even at high bile salt concentrations, indicates an excess transport capacity that

is able to accommodate large variations in the amount of bile salts presented

to the liver. At higher bile salt fl uxes, more hepatocytes along the acinus will be

effectively involved in bile salt transport. In parallel with Ntcp, sodium-dependent

hepatocellular uptake of bile salts may be mediated by microsomal epoxide

hydrolase, although its contribution to overall bile salt uptake is still unclear41;42.

Organic anion transporting polypeptides (Oatp; Slc21a) function like

antiporters or exchange proteins (Figure 3). Oatps are multispecific organic

substrate carriers, which mediate hepatocellular uptake of conjugated and mainly

unconjugated primary or secondary bile salts, but also of other substrates (e.g.,

bilirubin, steroids, or drugs) in exchange for an intracellular compound. To date,

three hepatic Oatps have been identified in humans (OATPB, OATP-C, which is

similar to Oatp2 in rodents, and OATP8) and three in rodents (Oatp1, Oatp2,

Oatp4)43;44.

In addition to sodium-dependent and sodium-independent bile salt uptake

systems, deconjugated hydrophobic bile acids may be able to traverse the hepa-

tocellular bilayer by simple passive diffusion.

Intracellular bile salt transport

The exact mechanism of intracellular bile salt transport in the liver is not known.

Intracellular bile salt transport from uptake to biliary secretion occurs very rapidly.

For example, within 10 minutes after injection of a radioactively labelled bile salt

into an isolated rat liver, intrahepatic radioactivity has diminished39. It has been

hypothesized that at least two mechanisms exist: transport in association with

bile salt-binding proteins and vesicullar transport. The bulk of bile salts are bound

to cytosolic proteins (including 3α-hydroxysteroid dehydrogenase (3α-HSD), glu-

tathione S-transferase, liver fatty acid-binding proteins (L-FABP), and dihydrodiol

17


hydrogenase) and traverse the cell mainly by diffusion. Inhibition of 3α-HSD

results in redistribution of bile salts out of the cytosol in vitro and a delay in biliary

bile salt excretion in vivo45. Vesicle-mediated transport has been implicated to be

involved in intracellular traffi cking, in particular of secondary or tertiary bile salt

species. Yet, vesicular transport contributes to overall intracellular transport only

under circumstances of strongly increased hepatic bile salt fl uxes46.

Canalicular bile salt secretion

Canalicular secretion of bile salts is mediated by the canalicular bile salt export

pump (Bsep, Abcb11), an adenosine triphosphate (ATP)-dependent bile salt

transporter encoded by the Abcb11 gene on human chromosome 2q24-31

(Figure 3)47. Abcb11 belongs to the ATP-binding cassette (ABC) transporter

superfamily, which is composed of highly conserved proteins sharing ATP-binding

domains. About 50 ABC transporters have been identifi ed to date, which are

classifi ed in 7 groups (A-G) based on their structure and homology. ABC

transporters hydrolyze ATP and translocate a variety of molecules across lipid

membranes by active transport or by conducting the transport via stimulation

of other translocation mechanisms26. ABC transporters are present in subcellular

compartments. Delivery to the canalicular membrane follows physiological stimuli,

e.g., the need to secrete bile salts during and after a fatty meal48. Bsep is

responsible for active canalicular secretion of mainly conjugated bile acids into

bile.

In humans, mutations in the gene encoding Bsep are associated with low biliary

bile salt concentrations and intrahepatic cholestasis, also known as progressive

familial intrahepatic cholestasis (PFIC-2). This disease is further characterized

by extreme pruritus, growth failure, and progression to livercirrhosis in the fi rst

decade of life49. In contrast, Bsep knockout mice (Bsep(-/-)) show a reduced biliary

bile salt secretion rate (~70%) but a relatively mild cholestasis. The presence of

an alternative bile salt transport system is anticipated, because biliary secretion

of muricholate (a rodent-specifi c bile salt species) and tetrahydroxylated bile salts

still occured and the bile salt output and bile fl ow in Bsep(-/-) mice fed a bile salt-

enriched diet signifi cantly increased50;51.

Another canalicular protein involved in hepatobiliary bile salt effl ux is the

canalicular multispecifi c organic anion transporter (cMOAT), also known as the

multidrugresistant protein2 (Mrp2, Abcc2), which is a member of the multidrug

resistance protein family (Figure 3)52. Apart from its role in dianionic bile salt

transport, Mrp2 functions as an effl ux protein for organic anions, including

glucuronide or sulfate conjugated compounds, like bilirubin diglucuronide and

sulphated bile salts. Mutations or deletions in the MRP2 gene result in conjugated

hyperbilirubinemia, which is known as the Dubin-Johnson syndrome53.

Bile salt transport in cholangiocytes

After hepatobiliary secretion, hepatic bile is exposed to epithelial cells, i.e., cho-

langiocytes. These cells form the lining of the biliary tree which, apart from its

anatomic pipeline function, is functionally involved in biliary transport and bile

formation54. In addition to electrolytes and water, cholangiocytes are capable to

18

Chapter 1

take up bile salts from the primary bile. Cholangiocytes have been suggested to

infl uence the BSDF via their role in the so-called “cholehepatic shunt pathway”

(Figure 3). The cholehepatic shunt concept was originally proposed to explain

the hypercholeresis observed after administration of certain (unconjugated) bile

salt species55. According to this concept, cholangiocytes absorb by passive diffu-

sion unconjugated bile salts after their protonation. Subsequently, these bile salts

return to the liver via the periductular capillary plexus to be resecreted into the

biliary tree, thereby promoting additional movement of water. Bile salt transport

proteins have recently been identifi ed at the apical and basolateral membranes of

cholangiocytes, which suggests that, in addition to unconjugated bile salts, active

reabsorption of conjugated bile salts from bile can occur56. The apical sodium-

dependent bile salt transporter (Asbt, Slc10a2) is, in addition to the terminal

ileum, present at the apical membrane of cholangiocytes (Figure 3). Asbt facilita-

tes uptake of conjugated bile salt species57;58. Bile salt effl ux from the basolateral

membrane of cholangiocytes may involve a truncated isoform of Asbt (t-Asbt)

and/ or the multidrug-resistance protein 3 (Mrp3, Abcc3), which has been identi-

fi ed as a conjugate export pump, or the organic anion transporting polypeptide

OATP-A (Figure 3)59-62. Especially during conditions associated with bile duct pro-

liferation, such as extrahepatic cholestasis, cholehepatic circulation of bile salts

could protect the liver from further bile salt toxicity via feedback repression of

de novo bile salts synthesis. For ursodeoxycholate (UDCA), used as a therapeutic

agent in various cholestatic liver diseases, indications for cholehepatic shunting

were reported63.

Bile salt transport in the intestine

Intestinal processes of the enterohepatic circulation include uptake of bile salts

across the apical membrane of the enterocyte, intracellular bile salt transport, and

basolateral secretion into the capilaries of the venous portal system.

Apical bile salt uptake

The vast majority of bile salts is effi ciently reabsorbed from the small intestine

through a combination of active sodium-dependent absorption in the distal ileum,

sodium-independent absorption, and passive diffusion in the proximal small intes-

tine39. Whereas unconjugated bile salts are absorbed in signifi cant portions by

passive diffusion in the jejunum and proximal ileum, the majority of conjugated

bile salts is retained in the lumen of the small intestine and hence require

active sodium-dependent reabsorption25. Absorption of conjugated (trihydroxy)

bile salts, which are the least able to diffuse across the apical membrane of the

enterocyt is, to a large extent, mediated by the apical sodium-dependent bile salt

transporter (Asbt, Slc10a1) localized in the apical domain of the enterocyte of

the distal ileum (Figure 3)64. The gene encoding rat Asbt, Slc10a2, shares 63%

homology with its transporter family member Ntcp (Slc10a). Asbt activity in the

distal ileum ensures almost complete recovery of bile salts not absorbed in the

former part of the small intestine, thereby minimalizing the occurence of secretory

diarrhea caused by an excess of colonic bile salts. Moreover, beyond the distal

19


ileum, bile salts are not required for micelle formation and fat absorption. The

physiological importance of Asbt for the enterohepatic circulation is underlined by

several observations. Mice in which the Asbt gene is disrupted show an increased

fecal loss and synthesis rate of bile salts and a decreased bile salt pool size65.

In humans, mutations in the ASBT gene have been reported in patients with

so-called primary bile salt malabsorption (PBAM)66. In this disease, a dysfunctio-

nal ASBT protein is associated with congenital diarrhea, steatorrhea, and growth

retardation. Nonfunctional Asbt results in interruption of the enterohepatic circu-

lation of bile salts leading to an increased turnover and a diminished pool size of

bile salts in these patients. Abnormal bile salt absorption associated with reduced

expression levels of ASBT in patients with type IV hypertriglyceridemia also sup-

ports the important role of Asbt in bile salt reabsorption67.

The identifi cation of the organic anion transport protein 3 (Oatp3), which

is 80% identical to Oatp1, as a sodium-independent bile salt uptake system

in the brush border membrane of jejunal enterocytes of the small intestine in

rats suggests a signifi cant role of this transporter for overall intestinal bile salt

absorption. In rats, jejunal absorption of taurine conjugated cholate accounts

upto 50% of total bile salt absorption68. At present, it remains to be established

whether functional expression of bile salt transporting-OATPs also occurs in

humans, although intestinal expression of OATP-A has been reported and evidence

for jejunal absorption of conjugated bile salts exist, suggesting a more proximal

absorption of conjugated bile salts68.

Intracellular bile salt transport

In the cytosol of enterocytes bile salts may interact with cytosolic proteins,

including 3α-HSD. In enterocytes of the ileum, a specific cytosolic protein is

expressed. This cytosolic protein is also known as the ileal lipid-binding protein or

ileal bile acid-binding protein, respectively (Ilbp or Ibabp)69. Ibabp is a member

of the so-called liver fatty acid binding protein (L-FABP) family, which comprises a

large number of proteins assumed to assist in the intracellular transport of fatty

acids and other hydrophobic compounds. Although Ibabp has been proposed as an

important mediator of transcellular bile salt movement through the enterocytes,

functional studies to establish the physiological role of this protein have not been

reported sofar.

Basolateral bile salt excretion

Basolateral excretion is the last step before the (un)conjugated bile acids enter

the mesenteric venous blood to the portal system. The precise mechanism has

still to be elucidated. Yet, several candidate proteins exist for the basolateral efflux

of bile salts from enterocytes. One of them is the multidrug-resistant related

protein3 (Mrp3) which transports organic anions, including bile salts. Mrp3 is

expressed in enterocytes of the small intestine (Figure 3)60. A splice variant

of Asbt, truncated Asbt (t-Asbt), has also been documented to be present in

the basolateral membrane of enterocytes (Figure 3). Because this protein has

the capacity to exchange anions and because from earlier experiments it was

20

Chapter 1

concluded that a bile salt anion exchange mechanism is present in the basolateral

membrane, t-Asbt is putatively involved in basolateral bile salt export in the

small intestine59. Recently, the so-called organic solute transporter alpha and beta

(Ost-α/β) complex has been proposed as a new tranporter that may facilitate

basolateral bile salt transport70.

Regulation of the enterohepatic circulation

It has been known for many years that bile salts repress their own biosynthesis

and regulate bile flow. Furthermore, regulatory mechanisms exist controlling bile

salt uptake and clearance systems to prevent intracellular accumulation of bile

salts, which is harmful to the cells. Thus, virtual all steps in the enterohepatic

ciculation are subjected to regulatory mechanisms. Regulation of proteins involved

in bile salt synthesis and transport occurs to some extent by posttranscriptional

mechanisms but mainly at the level of gene transcription (Figure 4). Interaction

of bile salts with so-called nuclear receptors, ligand-activated transcription factors

of a highly conserved gene family that are selectively expressed in enterohepatic

tissues, plays a major role in transcriptional regulation of genes critically involved

in various processes of bile salt and lipid homeostasis. The nuclear receptors

and their target genes that have been identified to date have been extensively

reviewed elsewhere2;71. In short, nuclear receptors function as intracellular sensors

to protect cells from excess of potentially harmful compounds, including bile salts.

For the scope of this thesis, the role of FXR in coordinating the expression of genes

involved in bile salt homeostasis is adressed in more detail. FXR (NR1H4) belongs

to the NR1 family of nuclear receptors and is highly expressed in liver, intestine,

kidney and adrenal gland. Bile salts can bind and activate the nuclear receptor

FXR. The most effective activator of FXR is CDCA. After FXR heterodimerizes with

the retinoid receptor (RXR), the bile salt-activated FXR-RXR complex effectively

regulates the transcription of several genes considered crucial in bile salt synthesis

and transport72.

Regulation of bile salt synthesis in the liver

Synthesis of bile salts is mainly regulated at the transcriptional level, particular of

the Cyp7a1 gene2. Co-ordinately regulated feedback and feedforward mechanisms

result in bile salt-mediated down- or upregulation, respectively, of transcription of

Cyp7a1. This feedback regulation is, in part, mediated by bile salt-activated FXR.

Transcriptional repression of Cyp7a1 is achieved indirectly via a regulatory cascade

involving other liver-specific factors, including the small heterodimer partner

(SHP; NROB2)72. Bile salt-activated FXR-RXR heterodimers induce expression

of SHP, which then inactivates Cyp7a1 expression by binding to liver receptor

homologue-1 (LRH-1), also called fetal transcription factor (FTF) (NR5A2) and

hepatocyte nuclear factor factor (HNF) 4α, both competence factors for Cyp7a1

expression72. Sterol 12α-hydroxylase (Cyp8b1), the enzyme that controls the ratio

in which the primary bile salt species cholate and chenodeoxycholate are being

formed, is also negatively controlled by bile salts in a FXR-dependent manner73.

Thus, increased intracellular bile salt levels are able to repress their own synthesis

21


to prevent further intracellular accumulation. The role of FXR in coordinating the

expression of genes involved in bile salt synthesis has been established in FXR

knockout mice and by the use of FXR agonists74;75. It has been demonstrated that,

apart from FXR/ SHP-dependent regulatory pathways, FXR/ SHP-independent

pathways exist in which the Kupffer cells (macrophages) in the liver are putatively

involved76;77. It has been shown that bile salts can interact with Kupffer cells

Figure 4. The general structure and function of nuclear hormone receptors. The upper

pannel represents the functional domain stucture of a nuclear receptor. It contains from the

N towards the C-terminus, activation function domain1 (AF1), DNA binding domain (DBD),

hinge region (D), ligand binding domain (LBD), and activation function domain 2 (AF2). The

primary functions of the DBD and LBD are to recognize specifi c DNA sequences and ligands,

respectively. The lower pannel shows FXR-mediated regulation of bile salt metabolism in the

hepatocyte. Bile salts (�) are endogenous ligands for FXR. Bile salt-activated FXR forms

heterodimers with RXR (bound by retinoids, i.e., 9-cis retinoic acid (�)). FXR indirectly

affects gene transcription by induction of SHP, which mediates transcriptional repression of

Cyp7a1 and Cyp8b1 (bile salt synthesis) and Ntcp (bile salt uptake), as well as upregulation

of Bsep (bile salt effl ux).

22

Chapter 1

before transport into hepatocytes. Interaction between bile salts and Kupffer cells

induces the expression of inflammatory cytokines, which also repress Cyp7a1

expression77.

Recently, functional involvement of peroxisome proliferator-activated receptors,

i.e., PPARα in the suppression of bile salt synthesis was demonstrated in vitro

and in vivo78. Upon PPAR activation by fibrates (hypolipidemic drugs) in cultured

rat hepatocytes and in rodents, activities of cholesterol 7α-hydroxylase and sterol

27-hydroxylase activities were suppressed, paralleled by a similar reduction of the

respective mRNAs and reduced fecal bile salt loss78.

Conversion of cholesterol to bile salts can be promoted by activation of the

liver X receptor (LXR), a nuclear receptor that can bind oxysterols, metabolites of

cholesterol. Oxysterols are synthesized when an excess of cholesterol accumulates

in the liver. After binding of oxysterols to LXR, Cyp7a1 gene expression increases

in rodents, but this mode of regulation appears to be absent in humans, probably

due to the lack an LXR-responsive element in the promotor of CYP7A179;80.

Regulation of hepatobiliary transport.

The major hepatocytic uptake system for bile salts, Ntcp (Slc 10a1), is also

regulated by a concerted action of FXR and SHP81. In addition this, cytokines

appear to be involved in transcriptional regulation of Ntcp. In vitro, in WIF-B rat

hepatoma hybrid cells, Ntcp messenger RNA (mRNA) expression was significantly

reduced after exposure to cytokines76. Macrophages and their ability to secrete

cytokines may be essential in mediating the endotoxin-induced decrease of

hepatocellular bile salt uptake. In addition to this transcriptional regulation by

bile salt-activated FXR and cytokines, Ntcp activity appears to be regulated at a

posttranscriptional level: translocation of Ntcp from a preformed intracellular pool

to the basolateral membrane may represent an important mechanism for rapid

regulation of basolateral bile salt uptake39. High bile salt fluxes induced by a bile

salt-enriched diet or partial hepatectomy result in reduction of Ntcp mRNA and/or

protein expression82. In general, expression of Ntcp is only marginally affected by

large variations in transhepatic bile salt fluxes, suggesting that this transporter

is abundantly expressed under normal physiological conditions. The liver is thus

prepared for adequate handling a large variation in amounts of bile salts, e.g.,

during postprandial periods.

Oatp is also regulated at transcriptional and posttranscriptional levels.

Although not consistently, down-regulation of Oatp1 mRNA and protein levels

upon bile salt feeding has been reported, especially in the periportal region where

bile salt concentrations are supposedly highest83. Oatp1 is also down-regulated

after bile duct ligation and after partial hepatectomy. Together, these results might

indicate that reduction of Oatp expression contributes to protection of the liver

against intracellular bile salt accumulation and the associated bile salt toxicity.

Activation of the bile salt efflux pump Bsep by bile salts may represent an

adaptive mechanism to prevent excess of intracellular bile salts. Bile salts induce

Bsep expression in an FXR-mediated manner84. Adaptation of hepatocellular

bile salt transport capacity induced by high bile salt fluxes is also achieved by

canalicular insertion of Bsep, indicating posttranscriptional regulatory mechanisms.

23


However, high intracellular bile salt concentrations in vivo as induced by bile duct

ligation cause a decrease in Bsep expression85: in this situation other regulatory

factors apparently overrule bile salt regulation82.

Regulation of bile salt transport in the intestine

Apart from regulating their own synthesis and hepatobiliary transport, bile salts

appear also to be able to regulate their own intestinal reabsorption. From

ontogenetic studies it has become clear that the developmental pattern of

Asbt and Ibabp, two proteins considered to be involved in intestinal bile salt

reabsorption, are closely interrelated86. Increased postnatal expression of both

Asbt and Ibabp coincides with functional bile salt transport. Recent studies

indicate that mouse Asbt, but not rat Asbt, is subjected to negative feedback

regulation mediated by LRH-1 activation87. This explains, at least in part, the

reported contradictory effects of manipulating the bile salt pool on the expression

of Asbt88. In contrast, intestinal expression of Ibabp, considered to be involved in

intracellular trafficking of bile salts is strongly induced by bile salt-activated FXR

in mice and in rats69;72;88;89.

Bile salt kinetics: characterizing the dynamics of the enterohepatic

circulation

Enterohepatic cycling of bile salts involves hepatic uptake and synthesis,

hepatobiliary transport, and intestinal reabsorption of bile salts. These processes

are essential for bile salt and lipid metabolism, as evidenced by the various

phenotypic characteristics and disease states caused by dysfunction of proteins

involved in this cascade. Knowledge of key proteins involved in bile salt metabolism

has staggeringly increased in the past couple of years and, together with improved

molecular tools, detailed analysis ot their molecular regulation and function has

become possible. Yet, to fully appreciate the physiological importance of the

various proteins, in vivo techniques that quantify actual metabolic fluxes are

required. Isotope dilution techniques have been used to measure bile salt

kinetics in vivo, which allows to calculate bile salt synthesis, pool size and

turnover in order to characterize the dynamics of the enterohepatic circulation. To

delineate potential clinical implications of these parameters an overview of current

knowledge of the individual parameters on bile salt kinetics is presented in the

following paragraph.

Bile salt kinetic parameters: pool size, fractional turnover rate and

synthesis rate

The size and composition of the bile salt pool are critical for adequate bile

formation and lipid absorption. The crucial role of bile salt pool size in lipid

absorption is evident from studies performed in preterm infants. In general,

premature neonates have a smaller bile salt pool as compared to full-term

neonates or infants. The small bile salt pool in preterm neonates is associated

with low intraluminal bile salt concentrations, frequently below their critical

24

Chapter 1

micellar concentration, which coincides with inefficient absorption of fat20. Limited

synthesis of bile salts and incomplete intestinal recovery of bile salts due to

immaturity of intestinal proteins may underlie the small bile salt pool size. Early

in life the bile salt pool increases, leading to increased hepatobiliary bile salt

secretion rates and a more efficient intestinal fat absorption20;90. Thus, the bile salt

pool size seems to develop in response to maturational changes in the machinery

of proteins involved in enterohepatic cycling of bile salts. Yet, at comparable bile

salt pool sizes, fat absorption in neonates fed human milk is more efficient than

in neonates fed a cow’s milk formula, implying that other factors than bile salts

are also important for fat absorption. For example, human milk contains a lipase

(bile salt-stimulated lipase) that is considered to have an important role in fat

absorption91.

In adult humans, age, race, and body size showed no statistically significant

relationship with bile salt pool size, in constrast to gender92. Limited data are

available with respect to effects of dietary factors on bile salt pool size. In

neonates, a more pronounced increase in bile salt pool size was observed

in infants fed human milk compared to formula-fed infants suggesting that

dietary factors affect pool size independent of maturation20. In adult humans,

no consistent effects on cholate pool size were found while fed solid diets or fat-

rich liquid diets containing either corn oil or coconut oil,93 whereas bile salt pool

sizes increased after institution of a fat- and protein-restricted diet94. Recently,

effects of both low- and high-fat feeding on bile salt kinetics have been described.

Although total pool size of primary bile salts remained unchanged, differential

effects on bile salt composition and individual pool sizes were observed95.

In humans, the rate of gallbladder emptying and short bowel transit time

are determinants of bile salt pool size96-98. Incomplete gallbladder emptying or a

delay in intestinal transit time coincide with a reduced cycling frequency and an

enlargement of the bile salt pool size. In contrast, when intestinal transit time

of bile salts increases, bile salt pool size decreases. Thus, an inverse relationship

exists between the cycling frequency and the bile salt pool size. Variations in

bile salt pool size are compensated for by an altered cycling frequency, so

that hepatobilary secretion rate and probably intestinal bile salt delivery are

maintained99. The influence of intestinal bile salt delivery on bile salt pool size

has been studied in an experimental primate model. It appeared that short term

regulation of the bile salt pool can be accomplished via interfering with the bile

salt cycling frequency and fecal losses; an acute increase in intestinal bile salts

via infusion in the small bowel increased bile salt cycling frequency which resulted

in increased fecal losses and maintenance of bile salt pool size. In contrast, in

fasted animals with diminished intestinal bile salt input, reduced bile salt cycling

and fecal losses help to preserve bile salt pool size100.

It has been shown that, apart from fat absorption, the bile salt pool size

and its composition are important determinants of hepatobiliary secretion rates

of cholesterol and phospholipids, factors that affect the lithogenicity of bile101-103.

Chenodeoxycholate pool size has been found to be negatively correlated with

biliary cholesterol saturation, suggesting a role in the etiology of cholesterol

gallstone formation93. Ursodeoxycholate (UDCA), a hydrophilic bile salt, is an

effective litholytic drug that promotes the dissolution of cholesterol gallstones,

25


by decreasing biliary cholesterol saturation104;105. Moreover, UDCA modifies the

bile salt pool composition by decreasing levels of endogenous, hydrophobic bile

acids while increasing the proportion of the non-toxic hydrophilic UDCA, and has

a choleretic effect102;106;107. The bile salt pool size can also be manipulated by

other drugs. For example, enlargement of the bile salt pool has been observed

in neonates, whose mothers were treated with dexamethasone or phenobarbital,

probably caused by drug-induced upregulation or increased activity of hepatic

and/ or intestinal proteins involved in bile salt metabolism.

The bile salt pool size is influenced by various diseases as diverse as inborn

errors of bile salt synthesis, liver and intestinal diseases, endocrine disorders and

hyperlipidemias108. Some of these disorders may directly affect key enzymes in

bile salt synthesis (e.g., cerebrotendinous xanthomatosis), whereas others result

in changed expression of transport proteins involved in bile salt metabolism (e.g.,

diabetes mellitus) or alterations in the enterohepatic cycling time (e.g., celiac

sprue)109.

Measurement of fecal bile salt excretion, or, in kinetic terms, bile salt turnover,

provides information on the portion of the bile salt pool that is newly synthesized

per day. The fractional turnover rate of bile salts is found to be inversely

correlated with bile salt pool size, indicating that with a large bile salt pool,

the portion that is lost via the feces is smaller20. Measurements of turnover

rates have provided useful knowledge of sterol balances in, for example, patients

with various types of hyperlipoproteinemia or in patiens with cholelithiasis110-113.

Bile salt synthesis which, under steady state conditions, maintains bile salt

pool size can be demonstrated as early as after 15 weeks of gestation114. In

human neonates, bile salt synthesis rates are relatively high when compared

to adults23. Bile salt synthesis rates increase in the first year of life, coinciding

with an increased activity of cholesterol 7α-hydroxylase (CYP7A1) and maturation

of ileal absorption, resulting in enlargement of the bile salt pool. In humans,

a large variation in the daily conversion of cholesterol to bile salts exists, for

reasons unrevealed to date115. The significant contribution of bile salt synthesis to

cholesterol homeostasis is illustrated by progressive accumulation of cholesterol

and accelerated atherosclerosis in inborn errors of bile salt synthesis116. A

relationship between bile salt and lipid metabolism has emerged from various

other studies, targeting bile salt synthesis as a therapeutic option to lower serum

cholesterol levels117-119.

Outline and scope of the thesis

Bile salts are of crucial importance in mammalian physiology, i.e., as generators

of bile flow, as promotors of biliary lipid excretion, as lipid solubilizers and as

“end products” of cholesterol catabolism. The recent identification of bile salts

as signaling molecules, affecting expression of genes in control of bile salt, lipid,

and glucose metabolism through nuclear receptors, has revolutionized traditional

concepts and has promoted research on bile salt metabolism tremendously. A

fascinating aspect of bile salt metabolism is their enterohepatic cycling, which

involves coordinated action of transporter proteins in liver and intestine. Many

of these proteins have been identified to date by modern cloning techniques.

26

Chapter 1

Development of methodology to fully appreciate the role of these proteins in whole

body bile salt metabolism in vivo has been a major effort in many laboratories. For

many decades, isotope dilution methods have been succesfully applied in adults

and provided insight into in vivo bile salt kinetic parameters: the bile salt pool

size, the fractional turnover rate, and the bile salt synthesis rate. Yet, a serious

limitation of the “conventional” approaches was the requirement to collect a

series of relatively large blood samples, which precluded its use in children or

commonly used (small) experimental animal models. In chapter 2 an adapted

stable isotope dilution technique using [2H4]-cholate with novel derivatisation

modalities and analytical procedures is described that overcomes this limitation,

as only extremely small blood samples are required. The availability of this novel

method to measure bile salt kinetics in vivo together with the construction of

genetically-modified, i.e., knockout or transgenic mouse models, in parallel with

the development of nuclear receptor ligands, has stimulated research on kinetics

of bile salts in the enterohepatic circulation. Scope of the research described

in this thesis was to unravel the role of hepatic and intestinal proteins on

the enterohepatic circulation of bile salts in vivo. In addition, effects of

established and potentially novel drugs on bile salt and lipid metabolism

were determined.

Effects of cyclosporin A (CsA), a commonly used immunosuppressant in

transplantation medicine and in auto-immunological disorders, on bile salt

metabolism were studied. In chapter 3 we characterized the effects of CsA on

the enterohepatic circulation of cholate with respect to kinetic parameters and in

relation to the expression of relevant transporters in liver and intestine in rats. CsA

appeared to enhance efficacy of intestinal cholate reabsorption through increased

Asbt protein expression in the distal ileum, which contributed to maintenance of

cholate pool size. Thus, in addition to hepatic regulation of bile salt homeostasis,

it was demonstrated that regulation of bile salt pool size occured also at the

intestinal level.

Studies described in chapter 4 aimed to elucidate whether CsA treatment

affects bile salt metabolism in pediatric patients after liver transplantation, and

whether such effects would be related to CsA-associated hyperlipidemia, a well

known side effect of CsA. CsA inhibited bile salt synthesis and increased plasma

concentrations of cholesterol and triglycerides in pediatric liver transplant patients.

Suppression of bile salt synthesis by long-term CsA treatment may contribute to

hyperlipidemia and thus to increased risk for cardiovascular disease.

Nuclear receptors control a wide variety of genes important for metabolism

of bile salts as well as of lipids. One of these proteins is the farnesoid X

receptor (FXR; NR1H4), which acts as an intracellular bile salt sensor, effectively

coordinating the expression of genes involved in bile salt and lipid metabolism.

Although the role of FXR as an important transcription factor has been firmly

established, predominantly in in vitro studies, the physiological role of FXR in

controlling the enterohepatic circulation of bile salts has not been addressed

sofar. The role of FXR in control of in vivo bile formation and the kinetics of the

enterohepatic circulation of bile salts has been determined by quantifying bile salt

kinetics using the newly developed stable isotope dilution method. The impact of

FXR-deficiency on bile formation and bile salt kinetics in FXR-deficient (Fxr (-/-))

27


mice is described in chapter 5. In chapter 6 we studied the physiological

consequences of prolonged treatment of rats with the synthetic FXR agonist

GW4064 on bile salt kinetics.

In addition to an enterohepatic circulation, the existence of cholehepatic

circulation of bile salts has been postulated, which could be involved in feedback

repression of de novo bile salt synthesis and affect enterohepatic cycling of bile

salts. Especially during conditions associated with bile duct proliferation such

as extrahepatic cholestasis, cholehepatic circulation of bile salts could thus in

theory protect the liver from further bile salt toxicity by limiting biosynthesis

of bile salts. In chapter 7 we studied whether bile duct proliferation without

cholestasis is associated with altered bile salt synthesis and/or bile flow using

Mdr2 P-glycoprotein (or Abcb4) -deficient (Mdr2 (-/-)) mice that are unable to

secrete phospholipids into bile and develop progressive bile duct proliferation in

the absence of obstructive cholestasis.

Finally, an intergrated view of the results obtained in this thesis is provided in

a general discussion.

28

Chapter 1

References

1. Hofmann AF. Bile Acids: The Good, the Bad, and the Ugly. News Physiol Sci 1999; 14: 24-9.

2. Chiang JY. Bile acid regulation of gene expression: roles of nuclear hormone receptors. Endocr Rev 2002; 23: 443-63.

3. Myant NB, Mitropoulos KA. Cholesterol 7 alpha-hydroxylase. J Lipid Res 1977; 18: 135-53.

4. Hofmann AF. Bile acid secretion, bile fl ow and biliary lipid secretion in humans. Hepa-tology 1990; 12: 17S-22S.

5. Minich D, Havinga R, Stellaard F, Vonk R, Kuipers F, Verkade H. Intestinal absorption and postabsorptive metabolism of linoleic acid in rats with short-term bile duct ligation. Am J Physiol Gastrointest Liver Physiol 2000; 279: G1242-G1248.

6. Werner A, Havinga R, Kuipers F, Verkade HJ. Treatment of EFA defi ciency with dietary triglycerides or phospholipids in a murine model of extrahepatic cholestasis. Am J Phy-siol Gastrointest Liver Physiol 2004; 286: G822-G832.

7. Nishioka T, Having R, Tazuma S, Stellaard F, Kuipers F, Verkade HJ. Administration of phosphatidylcholine-cholesterol liposomes partially reconstitutes fat absorption in chronically bile-diverted rats. Biochim Biophys Acta 2004; 1636: 90-8.

8. Riepl RL, Fiedler F, Ernstberger M, Teufel J, Lehnert P. Effect of intraduodenal taurode-oxycholate and L-phenylalanine on pancreatic secretion and on gastroenteropancreatic peptide release in man. Eur J Med Res 1996; 1: 499-505.

9. Koop I, Schindler M, Bosshammer A, Scheibner J, Stange E, Koop H. Physiological con-trol of cholecystokinin release and pancreatic enzyme secretion by intraduodenal bile acids. Gut 1996; 39: 661-7.

10. Nakamura R, Miyasaka K, Kuyama Y, Kitani K. Luminal bile regulates cholecystokinin release in conscious rats. Dig Dis Sci 1990; 35: 55-60.

11. Elzinga BM, Baller JF, Mensenkamp AR, Yao Z, Agellon LB, Kuipers F, Verkade HJ. Inhibi-tion of apolipoprotein B secretion by taurocholate is controlled by the N-terminal end of the protein in rat hepatoma McArdle-RH7777 cells. Biochim Biophys Acta 2003; 1635: 93-103.

12. Elzinga BM, Havinga R, Baller JF, Wolters H, Bloks V, Mensenkamp AR, Kuipers F, Ver-kade HJ. The role of transhepatic bile salt fl ux in the control of hepatic secretion of triacylglycerol-rich lipoproteins in vivo in rodents. Biochim Biophys Acta 2002; 1573: 9-20.

13. Lin Y, Havinga R, Schippers IJ, Verkade HJ, Vonk RJ, Kuipers F. Characterization of the inhibitory effects of bile acids on very-low-density lipoprotein secretion by rat hepato-cytes in primary culture. Biochem J 1996; 316: 531-8.

14. McCormick WC, III, Bell CC, Jr., Swell L, Vlahcevic ZR. Cholic acid synthesis as an index of the severity of liver disease in man. Gut 1973; 14: 895-902.

15. Shiffman ML, Carithers RL, Jr., Posner MP, Moore EW. Recovery of bile secretion fol-lowing orthotopic liver transplantation. J Hepatol 1991; 12: 351-61.

16. Sauer P, Rudolph G, Endele R, Senn M, Theilmann L, Otto G, Stremmel W, Stiehl A. Kinetics of primary bile acids in patients after orthotopic liver transplantation. Eur J Clin Invest 1996; 26: 979-82.

17. Pauletzki J, Stellaard F, Paumgartner G. Bile acid metabolism in human hyperthyroi-dism. Hepatology 1989; 9: 852-5.

18. Berr F, Pratschke E, Fischer S, Paumgartner G. Disorders of bile acid metabolism in cholesterol gallstone disease. J Clin Invest 1992; 90: 859-68.

19. Kullak-Ublick GA, Paumgartner G, Berr F. Long-term effects of cholecystectomy on bile acid metabolism. Hepatology 1995; 21: 41-5.

20. Watkins JB, Jarvenpaa AL, Szczepanik-Van Leeuwen P, Klein PD, Rassin DK, Gaull G, Raiha NC. Feeding the low-birth weight infant: V. Effects of taurine, cholesterol, and human milk on bile acid kinetics. Gastroenterology 1983; 85: 793-800.

21. Koopman BJ, Kuipers F, Bijleveld CM, van der Molen JC, Nagel GT, Vonk RJ, Wolthers BG. Determination of cholic acid and chenodeoxycholic acid pool sizes and fractional turnover rates by means of stable isotope dilution technique, making use of deuterated cholic acid and chenodeoxycholic acid. Clin Chim Acta 1988; 175: 143-55.

22. Stellaard F, Sackmann M, Sauerbruch T, Paumgartner G. Simultaneous determination of

29


cholic acid and chenodeoxycholic acid pool sizes and fractional turnover rates in human serum using 13C-labeled bile acids. J Lipid Res 1984; 25: 1313-9.

23. Watkins JB, Ingall D, Szczepanik P, Klein PD, Lester R. Bile-salt metabolism in the new-born. Measurement of pool size and synthesis by stable isotope technic. N Engl J Med 1973; 288: 431-4.

24. LINDSTEDT S. The turnover of cholic acid in man: bile acids and steroids. Acta Physiol Scand 1957; 40: 1-9.

25. Bahar RJ, Stolz A. Bile acid transport. Gastroenterol Clin North Am 1999; 28: 27-58.26. Dean M, Hamon Y, Chimini G. The human ATP-binding cassette (ABC) transporter

superfamily. J Lipid Res 2001; 42: 1007-17.27. Ballatori N, Truong AT. Glutathione as a primary osmotic driving force in hepatic bile

formation. Am J Physiol 1992; 263: G617-G624.28. Tietz PS, Marinelli RA, Chen XM, Huang B, Cohn J, Kole J, McNiven MA, Alper S, LaRusso

NF. Agonist-induced coordinated traffi cking of functionally related transport proteins for water and ions in cholangiocytes. J Biol Chem 2003; 278: 20413-9.

29. Davis RA, Miyake JH, Hui TY, Spann NJ. Regulation of cholesterol-7alpha-hydroxylase: BAREly missing a SHP. J Lipid Res 2002; 43: 533-43.

30. Duane WC, Javitt NB. 27-hydroxycholesterol: production rates in normal human sub-jects. J Lipid Res 1999; 40: 1194-9.

31. Vlahcevic ZR, Stravitz RT, Heuman DM, Hylemon PB, Pandak WM. Quantitative estima-tions of the contribution of different bile acid pathways to total bile acid synthesis in the rat. Gastroenterology 1997; 113: 1949-57.

32. Schwarz M, Russell DW, Dietschy JM, Turley SD. Marked reduction in bile acid synthe-sis in cholesterol 7alpha-hydroxylase-defi cient mice does not lead to diminished tissue cholesterol turnover or to hypercholesterolemia. J Lipid Res 1998; 39: 1833-43.

33. Li-Hawkins J, Lund EG, Turley SD, Russell DW. Disruption of the oxysterol 7alpha-hydroxylase gene in mice. J Biol Chem 2000; 275: 16536-42.

34. Pircher PC, Kitto JL, Petrowski ML, Tangirala RK, Bischoff ED, Schulman IG, Westin SK. Farnesoid x receptor regulates bile Acid-amino Acid conjugation. J Biol Chem 2003; 278: 27703-11.

35. Midtvedt T. Microbial bile acid transformation. Am J Clin Nutr 1974; 27: 1341-7.36. Jonsson G, Midtvedt AC, Norman A, Midtvedt T. Intestinal microbial bile acid transfor-

mation in healthy infants. J Pediatr Gastroenterol Nutr 1995; 20: 394-402.37. Hill MJ, Drasar BS. Degradation of bile salts by human intestinal bacteria. Gut 1968; 9:

22-7.38. Björkhem I. Mechanisms of bile acid synthesis in mammalian liver. In: Danielsson

H, Sjövall J, eds. Sterols and bile acids. Amsterdam: Elsevier Scientifi c Publishers, 1985;231-78.

39. Meier PJ, Stieger B. Bile salt transporters. Annu Rev Physiol 2002; 64: 635-61.40. Gartung C, Matern S. Molecular regulation of sinusoidal liver bile acid transporters

during cholestasis. Yale J Biol Med 1997; 70: 355-63.41. von Dippe P, Zhu QS, Levy D. Cell surface expression and bile acid transport function

of one topological form of m-epoxide hydrolase. Biochem Biophys Res Commun 2003; 309: 804-9.

42. Alves C, von Dippe P, Amoui M, Levy D. Bile acid transport into hepatocyte smooth endoplasmic reticulum vesicles is mediated by microsomal epoxide hydrolase, a mem-brane protein exhibiting two distinct topological orientations. J Biol Chem 1993; 268: 20148-55.

43. Kullak-Ublick GA, Stieger B, Hagenbuch B, Meier PJ. Hepatic transport of bile salts. Semin Liver Dis 2000; 20: 273-92.

44. Jung D, Hagenbuch B, Gresh L, Pontoglio M, Meier PJ, Kullak-Ublick GA. Characteriza-tion of the human OATP-C (SLC21A6) gene promoter and regulation of liver-specifi c OATP genes by hepatocyte nuclear factor 1 alpha. J Biol Chem 2001; 276: 37206-14.

45. Takikawa H, Stolz A, Kaplowitz N. Cyclical oxidation-reduction of the C3 position on bile acids catalyzed by rat hepatic 3 alpha-hydroxysteroid dehydrogenase. I. Studies with the purifi ed enzyme, isolated rat hepatocytes, and inhibition by indomethacin. J Clin Invest 1987; 80: 852-60.

46. Crawford JM, Berken CA, Gollan JL. Role of the hepatocyte microtubular system in the excretion of bile salts and biliary lipid: implications for intracellular vesicular transport.

30

Chapter 1

J Lipid Res 1988; 29: 144-56.47. Gerloff T, Stieger B, Hagenbuch B, Madon J, Landmann L, Roth J, Hofmann AF, Meier PJ.

The sister of P-glycoprotein represents the canalicular bile salt export pump of mam-malian liver. J Biol Chem 1998; 273: 10046-50.

48. Kipp H, Arias IM. Traffi cking of canalicular ABC transporters in hepatocytes. Annu Rev Physiol 2002; 64: 595-608.

49. Thompson R, Strautnieks S. BSEP: function and role in progressive familial intrahepatic cholestasis. Semin Liver Dis 2001; 21: 545-50.

50. Wang R, Salem M, Yousef IM, Tuchweber B, Lam P, Childs SJ, Helgason CD, Ackerley C, Phillips MJ, Ling V. Targeted inactivation of sister of P-glycoprotein gene (spgp) in mice results in nonprogressive but persistent intrahepatic cholestasis. Proc Natl Acad Sci U S A 2001; 98: 2011-6.

51. Wang R, Lam P, Liu L, Forrest D, Yousef IM, Mignault D, Phillips MJ, Ling V. Severe cholestasis induced by cholic acid feeding in knockout mice of sister of P-glycoprotein. Hepatology 2003; 38: 1489-99.

52. Borst P, Evers R, Kool M, Wijnholds J. The multidrug resistance protein family. Biochim Biophys Acta 1999; 1461: 347-57.

53. Efferth T. The human ATP-binding cassette transporter genes: from the bench to the bedside. Curr Mol Med 2001; 1: 45-65.

54. Hylemon PB, Bohdan PM, Sirica AE, Heuman DM, Vlahcevic ZR. Cholesterol and bile acid metabolism in cultures of primary rat bile ductular epithelial cells. Hepatology 1990; 11: 982-8.

55. Gurantz D, Schteingart CD, Hagey LR, Steinbach JH, Grotmol T, Hofmann AF. Hyper-choleresis induced by unconjugated bile acid infusion correlates with recovery in bile of unconjugated bile acids. Hepatology 1991; 13: 540-50.

56. Benedetti A, Di Sario A, Marucci L, Svegliati-Baroni G, Schteingart CD, Ton-Nu HT, Hof-mann AF. Carrier-mediated transport of conjugated bile acids across the basolateral membrane of biliary epithelial cells. Am J Physiol 1997; 272: G1416-G1424.

57. Lazaridis KN, Pham L, Tietz P, Marinelli RA, deGroen PC, Levine S, Dawson PA, LaRusso NF. Rat cholangiocytes absorb bile acids at their apical domain via the ileal sodium-dependent bile acid transporter. J Clin Invest 1997; 100: 2714-21.

58. Alpini G, Glaser SS, Rodgers R, Phinizy JL, Robertson WE, Lasater J, Caligiuri A, Tretjak Z, LeSage GD. Functional expression of the apical Na+-dependent bile acid transporter in large but not small rat cholangiocytes. Gastroenterology 1997; 113: 1734-40.

59. Lazaridis KN, Tietz P, Wu T, Kip S, Dawson PA, LaRusso NF. Alternative splicing of the rat sodium/bile acid transporter changes its cellular localization and transport properties. Proc Natl Acad Sci U S A 2000; 97: 11092-7.

60. Rost D, Konig J, Weiss G, Klar E, Stremmel W, Keppler D. Expression and localization of the multidrug resistance proteins MRP2 and MRP3 in human gallbladder epithelia. Gastroenterology 2001; 121: 1203-8.

61. Soroka CJ, Lee JM, Azzaroli F, Boyer JL. Cellular localization and up-regulation of multi-drug resistance-associated protein 3 in hepatocytes and cholangiocytes during obstruc-tive cholestasis in rat liver. Hepatology 2001; 33: 783-91.

62. Kullak-Ublick GA, Stieger B, Meier PJ. Enterohepatic bile salt transporters in normal physiology and liver disease. Gastroenterology 2004; 126: 322-42.

63. Elsing C, Sagesser H, Reichen J. Ursodeoxycholate-induced hypercholeresis in cirrhotic rats: further evidence for cholehepatic shunting. Hepatology 1994; 20: 1048-54.

64. Shneider BL. Intestinal bile acid transport: biology, physiology, and pathophysiology. J Pediatr Gastroenterol Nutr 2001; 32: 407-17.

65. Dawson PA, Haywood J, Craddock AL, Wilson M, Tietjen M, Kluckman K, Maeda N, Parks JS. Targeted deletion of the ileal bile acid transporter eliminates enterohepatic cycling of bile acids in mice. J Biol Chem 2003.

66. Oelkers P, Kirby LC, Heubi JE, Dawson PA. Primary bile acid malabsorption caused by mutations in the ileal sodium-dependent bile acid transporter gene (SLC10A2). J Clin Invest 1997; 99: 1880-7.

67. Duane WC, Hartich LA, Bartman AE, Ho SB. Diminished gene expression of ileal apical sodium bile acid transporter explains impaired absorption of bile acid in patients with hypertriglyceridemia. J Lipid Res 2000; 41: 1384-9.

68. Amelsberg A, Jochims C, Richter CP, Nitsche R, Folsch UR. Evidence for an anion

31


exchange mechanism for uptake of conjugated bile acid from the rat jejunum. Am J Physiol 1999; 276: G737-G742.

69. Landrier JF, Grober J, Zaghini I, Besnard P. Regulation of the ileal bile acid-binding protein gene: an approach to determine its physiological function(s). Mol Cell Biochem 2002; 239: 149-55.

70. Hubbert ML, Craddock AL, Haywood N, Ballatori N, Dawson PA. The heteromeric organic solute transporter (Ost) alpha and beta complex is an ileal basolateral bile acid trans-porter. 2004. Falk Symposium No141: Bile Acid Biology and its Therapeutic Implicati-ons.

71. Edwards PA, Kast HR, Anisfeld AM. BAREing it all: the adoption of LXR and FXR and their roles in lipid homeostasis. J Lipid Res 2002; 43: 2-12.

72. Lu TT, Makishima M, Repa JJ, Schoonjans K, Kerr TA, Auwerx J, Mangelsdorf DJ. Mole-cular basis for feedback regulation of bile acid synthesis by nuclear receptors. Mol Cell 2000; 6: 507-15.

73. Yang Y, Zhang M, Eggertsen G, Chiang JY. On the mechanism of bile acid inhibition of rat sterol 12alpha-hydroxylase gene (CYP8B1) transcription: roles of alpha-fetoprotein transcription factor and hepatocyte nuclear factor 4alpha. Biochim Biophys Acta 2002; 1583: 63-73.

74. Kok T, Hulzebos CV, Wolters H, Havinga R, Agellon L, Stellaard F, Shan B, Schwarz M, Kuipers F. Enterohepatic Circulation of Bile Salts in Farnesoid X Receptor-defi cient Mice: EFFICIENT INTESTINAL BILE SALT ABSORPTION IN THE ABSENCE OF ILEAL BILE ACID-BINDING PROTEIN. J Biol Chem 2003; 278: 41930-7.

75. Maloney PR, Parks DJ, Haffner CD, Fivush AM, Chandra G, Plunket KD, Creech KL, Moore LB, Wilson JG, Lewis MC, Jones SA, Willson TM. Identifi cation of a chemical tool for the orphan nuclear receptor FXR. J Med Chem 2000; 43: 2971-4.

76. Sturm E, Zimmerman TL, Crawford AR, Svetlov SI, Sundaram P, Ferrara JL, Karpen SJ, Crawford JM. Endotoxin-stimulated macrophages decrease bile acid uptake in WIF-B cells, a rat hepatoma hybrid cell line. Hepatology 2000; 31: 124-30.

77. Miyake JH, Wang SL, Davis RA. Bile acid induction of cytokine expression by macropha-ges correlates with repression of hepatic cholesterol 7alpha-hydroxylase. J Biol Chem 2000; 275: 21805-8.

78. Post SM, Duez H, Gervois PP, Staels B, Kuipers F, Princen HM. Fibrates suppress bile acid synthesis via peroxisome proliferator-activated receptor-alpha-mediated downre-gulation of cholesterol 7alpha-hydroxylase and sterol 27-hydroxylase expression. Arte-rioscler Thromb Vasc Biol 2001; 21: 1840-5.

79. Gupta S, Pandak WM, Hylemon PB. LXR alpha is the dominant regulator of CYP7A1 transcription. Biochem Biophys Res Commun 2002; 293: 338-43.

80. Agellon LB, Drover VA, Cheema SK, Gbaguidi GF, Walsh A. Dietary cholesterol fails to stimulate the human cholesterol 7alpha-hydroxylase gene (CYP7A1) in transgenic mice. J Biol Chem 2002; 277: 20131-4.

81. Denson LA, Sturm E, Echevarria W, Zimmerman TL, Makishima M, Mangelsdorf DJ, Karpen SJ. The orphan nuclear receptor, shp, mediates bile acid-induced inhibition of the rat bile acid transporter, ntcp. Gastroenterology 2001; 121: 140-7.

82. Wolters H, Elzinga BM, Baller JF, Boverhof R, Schwarz M, Stieger B, Verkade HJ, Kuipers F. Effects of bile salt fl ux variations on the expression of hepatic bile salt transporters in vivo in mice. J Hepatol 2002; 37: 556-63.

83. Fickert P, Zollner G, Fuchsbichler A, Stumptner C, Pojer C, Zenz R, Lammert F, Stieger B, Meier PJ, Zatloukal et al. Effects of ursodeoxycholic and cholic acid feeding on hepa-tocellular transporter expression in mouse liver. Gastroenterology 2001; 121: 170-83.

84. Plass JR, Mol O, Heegsma J, Geuken M, Faber KN, Jansen PL, Muller M. Farnesoid X receptor and bile salts are involved in transcriptional regulation of the gene encoding the human bile salt export pump. Hepatology 2002; 35: 589-96.

85. Lee JM, Trauner M, Soroka CJ, Stieger B, Meier PJ, Boyer JL. Expression of the bile salt export pump is maintained after chronic cholestasis in the rat. Gastroenterology 2000; 118: 163-72.

86. Trauner M, Boyer JL. Bile salt transporters: molecular characterization, function, and regulation. Physiol Rev 2003; 83: 633-71.

87. Chen F, Ma L, Dawson PA, Sinal CJ, Sehayek E, Gonzalez FJ, Breslow J, Ananthanaray-anan M, Shneider BL. Liver receptor homologue-1 mediates species- and cell line-spe-

32

Chapter 1

cifi c bile acid-dependent negative feedback regulation of the apical sodium-dependent bile acid transporter. J Biol Chem 2003; 278: 19909-16.

88. Arrese M, Shneider BL. Neither intestinal sequestration of bile acids nor common bile duct ligation modulate the expression and function of the rat ileal bile acid transporter. Hepatology 1998; 28: 1081-7.

89. Donner MG, Keppler D. Up-regulation of basolateral multidrug resistance protein 3 (Mrp3) in cholestatic rat liver. Hepatology 2001; 34: 351-9.

90. Heubi JE, Balistreri WF, Suchy FJ. Bile salt metabolism in the fi rst year of life. J Lab Clin Med 1982; 100: 127-36.

91. Hernell O, Blackberg L. Human milk bile salt-stimulated lipase: functional and molecu-lar aspects. J Pediatr 1994; 125: S56-S61.

92. Bennion LJ, Drobny E, Knowler WC, Ginsberg RL, Garnick MB, Adler RD, Duane WC. Sex differences in the size of bile acid pools. Metabolism 1978; 27: 961-9.

93. LINDSTEDT S, Avigan J, Goodman DS, Sjovall J, Steinberg D. The effect of dietary fat on the turnover of cholic acid and on the composition of the biliary bile acids in man. J Clin Invest 1965; 44: 1754-65.

94. Hepner GW. Effect of decreased gallbladder stimulation on enterohepatic cycling and kinetics of bile acids. Gastroenterology 1975; 68: 1574-81.

95. Bisschop PH, Bandsma RH, Stellaard F, Ter Harmsel A, Meijer AJ, Sauerwein HP, Kuipers F, Romijn JA. Low-fat, high-carbohydrate and high-fat, low-carbohydrate diets decrease primary bile acid synthesis in humans. Am J Clin Nutr 2004; 79: 570-6.

96. Duane WC. Simulation of the defect of bile acid metabolism associated with cholesterol cholelithiasis by sorbitol ingestion in man. J Lab Clin Med 1978; 91: 969-78.

97. Duane WC, Hanson KC. Role of gallbladder emptying and small bowel transit in regula-tion of bile acid pool size in man. J Lab Clin Med 1978; 92: 858-72.

98. Duane WC, Bond JH, Jr. Prolongation of intestinal transit and expansion of bile acid pools by propantheline bromide. Gastroenterology 1980; 78: 226-30.

99. Northfi eld TC, Hofmann AF. Biliary lipid secretion in gallstone patients. Lancet 1973; 1: 747-8.

100. Redinger RN, Hawkins JW, Grace DM. The economy of the enterohepatic circulation of bile acids in the baboon. 1. Studies of controlled enterohepatic circulation of bile acids. J Lipid Res 1984; 25: 428-36.

101. Icarte MA, Pizarro M, Accatino L. Adaptive regulation of hepatic bile salt transport: effects of alloxan diabetes in the rat. Hepatology 1991; 14: 671-8.

102. Angulo P. Use of ursodeoxycholic acid in patients with liver disease. Curr Gas-troenterol Rep 2002; 4: 37-44.

103. Xu G, Salen G, Shneider BL, Ananthanarayanan M, Shefer S, Ma L, Batta A, Nguyen LB, Lingutla JJ, Tint GS, Pcolinsky M, Suchy FJ. Cholecystectomy prevents expansion of the bile acid pool and inhibition of cholesterol 7alpha-hydroxylase in rabbits fed cholesterol. J Lipid Res 2001; 42: 1438-43.

104. Efficacy and indications of ursodeoxycholic acid treatment for dissolving gallstones. A multicenter double-blind trial. Tokyo Cooperative Gallstone Study Group. Gastroenterology 1980; 78: 542-8.

105. Wang DQ, Tazuma S. Effect of beta-muricholic acid on the prevention and dissolution of cholesterol gallstones in C57L/J mice. J Lipid Res 2002; 43: 1960-8.

106. Soderdahl G, Nowak G, Duraj F, Wang FH, Einarsson C, Ericzon BG. Ursodeoxycholic acid increased bile flow and affects bile composition in the early postoperative phase following liver transplantation. Transpl Int 1998; 11 Suppl 1:S231-8.: S231-S

107. van Gorkom BA, van der Meer R, Boersma-van Ek W, Termont DS, de Vries EG, Kleibeuker JH. Changes in bile acid composition and effect on cytolytic activity of fecal water by ursodeoxycholic acid administration: a placebo-controlled cross-over intervention trial in healthy volunteers. Scand J Gastroenterol 2002; 37: 965-71.

108. Subbiah MT, Yunker RL, Hassan AS, Thibert P. Abnormal bile acid pool and composition in neonates of spontaneously diabetic Wistar BB rats and its change during development. Biochim Biophys Acta 1984; 794: 355-60.

109. Lanzini A, Lanzarotto F. Review article: the ‘mechanical pumps’ and the enterohepatic circulation of bile acids--defects in coeliac disease. Aliment Pharmacol Ther 2000; 14 Suppl 2:58-61.: 58-61.

110. Subbiah MT, Tyler NE, Buscaglia MD, Marai L. Estimation of bile acid excretion in man:

33


comparison of isotopic turnover and fecal excretion methods. J Lipid Res 1976; 17: 78-84.

111 Angelin B, Hershon KS, Brunzell JD. Bile acid metabolism in hereditary forms of hypertriglyceridemia: evidence for an increased synthesis rate in monogenic familial hypertriglyceridemia. Proc Natl Acad Sci U S A 1987; 84: 5434-8.

112. Berr F, Stellaard F, Pratschke E, Paumgartner G. Effects of cholecystectomy on the kinetics of primary and secondary bile acids. J Clin Invest 1989; 83: 1541-50.

113. Kimball A, Pertsemlidis D, Panveliwalla D. Composition of biliary lipids and kinetics of bile acids after cholecystectomy in man. Am J Dig Dis 1976; 21: 776-81.

114. Dietschy JM, Turley SD, Spady DK. Role of liver in the maintenance of cholesterol and low density lipoprotein homeostasis in different animal species, including humans. J Lipid Res 1993; 34: 1637-59.

115. Stellaard F, Sackmann M, Berr F, Paumgartner G. Simultaneous determination of pool sizes and fractional turnover rates, of deoxycholic acid, cholic acid and chenodeoxycholic acid in man by isotope dilution with 2H and 13C labels and serum sampling. Biomed Environ Mass Spectrom 1987; 14: 609-11.

116. Verrips A, Wevers RA, Van Engelen BG, Keyser A, Wolthers BG, Barkhof F, Stalenhoef A, De Graaf R, Janssen-Zijlstra F, Van Spreeken A, Gabreels FJ. Effect of simvastatin in addition to chenodeoxycholic acid in patients with cerebrotendinous xanthomatosis. Metabolism 1999; 48: 233-8.

117. Spady DK, Cuthbert JA, Willard MN, Meidell RS. Overexpression of cholesterol 7alpha-hydroxylase (CYP7A) in mice lacking the low density lipoprotein (LDL) receptor gene. LDL transport and plasma LDL concentrations are reduced. J Biol Chem 1998; 273: 126-32.

118. Pullinger CR, Eng C, Salen G, Shefer S, Batta AK, Erickson SK, Verhagen A, Rivera CR, Mulvihill SJ, Malloy MJ, Kane JP. Human cholesterol 7alpha-hydroxylase (CYP7A1) deficiency has a hypercholesterolemic phenotype. J Clin Invest 2002; 110: 109-17.

119. Miyake JH, Duong-Polk XT, Taylor JM, Du EZ, Castellani LW, Lusis AJ, Davis RA. Transgenic expression of cholesterol-7-alpha-hydroxylase prevents atherosclerosis in C57BL/6J mice. Arterioscler Thromb Vasc Biol 2002; 22: 121-6.

36

Chapter 2

ABSTRACT

A stable isotope dilution method is described that allows measurement of

cholic acid (CA) kinetics, that is, pool size, fractional turnover rate (FTR), and

synthesis rate in mice, rats, and humans. Decay of administered [2,2,4,4-2H4]-CA

enrichment was measured in time in 50-µl plasma samples by gas-liquid

chromatography/electron capture negative chemical ionization-mass spectrometry,

applying the pentafl uorobenzyl-trimethylsilyl derivative.

The kinetic data expressed species-dependent differences. The CA pool sizes

were 16.8 ± 2.1, 10.6 ± 1.2, and 2.4 ± 0.7 µmol/100 g body weight for mice,

rats, and humans, respectively. The FTR values were 0.44 ± 0.03, 0.88 ± 0.10,

and 0.46 ± 0.14 per day for mice, rats, and humans. The corresponding synthesis

rates were 7.3 ± 1.6, 9.3 ± 0.1, and 1.0 ± 0.2 µmol/100 g body weight per day.

The human data agreed well with literature data obtained by conventional isotope

dilution techniques. For rats and mice these are the fi rst reported isotope dilution

data. The method was validated by confi rmation of isotopic equilibrium between

biliary CA and plasma CA in the rat. Its applicability was demonstrated by the

observation of increased CA FTR and CA synthesis rate in rats fed cholestyramine,

which is known to increase fecal bile acid excretion.

The presented stable isotope dilution method enables the determination of

CA kinetic parameters in small plasma samples. The method can be applied in

unanesthesized rodents with an intact enterohepatic circulation and may also be

valuable when studying the development of human neonatal bile acid kinetics.

37

Cholic acid kinetics in rodents and humans

INTRODUCTION

The active secretion of bile acids into the canaliculus generates bile fl ow and biliary

secretion of phospholipids and cholesterol1. Apart from their role in bile secretion,

bile acids enhance the intestinal absorption of dietary fats and cholesterol. The

conversion of cholesterol to bile acids is of crucial importance for maintenance of

cholesterol homeostasis2. Cholic acid (CA) is a primary bile acid in humans as well

as in rodents and comprises 30% to 50% (humans) or 50% to 80% (rodents)

of the total bile acid pool. CA pool size, fractional turnover rate (FTR), and

synthesis rate are the kinetic parameters that allow description of its production

and conservation in the body. Isotope dilution techniques applying radioactive or

stable isotopes3-7 have been accepted as the preferred method to study bile acid

kinetics in vivo and have contributed signifi cantly to the present knowledge of bile

acid (patho)physiology in humans8-14. The techniques allow for the simultaneous

determination of the CA pool size, FTR, and synthesis rate without interruption of

the enterohepatic circulation.

Several novel animal models, including transgenic and knockout models, offer

the opportunity to gain further insight in the regulation of bile acid metabolism

as well as in the metabolic action of bile acids. Different methods have been

used to measure parameters of bile acid kinetics in experimental animals, that is,

analysis of the intestinal bile acid content as a refl ection of the pool size15,16 and the

“washout” method to estimate pool size and synthesis rate17,18. The fecal balance

method is commonly applied to determine the total bile acid synthesis rate in

rodents19. Finally, the activities or expression levels of cholesterol 7α-hydroxylase

and sterol 27-hydroxylase, the rate-limiting enzymes in the classic and alternative

pathway of bile acid synthesis, respectively, are often used as a refl ection of bile

acid synthesis rates20,21. However, none of the described methods is suitable to

measure all relevant parameters of bile acid metabolism (i.e., pool size, FTR,

and synthesis rate) simultaneously in vivo in animals with an intact enterohepatic

circulation and most of the methods cannot be used repeatedly in the same

animal. These disadvantages are theoretically circumvented by application of an

isotope dilution procedure using blood sampling. However, current stable isotope

approaches require 5-ml blood samples to obtain accurate measurements of

isotope enrichment, which precludes use in rodents and in small humans (infants

and neonates).

Therefore, we have developed a microscale stable isotope dilution procedure

for CA, which allows for isotope enrichment measurements in small volumes of

plasma. The method chosen is based on gas liquid chromatography (GLC)/electron

capture negative chemical ionization-mass spectrometry (MS) applied to the

pentafl uorobenzyl-trimethylsilyl (PFB-TMS) derivative of CA6. The technique was

applied in healthy humans to enable comparison with literature data obtained by

the conventional stable isotope technique with plasma sampling. To demonstrate

isotopic equilibrium in the bile acid pool, CA kinetic data were determined

simultaneously in plasma and bile of male unanesthesized Wistar rats with an

exteriorized enterohepatic circulation22. The applicability of the procedure was

tested in male Wistar rats after manipulation of CA kinetics by cholestyramine

treatment, which is anticipated to enhance CA turnover23. The technique was also

38

Chapter 2

applied in male mice to be able to evaluate species dependency of CA metabolism.

The studies reported herein show that the method allows for the measurement of

bile acid kinetic parameters in rodents and, because of the small blood volumes,

may also be useful in human neonates and children.

MATERIALS AND METHODS

Materials

2,2,4,4-Tetradeuterated cholic acid ([2H4]-CA; isotopic purity, 98%) was obtained

from Isotec (Miamisburg, OH). Cholylglycine hydrolase from Clostridium perfringens

(welchii) was purchased from Sigma (St. Louis, MO). Pentafl uorobenzylbromide

was purchased from Fluka Chemie (Buchs, Neu-Ulm, Switzerland). All other

chemicals and solvents used were of the highest purity commercially available.

Animals and diets

Male Wistar rats (Harlan Laboratories, Zeist, The Netherlands) of 350 g and male

FVB mice (breeding colony at the Animal Facility of the Academic Medical Center

of Amsterdam) of 30 g were used in the experiments. The animals were housed

in a light- and temperature-controlled facility. They had free access to tap water

and standard lab chow, or, when indicated, to chow supplemented with 1% (w/w)

cholestyramine (Sigma). Experimental protocols were approved by the Ethical

Committee for Animal Experiments, Faculty of Medical Sciences (University of

Groningen, Groningen, The Netherlands).

Human studies

Experimental protocols for studies in human volunteers were approved by the

Ethical Committee of the University Hospital Groningen and were performed with

the informed consent of the participants.

Experimental procedures

Experiment 1: Measurement of [2H4]-CA kinetics in humans. CA kinetic parameters

were measured in six healthy volunteers taking a normal Western-type diet (two

females, four males; age, 25–58 years). Fifty milligrams of [2,2,4,4-2H4]-CA

was administered orally in 200 ml of 0.5% NaHCO35. Basal blood samples were

collected before [2H4]-CA administration. Subsequently postprandial blood samples

were taken twice daily for the next 3 days. Blood was centrifuged and plasma was

stored at - 20°C until analysis.

Experiment 2: Comparison of CA kinetics determined in rat plasma and bile. Three

rats were individually housed and equipped with permanent catheters in the bile

duct, duodenum, and heart, using techniques described previously22. Catheters

in bile duct and duodenum were connected to maintain an intact enterohepatic

circulation. Animals were allowed to recover from surgery for 5 days. On day 5,

7 mg of [2H4]-CA in a total volume of 250 µl of 0.5% NaHCO

3 in PBS was slowly

administered as a bolus via the duodenal catheter. The amount of labeled CA

administered was estimated to equal 10% of the endogenous bile acid pool15.

Blood samples (250 µl) were collected via the heart catheter 1, 3, 4.5, 6, 9, 12,

39


21, 24, 48, 72, and 96 h after administration of [2H4]-CA. Bile (50 µl) was sampled

simultaneously with the blood samples from the bile duct catheter at 2 min. After

bile sampling, the enterohepatic circulation was immediately restored. Blood was

centrifuged at 4000 rpm for 10 min. Plasma and bile samples were stored at -

20°C until analysis.

Experiment 3: Effects of cholestyramine treatment on CA kinetics in intact rats.

To characterize the effects on CA kinetics of 1% (w/w) cholestyramine added

to the diet of rats, 12 rats were individually housed and equipped with a heart

catheter23. They were randomly divided in two groups of six animals each. One

group had free access to normal chow (controls), and the other group received

normal chow supplemented with 1% (w/w) cholestyramine for 7 days. On day

5, 5 mg of [2H4]-CA in a total volume of 250 µl of 0.5% NaHCO

3 in PBS solution

was slowly administered through the heart catheter. Blood samples (250 µl) were

collected in heparinized test tubes via the heart catheter before and 3, 4.5, 6, 12,

24, 30, and 48 h after injection of [2H4]-CA. Blood was centrifuged at 4000 rpm for

10 min. Plasma samples were stored at -20°C until analysis. Feces were collected

in 24-h fractions during the experiment to determine fecal bile acid output as an

independent refl ection of bile acid synthesis, assuming steady state conditions.

Experiment 4: Measurement of [2H4]-CA kinetics in mice. To determine bile acid

kinetics in mice, six male mice were housed individually. On day 7, 210 µg of

[2H4]-CA in a solution of 0.5% NaHCO

3 in PBS was slowly injected intravenously

via the penile vein under halothane anesthesia. At 6, 23, 48, and 72 h after

administration (n = 3) or at 14, 34, 48, and 72 h (n = 3), blood samples (225

µl) were collected by tail bleeding under halothane anesthesia. Samples used for

baseline isotope abundance measurements were obtained by heart puncture from

a separate group of mice. Blood was collected in microhematocrit tubes containing

heparin and centrifuged to obtain plasma. After centrifugation (4000 rpm for 10

min) plasma was stored at -20°C until analysis.

Analytical techniques

Preparation of plasma and bile samples for isotope analysis.

Plasma and bile samples were prepared for GLC-MS analysis as described

previously24.

Gas-liquid chromatography-electron capture negative chemical ionization-

mass spectrometry.

All analyses were performed on a Finnigan SSQ7000 quadrupole GLC-MS

instrument (Finnigan MAT, San Jose, CA). Gas-liquid chromatographic separation

was performed on a 30 m x 0.25 mm column, with a fi lm thickness of 0.25

µm (DB-5MS; J&W Scientifi c, Folsom, CA). One to 3 µl of the fi nal solution of

derivatized bile acids was injected in the splitless mode at an injector temperature

of 290°C and a column temperature of 150°C. The column temperature was then

programmed to remain at 150°C for 1 min, to rise to 315°C at a rate of 30°C/min,

and then to remain at 315°C for 14 min. The interface temperature was 290°C.

The ion source was operated in the negative ion chemical ionization mode at

40

Chapter 2

150°C, applying methane as the moderating gas at a source pressure of 1600

mTorr. Isotope ratios were determined in the selected ion monitoring mode on

m/z 623.3 (M0) and 627.3 (M4) for CA. Optimal GLC-MS conditions were assessed

by examining the effects of mass spectrometric and selected ion monitoring

parameters. Settings were adjusted for each set of samples to obtain at least

30 data points on the gas chromatographic peak and a peak intensity for the M0

cholate peak at m/z 623.3 between 1 x 106 and 5 x 107 instrument units. Within

this range stable isotope ratio values of M1/M0, M2/M0, M3/M0, and M4/M0 were

obtained. Injection volume and electron multiplier voltage were adjusted to obtain

base peak intensities at the defi ned intensity plateau, assuring accurate and

reproducible M4/M0 isotope ratios. Because bile acid concentrations are different

in bile and plasma and in plasma samples of different species, results have always

been obtained under these standardized conditions.

Fecal bile acids.

Total bile acid concentrations were measured in an aliquot of freeze-dried

homogenized feces and determined by an enzymatic fl uorimetric assay, as

described previously25.

Calculations

Isotope dilution technique. The area ratio M4/M0 is calculated after computerized

integration of peak areas of M4 CA and M0 CA in the mass chromatograms for m/z

627.3 and 623.3, using LCQuan software (Finnigan MAT). Enrichment is defi ned

as the increase of M4/M0 after administration of [2H4]-CA and expressed as the

natural logarithm of the atom% excess (ln APE) value26. The decay of ln APE over

time was described by linear regression analysis. From this linear decay curve the

FTR and pool size of CA were calculated. The FTR (per day) equals the slope of the

regression line. The pool size (micromoles per 100 g body weight) is determined

according to the formula:

D . b . 100

Pool size = - D,

ea

where D is the administered amount of label, b is the isotopic purity, and a is the

intercept on the y axis of the ln APE-versus-time curve. The CA synthesis rate

(micromoles per 100 g body weight per day) is determined by multiplying pool

size and FTR5.

Statistics

Values represent means ± SD for the indicated number of humans and animals per

group. Using SPSS (Chicago, IL) version 8.0 statistical software, the signifi cance

of differences was calculated by using the two-tailed Student’s t-test for normally

distributed paired data or a Mann-Whitney U test for data that were not normally

distributed. P < 0.05 was considered signifi cant. For the assessment of agreement

between the measurements in bile and plasma, the Bland-Altman approach was

used27.

41


RESULTS

Accuracy and precision of M4/M0 isotope abundance measurements

Table 1 summarizes the measurements of M4/M0 natural abundance of CA and

the corresponding variations in plasma and bile of rats, and in plasma of mice

and humans. The theoretical natural isotope abundance based on the elemental

and isotopic composition of the selected [M-PFB]- ion is also shown. All measured

abundance values were within 20% of the theoretical value, which is considered to

be accurate at the abundance level of 1.95%. The precision was good for CA in the

rat and human specimens (SD < 0.1%), but for unknown reasons precision was

less for mouse plasma. There were small but consistent differences in the natural

abundance (M4/M0) of plasma CA between the different species. There was close

agreement between the measurements of natural abundance in plasma and bile

in rats.

Table 1. Natural abundance of CA M4/M0 in rats, mice, and humans as measured by gas-liquid chromatography/electron capture negative chemical ionization-mass spectrometry, using the pentafluorobenzyl-TMS derivative

Species Matrix Natural M4/M0 Abundance % Rat Plasma 1.69 ± 0.03 Bile 1.69 ± 0.09 Mouse Plasma 2.36 ± 0.44 Human Plasma 1.76 ± 0.03 Theoretical value 1.95

Values represent mean s ± standard deviation (n = 3 or 4) per group.

Linearity of [2H4]-CA enrichment measurements

To assess the linearity of the analyses, M4/M0 area ratio values in CA calibration

standards containing 0, 0.02, 0.04, 0.06, 0.08, and 0.1 molar ratios of [2H4]-CA,

respectively, were determined. A Pearson’s correlation coeffi cient of >0.99 was

obtained. The slope (1.09) was close to 1 and the intercept (0.09) was close to 0.

The coeffi cients of variation of the M4/M0 area ratios in the calibration samples of

[2H4]-CA/[2H

0]CA ranged from 0.2% to 1.2%.

CA kinetics in humans

In applying the technique to the group of healthy human volunteers administered

a normal Western-type diet the CA pool size averaged 2.4 ± 0.7 µmol/100 g

body weight. The FTR and synthesis rate values were 0.46 ± 0.14 per day and

1.0 ± 0.2 µmol/100 g body weight per day, respectively (Table 2). Data were in

close agreement with those described earlier for human volunteers, using a stable

isotope dilution technique and applying larger plasma samples and GLC combined

with electron impact mass spectrometry (CA pool size, 2.8 ± 1.0 µmol/100 g body

weight; FTR, 0.44 ± 0.13 per day; synthesis rate, 1.2 ± 0.5 µmol/100 g body

weight per day)6.

42

Chapter 2

Comparison of kinetic data obtained in rat bile and plasma

CA isotope enrichments between 1% and 60% were obtained in bile and plasma

samples of rats collected between 3 and 96 h after administration of label. Linear

regression analysis between plasma data and bile data yielded a slope of 1.02,

an intercept of 0.6%, and an r2 value of 0.9931 (Fig.1A). Analysis by the

Bland-Altman method showed that the mean difference between enrichments

found in plasma and bile was +1.3% (range, - 1.0 to +3.6%) over the whole

range of values (Fig.1B), indicating a slight overestimation of enrichment in

plasma compared with bile. This difference was not dependent on the degree of

enrichment. This phenomena may refl ect the dilution of biliary [2H]-CA by newly

synthesized unlabeled CA molecules at the time of sampling.

Figure 1. Comparison of molar [2H4]-CA

enrichment in plasma and bile of male Wistar

rats 3–96 h after intraduodenally administration

of label. (A) Expressed as linear regression.

(B) Expressed as a Bland-Altman plot.

Table 2. Pool sizes, fractional turnover rates, and synthesis rates of CA obtained by [2H

4]-CA isotope enrichment measurements in plasma of rats, mice, and humans

Species Pool Size FTR Synthesis Rate µmol/100 g per day µmol/100 g body weight body weight per day Rat 10.6 ± 1.2 0.88 ± 0.10 9.3 ± 0.1 Mouse 16.8 ± 2.1 0.44 ± 0.03 7.3 ± 1.6 Human 2.4 ± 0.7 0.46 ± 0.14 1.0 ± 0.2

Values represent means ± standard deviation (n = 6) for all species.

43


CA decay curves measured simultaneously in plasma and bile of rats exhibited

fi rst-order kinetics (Fig.2). The average linear regression correlation coeffi cients

were 0.9973 and 0.9975 for [2H4]-CA decay in plasma and bile, respectively. Mean

values of the intercepts and slopes of the ln APE-versus-time curves determined

in plasma and bile were not different. In accordance with this observation, also

the CA pool sizes (mean difference, plasma - bile: - 1.0 µmol/100 g body weight),

FTR (- 0.01 per day), and synthesis rates (- 0.5 µmol/100 g body weight per day)

determined via plasma sampling and bile sampling, respectively, were similar.

However, the absolute values for pool size, FTR, and synthesis rates obtained in

this experiment have no physiological meaning because they are strongly affected

by the removal of bile during the experiment. Bile sampling refl ects a transient

interruption of the enterohepatic circulation and approximately 5% of the CA pool

is removed each time.

Figure 2. Decay of [2H4]-CA in plasma (open

circles, dashed trend line) and bile (closed

circles, solid trend line) after intraduodenally

administration into male Wistar rats. Values

are expressed as means ± SD (n = 3 per

time point).

CA kinetics in intact rats and the effects of cholestyramine feeding

The CA pool size, FTR, and synthesis rate determined in rats with intact

enterohepatic circulation not affected by catheterization and bile sampling are

shown in Table 2.

The CA pool size was slightly (- 21%) but signifi cantly reduced in cholestyramine-

treated rats (8.4 ± 1.9 vs. 10.6 ± 1.2 µmol/100 g body weight; p < 0.05).

As expected, the FTR and synthesis rate of CA were signifi cantly higher in rats

treated with cholestyramine: 1.89 ± 0.29 versus 0.88 ± 0.10 per day (p < 0.005)

and 15.7 ± 3.4 versus 9.3 ± 0.1 µmol/100 g body weight per day (p < 0.05),

respectively. In line with this result, an approximately 2.5-fold increase in the total

fecal bile acid excretion was observed in the cholestyramine-treated group (26.6

± 3.1 vs. 10.9 ± 2.2 µmol/100 g body weight per day; p < 0.05).

CA kinetics in mice

Also in male FVB mice kept on regular lab chow the decay of label enrichment

showed fi rst-order kinetics (Fig.3). Kinetic data obtained are shown in Table 2. CA

pool sizes and synthesis rates were similar in rats and mice, but markedly higher

in these rodents than in humans. In contrast, the FTR was markedly lower in mice

compared with rats.

44

Chapter 2

Figure 3. Decay of [2H4]-CA in plasma after

intravenous injection into male FVB mice.

Values are expressed as means ± SD (n = 3

per time point).

DISCUSSION

We have developed and evaluated a stable isotope dilution method using small

plasma samples, applicable for determination of bile acid kinetics in vivo in

humans as well as in rodents. To the best of our knowledge, this is the

fi rst report describing a stable isotope dilution technique applied in vivo in

rodents with an intact enterohepatic circulation. Application of this technique

allows for determination of CA pool size, FTR, and synthesis rate in the intact,

unanesthesized animal and circumvents the specifi c disadvantages of previously

used methods outlined in the introduction. The washout method requires biliary

drainage for estimation of bile acid synthesis and bile acid pool size. This method

is invasive, requires laparotomy, and cannot be repeated in the same animal.

Moreover, anesthesia is most often required, which infl uences intestinal motility

and therefore may reduce intestinal bile acid absorption22,28. Estimation of the pool

size via measurement of intestinal bile acid content can obviously be performed

only after killing the animal. In experiments involving the fecal balance method,

feces are collected for several days and the daily fecal bile salt excretion is

measured. Under steady state conditions, fecal bile acid excretion corresponds to

hepatic bile acid neosynthesis. In this way the method provides data for bile

acid synthesis. However, no information about bile acid pool size and FTR is

obtained. Although the procedure is principally harmless and can be repeatedly

performed, sample preparation is laborious, and requires determination of the

extraction effi ciency, while the presence of unidentifi ed fecal metabolites may

affect the outcome19,29. Also, to ensure that all feces are collected a stool marker

is necessary as well as individual housing of the animals in metabolic cages.

Measurement of cholesterol 7α-hydroxylase and sterol 27-hydroxylase expression

and/or activity requires sampling of hepatic tissue. In addition, the degree of

change in enzyme activity does not by defi nition refl ect the actual change in

bile acid synthesis30. The isotope dilution method is the accepted method to

determine bile acid pool sizes, FTR, and synthesis rates in humans. Development

of stable isotope technology and mass spectrometry enabling isotope enrichment

measurements in plasma has greatly improved the applicability of the method in

adult humans. However, the conventional electron impact MS technique applied to

45


the methyl TMS derivative lacks sensitivity to allow measurements in suffi ciently

small plasma samples to allow application in human neonates and in rodents.

From previous studies, it is known that application of electron capture negative

chemical ionization to PFB-TMS derivates of bile acids yields high sensitivity24.

Indeed, by applying this derivatization technique, the blood sample size

could be strongly reduced without loss of quality of measurement. The isotope

ratio measurements for the natural isotope abundance resulted in values near

the theoretical natural abundance value that were highly reproducible. This is

a basic prerequisite because natural abundance values are subtracted from the

enriched values obtained after administration of labeled CA. Small but consistent

differences were found between values obtained in rats, mice, and humans. The

largest difference is found in mouse plasma. Because of the larger interindividual

variation this difference is not statistically signifi cant. Because the intraindividual

variation is smaller, these differences do not affect the measurement of isotope

enrichment. The method is accurate in measuring enrichments, as could be

demonstrated by the high degree of linearity of the calibration curve and the low

coeffi cients of variation of the measurements.

The protocol for stable isotope dilution kinetic measurements in humans is

well established. We describe the fi rst experiments in rodents using the dosage

of label and time schedule as described. On the basis of this experience it can

be concluded that the time schedule of 72 h is well chosen for rodents. Also, the

dose of 210 µg of [2H4]-CA is recommendable for mice because the calculated

enrichment at time point 0 is below 10%, whereas at 72 h the enrichment is still

above 1%. It is recommended that the dose of [2H4]-CA in rats be lowered to 2.5

mg to meet the same criteria as described for the mouse.

The data obtained for CA kinetic parameters in humans fi tted well within the

range of data reported in stable isotope dilution studies applying plasma samples

or bile samples3,6. This indicates that downscaling of plasma sample sizes and

adaptation of the sample preparation procedure and mass spectrometry technique

did not affect the fi nal outcome, that is, values for pool size, FTR, and synthesis

rate.

To demonstrate that, also in rodents, isotope enrichment values measured in

plasma (<1% of the total pool) refl ect those determined in the enterohepatic pool

(>99% of the total pool), the [2H4]-CA enrichment was measured simultaneously

in bile and plasma of unanesthesized rats. The natural isotope abundance was

similar in the two matrices, that is, bile and plasma. A small but consistent

difference in enrichment was found independent of the enrichment itself. This

difference cannot be explained by inadequate isotopic equilibration, but may

be due to the steady infl ux of newly synthesized and unlabeled CA from the

hepatocyte. No signifi cant differences were found between the decay of label

enrichment in bile and plasma. Isotopic equilibrium was thus quickly achieved

after administration of [2H4]-CA. Moreover, no signifi cant differences in CA pool

size, synthesis rate, and FTR calculated from plasma and bile measurements

were found. Therefore, in analogy to studies of humans5, CA kinetics can be

determined reliably by stable isotope enrichment measurements in plasma of

rats. Interestingly, CA kinetic data obtained in rats in which bile collections were

performed were clearly different from the data in rats without bile collections. This

46

Chapter 2

may be explained by the pool depletion due to bile sampling. In retrospect, we

could have diminished this effect by collecting smaller bile samples. In humans,

Duane compared different techniques for measurement of bile acid synthesis

in hypertriglyceridemia patients and control subjects31. The techniques included

isotope dilution using radioactive isotopes for CA and chenodeoxycholic acid,

fecal bile acid excretion, and the release of 14CO2 after [26-14C]-cholesterol

administration. They found systematically higher values when the isotope dilution

technique was used, applying radioactive tracers and bile sampling. The authors

hypothesized that artifi cial, cholecystokinin-induced gallbladder contraction used

for bile collection induces bile acid synthesis. This puts further emphasis on the

strength of our isotope dilution method, which does not require bile sampling.

To determine whether manipulation of bile acid kinetics can be detected by

this method, an experiment was conducted in which cholestyramine was added

to the diet of rats. Cholestyramine is a resin known to bind bile acids in the

small intestine, increasing the turnover of the bile acid pool as well as bile acid

synthesis and cholesterol synthesis23. In line with these data, cholestyramine

feeding of rats in this study resulted in an increased CA synthesis rate and

FTR. This observation is also in accordance with the increased total fecal bile

acid output in the cholestyramine-treated rats compared with the control group

and it demonstrates that manipulations of bile acid kinetics in vivo in rats

can easily be detected via application of this stable isotope procedure. Despite

strongly increased fecal bile acid loss, CA pool size was only slightly reduced. This

demonstrates the capability of the system to upregulate CA synthesis under an

induced condition of increased fecal loss. From our data no direct comparison can

be made between CA synthesis data obtained with the isotope dilution technique

and the fecal loss data for total bile acids. Total bile acid excretion is composed

not only of CA metabolites but also of metabolites derived from α-, β-, and ω-

muricholic acids.

This study shows, to the best of our knowledge, the fi rst data on CA kinetics

in mice with an intact enterohepatic circulation. It appears that the CA pool size

in male FVB mice, when expressed relative to body weight, is somewhat larger

than that of male Wistar rats, whereas CA synthesis rates are comparable in

both species. The difference in pool size may be explained by a more effi cient

conservation of the CA pool in the mouse as FTR values in mice were almost

2-fold lower than in rats. This difference in FTR may be caused by the fact that,

in contrast to rats, mice have a gallbladder. Obviously, it should be realized that

there may be considerable strain differences in bile acid metabolism between

different strains of mice17,32, which must be taken into account when comparing

data from different studies.

In general, a direct comparison with literature data on bile acid kinetics

in rodents is hampered by the large variation in reported values15-19,33-39. For

example, previous estimates of the total bile acid pool size vary over a range

of 12–60 µmol/100 g body weight in rats and 13–89 µmol/100 g body weight

in mice. Strain, sex, and size differences between the animals, different dietary

regimens, as well as the applied method may all account for the observed

quantitative differences in total bile acid pool size. When taking into account

that CA comprises 50–80% of the total bile acid pool in rodents, and assuming

47


identical kinetics for all bile acids, our measurements lead to mean estimates

of total bile acid pool sizes of about 15 µmol/100 g body weight in male Wistar

rats and 25 µmol/100 g body weight in FVB mice. These values are in the lower

range of data reported in the literature. Data on CA synthesis rates specifi cally are

scarce for rodents because most studies report data on total bile acid synthesis

rates.

Comparison of CA kinetics in rodents and humans obtained by the same

methodology now reveals for the fi rst time that rodents have a much larger CA

pool size (about three to seven times) than human adults when expressed relative

to body weight. Second, the FTR of CA is similar in mice and humans (0.4– 0.5

per day), implying that the pool of CA is renewed by synthesis in about 48 h. CA

synthesis in rodents is seven to nine times higher than in humans. Rodents also

have a higher rate of cholesterol synthesis than humans when data are related

to body size40. Although the physiological consequences thereof are beyond the

scope of this article, a higher bile acid synthesis may contribute to the relative

resistance of rodents against diet-induced hypercholesterolemia.

In conclusion, the development and validation of a microscale stable isotope

dilution technique for measurement of CA kinetics have been presented. It allows

for use of small plasma volumes and reliable determination of CA kinetics in

plasma of humans and small experimental animals with an intact enterohepatic

circulation. The method can be used repeatedly in the same animal. In particular,

the development of genetically modifi ed mouse models with altered cholesterol

and bile acid metabolism has generated a wealth of applications for this technique.

In addition, this microscale method provides reliable data in adult humans and

may well be applicable in human neonates and small children permitting study of

the early development of human bile acid metabolism.

FOOTNOTES

Henkjan J. Verkade is a fellow of the Royal Dutch Academy of Sciences (KNAW).

Robert H. Bandsma is supported by the Netherlands Organization for Scientifi c

Research (NWO), grant 920-03-123.

48

Chapter 2

REFERENCES

1. Hofmann AF. Bile acids: the good, the bad, and the ugly. News Physiol Sci

1999;14:24-9.2. Vlahcevic ZR, Pandak WM, Stravitz RT. Regulation of bile acid biosynthesis. Gastroenterol

Clin North Am 1999;28:1-25.3. Lindstedt S, Norman A. The turnover of cholic acid in man Acta Physiol Scand 40: 1-9.4. Watkins JB, Ingall D, Szczepanik PA, Klein PD, Lester R. 1973. Bile salt metabolism

in the newborn. Measurement of pool size by stable isotope technique. N Engl J Med 1957;288:431-4.

5. Stellaard F, Sackmann M, Sauerbruch T, and Paumgartner G. Simultaneous determination of cholic and chenodeoxycholic acid pool sizes and fractional turnover rates in human serum using 13C-labeled bile acids. J Lipid Res 1984;25:1313-9.

6. Stellaard F, Sackmann M, Berr F, Paumgartner G. Simultaneous determination of pool sizes and fractional turnoverrates of deoxycholic acid, cholic acid, and chenodeoxycholic acid in man by stable isotope dilution with 2H and 13C labels and serum sampling. Biomed Env Mass Spectr 1987;14:609-11.

7. Koopman BJ, Kuipers F, Bijleveld CMA, van der Molen JC, Nagel GT, Vonk RJ, Wolthers BG. Determination of cholic and chenodeoxycholic acid pool sizes and fractional turnover rates by means of stable isotope dilution technique, making use of tetradeuterated cholic acid and chenodeoxycholic acid. Clin Chim Acta 1988;175: 143-56.

8. Watkins JB, Szczepanik PA, Gould JB, Klein PD, Lester R. Bile salt metabolism in the human premature infant. Preliminary observations of pool size and synthesis rate following prenatal administration of dexamethason and Phenobarbital Gastroenterology 1975;69:706-13.

9. Watkins JB, Järvenpää AL, Szczepanik-van Leeuwen P, Klein PD, Rassin DK, Gaull G, Raiha NC. Feeding the low-birth weight infant. V. Effects of taurine, cholesterol, and human milk on bile acid kinetics. Gastroenterology 1983;85:793-800.

10. Kern F, Jr. Everson GT, DeMark B, McKinley C, Showalter R, Erfl ing W, Braverman DZ, Szczepanik-van Leeuwen P, Klein PD 1981. Biliary lipids, bile acids, and gall bladder function in the human female: effects of pregnancy and the ovulatory cycle. J. Clin. Invest. 68:1229-1242

11. Kern F, Jr. Everson GT, DeMark B, McKinley C, Showalter R, Braverman DZ, Szczepanik-Van Leeuwen P, Klein PD 1982. Biliary lipids, bile acids, and gallbladder function in the human female: effects of contraceptive steroids. J. Lab. Clin. Med. 99:798-805

12. Pauletzki J, Stellaard F, Paumgartner G. Bile acid metabolism in human hyperthyroidism. Hepatology 1989;9:852-5.

13. Berr F, Stellaard F, Pratchke E, Paumgartner G. Effects of cholecystectomy on the kinetics of primary and secondary bile acids. J Clin Invest 1989;83:1541-50.

14. Berr F, Pratschke E, Fischer S, Paumgartner G. Disorders of the bile acid metabolism in cholesterol gallstone disease. J Clin Invest 1992;90:859-68.

15. Fisher MM, Kakis G, Yousef IM. Bile acid pool in Wistar rats. Lipids 1975;11:93-6.16. Norman A, Sjövall J. On the transformation and enterohepatic circulation of cholic acid

in the rat: bile acids and steroids 68. J Biol Chem 1958;233:872-85. 17. Schwarz M, Russell DW, Dietschy JM, Turley SD. Marked reduction in bile acid synthesis

in cholesterol 7α-hydroxylase defi cient mice does not lead to diminished tissue cholesterol turnover or to hypercholesterolaemia. J Lipid Res 1998;39:1833-43.

18. Oude Elferink RPJ, Ottenhof R, van Wijland M, Smit JJM, Schinkel AH, Groen AK. Regulation of biliary lipid secretion by mdr2 P-glycoprotein in the mouse. J Clin Invest 1995;95:31-8.

19. Kinugasa T, Uchida K, Kadowaki M, Takase H, Nomura Y, Saito Y. Effect of bile duct ligation on bile acid metabolism in rats. J Lipid Res 1981:22:201-7.

20. Russell DW, Setchell KDR. Bile acid biosynthesis. Biochemistry 1992;31:4737-49. 21. Chiang JYL. Reversed-phase high-performance liquid chromatography assay of

cholesterol 7α-hydroxylase. Methods Enzymol 1991;206:483-9122. Kuipers F, Havinga R, Bosschieter H, Toorop GP, Hindriks FR, Vonk RJ. Enterohepatic

circulation in the rat. Gastroenterology 1985;88:403-11.23. Gustafsson BE, Angelin B, Einarsson K, Gustafsson JA. Infl uence of cholestyramine on

49


synthesis of cholesterol and bile acids in germfree rats. J Lipid Res 1978;19:972-7. 24. Stellaard F, Langelaar SA, Kok RM, Jakobs C. Determination of plasma bile acids

by capillary gas-liquid chromatography-electron capture negative chemical ionization mass fragmentography. J Lipid Res 1989;30:1647-52.

25. Murphy GM, Billing BH, Baron DN. A fl uorimetric and enzymatic method for the estimation of serum total bile acids. J Clin Pathol 1970;23:594-8.

26. Campbell IM. Incorporation and dilution values: their calculation in mass spectrally assayed stable isotopes labeling experiments. Bioorg Chem 1974;3:386-97.

27. Bland JM, Altman DG. Measurement in medicine: the analysis of method comparison studies. Statistican 1983;32:302-17.

28. Gustafsson BE, Norman A. Bile acid absorption from the caecal contents of germfree rats. Scand J Gastroent 1969;4:585-90.

29. Setchell KD, Lawson AM, Tanida N, Sjövall J. General methods for the analysis of metabolic profi les of bile acids and related compounds in feces. J Lipid Res 1983;24: 1085-1099.

30. Smit MJ, Temmerman AM, Havinga R, Kuipers F, Vonk RJ. Short-and long-term effects of biliary drainage on hepatic cholesterol metabolism in the rat. Biochem J 1990;269: 781-8.

31. Duane WC. Measurement of bile acid synthesis by three different methods in hypertriglyceridemic and control subjects. J Lipid Res 1997;38:183-188.

32. Fuchs M, Lammert F, Wang DO, Paigen B, Carey MC, Cohen DE. Sterol carrier protein 2 participates in hypersecretion of biliary cholesterol during gallstone formation in genetically gallstone-susceptible mice. Biochem J 1998;336:33-7.

33. Turley SD, Schwarz M, Spady DK, Dietschy JM. Gender-related differences in bile acid and sterol metabolism in outbred CD-1 mice fed low- and high-cholesterol diets. Hepatology 1998;28:1088-94.

34. Uchida K, Nomura Y, Kadowaki M, Takase H, Takano K, Takeuchi N. Age-related changes in cholesterol and bile acid metabolism in rats. J Lipid Res 1978;19:544-52.

35. Uchida K, Okuno I, Takase H, Nomura Y, Kadowaki M, Takeuchi N. Distribution of bile acids in rats. Lipids 1978;13:42-8.

36. Kuipers F, van Ree JM, Hofker MH, Wolters H, in ‘t Veld GI, Havinga R, Vonk RJ, Princen HMG, Havekes LM. Altered lipid metabolism in apolipoprotein E-defi cient mice does not affect cholesterol balance across the liver. Hepatology 1996;24:241-7.

37. Eyssens HJ, Parmentier GG, Mertens JA. Sulfated bile acids in germ-free and conventional mice. Eur J Biochem 1976;66:507-14.

38. Uchida K, Mizuno H, Hirota K, Takeda K, Takeuchi N, Ishikawa Y. Effects of spinasterol and sitosterol on plasma and liver cholesterol levels and biliary and fecal sterol and bile acid excretions in mice. Japan J Pharmacol 1983;33:103-12.

39. Uchida K, Makino S, Akiyoshi T. Altered bile acid metabolism in nonobese, spontaneously diabetic (NOD) mice. Diabetes 1985;34:79-83.

40. Dietschy JM. Regulation of cholesterol metabolism in man and other species. Klin Wochenschr 1984;62:338-45.

Chapter 2

Measurement of parameters of cholic acid kinetics in plasma using a microscale stable

isotope dilution technique: application to rodents and humans

Christian V. Hulzebos1, Lorraine Renfurm1, Robert H. Bandsma1,Henkjan J. Verkade1, Theo Boer1, Renze Boverhof1, Hiroshi Tanaka2, Igor Mierau2, Pieter J.J. Sauer1,

Folkert Kuipers1, and Frans Stellaard1

1 Groningen University Institute for Drug Exploration, Center for Liver, Digestive, and Metabolic Diseases, Laboratory of Pediatrics, University Hospital Groningen,

Groningen, The Netherlands. 2 Snow Brand European Research Laboratory, Groningen, The Netherlands.

THE JOURNAL OF LIPID RESEARCH 2001;42:1923-9

© 2003 by Lipid Research, Inc.

Chapter 3

Cyclosporin A and enterohepatic circulation of bile salts in rats: decreased cholate synthesis

but increased intestinal reabsorption

Christian V. Hulzebos1, Henk Wolters1, Torsten Plösch1, Werner Kramer2, Siegfried Stengelin2, Frans Stellaard1,

Pieter J.J. Sauer1, Henkjan J. Verkade1 and Folkert Kuipers1

1 Groningen University Institute for Drug Exploration, Center for Liver, Digestive,

and Metabolic Diseases, Laboratory of Pediatrics, University Hospital Groningen,

Groningen, The Netherlands. 2 Aventis Pharma Deutschland GmbH, Frankfurt am Main, Germany.

THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS

2003;304:356-363

© 2003 by the American Society for Pharmacology and Experimental

Therapeutics

52

Chapter 3

ABSTRACT

Background/Aims: Cyclosporin A (CsA) has been shown to inhibit synthesis and

hepatobiliary transport of bile salts. However, effects of CsA on the enterohepatic

circulation of bile salts in vivo are largely unknown. We characterized the effects

of CsA on the enterohepatic circulation of cholate, with respect to synthesis

rate, pool size, cycling time, intestinal absorption, and the expression of relevant

transporters in liver and intestine in rats.

Methods: CsA (1 mg·100 g-1·day-1 s.c.) or its solvent was administered daily to

male rats for 10 days. Cholate synthesis rate and pool size were determined by a

[2H4]-cholate dilution technique. Bile and feces were collected for determination of

cholate and total bile salts, respectively. Cycling time and intestinal absorption of

cholate were calculated. The mRNA levels and corresponding transporter protein

levels in liver and intestine were assessed by real-time polymerase chain reaction

and Western analysis, respectively.

Results: CsA treatment decreased cholate synthesis rate by 71%, but did not

affect pool size or cycling time. CsA reduced the amount of cholate lost per

enterohepatic cycle by ~70%. Protein levels of the apical sodium-dependent bile

salt transporter (Asbt) were 2-fold increased in distal ileum of CsA-treated rats,

due to post-transcriptional events.

Conclusions: Chronic CsA treatment markedly reduces cholate synthesis rate in

rats, but does not affect cholate pool size or cycling time. Our results strongly

suggest that CsA enhances effi cacy of intestinal cholate reabsorption through

increased Asbt protein expression in the distal ileum, which contributes to

maintenance of cholate pool in CsA-treated rats.

53

Cyclosporin A and enterohepatic circulation of bile salts

INTRODUCTION

Bile formation is mainly driven by active hepatobiliary secretion of bile salts

mediated by the canalicular bile salt export pump (Bsep or Abcb11 according to

new nomenclature), a member of the P-glycoprotein subfamily of ATP-binding

cassette transporters1. After secretion into the bile, the majority of bile salts

is maintained within the enterohepatic circulation, implying reabsorption from

the intestine and reuptake by the liver. Intestinal absorption of bile salts is, to

a large extent, mediated by the apical sodium-dependent bile salt transporter

(Asbt) localized in the terminal ileum2. After their intestinal uptake and subsequent

appearance in the portal circulation, bile salts are effi ciently taken up by

hepatocytes, mainly via the Na+-taurocholate cotransporting polypeptide (Ntcp)

and organic anion transporting polypeptide (Oatp)2. Under steady-state conditions,

only a relatively small fraction of bile salts escapes intestinal absorption and is

lost into the feces, which is compensated for by de novo bile salt biosynthesis in

the liver3. Thus, the size of bile salt pool is regulated by effi ciency of intestinal

absorption and hepatic biosynthesis.

Cyclosporin A (CsA), a drug that has successfully been applied for

immunosuppression after solid organ transplantation, is associated with a number

of side effects, including nephrotoxicity, hyperlipidemia, and hepatotoxicity4.

Cholestasis and cholelithiasis, i.e., disturbances of bile formation, have repeatedly

been reported in patients on CsA therapy5. CsA has been shown to interact with

various steps of bile salt metabolism. CsA acutely inhibits bile salt synthesis in

cultured rat and human hepatocytes6. Reductions of bile salt synthesis and bile

fl ow have been reported in rats treated with CsA7-9. CsA also interferes with

hepatocytic bile salt transport. The drug competitively inhibits sodium-dependent

uptake of radiolabeled taurocholate by rat hepatocytes10 and by liver plasma

membrane vesicles11. In canalicular liver plasma membrane vesicles, CsA impairs

ATP-dependent transport of taurocholate12. Hepatobiliary secretion of intravenously

administered radiolabeled taurocholate was inhibited in bile fi stula rats that were

acutely or chronically treated with CsA13. Finally, CsA may also directly affect

bile salt handling by the intestine: ileal perfusion with CsA was shown to impair

intestinal bile salt absorption in rats14.

Thus, the effects of CsA on separate processes involved in the enterohepatic

cycling of bile salts have been studied rather extensively, predominantly in in vitro

systems and in vivo after surgical interruption of the enterohepatic circulation

in animals. However, no integrated in vivo data are available on the effects of

chronic CsA treatment. To obtain an integrated view of the effects of CsA on the

enterohepatic circulation of bile salts, we studied parameters of the enterohepatic

circulation of cholate, a quantitatively major bile salt species in the rat, in relation

to the expression of transport proteins involved in the enterohepatic circulation

(i.e., Ntcp, Oatp1, Bsep, and Asbt). Gene expression of ileal bile salt binding

protein (Ilbp), a cytosolic protein implicated in control of intestinal bile salt

reabsorption, and expression of the nuclear bile salt receptor FXR, known to be

involved in control of Ilbp expression, as well as gene expression of the truncated

form of Asbt (tAsbt), a candidate protein for basolateral bile salt transport, were

also assessed2. A recently developed stable isotope dilution method was used for

54

Chapter 3

quantifi cation of cholate kinetics in unanesthesized rats15.

The results demonstrate that CsA inhibits the synthesis of cholate, but does

not affect its pool size. Maintenance of the cholate pool size is associated with

more effi cient absorption of cholate from the intestinal lumen and with increased

Asbt protein expression in the distal ileum of CsA-treated rats.

MATERIAL AND METHODS

Animals

Male Wistar rats (mean body weight ± S.D., 339 ± 29 g; Harlan Laboratories, Zeist,

The Netherlands) were kept in a light- and temperature-controlled environment.

They were fed standard rodent diet (RMH-B; Hope Farms BV, Woerden, The

Netherlands) and tap water ad libitum. Experimental protocols were approved by

the local Ethical Committee for Animal Experiments.

Materials

[2,2,4,4-2H4]-Cholate ([2H

4]-cholate, isotopic purity 98%) was obtained from

Isotech Inc. (Miamisburg, OH). Cholylglycine hydrolase from Clostridium

perfringens (welchii) was purchased from Sigma-Aldrich (St. Louis, MO).

Pentafl uorobenzylbromide was purchased from Fluka Chemie (Buchs, Neu-Ulm,

Switzerland). All other chemicals and solvents used were of the highest purity

commercially available.

Experimental Procedures

Rats were equipped with a permanent heart catheter under halothane anesthesia

as described previously16. After recovery for 1 week, rats were injected

daily subcutaneously with CsA (dose 1 mg·100g-1·day-1) or with its vehiculum

[Cremophor EL, 650 mg/ml and ethanol 33% (v/v)] for 10 days. At day 7,

[2H4]-cholate (dose 5 mg/rat) was intravenously administered to CsA-treated and

control rats. Subsequently, blood samples (0.25 mL) were obtained between days

7 and 10 at 1, 3, 6, 9, 12, 21, 28, and 48 h after administration of [2H4]-cholate.

Plasma was obtained by centrifugation at 4000 rpm for 10 min and stored at

20°C until analysis. At day 10, animals were anesthesized by intraperitoneal

injection of sodium pentobarbital and, after collection of a single 15-min bile

sample via a bile fi stula, the liver and small intestine of the animals were quickly

removed. The 30-cm distal end of the small intestine was rinsed with 10 ml of 1

mM NaHCO3 buffer (pH 7.4) containing phenylmethylsulfonylfl uoride to prevent

protein degradation and divided into proximal, mid-, and distal segments of 10

cm. After collection, tissue samples were immediately frozen in liquid nitrogen and

stored at 80°C for membrane preparation and RNA isolation.

Analytical Procedures

Plasma alanine transaminase, aspartate transaminase, alkaline phosphatase,

bilirubin, cholesterol, and triglycerides were determined by routine laboratory

techniques. Total bile salts in plasma, bile, and feces were determined by an

enzymatic fl uorometric assay using 3α-hydroxysteroid dehydrogenase17. Whole

blood concentrations of CsA were determined by use of an enzymatic multiplied

55


immunoassay technique18.

Gas-Liquid Chromatography Electron Capture Negative Chemical

Ionization Mass Spectrometry

Plasma samples were prepared for bile salt analysis by gas chromatography-

mass spectrometry15. All analyses were performed on an SSQ7000 quadrupole

gas chromatography-mass spectrometry instrument (Thermo Finnigan, San Jose,

CA). GC separation was performed on a 30 m × 0.25 mm column, 0.25-µm fi lm

thickness (DB-5MS; J&W Scientifi c, Folsom, CA).

Gas Chromatography

Bile salt composition of bile and feces samples were determined by capillary gas

chromatography on a Hewlett Packard gas chromatograph (HP 5880A), equipped

with a 50 m × 0.32 mm CP-Sil-19 fused silica column (Chrompack BV, Middelburg,

The Netherlands). For this purpose, bile salts were converted to methylester-

trimethylsilyl derivatives. Quantifi cation of bile salts was performed by adding

coprostanol as internal standard.

Preparation of Hepatic and Intestinal Membranes for Protein Analysis

Isolation of hepatic plasma membranes was performed as described previously19.

Intestinal brush-border membranes were isolated as described by Schmitz

et al.20. Total protein concentration of membrane fractions was determined

using the method described by Lowry et al.21. To determine the degree of

purifi cation of the isolated membrane fractions, activities of marker enzymes in the

membrane fractions were divided by activities in the corresponding homogenates.

Na+/K+-ATPase and Mg2+-ATPase were used for the basolateral and canalicular

fractions of liver plasma membranes, respectively22. For the intestinal brush-

border membranes alkaline phosphatase was used as a marker enzyme23.

The amounts of protein of liver plasma membrane fractions and intestinal brush-

border fractions used for gel electrophoresis were standardized to achieve similar

relative enrichments of the respective marker enzymes. Separation of proteins

was performed on 4 to 15% gradient gels (Bio-Rad, Hercules, CA) and proteins

were transferred to ECL-Hybond nitrocellulose (Amersham Biosciences UK, Ltd.,

Little Chalfont, Buckinghamshire, UK) by Western blotting. Liver samples were

probed with anti-Ntcp-immunoglobulin(Ig)G K4, anti-Oatp1-immunoglobulin IgG

K10 [gift from Prof. Dr. P. J. Meier-Abt and Dr. B. Stieger (Division of Clinical

Pharmacology and Toxicology, Department of Medicine, University, Hospital,

Zürich, Switzerland)]24, anti-Bsep IgG1, or anti-Mrp2 IgG (both kindly provided by

Prof. Dr. M. Müller, University of Wageningen, Wageningen, The Netherlands)25,

respectively. Asbt protein content of brush-border membranes was determined

using polyclonal anti-rat Asbt antibody26. Detection of immune complexes in

liver and intestinal membranes was performed using anti-rabbit or anti-guinea

pig antibody, respectively, linked to horseradish peroxidase (Sigma-Aldrich)

as secondary antibody and enhanced chemiluminescence as provided by the

manufacturers (Amersham Biosciences UK, Ltd.). Intensities of the protein bands

were measured by densitometry and relative amounts compared with controls

were determined.

56

Chapter 3

RNA Isolation and PCR Procedures

Total RNA from the three intestinal sections per animal was isolated and reverse

transcribed as described previously27. Real-time quantitative PCR was performed

using a 7700 sequence detector according to the manufacturer’s instructions

(Applied Biosystems, Foster City, CA). Primers were obtained from Invitrogen

(Carlsbad, CA). Fluorogenic probes, labeled with 6-carboxy-fl uorescein and

6-carboxy-tetramethyl-rhodamine, were made by Eurogentec (Seraing, Belgium).

Primers and probes were as follows: β-actin (NM_031144, sense

AGCCATGTACGTAGCCATCCA, antisense TCTCCGGAGTCCATCACAATG, and probe

TGTCCCTGTATGCCTCTGGTCGTACCAC); FXR (U18374, sense CGCTGAGATGCTG-

ATGTCTTG, antisense CCTTCACTGCACATCCCAGAT, and probe TGACCACAAGTT-

CACCCCGCTCCT); Ilbp (NM_008375, sense CCCCAACTATCACCAGACTTCG,

antisense ACATCCCCGATGGTGGAGAT, and probe TCCACCAACTTGTCACCCA-

CGACCT); Asbt (U07183, sense ACCACTTGCTCCACACTGCTT, antisense

CGTTCCTGAGTCAACCCACAT, and probe CTTGGAATGATGCCCCTTTGCCTCT); and

truncated Asbt (U07183, sense AGGCTGTGGTGGTGCTAATTATG, antisense

CAGAGAAATGCCTGAGGTCCAT, and probe CTGCCCTGGAGGAACTGGCTCCA). Asbt

primers are situated in exon 2, which is skipped in tAsbt; the antisense tAsbt

primer consists of two halves, one in exon 1, the other in exon 3. Therefore,

this PCR setup can differentiate between the functionally different Asbt and

tAsbt. All expression data were subsequently standardized for β-actin, which was

analyzed in separate runs. Glutathione analysis in bile was performed as described

previously28.

Calculations

Isotope Dilution Technique.

The isotope dilution technique was performed as described by Hulzebos et al.15.

Enrichment was defi ned as the increase of (M4-CA)/M

0-CA relative to baseline

measurements after administration of [2H4]-CA and expressed as the natural

logarithm of atom percent excess (ln APE) value29. The decay of ln APE in time

was calculated by linear regression analysis. From this linear decay curve the

fractional turnover rate (FTR) and pool size of CA were calculated. The FTR (per

day) equals the slope of the regression line. The pool size (micromoles per 100

grams) is determined according to the formula (D · b · 100)/ea) - D, where D is

the administered amount of label, b is the isotopic purity, and a is the intercept on

the y-axis of the ln APE versus time curve. Cholate synthesis rate (micromoles per

100 grams per day) was determined by multiplying pool size and FTR.

Cycling Time.

The cholate cycling time, i.e., the time it takes the cholate pool to circulate

one time in the enterohepatic circulation, was calculated by dividing the cholate

pool size (micromoles per 100 grams) by the biliary secretion rate of cholate

(micromoles per hour per 100 grams). The cholate biliary secretion rate was

calculated by multiplying the bile fl ow (microliters per hour per 100 grams)

with the cholate concentration (millimolar) in a single 15-min fraction, obtained

immediately after cannulation of the common bile duct. The fraction of cholate lost

57


per enterohepatic cycle was subsequently calculated by dividing fractional cholate

synthesis rate by cholate cycling frequency and was expressed as percentage of

total cholate pool size (%CA pool size), assuming steady-state conditions in which

synthesis rate equals fecal loss.

Statistical Analysis.

All results are presented as means ± standard deviation. Differences between

CsA-treated and control rats were evaluated by Rank test or Mann-Whitney exact

two-tailed U test. Level of signifi cance for all statistical analyses was set at

p < 0.05. Analysis was performed using SPSS 8.5 for Windows software (SPSS,

Chicago, IL).

RESULTS

Animal Characteristics and Effects of Chronic CsA Treatment on

Parameters of Liver Function.

Body weights of CsA-treated animals were decreased compared with those of

controls (Table 1), mainly due to weight loss during the fi rst 5 days after

onset of CsA treatment. The liver weight/body weight ratio was unaffected

by CsA treatment. CsA treatment was associated with elevated plasma bile

salt and bilirubin concentrations, whereas alanine transaminase activity was

slightly decreased (Table 1). There were no differences in alkaline phoshatase

and aspartate transaminase activities nor in plasma cholesterol and triglyceride

concentrations between CsA-treated and control rats. The CsA levels after 10

days of treatment were 3.9 ± 1.2 mg/l. CsA treatment was associated with a

31% reduction of bile fl ow rate after acute interruption of the enterohepatic

circulation (Table 2). Total biliary bile salt secretion rate as well as the biliary

cholate secretion, as measured during the fi rst 15 min after initiation of bile

TABLE 1. Animal characteristics and plasma parameters of liver function

Control CsA

Body weight (g) 364 ± 9 313 ± 11***

Liver weight (g) 12.8 ± 0.4 11.4 ± 1.2

Liver/body weight ratio 0.035 ± 0.001 0.036 ± 0.003

Bile salts (µmol/l) 44.2 ± 16.6 180.6 ± 32.3***

Total bilirubin (µmol/l) 8.2 ± 0.8 12.0 ± 1.2*

Alanine transaminase (units/l) 41.6 ± 2.3 28.8 ± 6.6*

Aspartate transaminase (units/l) 98.6 ± 25.1 69.8 ± 15.6

Alkaline phosphatase (units/l) 127.2 ± 17.2 121.4 ± 31.1

Cholesterol (mmol/l) 1.4 ± 0.2 1.5 ± 0.2

Triglycerides (mmol/l) 1.0 ± 0.6 0.9 ± 0.3

Cyclosporin (mg/l) <0.025 3.9 ± 1.2*** CsA vehiculum (Cremophor EL, controls) or CsA alone were given for 1 week. CsA (s.c.) was administered at doses of 1 mg · 100g-1 · day-1. Data are expressed as means ± S.D. of control and CsA-treated rats. *** p < 0.001; * p < 0.05; n = 5 rats/group.

58

Chapter 3

Figure 1. Decay of intravenously admini-

stered [2H4]-cholate (5 mg/rat) in control

(open circles) and CsA-treated (closed

circles) rats. Data are means ± standard

deviation of n = 4 rats/group.

Figure 2. Effects of CsA treatment on FTR (A), pool size (B), synthesis rate (C), and

calculated fecal loss of cholate (D) in control (open squares) and CsA-treated (closed

squares) rats. Data are means ± SD of n = 4 rats/group. CsA-treated rats signifi cantly

different from controls, *, p < 0.05; ***, p < 0.001.

TABLE 2. Effects of chronic CsA treatment on bile formation Control CsA

Bile fl ow (µl · 100 g-1 · min-1) 5.5 ± 0.5 3.8 ± 0.6*

Bile salt secretion rate (nmol · 100 g-1 · min-1) 270 ± 54 264 ± 35

Cholate secretion rate (nmol · 100 g-1 · min-1) 177 ± 28 165 ± 15

Glutathione secretion rate (nmol · 100 g-1 · min-1) 22.7 ± 4.8 11.2 ± 5.9* CsA vehiculum (Cremophor EL, controls) or CsA alone were given for 1 week. CsA (s.c.) was administered at doses of 1 mg · 100 g-1 · day-1. Data are expressed as means ± SD of control and CsA-treated rats. * p < 0.05; n = 5 rats/group.

59


collection were not signifi cantly altered in the CsA-treated animals. In contrast,

glutathione secretion into bile was signifi cantly lower in the CsA-treated rats.

Effects of Chronic CsA Treatment on Kinetic Parameters of Cholate

Metabolism.

Analysis of plasma cholate enrichments over time indicated that deuterated

cholate disappeared from plasma at a slower rate in the CsA-treated rats than

in controls (Fig. 1). The fractional turnover rate of cholate (Fig. 2A), calculated

from the absolute value of the slope of the linear regression curve (Fig.1), was

reduced by 65% in CsA-treated rats compared with controls (0.25 ± 0.07 versus

0.72 ± 0.14 pools · day-1, respectively; p < 0.001). The cholate pool size (Fig.2B),

calculated from the y-intercept of the linear regression line (Fig.1), was similar in

both groups (12.7 ± 2.2 versus 15.2 ± 2.3 µmol·100 g-1, CsA-treated rats versus

controls; N.S.). Total biliary bile salt concentration was not similar in both groups

(70.7 ± 7.8 versus 49.4 ± 7.3 mM, CsA-treated rats versus controls; p < 0.05).

Quantitatively, the cholate fraction accounted for more than 60% of the biliary bile

salts (63.3 ± 7.8 versus 66.1 ± 3.5%, CsA-treated rats versus controls; N.S.).

Under the assumption that the different bile salt species displayed a similar cycling

frequency, the calculated total pool sizes of non-cholate bile salts were 7.9 ± 4.4

µmol · 100 g-1 after CsA treatment and 7.8 ± 1.2 µmol·100 g-1 in control rats

(N.S.).

CsA decreased the cholate synthesis rate (Fig.2C) by 71% compared with controls

(3.2 ± 1.1 versus 10.8 ± 1.6 µmol·100 g-1·day-1, CsA-treated rats versus controls;

p < 0.001). In accordance with the reduced cholate synthesis rate determined

by stable isotope dilution in a steady-state condition, CsA decreased fecal loss of

bile salts by ~30% (4.2 ± 1.4 versus 6.1 ± 0.5 µmol·100·g-1 · day-1, CsA-treated

versus control rats; p < 0.05).

The cholate cycling time was not affected by CsA treatment (1.3 ± 0.3 versus 1.5

± 0.3 h, CsA-treated versus control rats; N.S.). Consequently, CsA reduced the

calculated percentage of cholate lost per enterohepatic cycle (Fig.2D) by ~70%

(1.4 ± 0.5 versus 4.3 ± 0.5% CA pool size, CsA-treated versus control rats;

p < 0.001).

Effects of Chronic CsA Treatment on Hepatic Transporters (Ntcp, Oatp1,

Bsep, and Mrp2).

CsA treatment did not signifi cantly affect protein levels of Ntcp, Oatp1, Bsep, and

of Mrp2 in isolated hepatic plasma membrane fractions, although the latter, on

average, was slightly reduced (Fig.3).

Intestinal mRNA Expression Patterns of Bile Salt Transporters.

CsA treatment did not affect mRNA expression levels of genes encoding transport

proteins putatively involved in bile salt uptake (Asbt), basolateral effl ux (tAsbt),

and intracellular traffi cking (Ilbp) (Fig.4). The mRNA levels of genes encoding

these proteins, which were measured in different sections derived from the 30-cm

distal end of small intestine, were almost absent in the proximal segment, and

showed a steep increase toward the distal ileum. A similar expression pattern was

observed for the nuclear bile salt receptor FXR.

60

Chapter 3

Figure 4. Intestinal mRNA expression

patterns of bile salt transporters and a

nuclear bile salt receptor (FXR) in the

small intestine of control (open circles)

and CsA-treated (closed circles) rats.

Analysis was done as described under

Materials and Methods. All expression data

were standardized for β-actin. Results are

shown for three sequential sections of the

30-cm distal end of the small intestine,

i.e., proximal , mid , and distal ileum. CsA

treatment did not affect gene expression

levels of transport proteins involved in

bile salt uptake (Asbt), basolateral effl ux

(tAsbt), intracellular traffi cking (Ilbp), or

the level of FXR. Data are means ±

standard deviation of n = 5 rats/group.

Asbt Protein Levels in Distal Segments of Small Intestine.

Immunoblotting experiments with brush-border membrane fractions from different

intestinal sections derived from the terminal 30 cm of the ileum of from CsA-

treated and control rats demonstrated that expression of Asbt protein was mainly

confi ned to the most distal segments in control rats and shifted toward more

proximal segments after CsA treatment (Fig.5, top). Asbt protein content was

approximately 2-fold increased in CsA-treated rats compared with controls in the

most distal part of the small intestine (Fig.5, bottom).

Figure 3. Protein levels of Ntcp, Oatp1,

Bsep, and Mrp2 in hepatic plasma

membrane fractions isolated from CsA-

treated and control rats; n = 5/group.

Analysis was done as described under

Materials and Methods. The relative

amounts of Ntcp, Oatp1, Bsep, and Mrp2

were not signifi cantly affected by CsA

treatment compared with controls (100%)

(Ntcp, 210 ± 90%; Oatp1, 90 ± 40%;

Bsep, 150 ± 30%; and Mrp2, 70 ±

30%).

61


Figure 5. Asbt protein levels in the 30-cm distal end of the small intestine, i.e., proximal

(1), mid (2), and distal (3) ileum, of control and CsA-treated rats by Western blot analysis

(top). Analysis was done as described under Materials and Methods. The amounts of protein

loaded onto the gel were standardized to similar activities of alkaline phosphatase. Results

are shown for three sequential different distal brush-border membrane fractions per animal,

and for two animals per group that are representative for n = 4/group. Quantifi cation of

Asbt protein expression in distal (3) ileum after CsA treatment (bottom). Immunoreactive

bands, detected by Western blot analysis (top) were evaluated with densitometry. Asbt

levels were expressed as percentage of the control group. Data are means ± standard

deviation of n = 4 rats/group, expressed as percentage of the control group. CsA-treated

rats signifi cantly different from controls, *, p < 0.05.

Figure 6. Effects of CsA on the enterohepatic circulation of CA. CA synthesis rate is

markedly decreased after CsA treatment, whereas biliary CA secretion rate and CA cycling

time are unaffected. CsA reduced the calculated percentage of CA lost per enterohepatic

cycle in association with an increased intestinal Asbt protein (closed circles).

62

Chapter 3

DISCUSSION

This present study is the fi rst to describe the effects of CsA on the enterohepatic

circulation of bile salts in unanesthesized rats in vivo. In accordance with available

in vitro data, it was confi rmed that CsA profoundly inhibits the synthesis of

the primary bile salt cholate in vivo. Yet, the size of cholate pool undergoing

enterohepatic circulation is not reduced, but rather maintained through more

effi cient absorption of cholate from the intestine: both the calculated percentage

of cholate lost per enterohepatic cycle and the amount of bile salts lost in the

feces were markedly lower in CsA-treated rats than in controls. We speculate

that induction of Asbt expression in the distal ileum contributes to more effi cient

absorption of cholate from the intestinal lumen and is responsible for the

maintenance of the cholate pool size during CsA treatment (summarized in Fig.6).

CsA is known to interfere with hepatobiliary bile salt transport6-11;13.

Accordingly, CsA-treated rats showed elevated plasma bile salt levels. However, CsA

treatment does not infl uence biliary bile salt secretion rate, which demonstrates

that interference of CsA with hepatic transporters does not affect net hepatobiliary

transport rates in steady-state conditions, albeit at increased serum bile salt

concentrations. Elevated plasma bile salts in CsA-treated rats may result from

interference of CsA with hepatic uptake, transcellular transport, and/or canalicular

secretion of bile salts. After CsA treatment, however, no signifi cant changes in

protein expression of Ntcp, Oatp1 (bile salt uptake), and Bsep (bile salt secretion)

were observed. It thus seems more likely that CsA treatment interferes directly

with these bile salt transporting systems, for example, by competitive inhibition as

reported previously12. Also, CsA has been demonstrated to interfere directly with

Mrp2-mediated transport activity30. Moreover, CsA alters liver plasma membrane

composition, fl uidity, and depletes hepatic glutathione content31. In agreement

with this in vitro observation, we found biliary glutathione secretion rate to

be markedly diminished after CsA treatment in the presence of only slightly

reduced levels of Mrp2 protein, the canalicular transporter responsible for biliary

glutathione secretion. Biliary secretion of glutathione signifi cantly contributes to

generation of the bile salt-independent fraction of bile fl ow32. Therefore, the

reduction of bile fl ow in the CsA-treated group is probably mainly caused by

reduction of glutathione secretion.

CsA reduced cholate synthesis by 70%. Yet, hepatic mRNA levels of both

Cyp7A1 and Cyp27 were increased by ~300 and ~150%, respectively, in CsA-

treated rats (data not shown). Impaired cholate synthesis could thus be related

to interference of CsA with enzyme activities or to CsA-induced changes in the

relevant precursor pool sizes. Whether the drug similarly affects only the activities

of Cyp7A1 and Cyp27 or also activities of enzymes further downstream in the

cascades of the acidic and neutral pathway of bile salt synthesis cannot be

deduced from the data presented. The latter option is likely in view of the largely

unchanged bile salt pool composition after CsA treatment.

For the genes involved in intestinal bile salt transport (i.e., Asbt, Ilbp,

and tAsbt) and one of the key regulators, i.e., the bile salt receptor FXR, we

found highest expression in the distal segment of the terminal ileum of rats, in

agreement with reported data2. Yet, no signifi cant differences were found between

63


CsA-treated and control rats.

The profound inhibitory effects of CsA on bile salt synthesis in vivo are in line

with previous observations in cultured rat and human hepatocytes6. In a previous

in vivo rat study, a daily treatment with CsA for 1 week led to ~50% reduction

of total bile salt synthesis, as determined by the washout technique applied to

anesthesized animals9. In the present study, we have focused on the kinetics of

cholate metabolism using a novel microscale isotope dilution technique, applicable

in in vivo unanesthesized animals15. In contrast to previous data on CsA treatment

in rats7-9, obtained by the washout technique, we did not observe a signifi cant

change in cholate pool size or in the (calculated) total bile salt pool size.

Differences in experimental setup, i.e., use of unanesthesized animals with intact

enterohepatic circulation, different strains or ages of rats, or the use of different

methods may contribute to this discrepancy. It should be realized that introduction

of an acute bile fi stula after anesthesia is not without possible artifact on bile

salt output16 and the use of an unanesthesized rat model with exteriorized

enterohepatic circulation would be most optimal33. However, it is anticipated

that potentially interfering effects have been similar in both groups studied. In

previous studies7-9, it was hypothesized that reduced bile salt synthesis contributes

to the concomitantly observed reduction in bile salt pool size. Our data clearly

demonstrate that decreased bile salt synthesis does not necessarily lead to a

reduced bile salt pool size. Rather, our data provide three indications that the

lower bile salt synthesis is compensated for by a more effi cient intestinal bile salt

conservation during chronic CsA treatment.

First, we were able to calculate the fraction of the cholate pool that escapes

intestinal absorption per enterohepatic cycle; cholate constitutes quantitatively

the major fraction of the bile salt pool in rats and CsA induces only minor changes

in biliary bile salt composition. The time needed for a cholate molecule to undergo

one full enterohepatic cycle, the “cycling time”, was determined in control and

CsA-treated rats. During CsA treatment, the calculated percentage of cholate lost

per enterohepatic cycle was ~70% lower than in control rats. Second, the strongly

decreased fecal bile salt excretion rate in the face of unchanged rate of bile salt

secretion in bile, cycling time, and pool size also supports more effective intestinal

conservation of bile salts during CsA treatment. Third, the increased expression

of Asbt in the intestinal mucosa of CsA-treated rats favors the possibility that

intestinal bile salt absorption effi ciency is enhanced at this level. A possible role

of Asbt in intrahepatic bile duct cells in cyclosporin A-induced changes of cholate

kinetics seems unlikely; Asbt expression in crude plasma membranes of total liver

was not signifi cantly affected by CsA (data not shown).

The present data thus indicate that, despite a profound inhibition of bile

salt biosynthesis, the bile salt pool size is maintained in CsA-treated rats by a

more effi cient intestinal absorption. The “classic view” implies that bile salt pool

size is maintained by bile salt synthesis, which, under steady-state conditions,

compensates for fecal bile salt loss. This view is supported by the frequently

observed increase in bile salt synthesis in rodents and in humans after ingestion

of cholestyramine, a bile salt-binding resin that enhances fecal bile salt excretion.

The increased bile salt synthesis during cholestyramine treatment is mediated

by alleviation of feedback repression of synthesis through the action of FXR, a

64

Chapter 3

nuclear receptor that is activated by bile salts2. Various studies34-35, including the

present one, however, indicate that regulation of the bile salt pool size may not

only occur at the level of hepatic biosynthesis in response to intestinal events.

Rather, data strongly suggest that intestinal events can infl uence the bile salt pool

size independently. Lillienau et al.36 found functional ileal bile salt transport to

be up-regulated by cholestyramine and down-regulated by glycocholate feeding,

each of which may serve to maintain a constant bile salt pool size. Yet, the

regulation of ileal bile salt transport has not been fully characterized yet, and

seemingly confl icting reports on up- or down-regulation by intestinal bile salts

have been published37-38. In our study, the infl ux of bile salts into the intestine was

not altered in CsA-treated animals, whereas the total amount of Asbt protein in

the terminal ileum was clearly increased. It seems therefore possible that another

factor than the intestinal bile salt fl ux, either directly or indirectly, infl uences ileal

bile salt transport by altering Asbt protein levels. The discrepancy between Asbt

mRNA levels and Asbt protein expression indicates post-transcriptional events to

be involved, e.g., stabilization of the protein. The induction of Asbt may be a direct

consequence of CsA treatment, for instance, related to CsA-induced intestinal

hemodynamic and functional impairment39. It cannot be ruled out, however, that

CsA mediates its effects on bile salt reabsorption by indirect means, e.g., by

effects on intestinal motility40.

In conclusion, CsA inhibits bile salt synthesis, without affecting bile salt pool

size or the enterohepatic cycling time of cholate in rats. The calculated percentage

cholate that is lost per enterohepatic cycle as well as the total fecal bile salt

loss are reduced. We speculate that the concomitantly observed increase in Asbt

protein expression in CsA-treated rats is involved in a more effi cient intestinal bile

salt absorption and exerts a regulatory role in maintenance of the bile salt pool

size.

ACKNOWLEDGEMENTS

We are indebted to Rick Havinga, Theo Boer, and Renze Boverhof for skillful

assistance in the experiments described in this article.

65


REFERENCES

1. Gerloff T, Stieger B, Hagenbuch B, Madon J, Landmann L, Roth J, Hofmann AF and Meier PJ. The sister of P-glycoprotein represents the canalicular bile salt export pump of mammalian liver. J Biol Chem 1998;273: 10046-10050.

2. Meier PJ and Stieger B. Bile salt transporters. Annu Rev Physiol 2002;64: 635-661. 3. Björkhem I Mechanisms of bile acid synthesis in mammalian liver, in Sterols and

Bile Acids (Danielsson H andSjövall J eds) 1985;pp 231-278, Elsevier Publishing Co., Amsterdam.

4. Burke JF, Pirsch JD, Ramos EL, Salomon DR, Stablein DM, Van Buren DH and West JC. Long-term effi cacy and safety of cyclosporin in renal transplant recipients. New Engl J Med 1994;331: 358-363.

5. Arias IM. Cyclosporin, the biology of the bile canaliculus and cholestasis. Gastro-enterology 1993;104: 1558-1560.

6. Princen HMG, Meijer PJ, Wolthers BG, Vonk RJ and Kuipers F. Cyclosporin A blocks bile acid synthesis in cultured hepatocytes by specifi c inhibition of chenodeoxycholic acid synthesis. Biochem J 1991;275: 501-505.

7. Le Thai B, Dumont M, Michel A, Erlinger S and Houssin D. Cholestatic effect of cyclosporine in the rat. An inhibition of bile acid secretion. Transplantation 1988;46: 510-512.

8. Chanussot F, Botta Fridlund D, Lechene de la Porte P, Sbarra V, Portugal H, Pauli AM, Hauton J, Gauthier A and Lafont H. Effects of cyclosporine and corticosteroids on bile secretion in the rat. Transplantation 1992;54: 226-231.

9. Chan FK and Shaffer EA. Cholestatic effects of cyclosporine in the rat. Transplantation 1997;63: 1574-1578.

10. Azer SA and Stacey NH. Differential effects of cyclosporin A on the transport of bile acids by human hepatocytes. Biochem Pharmacol 1993;46: 813-819.

11. Moseley RH, Johnson TR and Morrissette JM. Inhibition of bile acid transport by cyclosporin A in rat liver plasma membrane vesicles. J Pharmacol Exp Ther 1990;253: 974-980.

12. Böhme M, Müller M, Leier I, Jedlitschky G and Keppler D. Cholestasis caused by inhibition of the adenosine triphosphate-dependent bile salt transport in rat liver. Gastroenterology 1994;107: 255-265.

13. Kadmon M, Klünemann C, Böhme M, Ishikawa T, Gorgas K, Otto G, Herfarth C and Keppler D. Inhibition by cyclosporin A of adenosine triphosphate-dependent transport from the hepatocyte into bile. Gastroenterology 1993;104: 1507-1514.

14. Sauer P, Klöters-Plachky P and Stiehl A. Inhibition of ileal bile acid transport by cyclosporin A in rat. Eur J Clin Invest 1995;25: 677-682.

15. Hulzebos CV, Renfurm L, Bandsma RH, Verkade HJ, Boer T, Boverhof R, Tanaka H, Mierau I, Sauer PJJ, Kuipers F, Stellaard F. Measurement of cholic acid kinetics in plasma using a micro scale stable isotope technique: application to rodents and man. J Lipid Res 2001;42: 1923-1929.

16. Kuipers F, Dijkstra T, Havinga R, van Asselt W and Vonk RJ. Acute effects of pentobarbital-anaesthesia on bile secretion. Biochem Pharmacol 1985a;15: 1731-1736.

17 Murphy GM, Billing BH and Baron DN. A fl uorimetric and enzymatic method for the estimation of serum total bile acids. J Clin Pathol 1970;23: 594-598.

18. Tredger JM, Roberts N, Sherwood R, Higgins G and Keating J. Comparison of fi ve cyclosporin immunoassays with HPLC. Clin Chem Lab Med 2000;38: 1205-1207.

19. Meier PJ and Boyer JL. Preparation of basolateral (sinusoidal) and canalicular plasma membrane vesicles for the study of hepatic transport processes. Methods Enzymol 1990;192: 534-545.

20. Schmitz J, Preiser H, Maerstracci D, Ghosh BK, Cerda JJ and Crane RK. Purifi cation of the human intestinal brush border membrane. Biochem Biophys Acta 1973;323: 98-112.

21. Lowry OH, Roseborough NJ, Farr AL and Randall RL. Protein measurement with the folin reagents. J Biol Chem 1951;193: 265-275.

22. Wolters H, Spiering M, Gerding A, Slooff MJH, Kuipers F, Hardonk MH and Vonk RJ. Isolation and characterization of canalicular and basolateral plasma membrane fractions from human liver. Biochem Biophys Acta 1991;1069: 61-69.

66

Chapter 3

23. Jang I, Jung K and Cho J. Infl uence of age on duodenal brush border membrane and specifi c activities of brush border membrane enzymes in Wistar rats. Exp Anim 2000;49: 281-287.

24. Stieger B, Hagenbuch B, Landmann L, Hochli M, Schroeder A and Meier PJ. In situ localization of the hepatocytic Na+/Taurocholate cotransporting polypeptide in rat liver. Gastroenterology 1994;107: 1781-1787.

25. Roelofsen H, Vos TA, Schippers IJ, Kuipers F, Koning H, Moshage H, Jansen PL and Muller M. Increased levels of the multidrug resistance protein in lateral membranes of proliferating hepatocyte-derived cells. Gastroenterology 1997;112: 511-521.

26. Kramer W, Wess G, Bewersdorf U, Corsiero D, Girbig F, Weyland C and Stengelin S. Topological photoaffi nity labeling of the rabbit ileal Na+/bile-salt-co-transport system. Eur J Biochem 1997;249: 456-464.

27. Plösch T, Kok T, Bloks VW, Smit MJ, Havinga R, Chimini G, Groen AK and Kuipers F. Increased hepatobiliary and fecal cholesterol excretion upon activation of the liver X-receptor (LXR) is independent of ABCA1. J Biol Chem 2002;277: 33870-33877.

28. Griffi th OW. Determination of glutathione and glutathione disulfi de using glutathione reductase and 2-vinylpyridine. Anal Biochem 1980;106: 207-212.

29. Campbell IM. Incorporation and dilution values: their calculation in mass spectrally assayed stable isotopes labeling experiments. Bioorg Chem 1974;3: 386-397.

30. Chen ZS, Kawabe T, Ono M, Aoki S, Sumizawa T, Furukawa T, Uchiumi T, Wada M, Kuwano M and Akiyama SI. Effect of multidrug resistance-reversing agents on transporting activity of human canalicular multispecifi c organic anion transporter. Mol Pharmacol 1999;56: 1219-1228.

31. Galán AI, Muñoz ME and Jiménez R.. S-Adenosylmethionine protects against cyclosporin A-induced alterations in rat liver plasma membrane fl uidity and functions. J Pharmacol Exp Ther 1999;290: 774-781.

32. Ballatori N and Truong AT. Glutathione as a primary osmotic driving force in hepatic bile formation. Am J Physiol 1992;263: G617-G624.

33. Kuipers F, Havinga R, Bosschieter H, Toorop GP, Hindriks FR and Vonk RJ. Enterohepatic circulation in the rat. Gastroenterology 1985b;88: 403-411.

34. Dawson PA. Intestinal bile acid transport; molecules, mechanisms and malabsorption, in Bile Acids and Cholestasis (Paumgartner G, Stiehl A, Gerok W, Keppler D andLeuschner U eds) 1998;pp 1-31, Kluwer Academic Publishers, London.

35. Xu G, Shneider BL, Shefer S, Nguyen LB, Batta AK, Tint GS, Arrese M, Thevananther S, Ma L, Stengelin S, et al. Ileal bile acid transport regulates bile acid pool, synthesis and plasma cholesterol levels differently in cholesterol-fed rats and rabbits. J Lipid Res 2000;41: 298-304

36. Lillienau J, Crombie DL, Munoz J, Longmire-Cook SJ, Hagey LR and Hofmann AF. Negative feedback regulation of the ileal bile acid transport system in rodents. Gastroenterology 1993;104: 38-46.

37. Stravitz RT, Sanyal AJ, Pandak WM, Vlahcevic ZR, Beets JW and Dawson PA. Induction of sodium-dependent bile acid transporter messenger RNA, protein and activity in rat ileum by cholic acid. Gastroenterology 1997;113: 1599-1608.

38. Arrese M, Trauner M, Sacchiero RJ, Crossman MW and Shneider BL. Neither intestinal sequestration of bile acids nor common bile duct ligation modulate the expression and function of the rat ileal bile acid transporter. Hepatology 1998;28: 1081-1087.

39. Sun S, Greenstein SM, Kim DY, Schreiber TC, Schechner RS and Tellis VA. Nifedipine protects small intestine from cyclosporine-induced hemodynamic and functional impairment. J Surg Res 1997;69: 295-299.

40 Pernthaler H, Klaus A, Weiss H, Klima G and Margreiter R. Prolonged administration of cyclosporine A causes an increase in spontaneous contractile activity of the rat intestine. Transpl Proc 1997;29: 695-696.

Chapter 4

Cyclosporin A-induced reduction of bile salt synthesis associated with increased plasma lipids in children after liver transplantation

C.V. Hulzebos1, C.M.A. Bijleveld1, F. Stellaard1, F. Kuipers1, V. Fidler2, M.J.H. Slooff3, P.M.J.G. Peeters3, P.J.J. Sauer1, H.J. Verkade1.

1 Groningen University Institute for Drug Exploration, Center for Liver, Digestive and Metabolic Diseases, Pediatric Gastroenterology, Dept. Pediatrics, University

Hospital, Groningen, The Netherlands.2 Dept. Health Sciences, Faculty of Medical Sciences, University Groningen,

The Netherlands.3 Dept. Hepatobiliary Surgery, University Hospital, Groningen, The Netherlands.

Liver Transplantation 2004;10:872-80

© 2004 by the American Association for the study of Liver Diseases

68

Chapter 4

ABSTRACT

Background: Hyperlipidemia is a common side effect of Cyclosporin A (CsA)

after solid organ transplantation. CsA also markedly reduces the synthesis rate

of bile salts in rats and can inhibit biliary bile salt secretion. It is not known,

however, whether CsA inhibits the synthesis of bile salts in humans, and whether

the hyperlipidemic effects of CsA are related to bile salt metabolism.

Objectives: To assess the effects of CsA on the synthesis rate of bile salts and

on plasma triglycerides and cholesterol levels in pediatric liver transplant patients.

Methods: Before and after discontinuation of CsA treatment after liver

transplantation, synthesis rate and pool size of the primary bile salts cholate and

chenodeoxycholate were determined using a stable isotope dilution technique and

related to plasma lipids.

Results: In 6 children (age: 3-16 years) CsA treatment was discontinued at

2 years (median 2.3 years) after liver transplantation. Discontinuation of CsA

increased synthesis rate of chenodeoxycholate (+38%, p < 0.001) and cholate

(+21%, p < 0.05) and the pool size of chenodeoxycholate (+ 54%, p < 0.001).

Discontinuation of CsA decreased plasma levels of cholesterol (-18%, p < 0.05)

and triglycerides (-23%, p < 0.05). Bile salt synthesis rate appeared inversely

correlated with plasma cholesterol (rs= -0.82, p < 0.01) and plasma triglyceride

levels (rs= -0.62, p < 0.05).

Conclusions: CsA inhibits bile salt synthesis and increases plasma concentration

of cholesterol and triglycerides in pediatric liver transplant patients. Suppression

of bile salt synthesis by long-term CsA treatment may contribute to hyperlipidemia

and thus to increased risk for cardiovascular disease.

69

Cyclosporin A reduces bile salt synthesis and increases plasma lipids

INTRODUCTION

Hypertriglyceridemia and hypercholesterolemia are common side effects of

cyclosporin A (CsA), a widely used immunosuppressant after solid organ

transplantation1-3. Hyperlipidemia contributes to the increased incidence of

cardiovascular complications in transplant patients4-9. Elucidation of underlying

mechanisms may allow identifi cation of potentially preventive and treatment

strategies. To date, however, only limited data are available on the mechanism of

CsA-associated hyperlipidemia in humans in vivo. Data from in vivo animal studies

and from in vitro studies in human hepatoma cells indicated that CsA increases

hepatic lipoprotein production and reduces lipoprotein clearance. In mice, CsA

treatment increased hepatic VLDL triglyceride secretion10. In rats, CsA reduced

clearance of low-density-lipoprotein (LDL) and down-regulated lipoprotein lipase

expression11. In a human hepatoma cell line CsA reduced LDL receptor activity12.

In addition, LDL uptake could be impaired by incorporation of CsA into the LDL

particle13.

For a long time it has been known that CsA interacts with the enterohepatic

cycling of bile salts. CsA inhibits hepatic uptake and hepatobiliary secretion of bile

salts14-17. CsA has also been demonstrated to inhibit bile salt synthesis. In cultured

rat and human hepatocytes and hepatoma cells (HepG2), CsA inhibits bile salt

synthesis in vitro by inhibition of cholesterol 7α-hydroxylase (Cyp7a1), considered

to be the rate-limiting enzyme in bile salt synthesis, and of mitochondrial sterol-

27-hydroxylase (Cyp27), resulting in decreased synthesis rates of cholate and

particularly chenodeoxycholate9;11;18-20. Animal studies confi rm that CsA suppresses

bile salt synthesis in vivo21-24.

A relationship between bile salt metabolism and plasma lipid concentrations

has emerged from various studies. Bile salts inhibit VLDL secretion in rat and

human hepatocytes in vitro and, to a limited extent, in rodents in vivo25. The

relationship between bile salt biosynthesis and VLDL formation in humans in

vivo seems bi-directional; treatment with cholestyramine results in increased

hepatic VLDL secretion26, whereas an increased formation of plasma triglycerides,

as occurs in hyperlipoproteinemia, is associated with an augmented bile salt

formation27. Familial hypertriglycidemia is associated with bile salt malabsorption28;29,

and treatment with the bile salt chenodeoxycholate decreases plasma triglyceride

concentrations26;30.

In the present study we aimed to elucidate whether CsA treatment affects

bile salt synthesis in humans in vivo, and whether possible effects on bile salt

synthesis are related to CsA-associated hyperlipidemia.

In our center, CsA treatment is discontinued in pediatric liver transplant

patients at least 2 years after transplantation, provided that histology of liver

biopsy does not suggest the presence of rejection, including severe fi brosis or

signs of cholestasis. Recently, we reported the results of this regimen with respect

to incidence of rejection, graft survival and kidney function in preliminary form31.

Determination of bile salt kinetics and plasma lipid levels before and after CsA

discontinuation provides a unique opportunity to determine effects of CsA on bile

salt synthesis rate and plasma lipid levels. Our results indicate that CsA reversibly

reduced primary bile salt synthesis rate in children after liver transplantation and

70

Chapter 4

that the reduction is strongly, inversely correlated with plasma lipid levels.

SUBJECTS AND METHODS

Patient characteristics

The study protocol was approved by the Medical Ethics Committee of the

University Hospital Groningen and included informed consent by the parents and

the children. The study group included 6 children (4 males, 2 females; age:

3-16.5 yr.). Indications for OLT were end-stage liver disease caused by biliary

atresia (n = 5) and recurrent cholangitis with secondary biliary cirrhosis after

surgical removal of a choledochal cyst (n=1). Five patients received a whole liver

graft, and one a partial graft. Retransplantation had been performed in 1 patient at

10 months after the primary transplantation because of secondary biliary cirrhosis

(ischemic type of biliary lesions and recurrent cholangitis). All patients received a

hepatico-jejunostomy on a Roux-and-Y loop. Immunosuppressive medication after

liver transplantation consisted of CsA (trough levels from 6 months posttransplant

of ~100 ng/mL), prednisolon (0.2 mg.kg-1.2days-1, alternate day dosing)

and azathioprine (2 mg.kg-1.day-1). CsA treatment was discontinued after

a median duration of 2.3 years (range: 2.1-8.7 yr.) after OLT in case

of histological (liver biopsy) and biochemical (serum) absence of rejection.

Immunosuppressive medication after discontinuation of CsA consisted of

prednisolon (0.4 mg.kg-1.2days-1, alternate day dosing) and azathioprine (2.5

mg.kg-1.day-1). Two children used received ursodeoxycholate (15 mg.kg-1.day-1)

for a cholestatic episode in the past. Other medication consisted of nifedipine

(n=2), magnesiumsulphate/ gluconate (n=5), budesonide nasal spray (n=1),

alpha-calcidol (n=5), calciumcarbonate/ -lactogluconate (n=4), ferrofumarate

(n=2), and captopril (n=1).

Study protocol

After informed consent was obtained, the patients were subjected to maximal 2

study periods before and after discontinuation of CsA. To exclude the presence

of rejection, liver biopsy was performed 10 weeks (range 5-20) prior to CsA

withdrawal. Discontinuation of CsA occurred in 7 days after increasing the doses

of prednisolon and azathioprine. The median interval of the two study periods

after withdrawal of CsA was 4 weeks (range: 1-5) and 14 weeks (range:

7-29), respectively. On day 1 of a study period, after an overnight fast, a

baseline blood sample was collected into an EDTA-containing tube, after which

the patients received a tetradeuterated bile salt solution (oral ingestion or

administration via a nasogastric tube) containing 50 mg [2H4]-cholate and 50 mg

[2H4]-chenodeoxycholate dissolved in 80 mL 0.25% NaHCO

3. Subsequently, blood

samples (0.5 mL) in EDTA-containing tubes were taken at 10, 24, 32, 48, and

72 hours after administration of the bile salt solution. Plasma was obtained by

centrifugation at 4000 rpm for 10 minutes and stored at -20 °C until analysis.

During the 3 days of the test, patients ate their regular meals and medications.

In case of diarrhea the study was not initiated.

71


Materials

[2,2,4,4-2H4]-cholate and [2,2,4,4-2H

4]-chenodeoxycholate ([2H

4]-CA and

[2H4]-CDCA, isotopic purity 98%) were obtained from Isotech Inc.(Miamisburg,

OH). Cholylglycine hydrolase from Clostridium perfringens (welchii) was purchased

from Sigma Chemicals (St. Louis, MO). Pentafl uorobenzylbromide (PFB) was

purchased from Fluka Chemie (Buchs, Neu-Ulm, Switzerland). All other chemicals

and solvents used were of the highest purity commercially available.

Analytical procedures

Plasma alanine transaminase (ALT), aspartate transaminase (AST), alkaline

phosphatase (AP), γ-glutamyltranspeptidase (GGT), bilirubin, total cholesterol, HDL-cholesterol and triglycerides were determined by routine laboratory techniques. LDL-cholesterol was calculated according to Friedewald et al.32. Total bile salts in plasma were determined by an enzymatic fl uorimetric assay using

3α-hydroxysteroid dehydrogenase33. Whole blood concentrations of CsA were determined by use of an enzymatic multiplied immunoassay technique (EMIT)34.

Gas-liquid chromato graphy electron capture negative chemical ionization

mass spectrometry

Isotope enrichment of plasma bile salts was determined by gas chromato graphy

mass spectrometry (GC-MS) using a Finnigan SSQ7000 Quadrupole GC-MS

(Finnigan MAT, San José)35. GC separation was performed on a 15 m x 0.25 mm

column, 0.25 µm fi lm thickness (AT-5MS, Alltech Associates, Inc., Deerfi eld, IL)

and details of the running program and detection were identical to the method

previously developed and described35.

Calculations

Isotope dilution technique.

Enrichment of CA and CDCA was defi ned as the increase of M4-CA/ M

0-CA relative

to baseline measurements after administration of [2H4]-CA and expressed as the

natural logarithm of atom % excess (ln APE) value6. The decay of ln APE in time

was calculated by linear regression analysis. From this linear decay curve the

fractional turnover rate (FTR) and pool size of CA were determined. The FTR

(day-1) equals the slope of the regression line. The pool size (µmol.kg-1) was

determined according to the formula: ((D . b . 100) / ea ) - D)/ BW, where “D” is

the administered amount of label, “b” is the isotopic purity, “a” is the intercept on

the y-axis of the ln APE versus time curve, and “BW” bodyweight (kg). Cholate

synthesis rate (µmol.kg-1.day-1) was then calculated by multiplying pool size and

FTR.

Statistical analysis.

Results are presented as means ± standard deviation or as medians when

considered appropriate. To test the null hypothesis (no effect of CsA discontinuation)

the number of patients whose measurements without CsA all exceeded those

with CsA was used as test statistic. Paired statistical analysis was performed in

which each study subject served as its own control. Exact one-sided p-values

are presented. Based on in vitro and in vivo data on effects of CsA on lipid

72

Chapter 4

and bile salt metabolism we tested the hypothesis that CsA withdrawal would

increase bile salt synthesis and reduce plasma lipid levels2-4;10-13;18-24. Correlations

between parameters were calculated using Spearman rank correlation coeffi cient

(rs). Level of signifi cance for all statistical analyses was set at p < 0.05. Analysis

was performed using SPSS 10 for Windows software (SPSS, Chicago, IL).

RESULTS

Patient characteristics and effects of chronic CsA treatment on parameters

of liver function.

Table 1 shows the clinical data and biochemical parameters of the included

patients. Discontinuation of CsA signifi cantly increased bodyweight (+5%; paired

measurements, p < 0.01) at 5 weeks (median) after withdrawal of the

drug and slightly decreased plasma alkaline phosphatase activity. Alanine

transaminase activity increased, but remained below the upper level of normal

after discontinuation of CsA. Other parameters of liver graft function were

comparable before and after discontinuation of CsA.

Effects of chronic CsA treatment on plasma lipid concentrations.

To establish the effects of CsA on lipid metabolism, plasma concentrations of total

cholesterol, LDL-cholesterol, HDL-cholesterol and triglycerides were measured.

Figure 1A shows that plasma levels of total cholesterol were signifi cantly reduced

by 18% (p < 0.05) after discontinuation of CsA. This decrease consisted

predominantly of a decrease in LDL-cholesterol levels (-27%, p < 0.05),

whereas HDL-cholesterol levels were not signifi cantly affected (data not shown).

Discontinuation of CsA also decreased mean plasma levels of triglycerides (-23%;

p < 0.05, Figure 1B).

Table 1. Patient characteristics and plasma parameters of liver function during CsA treatment and after CsA discontinuation.

CsA treatment CsA discontinued Age (y) 11.3 ± 5.6 11.6 ± 5.6 Body weight (kg) 39.6 ± 19.7 41.2 ± 20.4* Years after OLT 3.2 ± 0.7 3.5 ± 0.7 Bile salts (mmol/L) 25 ± 22 22 ± 13 Total bilirubin (mmol/L) 20 ± 6 18 ± 8 Alanine transaminase (U/L) 15 ± 8 22 ± 9* Aspartate transaminase (U/L) 28 ± 4 32 ± 10 γ-glutamyltranspeptidase (U/L) 10 ± 3 12 ± 4 Alkaline phosphatase (U/L) 193 ± 53 137 ± 53* Cyclosporin (mg/L) 104 ± 33 N.D.

Means ± standard deviation of patient characteristics and liver function parameters in pediatric liver transplant patients before and after discontinuation of CsA (n = 6, paired; N.D., not detectable; *: p < 0.01).

73


Figure 1. Effects of CsA discontinuation

on plasma cholesterol (1A) and

triglycerides (1B) in pediatric patients

after liver transplantation. Data are

means (bold horizontal bars) and

individual values (circles connected with

solid line) of 6 paired measurements. *:

p < 0.05.

Figure 2. Synthesis rate of cholate

and chenodeoxycholate in pediatric liver

transplant patients before (CsA+) and

after discontinuation (CsA-) of CsA. Data

are means ± standard deviation of 6

paired measurements. *: p < 0.05.

Effects of chronic CsA treatment on bile salt metabolism.

To obtain an integrated view on the effects of CsA on bile salt metabolism

we studied parameters of bile salt kinetics, i.e., bile salt synthesis rate, pool

size, and fractional turnover rate using a recently developed stable isotope

dilution, applicable for small (50µL) plasma volumes. Figure 2 shows that

discontinuation of CsA signifi cantly increased total bile salt synthesis rate (18 ±

11 vs. 24 ± 7 µmol.kg-1.day-1, CsA-treated vs. CsA discontinued, resp.; p < 0.01).

Discontinuation of CsA treatment increased synthesis rates of chenodeoxycholate

(8 ± 3 vs. 10 ± 4 µmol.kg-1.day-1, CsA-treated vs. CsA discontinued, resp.;

p < 0.001) and of that of cholate (10 ± 8 vs. 13 ± 4 µmol.kg-1.day-1, CsA-treated

74

Chapter 4

vs. CsA discontinued, resp.; p < 0.05) signifi cantly. Figure 3 shows that total bile

salt pool size increased after discontinuation of CsA, but this difference did not

reach statistical signifi cance (47 ± 20 vs. 60 ± 26 µmol.kg-1, CsA-treated vs. CsA

discontinued, resp.; NS). Discontinuation of CsA signifi cantly increased CDCA pool

size (23 ± 13 vs. 36 ± 19 µmol.kg-1, CsA-treated vs. CsA discontinued, resp.;

p < 0.001), but not CA pool size (24 ± 10 vs. 25 ± 12 µmol.kg-1, CsA-treated vs.

CsA discontinued, resp.; NS).

Fractional turnover rate of CDCA, i.e., the portion of the CDCA pool that is newly

synthesized per day was not signifi cantly changed (0.40 ± 0.21 vs. 0.35 ± 0.15

day-1, CsA-treated vs. CsA discontinued, resp.; NS), whereas that of CA increased

after discontinuation of CsA (0.45 ± 0.33 vs. 0.62 ± 0.32 day-1, CsA-treated vs.

CsA discontinued, resp.; p < 0.05).

Analogous with previous studies, Figures 4A and 4B show that an inverse

Figure 4. Correlation between fractional

turnover rates and pool sizes for chenode-

oxycholate (A) and cholate (B) in pediatric

liver transplant patients before (closed cir-

cles) and after (open circles) discontinua-

tion of CsA.

Figure 3. Pool sizes of cholate (black

bars) and chenodeoxycholate (white bars)

in pediatric liver transplant patients before

(CsA+) and after discontinuation (CsA-) of

CsA. Data are means ± standard deviation

of 6 paired measurements. *: p < 0.05.

75


relationship was observed between the bile salt pool size and the fractional

turnover rate for CA and CDCA. This relationship was more pronounced for CDCA

(rs= -0.72, p < 0.01) than for CA (r

s= -0.58, p = 0.05). No signifi cant correlation

existed between bile salt synthesis rates and bile salt pool sizes of cholate and

chenodeoxycholate (data not shown).

Relationship between bile salt synthesis and plasma lipid levels.

From results described above, it could already be appreciated that CsA treatment

increased plasma lipid levels and inhibited bile salt synthesis (Figure 5). Bile

salt synthesis rate appeared inversely correlated with plasma cholesterol (rs=

-0.82, p < 0.01) as well as with triglyceride levels (rs= -0.62, p < 0.05). Of the

two primary bile salts measured, synthesis rate of chenodeoxycholate showed a

stronger correlation with plasma lipid levels than that of cholate (cholesterol: rs=

-0.78, p < 0.01 for CDCA and rs= -0.68, p < 0.05 for CA; triglycerides: r

s= -0.79,

p < 0.01 for CDCA and rs= -0.56, p = 0.06 for CA).

DISCUSSION

The present study demonstrates that CsA treatment signifi cantly affects bile

salt kinetics and plasma lipid levels in pediatric liver transplant patients.

Discontinuation of CsA decreases plasma levels of cholesterol, LDL-cholesterol,

and triglycerides by ~20%. These effects appeared strongly related to an

increased synthesis rate of bile salts, especially to that of chenodeoxycholate. The

results indicate that CsA increases the plasma triglyceride and cholesterol levels

Figure 5. Correlation between plasma

levels of cholesterol and total bile salt

synthesis rate (5A) and plasma triglycerides

and total bile salt synthesis rate (5B) in

pediatric liver transplant patients before

(closed circles) and after (open circles)

discontinuation of CsA.

76

Chapter 4

in humans in vivo in association with inhibition of bile salt synthesis.

To the best of our knowledge, this is the fi rst study to demonstrate that

CsA inhibits bile salt synthesis in pediatric liver transplant patients. Although for

long it has been known that CsA interacts with bile formation in humans, i.e.,

cholelithiasis and cholestasis have repeatedly been reported in patients on CsA

therapy36, data on bile salt synthesis and pool size in humans chronically treated

with CsA are scarce37. Our observation that CsA reduces bile salt synthesis is in

agreement with in vitro and in vivo animal data. CsA acutely inhibits bile

salt synthesis in cultured rat and human hepatocytes and in rats18;21;22;24;38.

Accordingly, protein levels but not mRNA levels of cholesterol 7α-hydroxylase

Cyp7a1, the rate-limiting enzyme in bile salt synthesis, have been shown to

be markedly downregulated in livers of CsA-treated rats11;24. Previously, it was

hypothesized that a reduced bile salt synthesis upon CsA treatment contributed

to the concomitantly observed reduction in bile salt pool size21;22;38. Yet, in a

recent study, we found that the cholate pool size was unaffected in CsA-treated

rats despite a signifi cantly reduced cholate synthesis upon CsA treatment24. The

unaffected cholate pool size in the pediatric liver transplant patient presented here

is in agreement with our data in CsA-treated rats. Interestingly, maintenance of

cholate pool size in CsA-treated rats was associated with increased expression

of the apical sodium-dependent bile salt transporter (Asbt) protein expression in

the distal ileum, considered pivotal in intestinal bile salt absorption11;24. Various

studies support the concept that regulation of the bile salt pool size is not only

regulated by hepatic biosynthesis in response to fecal loss of bile salts, but that

intestinal events can infl uence the bile salt pool size independently11;24;39-41. We

can not completely exclude an effect of the temporarily increased steroid dosing

on bile salt synthesis. Yet, comparison between the fi rst and second period after

CsA withdrawal did not give any sustained indication of a rebound effect (data not

shown), whereas the steroid dose had already been tapered again.

Long-term treatment with CsA increases plasma levels of triglycerides and

VLDL- and LDL-cholesterol3;42;43. HDL-cholesterol levels have been reported to

decrease or, as in the present study, to remain unaffected44-46. The incidence

and extent of hyperlipidemia varies among the numerous reports, which may be

related to differences in underlying diseases, time after transplantation, fasting

versus non-fasting lipid measurements, or in nutritional status of patients42;47.

Elucidation of the mechanism by which CsA raises plasma lipid levels may allow

the identifi cation of preventive and therapeutic options. Several hypotheses

reminiscent on concepts of impaired clearance and/or increased production

of lipoproteins have been proposed for the CsA-associated increase in LDL

cholesterol. Raine et al. suggested that hepatic LDL uptake was impaired by

incorporation of CsA into the LDL particle13. LDL uptake could also be diminished

by impaired LDL receptor activity. In agreement with this, CsA suppresses the

LDL receptor activity in HepG2 cells possibly by affecting the free intracellular

cholesterol pool12. Yet, it is not clarifi ed whether CsA decreases the clearance of

LDL from plasma, since data from in vivo and in vitro studies are confl icting48.

Another explanation for the CsA-associated hypertriglycidemia could reside in

an impaired expression or activity of the lipoprotein lipase enzyme as observed

in numerous in vivo studies in animals as well as in humans11;49-51. Apart from

77


a reduced activity of peripheral lipoprotein lipase, a reduced activity of hepatic

lipase may contribute to a lower lipolytic activity as has been described in

renal transplant patients on CsA therapy50. Alternatively, the CsA-associated

hyperlipidemia could result from increased hepatic production of cholesterol and

triglyceride-rich lipoproteins. In HepG2 cells, CsA dose- and time-dependently

decreased apo-B secretion, suggesting that the elevated plasma LDL-cholesterol

levels are not caused by hepatic overproduction of apoB-100-containing

lipoproteins52;53. Yet, CsA treatment increased VLDL triglyceride secretion in vivo

in mice in the presence of increased plasma lipid levels10. Considering the strong

inverse correlation between bile salt synthesis and triglycerides, bile salts

could also be involved in CsA-induced hyperlipidemia. Recently, it has been

shown that bile salts, i.e., transhepatic bile salt fl uxes, are inversely related

with VLDL-triglyceride concentration and hepatic triglyceride secretion in vivo in

rodents25. The present study does not allow addressing the transhepatic fl ux in the

patients, so that its potential involvement in the CsA-induced hypertriglycidemia

is unclear.

It is tempting to speculate that the strong quantitative association between

bile salt synthesis and plasma lipid levels is due to interaction between bile

salt and lipid metabolism. Conversion of cholesterol into bile salts and their

subsequent fecal excretion provides the major route for elimination of excess

cholesterol. Recently, it has become clear that bile salts exert regulatory actions on

expression of specifi c genes involved in bile salt and lipid metabolism via activation

of nuclear hormone receptors, e.g., the farnesoid X-receptor (FXR; NR1H4)54.

Bile salts, such as cholate, chenodeoxycholate and their conjugates are natural

ligands for FXR. Bile salt-activated FXR controls expression of several genes

considered crucial in maintenance of bile salt and cholesterol homeostasis55;56. Bile

salt-activated FXR inhibits transcription of the Cyp7a1 gene, encoding cholesterol

7α-hydroxylase which catalyzes the fi rst and rate-limiting step in bile salt

synthesis55;56. In addition, FXR appears to control a variety of genes involved

in control of plasma lipid levels57;58. In agreement with this is the observation

that upon FXR activation with a nonsteroidal ligand for FXR (GW4064) plasma

triglyceride levels decreased dose-dependently in Fischer rats59;60. Yet, in the FXR

knockout mice, an increased bile salt synthesis rate is associated with high plasma

lipid levels, which makes the exact role of FXR elusive at the moment61. Effects

of CsA on plasma lipids may, at least in part, be mediated by bile salts. We pro-

pose that the CsA-induced reduction in hepatic bile salt synthesis may increase

hepatic cholesterol content and thus reduce cholesterol clearance from plasma.

This concept is supported by the data presented in this study, which demonstrate

that CsA causes a sustained but reversible inhibition of bile salt synthesis in vivo

in humans associated with increased plasma lipids.

A substantial number of pediatric liver transplant patients have lipid

abnormalities that may contribute to atherosclerosis62;63. To treat posttransplant

hyperlipidemia several options exist. Replacing CsA by tacrolimus (FK506) as

primary immunosuppressive drug reduces hyperlipidemia64-67. Dietary therapy,

weight reduction and administration of HMG-CoA reductase inhibitors have

also been shown to effectively lower plasma lipid levels in organ transplant

recipients7;9;68. In the pediatric liver transplant patients reported in this study,

78

Chapter 4

the absolute values of plasma lipids were in the normal (cholesterol) – high

(triglycerides) range (median percentile corrected for age: P35 and P95,

respectively) and discontinuation of CsA resulted in low (cholesterol) – normal

(triglycerides) lipid levels. The present study suggest that discontinuation of CsA,

according to the present protocol lowers plasma lipid levels31;69. Observational

data show that there is no threshold below which lower plasma lipid levels are

not associated with a lower risk of cardiovascular disease70. The strength of the

relation between plasma lipid levels and coronary heart disease is weaker with

increasing age, stressing the importance of controlling lipid levels at a young

age70.

In conclusion, CsA inhibits bile salt synthesis and increases plasma

concentration of cholesterol and triglycerides in pediatric liver transplant patients.

Suppression of bile salt synthesis by long-term CsA treatment may contribute to

hyperlipidemia and thus to increased risk on cardiovascular disease.

ACKNOWLEDGEMENTS

The authors are indebted to Theo Boer and Renze Boverhof for their skillful

assistance in the analysis described in this manuscript. This project has been

supported by the Foundation ”De Drie Lichten” in The Netherlands.

79


REFERENCES

1. Moore R, Hernandez D, Valantine H. Calcineurin inhibitors and post-transplant hyperlipidaemias. Drug Saf 2001; 24(10):755-766.

2. Granot E, Shemesh P, Rivkin L, Kohen R. Plasma and low-density lipoprotein lipid peroxidation in cyclosporine A-treated children after liver transplant. Transplant Proc 1998; 30(8):4057-4059.

3. Atillasoy E, Gurkan A, Mor E, Altaca G, Sheiner P, Guy S, et al. Cholesterol levels long-term after liver transplant. Transplant Proc 1998; 30(5):2049-2050.

4. Kuster GM, Drexel H, Bleisch JA, Rentsch K, Pei P, Binswanger U et al. Relation of cyclosporine blood levels to adverse effects on lipoproteins. Transplantation 1994; 57(10):1479-1483.

5. Baum CL. Weight gain and cardiovascular risk after organ transplantation. JPEN J Parenter Enteral Nutr 2001; 25(3):114-119.

6. Campbell IM. Incorporation and dilution values: their calculation in mass spectrally assayed stable isotopes labeling experiments. Bioorg Chem 3(1974):386-397.

7. Asberg A. Interactions between cyclosporin and lipid-lowering drugs: implications for organ transplant recipients. Drugs 2003; 63(4):367-378.

8. Massy ZA. Hyperlipidemia and cardiovascular disease after organ transplantation. Transplantation 2001; 72(6 Suppl):S13-S15.

9. Reuben A. Long-term management of the liver transplant patient: diabetes, hyperlipidemia, and obesity. Liver Transpl 2001; 7(11 Suppl 1):S13-S21.

10. Wu J, Zhu YH, Patel SB. Cyclosporin-induced dyslipoproteinemia is associated with selective activation of SREBP-2. Am J Physiol 1999; 277(6 Pt 1):E1087-E1094.

11. Vaziri ND, Liang K, Azad H. Effect of cyclosporine on HMG-CoA reductase, cholesterol 7alpha-hydroxylase, LDL receptor, HDL receptor, VLDL receptor, and lipoprotein lipase expressions. J Pharmacol Exp Ther 2000; 294(2):778-783.

12. Winegar DA, Salisbury JA, Sundseth SS, Hawke RL. Effects of cyclosporin on cholesterol 27-hydroxylation and LDL receptor activity in HepG2 cells. J Lipid Res 1996; 37(1):179-191.

13. Raine AE, Carter R, Mann JI, Morris PJ. Adverse effect of cyclosporin on plasma cholesterol in renal transplant recipients. Nephrol Dial Transplant 1988; 3(4):458-463.

14. Azer SA, Stacey NH. Differential effects of cyclosporin A on the transport of bile acids by human hepatocytes. Biochem Pharmacol 1993; 46:813-819.

15. Moseley RH JT, Morrissette JM. Inhibition of bile acid transport by cyclosporin A in rat liver plasma membrane vesicles. J Pharmacol Exp Ther 1990; 253:974-980.

16. Bohme M, Muller M, Leier I, Jedlitschky G, Keppler D. Cholestasis caused by inhibition of the adenosine triphosphate-dependent bile salt transport in rat liver. Gastroenterology 1994; 107(1):255-265.

17. Kadmon M, Keppler D. Inhibition by cyclosporin A of adenosine triphosphate-dependent transport from the hepatocyte into bile. Gastroenterology 1993; 104:1507-1514.

18. Princen HM, Meijer P, Wolthers BG, Vonk RJ, Kuipers F. Cyclosporin A blocks bile acid synthesis in cultured hepatocytes by specifi c inhibition of chenodeoxycholic acid synthesis. Biochem J 1991; 275 ( Pt 2):501-505.

19. Levy J, Budai K, Javitt NB. Bile acid synthesis in HepG2 cells: effect of cyclosporin. J Lipid Res 1994; 35(10):1795-1800.

20. Axelson M, Ellis E, Mork B, Garmark K, Abrahamsson A, Bjorkhem I, et al. Bile acid synthesis in cultured human hepatocytes: support for an alternative biosynthetic pathway to cholic acid. Hepatology 2000; 31(6):1305-1312.

21. Chan FK, Shaffer EA. Cholestatic effects of cyclosporine in the rat. Transplantation 1997; 63:1574-1578.

22. Chanussot F. Effects of cyclosporine and corticosteroids on bile secretion in the rat. Transplantation 1992; 54:226-231.

23. Chan FK, Zhang Y, Lee SS, Shaffer EA. The effects of liver transplantation and cyclosporine on bile formation and lipid composition: an experimental study in the rat.

J Hepatol 1998; 28(2):329-336.24. Hulzebos CV, Wolters H, Plosch T, Kramer W, Stengelin S, Stellaard F, et al. Cyclosporin

A and enterohepatic circulation of bile salts in rats: decreased cholate synthesis but increased intestinal reabsorption. J Pharmacol Exp Ther 2003; 304(1):356-363.

80

Chapter 4

25. Elzinga BM, Havinga R, Baller JF, Wolters H, Bloks V, Mensenkamp AR, et al. The role of transhepatic bile salt fl ux in the control of hepatic secretion of triacylglycerol-rich lipoproteins in vivo in rodents. Biochim Biophys Acta 2002; 1573(1):9-20.

26. Angelin B, Einarsson K, Hellstrom K, Leijd B. Effects of cholestyramine and chenodeoxycholic acid on the metabolism of endogenous triglyceride in hyperlipoproteinemia. J Lipid Res 1978; 19(8):1017-1024.

27. Angelin B, Einarsson K, Hellstrom K, Leijd B. Bile acid kinetics in relation to endogenous tryglyceride metabolism in various types of hyperlipoproteinemia. J Lipid Res 1978; 19(8):1004-1016.

28. Duane WC, Hartich LA, Bartman AE, Ho SB. Diminished gene expression of ileal apical sodium bile acid transporter explains impaired absorption of bile acid in patients with hypertriglyceridemia. J Lipid Res 2000; 41(9):1384-1389.

29. Duane WC. Abnormal bile acid absorption in familial hypertriglyceridemia. J Lipid Res 1995; 36(1):96-107.

30. Miller NE, Nestel PJ. Triglyceride-lowering effect of chenodeoxycholic acid in patients with endogenous hypertriglyceridaemia. Lancet 1974; 2(7886):929-931.

31. Torringa R, Scheenstra R, Waalkens H, Peeters PMJG, Slooff MJH, Verkade HJ, et al. Towards minmising immunosuppressive therapy after liver transplantation: effects of cyclosporin A withdrawal on rejection, mortality and kidney function. J Pediatri gastroenterol Nutr 2003; 36:547.

32. Friedewald WT, Levy RI, Fredrickson DS. Estimation of the concentration of low-density lipoprotein cholesterol in plasma, without use of the preparative ultracentrifuge. Clin Chem 1972; 18(6):499-502.

33. Murphy GM BB, Baron DN. A fl uorimetric and enzymatic method for the estimation of serum total bile acids. J Clin Pathol 1970; 23:594-598.

34. Tredger JM RN, Keating J. Comparison of fi ve cyclosporin immunoassays with HPLC. Clin Chem Lab Med 2000; 38:1205-1207.

35. Hulzebos CV, Renfurm L, Bandsma RH, Verkade HJ, Boer T, Boverhof R, et al. Measurement of cholic acid kinetics in plasma using a micro scale stable isotope technique: application to rodents and man. J Lipid Res 2001; 42:1923-1929.

36. Arias IM. Cyclosporin, the biology of the bile canaliculus, and cholestasis. Gastroenterology 1993; 104:1558-1560.

37. Sauer P, Rudolph G, Endele R, Senn M, Theilmann L, Otto G, et al. Kinetics of primary bile acids in patients after orthotopic liver transplantation. Eur J Clin Invest 1996; 26(11):979-982.

38. Le Thai B, Houssin D. Cholestatic effect of cyclosporine in the rat. An inhibition of bile acid secretion. Transplantation 1988; 46:510-512.

39. Xu G, Salen G. Ileal bile acid transport regulates bile acid pool, synthesis, and plasma cholesterol levels differently in cholesterol-fed rats and rabbits. J Lipid Res 2000; 41:298-304.

40. Dawson PA. Intestinal bile acid transport; molecules, mechanisms, and malabsorption. In: Paumgartner G, Leuschner U, editors. Bile acids and cholestasis. London: Kluwer Academic Publishers, 1998: 1-31.

41. Dawson PA, Haywood J, Craddock AL, Wilson M, Tietjen M, Kluckman K, et al. Targeted deletion of the ileal bile acid transporter eliminates enterohepatic cycling of bile acids in mice. J Biol Chem 2003; 278(36):33920-33927.

42. Verpooten GA, Cools FJ, Van der Planken MG, Bedert LC, Claes R, Van Gaal LF, et al. Elevated plasminogen activator inhibitor levels in cyclosporin-treated renal allograft recipients. Nephrol Dial Transplant 1996; 11(2):347-351.

43. Steinmuller TM, Graf KJ, Schleicher J, Leder K, Bechstein WO, Mueller AR, et al. The effect of FK506 versus cyclosporine on glucose and lipid metabolism--a randomized trial. Transplantation 1994; 58(6):669-674.

44. Harris KP, Russell GI, Parvin SD, Veitch PS, Walls J. Alterations in lipid and carbohydrate metabolism attributable to cyclosporin A in renal transplant recipients. Br Med J (Clin Res Ed) 1986; 292(6512):16.

45. Kasiske BL, Tortorice KL, Heim-Duthoy KL, Awni WM, Rao KV. The adverse impact of cyclosporine on serum lipids in renal transplant recipients. Am J Kidney Dis 1991; 17(6):700-707.

46. Edwards BD, Bhatnagar D, Mackness MI, Gokal R, Ballardie FW, Chalmers RJ, et al.

81


Effect of low-dose cyclosporin on plasma lipoproteins and markers of cholestasis in patients with psoriasis. QJM 1995; 88(2):109-113.

47. Ballantyne CM, Podet EJ, Patsch WP, Harati Y, Appel V, Gotto AM, Jr., et al. Effects of cyclosporine therapy on plasma lipoprotein levels. JAMA 1989; 262(1):53-56.

48. Lopez-Miranda J, Vilella E, Perez-Jimenez F, Espino A, Jimenez-Pereperez JA, Masana L, et al. Low-density lipoprotein metabolism in rats treated with cyclosporine. Metabolism 1993; 42(6):678-683.

49. Lopez-Miranda J, Perez-Jimenez F, Gomez-Gerique JA, Espino-Montoro A, Hidalgo-Rojas L, Pedreno J, et al. Effect of cyclosporin on plasma lipoprotein lipase activity in rats. Clin Biochem 1992; 25(5):387-394.

50. Derfl er K, Hayde M, Heinz G, Hirschl MM, Steger G, Hauser AC, et al. Decreased postheparin lipolytic activity in renal transplant recipients with cyclosporin A. Kidney Int 1991; 40(4):720-727.

51. Superko HR, Haskell WL, Di Ricco CD. Lipoprotein and hepatic lipase activity and high-density lipoprotein subclasses after cardiac transplantation. Am J Cardiol 1990; 66(15):1131-1134.

52. Kaptein A, de Wit EC, Princen HM. Cotranslational inhibition of apoB-100 synthesis by cyclosporin A in the human hepatoma cell line HepG2. Arterioscler Thromb 1994; 14(5):780-789.

53. Macri J, Adeli K. Studies on intracellular translocation of apolipoprotein B in a permeabilized HepG2 system. J Biol Chem 1997; 272(11):7328-7337.

54. Makishima M, Okamoto AY, Repa JJ, Tu H, Learned RM, Luk A, et al. Identifi cation of a nuclear receptor for bile acids. Science 1999; 284(5418):1362-1365.

55. Russell DW. The Enzymes, Regulation, and Genetics of Bile Acid Synthesis. Annu Rev Biochem 2003.

56. Lu TT, Makishima M, Repa JJ, Schoonjans K, Kerr TA, Auwerx J, et al. Molecular basis for feedback regulation of bile acid synthesis by nuclear receptors. Mol Cell 2000; 6(3):507-515.

57. Edwards PA, Kast HR, Anisfeld AM. BAREing it all: the adoption of LXR and FXR and their roles in lipid homeostasis. J Lipid Res 2002; 43(1):2-12.

58. Claudel T, Sturm E, Duez H, Torra IP, Sirvent A, Kosykh V, et al. Bile acid-activated nuclear receptor FXR suppresses apolipoprotein A-I transcription via a negative FXR response element. J Clin Invest 2002; 109(7):961-971.

59. Pircher PC, Kitto JL, Petrowski ML, Tangirala RK, Bischoff ED, Schulman IG, et al. Farnesoid x receptor regulates bile Acid-amino Acid conjugation. J Biol Chem 2003; 278(30):27703-27711.

60. Willson TM, Jones SA, Moore JT, Kliewer SA. Chemical genomics: functional analysis of orphan nuclear receptors in the regulation of bile acid metabolism. Med Res Rev 2001; 21(6):513-522.

61. Kok T, Hulzebos CV, Wolters H, Havinga R, Agellon L, Stellaard F, et al. Enterohepatic circulation of bile salts in FXR-defi cient mice: Effi cient intestinal bile salt absorption in the absence of ileal bile acid-binding protein (Ibabp). J Biol Chem 2003;278:4193-7.

62. Hypertriglyceridaemia and vascular risk. Report of a meeting of physicians and scientists, University College London Medical School. Lancet 1993; 342(8874):781-787.

63. McDiarmid SV, Gornbein JA, Fortunat M, Saikali D, Vargas JH, Busuttil RW, et al. Serum lipid abnormalities in pediatric liver transplant patients. Transplantation 1992; 53(1):109-115.

64. Krentz AJ, Cramb R, Dousset B, Mayer D, McMaster P, Buckels J, et al. Serum lipids and apolipoproteins in liver transplant recipients: a comparative study of cyclosporin A and FK 506. J Lab Clin Med 1994; 124(3):381-385.

65. Pratschke J, Neuhaus R, Tullius SG, Jonas S, Bechstein WO, Neuhaus P. Treatment of cyclosporine-related adverse effects by conversion to tacrolimus after liver transplantation: long-term results. Transplant Proc 1998; 30(4):1419-1421.

66. McCune TR, Thacker LR, II, Peters TG, Mulloy L, Rohr MS, Adams PA, et al. Effects of tacrolimus on hyperlipidemia after successful renal transplantation: a Southeastern Organ Procurement Foundation multicenter clinical study. Transplantation 1998; 65(1):87-92.

67. Neal DA, Gimson AE, Gibbs P, Alexander GJ. Benefi cial effects of converting liver transplant recipients from cyclosporine to tacrolimus on blood pressure, serum lipids,

82

Chapter 4

and weight. Liver Transpl 2001; 7(6):533-539.68. Ichimaru N, Takahara S, Kokado Y, Wang JD, Hatori M, Kameoka H, et al. Changes

in lipid metabolism and effect of simvastatin in renal transplant recipients induced by cyclosporine or tacrolimus. Atherosclerosis 2001; 158(2):417-423.

69. Bergink V, Dammers FM, Gouw ASH, Peeters PMJG, Koetse HA, Bijleveld CMA. Withdrawal of CsA in triple drug immunosuppressive regime in children two years post OLT. Gastroenterology 110 (4) Suppl. S. 1-4-1996.

70. Law MR, Wald NJ, Thompson SG. By how much and how quickly does reduction in serum cholesterol concentration lower risk of ischaemic heart disease? BMJ 1994; 308(6925):367-372.

Chapter 5

Enterohepatic circulation of bile salts in farnesoid X receptor-defi cient mice:

effi cient intestinal bile salt absorption in the absence of ileal bile acid-binding protein

Tineke Kok*1, Christian V. Hulzebos*1, Henk Wolters1,Rick Havinga1, Luis B. Agellon2, Frans Stellaard1, Bei Shan3,

Margrit Schwarz4, Folkert Kuipers1

*equally contributed to this study

1 Department of Pediatrics, Center for Liver, Digestive and Metabolic Diseases, University Hospital Groningen, Groningen, The Netherlands.

2 Department of Biochemistry, University of Alberta, Edmonton, Canada.3 Tularik Inc., South San Francisco, California, USA.

4 F.Hoffmann-La Roche Ltd., Pharmaceuticals Division Vascular and Metabolic Diseases, Basel, Switzerland.

The Journal of Biological Chemistry 2003;278:41930-41937© 2003 by the American Society for Biochemistry and Molecular Biology,

Inc. (http://www.jbc.org)

84

Chapter 5

ABSTRACT

Background/Aims: The bile salt-activated farnesoid X receptor (FXR; NR1H4)

controls expression of several genes considered crucial in maintenance of bile salt

homeostasis. We evaluated the physiological consequences of FXR defi ciency on

bile formation and on the kinetics of the enterohepatic circulation of cholate, the

major bile salt species in mice.

Methods: The pool size, fractional turnover rate, synthesis rate, and intestinal

absorption of cholate were determined by stable isotope dilution and were related

to expression of relevant transporters in the liver and intestines of FXR-defi cient

(Fxr (-/-)) mice.

Results: Fxr (-/-) mice showed only mildly elevated plasma bile salt concentrations

associated with a 2.4-fold higher biliary bile salt output, whereas hepatic mRNA

levels of the bile salt export pump (Bsep) were decreased. Cholate pool size

and total bile salt pool size were increased by 67% and 39%, respectively,

in Fxr (-/-) mice compared to wild-type mice. The cholate synthesis rate was

increased by 85% in Fxr (-/-) mice, coinciding with a 2.5-fold increase in cholesterol

7α-hydroxylase (Cyp7a1) and unchanged sterol 12α-hydroxylase (Cyp8b1)

expression in the liver. Despite a complete absence of ileal bile acid-binding

protein (Ibabp) mRNA and protein, the fractional turnover rate and cycling time of

the cholate pool were not affected. The calculated amount of cholate reabsorbed

from the intestine per day was ~2-fold higher in Fxr (-/-) than in wild-type mice.

Conclusions: Absence of FXR in mice is associated with defective feedback

inhibition of hepatic cholate synthesis, which leads to enlargement of the

circulating cholate pool with an unaltered fractional turnover rate. The absence of

Ibabp does not negatively interfere with the enterohepatic circulation of cholate

in mice.

85

Enterohepatic circulation of bile salts in farnesoid X receptor-defi cient mice

INTRODUCTION

Bile salts, synthesized from cholesterol in the liver, have a number of important

physiological functions in the body. Bile salts are essential for generation of bile

fl ow and for biliary excretion of cholesterol. In the intestine, they are required

for effi cient absorption of dietary fat and fat-soluble vitamins1. Finally, there is

a growing body of evidence that bile salts are involved in the control of high

density lipoprotein (HDL)2 and very low density lipoprotein (VLDL)3-5 metabolism.

To ensure the presence of adequate concentrations of these biologically active

compounds at the sites of their actions, i.e., liver, biliary tract and intestine,

bile salts are maintained within the enterohepatic circulation by the combined

actions of transporter systems in the liver and intestine. The bile salt export pump

(Bsep; Abcb11) has been identifi ed as the major canalicular bile salt-transporting

protein6. Intestinal absorption of bile salts is mediated, to a large extent, by the

apical sodium-dependent bile salt transporter (Asbt; Slc10a2) localized in the

terminal ileum7. The Asbt splice variant t-Asbt is localized basolaterally and may

be involved in effl ux of bile salts from enterocytes toward portal blood7. Ileal

bile acid-binding protein (Ibabp) is a small soluble protein of which expression

is restricted to the terminal ileum. Ibabp is thought to be involved in facilitating

uptake of bile salts and their intracellular traffi cking in the small intestine8,9.

After their reabsorption, bile salts are taken up by hepatocytes from portal

blood via the Na+-taurocholate co-transporting polypeptide (Ntcp; Slc10a1)

and Na+-independent organic anion-transporting polypeptides, including Oatp1

(or Slc21a1)10. Only a relatively small fraction of bile salts escapes intestinal

absorption and is lost into the feces, which is compensated for by de novo bile salt

biosynthesis in the liver. Therefore, under steady state conditions, bile salt pool

size remains constant.

Recently, it has been become clear that bile salts exert regulatory actions

on expression of specifi c genes via the nuclear farnesoid X receptor (FXR;

NR1H4)8. Bile salts such as chenodeoxycholate, deoxycholate, cholate, and their

conjugates are natural ligands for FXR. Activated FXR inhibits expression of the

gene encoding cholesterol 7α-hydroxylase (Cyp7a1)11, which catalyzes the fi rst

and rate-controlling step of bile salt synthesis12. This repression is achieved

indirectly via a coordinated regulatory cascade involving FXR-mediated induction

of the small heterodimer partner (SHP; NROB2), which, in turn, inhibits the

activity of the tissue-specifi c factor liver receptor homologue-1 (LRH-1; NR5A2),

which controls expression of Cyp7a111. In this way, bile salts exert negative

feedback control on their own synthesis. Sterol 12α-hydroxylase (Cyp8b1), the

enzyme that controls the ratio in which the primary bile salt species cholate

and chenodeoxycholate are formed, seems to be under the negative control of

bile salts in an FXR-dependent manner as well13. Activated FXR also controls

expression of hepatic bile salt transporters, i.e., it induces the expression of

Bsep14,15 and down-regulates the expression of Ntcp via SHP16. A recent study17

showed that mouse (but not rat) Asbt is also subjected to negative feedback

regulation mediated by FXR via SHP-dependent repression of LRH-1 activation.

Finally, bile salts strongly induce the expression of intestinal Ibabp in an FXR-

dependent manner8,18.

86

Chapter 5

Therefore, in general terms, FXR appears to control various crucial steps in

bile salt metabolism, which may provide possibilities for therapeutic interventions,

e.g., aimed at treatment of hypercholesterolemia or of cholestatic liver diseases.

However, in view of the wide variety of genes that are controlled by FXR, it is

essential to understand the impact of induced alterations in FXR activity, not only

on expression of individual genes, but also on metabolism at the whole body level.

Recent studies in chow-fed FXR-defi cient mice by Sinal et al.13 showed increased

hepatic Cyp7a1 mRNA levels, but, very surprisingly, reductions in total bile salt

pool size and fecal bile salt loss. Counterintuitively, these data imply that, in

the absence of functional FXR, bile salt synthesis would actually be suppressed.

Other mouse models with increased Cyp7a1 expression19,20 showed, as expected,

increased bile salt synthesis rates and expansion of bile salt pool sizes. This may

imply that FXR defi ciency has an impact on maintenance of bile salt pool size at

other levels, for instance in the intestine. To address this issue further, we have

evaluated parameters of the enterohepatic circulation of cholate, quantitatively

the major bile salt species in the mouse, in relation to bile formation and

the expression of transport proteins in a new mouse model of FXR defi ciency

generated by the ‘classical’ homologous recombination approach. For quantitation

of cholate kinetic parameters, a recently developed stable isotope dilution

technique was used21.

This study demonstrates that, in accordance with derepressed transcription

of Cyp7a1, Fxr (-/-) mice do show an increased cholate synthesis rate. Interestingly,

the calculated intestinal cholate reabsorption was markedly increased despite a

complete absence of Ibabp mRNA and protein, leading to an enlarged bile salt

pool size. This fi nding may imply that Ibabp functions as a negative regulator

rather than as a positive regulator of intestinal bile salt reabsorption in the

mouse.

EXPERIMENTAL PROCEDURES

Animals

Fxr (-/-) mice were generated by Deltagen, Inc. (Redwood City, CA) using

standard gene-targeting methods. To disrupt the Fxr locus, a 292 bp fragment

corresponding to a segment of exon 2 was replaced by a phosphoglycerate

kinase promoter-driven neomycin resistance cassette in a targeting vector. The

construct was linearized and electroporated into embryonic stem cells derived

from the 129/OlaHsd strain. Cells harboring the desired mutation were identifi ed

by positive selection and injected into recipient C57BL/6J blastocysts to produce

chimeras, which were used for the generation of F1 heterozygotes. F

2 wild-type,

heterozygous, and homozygous mice were produced from F1 intercross in the

expected mendelian ratios. Genotyping was accomplished by PCR using primer

pairs specifi c for the wild-type Fxr allele (5’-GTT GTA GTG GTA CCC AGA GGC CCT

G-3’ and 5’-TAT GCT AAC AGA ACA CGC GGC AGG C-3’) or the mutant allele (5’-

GTT GTA GTG GTA CCC AGA GGC CCT G-3’ and 5’-GGG TGG GAT TAG ATA AAT

GCC TGC TCT-3’).

Male homozygous (Fxr (-/-)), heterozygous (Fxr

(+/-)) and wild-type (Fxr (+/+)) mice

(C57BL/6Jx129/OlaHsd) of 25-30 g were bred at the animal facility of the

87


University of Groningen and used for these studies. Mice were housed in a light-

and temperature-controlled facility. Food and water were available ad libitum,

and mice were maintained on standard laboratory chow (RMH-B; Hope Farms

BV, Woerden, The Netherlands). All experiments were approved by the Ethical

Committee on animal testing of the University of Groningen.

Materials

[2,2,4,4-2H4]-cholate ([2H

4]-cholate, isotopic purity 98%) was obtained from Isotec

(Miamisburg, OH). Cholylglycine hydrolase from Clostridium perfringens (welchii)

was purchased from Sigma Chemicals (St. Louis, MO). Pentafl uorobenzylbromide

(PFB) was purchased from Fluka Chemie (Buchs, Neu-Ulm, Switzerland). All other

chemicals and solvents used were of the highest purity commercially available.

Methods

Mice were anesthesized with a mixture of Hypnorm (1ml/kg) and Diazepam (10

mg/kg) (Janssen Pharmaceutica, Beerse, Belgium). Six Fxr (-/-), six Fxr

(+/-), and

six wild-type mice were subjected to bile duct cannulation for collection of bile22.

During the 30 min bile collection period, animals were placed in a humidifi ed

incubator to ensure maintenance of body temperature. Bile fl ow was determined

gravimetrically, assuming a density of 1 g/ml for bile. Bile was stored at -200C

until analysis. Blood was obtained by cardiac puncture and collected in EDTA-

containing tubes. Plasma was obtained by centrifugation at 9000 rpm for 10 min

and stored at -800C until analyzed. The livers were excised, weighed, cut into

small pieces, snap-frozen in liquid nitrogen, and stored at -800C until used for

isolation of RNA and for biochemical analyses. Samples for microscopic evaluation

were frozen in isopentane and stored at -800C or fi xed in paraformaldehyde

for hematoxylin/eosin and oil red O staining. The small intestine was rinsed

with phosphate-buffered saline (PBS) containing phenyl-methyl-sulfonylfl uoride

(PMSF) (Roche Applied Science) to prevent protein degradation and divided in

proximal, mid and distal parts. Tissue samples were immediately frozen in liquid

nitrogen and stored at -800C for membrane preparation and for RNA isolation.

Feces were lyophilized, weighed, and homogenized. To collect urine, four wild-type

and four Fxr (-/-) mice were placed in metabolic cages that allowed for separate

collection of feces and urine for a period of 24 h.

In a second experiment, 240 µg of [2H4]-cholate in a solution of 0.5% NaHCO

3 in

PBS (pH = 7.4) was intravenously administered to male Fxr (+/+) and Fxr

(-/-) mice.

Subsequently, blood samples (100 µL) were obtained at 24, 36, 48, and 60 hours

after administration of [2H4]-cholate. Plasma was obtained by centrifugation at

9000 rpm for 10 min and stored at –20ºC until analyzed. After 60 h, the mice

were anesthesized with Hypnorm and Diazepam (see above) and subjected to bile

duct cannulation22. To ensure that hepatic production was accurately measured,

bile produced during the initial 5 min after cannulation was discarded, and bile

was sampled for 30 min thereafter.

Steady-state mRNA levels determined by real-time quantitative PCR

Total RNA was isolated from frozen mouse liver and intestinal tissue using

TRIzol Reagent (Invitrogen) according to the manufacturer’s instructions. RNA

88

Chapter 5

was checked on an agarose gel for integrity, and RNA concentration was

measured using the Ribogreen RNA quantitation kit (Molecular Probes, Leiden,

The Netherlands). Reverse transcription was performed on 2.5 mg of total

RNA using random primers in a fi nal volume of 38 ml (Reverse Transcription

System, Promega, Madison, WI) for 10 min at 250C, followed by one hour at

450C. Samples were subsequently heated for 5 min at 950C to terminate the

reverse transcription reaction. Real-time quantitative PCR was performed on cDNA

samples as described by Heid et al.23 to quantify mRNA levels. Primer and probe

sequences for β-actin, Fxr (Nr1h4), Asbt (Slc10a2), truncated Asbt (t-Asbt), and

Ibabp have been described by Hulzebos et al.24. Primer and probe sequences for

Abcg5, Abcg8, Bsep (Abcb11), Cyp7a1, Cyp27, Mdr2 (Abcb4), Ntcp (Slc10a1),

and Oatp1(Slc21a1) have been described by Plösch et al.25. The following primer

sequences were used for Mrp2 (Abcc2); sense primer GGA TGG TGA CTG TGG

GCT GAT, anti-sense primer GGC TGT TCT CCC TTC TCA TGG and probe AGC TGC

ATC GTC AGG AAT TTC CTC CAC A (Accession number NM_013806). For Cyp8b1;

sense primer AAG GCT GGC TTC CTG AGC TT, anti-sense primer AAC AGC TCA

TCG GCC TCA TC and probe CGG CTA CAC CAA GGA CAA GCA GCA AG (Accession

number NM_010012). For Shp (Nr0b2); sense primer AAG GGC ACG ATC CTC TTC

AA, anti-sense primer CTG TTG CAG GTG TGC GAT GT and probe ATG TGC CAG

GCC TCC GTG CC (Accession number L76567). For Fic1 (Atp8b1); sense primer

CAC ACC AGG ATG GAG AAT CAG A, anti-sense primer GCC AGG AGC CAG TGA

TGA TTA and probe TCT CTG CGA AAT TTG CAC CTC CTG TG (Accession

number AF395823). And for Mrp3 (Abcc3); sense primer TCC CAC TTT TCG

GAG ACA GTA AC, anti-sense primer ACT GAG GAC CTT GAA GTC TTG GA

and probe CAC CAG TGT CAT TCG GGC CTA TGG C (Accession number

BF584533). Primers and detection probes for the gene of interest, labeled with

a fl uorescent reporter dye (6-carboxyfl uorescein) and a fl uorescent quenching

dye (6-carboxytetramethylrhodamine), were added. Fluorescence was measured

by an ABI Prism 7700 Sequence Detector version 1.6 software (Perkin Elmer

Life Sciences, Foster City, CA). For every PCR reaction, β-actin was used as

the internal control. The cycle number at the treshold (CT), after which the

intensity of reporter fl uorescent emission increases, was used to quantitate the

PCR product.

Preparation of intestinal membranes for protein analysis

Intestinal brush border membranes were isolated as described by Schmitz et

al.26. Total protein concentration of intestinal homogenates and brush-border

membrane fractions was determined using the method described by Lowry et

al.27.

Western blotting

Approximately 2.5 µg of protein of homogenates and of intestinal brush-border

membrane fraction of each group was separated using 4-15% Tris-HCL ready

gradient gels (Bio-Rad Laboratories, Hercules, CA) and transferred to nitrocellulose

(Amersham Biosciences, Buckinghamshire, UK) using a tankblotting system

(Bio-Rad laboratories). The Ibabp protein content of intestinal homogenates

and the Asbt protein content of brush-border membranes were determined

89


using recombinant anti-murine Ibabp antibody28 and polyclonal anti-hamster

Asbt antibody29, respectively. The blots were incubated with the fi rst antibody

diluted in Tris-buffered saline (TBS) containing 5% dried milk powder and 0.1%

polyoxyethylene sorbitan monolaurate (Tween 20; Sigma), washed in TBS / 0.1%

Tween 20 and incubated with horseradish peroxidase-labeled donkey anti-rabbit

IgG (dilution 1:1000; Amersham Biosciences). Detection was done using the ECL

Western blot kit (Amersham Biosciences).

Analyses

Bile salt concentrations in plasma, bile, feces and urine were determined by an

enzymatic fl uorimetic assay30. Levels of biliary cholesterol and phospholipids were

measured as described by Kuipers et al.31. Aspartate transaminase (ASAT) and

alanine transaminase (ALAT) activities and total bilirubin concentrations in plasma

were determined by routine clinical chemical procedures.

Gas chromatography

Bile salt composition of bile samples was determined by capillary gas

chromatography on a Hewlett-Packard gas chromatograph (HP 5880A) equipped

with a 50 m x 0.32 mm CP-Sil-19 fused silica column (Chrompack BV, Middelburg,

The Netherlands). For this purpose, bile salts were converted to their methyl

ester/trimethylsilyl derivatives21.

Thin-layer chromatography

Conjugation patterns of biliary bile salts were analyzed by thin-layer

chromatography (TLC) on precoated silica gels (60F254, Merck, Darmstadt,

Germany) using n-butanol-acetic acid-water (10:2:1) as solvent system32.

Gas-liquid chromatography/electron capture negative chemical ionization

mass spectrometry

Plasma samples were prepared for isotopic analysis of bile salts by gas

chromatography mass spectrometry (GC-MS) as described21. All analyses

were performed on a Finnigan SSQ7000 Quadrupole GC-MS instrument. Gas

chromatographic separation was performed on a 15m x 0.25 mm column,

0.25-mm fi lm thickness (AT-5MS, Alltech Associates Inc., Deerfi eld, IL).

Isotope dilution technique calculations

The isotope dilution technique has been described in detail by Hulzebos et al.21.

Enrichment was defi ned as the increase of M4-cholate/ M0-cholate relative to

baseline measurements after administration of [2H4]-cholate and is expressed as

the natural logarithm of atom percent excess (ln APE) value. The decay of ln

APE in time was calculated by linear regression analysis for the individual mice.

From the linear decay curve thus obtained, the fractional turnover rate (FTR)

and pool size of cholate were calculated. The FTR (per day) equals the slope

of the regression line. The pool size (mmol/100g) was determined according to

the formula: (D . b . 100) / ea ) - D, where ‘D’ is the administered amount of

label, ‘b’ is the isotopic purity, and ‘a’ is the intercept on the y-axis of the ln APE

versus time curve. The cholate synthesis rate (mmol/100g/day) was determined

90

Chapter 5

by multiplying pool size and FTR.

Enterohepatic cycling time and intestinal reabsorbtion of cholate

The cholate cycling time, i.e., the time it takes the cholate pool to circulate a

single time in the enterohepatic circulation, was calculated by dividing the cholate

pool size (mmol/100g) by the biliary secretion rate of cholate (mmol/100g/h).

The cholate biliary secretion rate was calculated by multiplying the bile fl ow

(mL/100g/h) by the cholate concentration (mM) in a single 30 min fraction,

obtained from 5 to 35 min after cannulation of the gallbladder. The amount of

cholate reabsorbed per day was calculated by multiplying cholate pool size by

cycling frequency and subsequent subtraction of the daily cholate synthesis rate.

Statistical analyses

All results are presented as means ± SD. Differences between the two or three

groups were determined by t test or one-way analysis of variance (ANOVA),

with post hoc comparison by Newman-Keuls t test, respectively. The level of

signifi cance for all statistical analyses was set at p < 0.05. Analyses were

performed using SPSS for Windows software (SPSS, Chicago, IL).

Figure 1. Targeted disruption of the murine Fxr gene. (A) Genomic organization of the

wild-type allele and of the disrupted allele arising after homologous recombination. Neor,

neomycin resistance cassette; pA, polyadenylation signal. (B) PCR genotyping of wild-type

(Fxr (+/+)), Fxr

(+/-) and Fxr (-/-) mice. Genomic DNA was isolated from animals of the indicated

genotype and amplifi ed via PCR using allele-specifi c primers described under Experimental

Procedures. Products were separated by agarose gel electrophoresis. (C) Northern blot

analysis of hepatic RNA from wild-type(+/+) and Fxr (-/-) mice. Poly (A+) RNA was isolated

from livers and pooled within genotype groups (n=5). Aliquots (3 µg) were separated by

gel electrophoresis, transferred to nylon membranes, and hybridized to a radiolabeled FXR

probe representing a 837-bp BamHI fragment containing the ligand-binding domain (upper

panel). The fi lters were stripped and reprobed with a cDNA encoding rat cyclophilin (lower

panel).

91


RESULTS

Deletion of the Fxr gene

Mutation of the Fxr gene was accomplished by replacement of 292 bp from exon

2 with a neomycin resistance cassette conferring antibiotic resistance (Figure 1A).

Homologous recombination in embryonic stem cells, injection into blastocysts,

and transmission of the mutation through the mouse germ line were carried

out by standard methods. The loss of ~97 amino acids encoded by exon 2 was

anticipated to remove a large part of the DNA-binding domain of the FXR protein.

PCR analysis (Figure 1B) of genomic DNA confi rmed the predicted recombinations.

RNA blotting revealed a Fxr transcript of ~2.0 kb in the livers of wild-type mice,

whereas no transcript was detectable in Fxr (-/-) mice (Figure 1C).

Animal characteristics

The body and liver weights of Fxr (-/-) and Fxr

(+/-) mice at three months of age

were slightly higher than those of wild-type mice, but liver weight/body weight

ratios were not affected (Table 1). There were no differences in plasma alanine

transaminase (ASAT), aspartate transaminase (ALAT) and bilirubin concentrations

between Fxr (-/-), Fxr

(+/-) and Fxr (+/+) mice. Plasma bile salt concentrations were

only slightly increased in Fxr (-/-) mice, in contrast to previously reported data in

another strain of Fxr (-/-) mice described by Sinal et al.13. Accordingly, urinary bile

salt loss was not signifi cantly different between wild-type and Fxr (-/-) mice, i.e.,

67.4 ± 14.6 nmol/day vs. 43.4 ± 11.0 nmol/day, respectively. Examination of

hematoxylin- and eosin-stained liver sections of wild-type, Fxr (+/-) and Fxr

(-/-) mice

did not reveal any overt abnormalities in FXR-defi cient mice (data not shown).

Table 1. Body and liver weights and plasma liver function parameters in wild-type, Fxr

(+/-) and Fxr (-/-) mice

Strain wild-type Fxr(+/-) Fxr(-/-)

Body weight (g) 23.0 ± 1.1 26.5 ± 1.7* 29.2 ± 3.1* Liver weight (g) 1.1 ± 0.1 1.4 ± 0.1* 1.5 ± 0.2* Ratio LW/BW 0.049 ± 0.004 0.051 ± 0.006 0.053 ± 0.006 ASAT (U/L) 98 ± 18 83 ± 14 120 ± 64 ALAT (U/L) 40 ± 8 36 ± 12 63 ± 32Bilirubin (mmol/L) 13.6 ± 2.6 13.0 ± 1.9 12.5 ± 1.0 Bile salts (mmol/L) 18.1 ± 3.6 21.6 ± 3.9 27.2 ± 7.4*

Values are expressed as means ± SD (n = 6 per group). *Signifi cant difference between wild-type and Fxr

(+/-) or Fxr (-/-) mice. BW, body weight; LW, liver weight; ASAT, aspartate

transaminase; ALAT, alanine transaminase.

Effects of FXR defi ciency on bile formation and bile composition

FXR defi ciency in mice was associated with an increase in bile fl ow (Table 2). The

concentrations of phospholipids and cholesterol in bile did not differ among the

three groups, but the biliary bile salt concentration was signifi cantly increased in

Fxr (-/-) mice. As a consequence, biliary output rates of bile salts were signifi cantly

increased in these animals. Output rates of phospholipid and cholesterol tended to

92

Chapter 5

be increased in Fxr (-/-) mice, but differences did not reach statistical signifi cance.

Because biliary secretion of phospholipids and cholesterol is tightly coupled to that

of bile salts32, the output rates of these biliary lipids were also expressed relative

to those of bile salts (Table 2). It is evident that, both for phospholipids and

cholesterol, these ratios were lower in Fxr (-/-) mice than in wild-type mice. When

Figure 2. Relationship between bile fl ow and biliary bile salt secretion in wild-type,

Fxr (+/-) and Fxr

(-/-) mice. Bile was collected for 30 min, and production rates were

determined gravimetrically. Biliary bile salt concentrations were determined as described

under Experimental Procedures. The combined data from wild-type (white circles), Fxr (+/-)

(grey circles) and Fxr (-/-) (black circles) mice reveal the characteristic linear relationship

between biliary bile salt output and bile fl ow that has been reported in several species.

Bile fl ow at the hypothetical zero value of bile salt output represents the magnitude of the

bile salt-independent fraction of bile fl ow (3 µl/min/100g BW), whereas the slope of the

relationship (8 µl/µmol) represents the choleretic activity of biliary bile salts.

Table 2. Concentrations of organic solutes in bile and biliary output rates in wild-type, Fxr (+/-) and Fxr (-/-) mice


Bile (mmol/l) Bile salts (BS) 51.3 ± 17.6 52.6 ± 9.5 82.6 ± 13.5* Phospholipids (PL) 6.65 ± 1.68 5.72 ± 1.36 6.74 ± 1.26 Cholesterol (CH) 0.40 ± 0.07 0.42 ± 0.06 0.43 ± 0.10

Bile fl ow (ml/min/100g body wt) 4.92 ± 1.70 6.40 ± 1.99 7.73 ± 1.5 Biliary output (nmol/min/100g body wt) Bile salts 272 ± 183 347 ± 158 640 ± 157* Phospholipids 32.8 ± 14.4 36.0 ± 13.3 51.3 ± 11.0 Cholesterol 1.99 ± 0.76 2.69 ± 0.98 3.32 ± 0.95PL/BS output ratio 0.14 ± 0.04 0.11 ± 0.04 0.08 ± 0.02* CH/BS output ratio 0.009 ± 0.003 0.008 ± 0.001 0.005 ± 0.002 Values are expressed as means ± SD ( n = 6 per group). *Signifi cant difference between wild-type and Fxr (+/-) or Fxr (-/-) mice.

93


Table 3. Biliary bile salt composition (% total) in wild-type, Fxr(+/-) and Fxr(-/-) Mice


Deoxycholate 2.7 ± 1.1 3.2 ± 1.3 3.3 ± 1.8 α-Muricholate 3.8 ± 0.4 3.0 ± 0.6* 1.7 ± 0.3* β-Muricholate 16.0 ± 2.5 16.3 ± 2.5 11.8 ± 4.5 ω-Muricholate 9.8 ± 2.2 9.1 ± 3.2 6.3 ± 3.4 HDC 3.4 ± 3.0 1.9 ± 1.9 0.6 ± 0.2 Chenodeoxycholate 2.7 ± 1.0 2.0 ± 0.3 1.4 ± 0.4* Cholate 61.6 ± 4.7 64.6 ± 4.1 74.5 ± 7.3*

Values are expressed as means ± SD (n = 6 mice per group). *Signifi cant difference

between wild-type and Fxr (+/-) or Fxr

(-/-) mice.

biliary bile salt output rates were plotted against bile fl ow for the individual mice of

the three groups, the classical linear relationship between these parameters was

observed (Figure 2). This strongly indicates that the bile formation process itself

is not affected by FXR defi ciency and that the higher bile fl ow rate in Fxr (-/-) mice

is caused by the higher bile salt output.

Analysis of biliary bile salt composition (Table 3) revealed that, in all three groups,

cholate constituted the major fraction of biliary bile salts and that this fraction

was higher in Fxr (-/-) mice than in the other two groups. Accordingly, the relative

contents of α-muricholate and chenodeoxycholate were signifi cantly decreased

in Fxr (-/-) mice. Thin-layer chromatography revealed that essentially all biliary

cholate was conjugated to taurine in wild-type as well as in Fxr (-/-) mice (data not

shown). Despite the fact that bile salt-conjugated enzymes have recently been

identifi ed as FXR target genes34, unconjugated bile salts were undetectable by this

procedure in bile of wild-type and Fxr (-/-) mice.

Steady-state mRNA levels of genes involved in bile salt synthesis and bile

formation

Real-time quantitative PCR was used to evaluate hepatic expression of specifi c

genes as infl uenced by FXR defi ciency (Figure 3). As expected, expression of

Shp tended to be lower in Fxr (-/-) mice. Cyp7a1 was clearly increased in Fxr

(-/-)

mice, whereas the expression levels of Cyp27 and Cyp8b1 were not signifi cantly

affected (Figure 3A). The mRNA levels of the gene encoding the canalicular

bile salt transporter Bsep, a well-known FXR target gene14,15, were signifi cantly

decreased in Fxr (-/-) mice (Figure 3B). Expression of other transporters genes

relevant to bile formation, such as the phospholipid translocator Mdr2, Ntcp,

and the putative cholesterol transporters Abcg5/g8, was not changed by FXR

defi ciency. Likewise, no effects on expression of Oatp1, Mrp2, and Mrp3 were

observed.

Effects of FXR defi ciency on kinetic parameters of cholate metabolism

To evaluate the physiological consequences of the observed changes in expression

of bile salt synthesis and transporter genes, kinetic parameters of the enterohepatic

circulation of cholate were determined by stable isotope dilution21. Because of the

small differences between the heterozygotes and wild-type mice with respect to

94

Chapter 5

Figure 4. Decay of intravenously administered [2H4]-cholate in wild-type and Fxr

(-/-) mice.

A dose of 240 µg of [2H4]-cholate was intravenously injected into wild-type (open symbols)

and Fxr (-/-) (closed symbols) mice, and blood samples were collected at 24, 36, 48 and 60

h after injection for determination of plasma cholate enrichments by GC-MS as described

under Experimental Procedures. Values are expressed in a logarithmic fashion, and the pool

size (y-intercept), fractional turnover rate (slope of the curve), and synthesis rate (pool size

x fractional turnover rate) were calculated for individual mice. Data are means ± standard

deviation of n = 5 mice per group.

Figure 3. Steady-state mRNA levels of genes involved in bile salt synthesis and transport in

livers of wild-type, Fxr (+/-) and Fxr

(-/-) mice. Total mRNA was isolated form the livers of wild-

type (white bars), Fxr (+/-) (grey bars) and Fxr

(-/-) (black bars) mice, transcribed into cDNA,

and subjected to real-time PCR as described in Experimental Procedures. (A) Hepatic mRNA

levels of Fxr, Shp, Cyp7a1, Cyp27 and Cyp8b1. (B) Hepatic mRNA levels of Bsep, Mdr2,

Abcg5, Abcg8, Ntcp, Oatp1, Mrp2 and Mrp3. n = 5 for all groups. *Signifi cant difference

between wild-type and Fxr (+/-) or Fxr

(-/-) mice.

95


bile formation and gene expression patterns, kinetic studies were conducted in

wild-type and Fxr (-/-) mice only. Analysis of plasma cholate enrichments over time

(Figure 4) demonstrated that the cholate pool size, calculated from the y-intercept

of the linear regression line shown in Figure 4, was larger in Fxr (-/-) mice than

in wild-type mice (Figure 5A: 42 ± 8 µmol/100g vs. 23 ± 3 µmol/100g, Fxr (-/-)

mice vs. wild-type; p < 0.0001). The percentage of cholate in hepatic bile, as

determined by gas chromatographic analysis in individual mice (Table 3), was

used to calculate total bile salt pool sizes. Under the assumption that all bile salt

species displayed a similar cycling frequency, the calculated total pool sizes of

non-cholate bile salts were similar (22 ± 4 mmol/100g vs. 23 ± 9 mmol/100g,

Fxr (-/-) vs. wild-type mice, respectively, NS), leading to calculated total bile salt

pool sizes of 64 ± 12 and 46 ± 13 mmol/100g in Fxr (-/-) and wild-type mice,

respectively (p < 0.05). Deuterated cholate disappeared from plasma at the same

rate in Fxr (-/-) and wild-type mice (Figure 4). The fractional turnover rate of

cholate, calculated from the slope of the linear regression curve, was similar in

Figure 5. Effects of FXR defi ciency on pool size (A), fractional turnover rate (B), synthesis

rate (C), cycling time (D), and daily intestinal reabsorption (E) of cholate as derived from

[2H4]-cholate isotope enrichment measurements in plasma of wild-type and Fxr (-/-) mice.

The pool size, fractional turnover rate (FTR), synthesis rate, cycling time and daily intesti-

nal reabsorption were calculated in wild-type (white bars) and Fxr (-/-) (black bars) mice as

described under Experimental Procedures. Data are means ± standard deviation of n = 5

mice per group. *Signifi cant difference between wild-type and Fxr (-/-) mice.

96

Chapter 5

both groups of mice. (Figure 5B: 0.5 ± 0.1 per day vs. 0.5 ± 0.2 per day, Fxr (-/-)

vs. wild-type, respectively, NS).

In the Fxr (-/-) mice, the calculated cholate synthesis rate (Figure 5C) was two

times increased compared to the wild-type mice (22 ± 2 mmol/100g/day vs.

11 ± 3 mmol/100g/day, Fxr (-/-) vs. wild-type mice; p < 0.001). In accordance with

the increased cholate synthesis rate determined by stable isotope dilution, fecal

loss of bile salts was increased by ~ 70 % (4.1 ± 1.1 mmol/day vs. 2.3 ± 0.7

mmol/day, Fxr (-/-) vs. wild-type mice; p < 0.05). The calculated cholate cycling

time (Figure 5D) was not affected by FXR defi ciency (4.4 ± 1.3 h vs. 4.3 ± 0.7 h,

Fxr (-/-) mice vs. wild-type mice; NS). The calculated absolute amount of cholate

reabsorbed in the intestines of Fxr (-/-) mice (Figure 5E) was ~ 2 fold larger than

that in the intestines of wild-type mice (227 ± 81 mmol/100g/day vs. 121 ± 11

mmol/100g/day, Fxr (-/-) mice vs. wild-type mice; p < 0.05).

Figure 6. mRNA and protein levels of intestinal bile salt transporters in wild-type and Fxr (-/-)

mice. (A) Steady-state mRNA levels of Asbt, Ibabp, t-Asbt, and Fic-1 in the ilea of wild-

type (white bars) and Fxr (-/-) (black bars) mice. Total mRNA was isolated from the ileum,

transcribed into cDNA, and subjected to real-time PCR as described under Experimental Pro-

cedures. *Signifi cant difference between wild-type and Fxr (-/-) mice. (B) Western blot analy-

sis of Asbt and Ibabp on brush-border membranes and liver homogenates, respectively,

from the ilea of wild-type and Fxr (-/-) mice. Apparent molecular masses are indicated to the

right.

97


Intestinal expression of genes involved in bile salt transport

To provide an explanation for the high bile salt absorption rate in Fxr (-/-) mice,

the mRNA levels of several genes considered to be involved in intestinal bile salt

absorption were determined in the terminal ileum. These studies showed that

expression of Ibabp, a well known FXR target gene8,18 thought to be involved

in intracellular bile salt traffi cking and active bile salt reabsorption8,9, was very

strongly decreased at the mRNA level in Fxr (-/-) mice (Figure 6A). FXR defi ciency

did not affect expression of transporter protein-encoding genes Asbt, responsible

for the major part of active ileal bile salt reabsorption, and of t-Asbt, putatively

involved in basolateral bile salt effl ux. Expression of Fic1 (Atp8b1), a P-type

ATPase proposed to function as an aminophospholipid translocator and essential

for normal bile salt metabolism35, also did not differ at the mRNA level between

wild-type and Fxr (-/-) mice. Western blot experiments on brush-border membrane

fractions and homogenates of the terminal part of the ileum (Figure 6B) showed

that Asbt protein levels were similar in wild-type and Fxr (-/-) mice, whereas the

protein levels of Ibabp were essentially non-detectable in the Fxr (-/-) mice.

DISCUSSION

This study has established the physiological consequences of FXR defi ciency on

bile formation and on the kinetics of enterohepatic bile salt circulation employing

an FXR-null mouse model generated by homologous recombination. A microscale

stable isotope dilution technique21 was used to quantify important parameters

of bile salt metabolism. Data show that the bile formation process per se was

not affected by FXR defi ciency and that effects on bile fl ow seen in Fxr (-/-) mice

were secondary to alterations in bile salt metabolism. In accordance with current

concepts of the role of FXR in control of bile salt synthesis36,37, hepatic Cyp7a1

mRNA levels were signifi cantly increased in Fxr (-/-) mice and were associated with

an increased cholate synthesis rate. Enhanced bile salt synthesis was confi rmed

by increased fecal bile salt loss in Fxr (-/-) mice, although the absolute difference

was somewhat less pronounced among the strains using this methodology. We

attribute the discrepancy between outcome of fecal excretion and the isotope

dilution method to the fact that no stool marker has been applied, which is

required to correct for fecal balance measurements. Furthermore, the intrinsic

diffi culties of quantitative fecal bile salt analysis have been extensively reviewed

by Setchell et al.38. As a consequence of defective feedback inhibition of hepatic

bile salt synthesis, Fxr (-/-) mice developed an increased bile salt pool size, which

implies that potential adaptive responses of intestinal bile salt reabsorption were

not effective in maintenance of the bile salt pool size. No change in intestinal Asbt

mRNA and protein levels was found in FXR-defi cient mice. By contrast, the well

known FXR target gene Ibabp was not expressed at all in the terminal ileum of

Fxr (-/-) mice. Despite the absence of Ibabp, our kinetic study revealed that the

absolute amount of bile salts reabsorbed from the intestine was not reduced, but

was actually enhanced by 2-fold in Fxr (-/-) mice. These fi ndings suggest that Ibabp

may not function as a ‘facilitator’9, but rather as a negative regulator of intestinal

bile salt absorption under physiological conditions in the mouse.

FXR has been shown to be involved in control of various steps of bile

98

Chapter 5

salt metabolism, i.e., synthesis and transport13,36,37,39, as well as in regulation

of plasma lipoprotein metabolism2,3,13,40. FXR-defi cient mice have been very

informative in elucidation of the various functions of this nuclear bile salt-activated

receptor. Studies by Sinal et al.13 and Lambert et al.40 were performed with

FXR-defi cient mice (C57BL/6J-SV129 background) that were generated by Cre-

mediated deletion of a fragment containing the last exon of the Fxr gene, encoding

the ligand-binding/dimerization domain, and the 3’-untranslated region of the

Fxr mRNA. In theory, a truncated protein containing the DNA-binding domain

could be formed that might affect expression of FXR target genes. In this study,

we used an FXR knockout model (C57BL/6J-129/OlaHsd background) generated

by homologous recombination, in which 292 bp of exon 2, encoding a part of

the DNA-binding domain, were deleted. These mice showed plasma HDL and

triglyceride levels (Elzinga et al., unpublished) that were elevated to a similar

extent as reported earlier13. In our study, liver function parameters were found

to be unaffected in Fxr (-/-) mice. Plasma bile salt concentrations were only slightly

increased in Fxr (-/-) mice compared with wild-type mice, in marked contrast to the

8-fold increase in plasma bile salt concentration in Fxr (-/-) mice reported by Sinal et

al.13. These strongly elevated plasma bile salt concentrations have been attributed

to defective hepatobiliary bile salt transport due to down-regulation of the major

canalicular bile salt export pump (Bsep)13. However, we have shown that a similar

or even more pronounced down-regulation of Bsep expression in mice was not

associated with impaired biliary bile salt secretion41. Furthermore, the more than

4-fold increase in biliary bile salt secretion during bile salt feeding in mice42 is

accommodated by a very modest increase in hepatic Bsep expression. These

data have been interpreted to indicate that Bsep at normal expression levels has

a marked overcapacity in mice. In fact, in this study, biliary bile salt secretion

was more than 2-fold increased despite a 40% reduction of Bsep expression.

Therefore, it appears that the livers of Fxr (-/-) mice are well able to handle the

(increased) bile salt load. The discrepancy between both strains with respect to

control of plasma bile salt concentrations remains unexplained at the moment.

FXR defi ciency was associated with an enhanced bile fl ow, as determined

during a 30 min period of bile collection. Biliary bile salt concentrations and

secretion rates were clearly enhanced in Fxr (-/-) mice, reinforcing the issue that

decreased Bsep expression levels do not necessarily correlate with defective bile

salt transport. The increase in bile fl ow in Fxr (-/-) mice appeared to be exclusively

due to the higher bile salt output, as is evident from the linear relationship

between bile fl ow and biliary bile salt output that was obtained when data from

wild-type, Fxr (+/-) mice and Fxr

(-/-) mice were combined (Figure 2). The fact that

values of individual mice from the three groups fi tted well to this relationship

indicates that the actual bile formation process was not affected by FXR defi ciency.

The value found for the choleretic activity (8 µl/µmol) of biliary bile salts is similar

to that reported earlier in rodents43. The bile salt-independent fraction of bile

fl ow (3 µl/min/100g body weight) was unaffected by FXR defi ciency, which is

in accordance with unchanged expression of Mrp2. Mrp2 is crucially involved in

hepatobiliary transport of glutathione44, which represents the major driving force

for the generation of bile salt-independent fl ow in rodents43,45. Although Mrp2 has

been identifi ed as an FXR-target gene46, Fxr (-/-) mice did not show reduced Mrp2

99


mRNA levels in this study or in a study by Schuetz et al.47. Biliary secretion rates

of both cholesterol and phospholipids were slightly enhanced in Fxr (-/-) mice as

compared to wild-type mice. Secretion of cholesterol and phospholipids into bile

is coupled to that of bile salts33. Cholesterol secretion appears to involve the

activity of Abcg5/Abcg8 dimers48,49, although the exact role of this twin transporter

remains to be defi ned50, whereas phospholipid secretion critically depends on the

activity of the Mdr2 P-glycoprotein51,52. Because expression of Abcg5/Abcg8 as

well as of Mdr2 was unaffected in Fxr (-/-) mice (Figure 3B), it is plausible to ascribe

the slight stimulation of biliary lipid secretion entirely to the enhanced bile salt

secretion. It should be noted that Lambert et al.40 did report reduced hepatic

Abcg5/Abcg8 expression in their strain of Fxr (-/-) mice, but this was found to

be associated with increased biliary cholesterol output rates. The reason for the

discrepancy in hepatic Abcg5/Abcg8 expression between both strains of mice is

not clear.

We have focused on the effects of FXR defi ciency on the kinetics of cholate

metabolism. For this purpose, we used a novel microscale isotope dilution

technique, applicable in unanesthetized animals21. FXR defi ciency was associated

with an increased cholate synthesis rate, in accordance with increased hepatic

Cyp7a1 mRNA levels in Fxr (-/-) mice. Although FXR has been advocated as the

major regulator of hepatic bile salt synthesis36,39, the effects of FXR defi ciency

on the basal expression of Cyp7a1 (~ +150%) and cholate synthesis (~ +67%)

were relatively modest. This fi nding underscores the importance of the recently

described FXR/SHP-independent mechanisms of regulation. Recent studies in bile

salt-fed SHP knockout mice53,54 have clearly demonstrated the existence of FXR/

SHP-independent repression of Cyp7a1 expression. Cyp27 and Cyp8b1 expression

levels were not signifi cantly affected in Fxr (-/-) mice, although the latter showed

tendency to increase, in accordance with an increase in the fractional contribution

of cholate in the bile salt pool of Fxr (-/-) mice. The fecal loss of bile salts was

increased by ~70 % in Fxr (-/-) mice. Because the mass of bile salts excreted

into feces is, by defi nition, directly proportional to the amount synthesized in

the liver36, the data on fecal loss confi rm a generalized derepression of bile salt

synthesis in FXR-defi cient mice. This again is at variance with the study of Sinal et

al.13, who reported increased expression of Cyp7a1, but decreased fecal bile salt

loss in Fxr (-/-) mice.

The fractional turnover rate of cholate was similar in wild-type and Fxr (-/-)

mice, whereas the cholate pool size was increased 2-fold in Fxr (-/-) mice, implying

enhanced intestinal cholate reabsorption in Fxr (-/-) mice. The calculated total bile

salt pool size was increased by ~40% in Fxr (-/-) mice. This is in contrast to the

situation reported by Sinal et al.13, i.e., a reduction of the total bile salt pool

size by ~50% in Fxr (-/-) mice fed a chow diet. In this case, bile salt pool size

was measured in homogenates of gallbladder, the liver immediately surrounding

the gall bladder, and the entire small intestine harvested after termination of

the animals. The bile salt contents of the homogenates, which were extracted

into ethanol, were determined colorimetrically. Whether methodological or strain-

differences underlie the deviating results between both studies in not clear: the

stable isotope dilution method is a well established procedure to quantify bile salt

kinetics in humans55 and in laboratory animals21.

100

Chapter 5

Maintenance of bile salt pool size can theoretically be regulated at the level

of the intestine by controlled reabsorption in the terminal ileum. Asbt had been

identifi ed as the major transporter involved in this process. However, expression

of Asbt was not different between wild-type and Fxr (-/-) mice. In contrast, Chen et

al.17 reported an increase in Asbt protein levels in Fxr (-/-) mice, in accordance with

the presence of LRH-1 sites in the promoter of the murine Asbt gene identifi ed by

these authors. t-Abst and Fic1 expression was also not changed at the mRNA level

between wild-type and Fxr (-/-) mice and therefore does not seem to play a role

in enhanced bile salt reabsorption effi ciency. Ibabp, a well known FXR gene, was

drastically down-regulated at mRNA and protein level in the ilea of Fxr (-/-) mice, in

accordance with earlier studies13,17. Ibabp is thought to be involved in intracellular

bile salt traffi cking and to facilitate reuptake of bile salts in the small intestine8,9.

Yet despite the complete absence of Ibabp protein in the ilea of the Fxr (-/-) mice,

daily intestinal cholate reabsorption was much higher than in wild-type mice. This

suggests that, under physiological conditions, Ibabp functions as a negative rather

than as a positive regulator of intestinal bile salt reabsorption in the mouse.

In conclusion, this work shows that the absence of FXR in vivo in mice is

associated with defective feedback inhibition of hepatic cholate synthesis, which

leads to an enlarged circulating cholate pool with an unaltered fractional turnover

rate. The absence of Ibabp does not negatively interfere with the enterohepatic

circulation of cholate in mice.

ACKNOWLEDGMENTS

We thank Sara Berdy, Theo Boer, Renze Boverhof, Anke ter Harmsel, Bert Hellinga,

Laura Hoffmann, Karen Siegler and Fjodor van der Sluijs for excellent technical

assistance. This work was supported by grant 902-23-191 from The Netherlands

Organization for Scientifi c Research (NWO).

101


REFERENCES

1. Hofmann AF. Bile Acids: The Good, the Bad, and the Ugly. News Physiol Sci 1999; 14:24-9.

2. Claudel T, Sturm E, Duez H, Torra IP, Sirvent A, Kosykh V, Fruchart JC, Dallongeville J, Hum DW, Kuipers F, Staels B. Bile acid-activated nuclear receptor FXR suppresses apolipoprotein A-I transcription via a negative FXR response element. J Clin Invest 2002; 109:961-71.

3. Kast HR, Nguyen CM, Sinal CJ, Jones SA, Laffi tte BA, Reue K, Gonzalez FJ, Willson TM, Edwards PA. Farnesoid X-activated receptor induces apolipoprotein C-II transcription: a molecular mechanism linking plasma triglyceride levels to bile acids. Mol Endocrinol 2001; 15:1720-8.

4. Lin Y, Havinga R, Verkade HJ, Moshage H, Slooff MJ, Vonk RJ, Kuipers F. Bile acids suppress the secretion of very-low-density lipoprotein by human hepatocytes in primary culture. Hepatology 1996; 23:218-28.

5. Duane WC. Abnormal bile acid absorption in familial hypertriglyceridemia. J Lipid Res 1995; 36:96-107.

6. Gerloff T, Stieger B, Hagenbuch B, Madon J, Landmann L, Roth J, Hofmann AF, Meier PJ. The sister of P-glycoprotein represents the canalicular bile salt export pump of mammalian liver. J Biol Chem 1998; 273:10046-50.

7. Meier PJ, Stieger B. Bile salt transporters. Annu Rev Physiol 2002; 64:635-61.8. Makishima M, Okamoto AY, Repa JJ, Tu H, Learned RM, Luk A, Hull MV, Lustig KD,

Mangelsdorf DJ, Shan B. Identifi cation of a nuclear receptor for bile acids. Science 1999; 284:1362-5.

9. Landrier JF, Grober J, Zaghini I, Besnard P. Regulation of the ileal bile acid-binding protein gene: an approach to determine its physiological function(s). Mol Cell Biochem 2002; 239:149-55.

10. Kullak-Ublick GA, Stieger B, Hagenbuch B, Meier PJ. Hepatic transport of bile salts. Semin Liver Dis 2000; 20:273-92.

11. Goodwin B, Jones SA, Price RR, Watson MA, McKee DD, Moore LB, Galardi C, Wilson JG, Lewis MC, Roth ME, Maloney PR, Willson TM, Kliewer SA. A regulatory cascade of the nuclear receptors FXR, SHP-1, and LRH-1 represses bile acid biosynthesis. Mol Cell 2000; 6:517-26.

12. Russell DW, Setchell KD. Bile acid biosynthesis. Biochemistry 1992; 31:4737-49.13. Sinal CJ, Tohkin M, Miyata M, Ward JM, Lambert G, Gonzalez FJ. Targeted disruption

of the nuclear receptor FXR/BAR impairs bile acid and lipid homeostasis. Cell 2000; 102:731-44.

14. Ananthanarayanan M, Balasubramanian N, Makishima M, Mangelsdorf DJ, Suchy FJ. Human bile salt export pump promoter is transactivated by the farnesoid X receptor/bile acid receptor. J Biol Chem 2001; 276:28857-65.

15. Plass JR, Mol O, Heegsma J, Geuken M, Faber KN, Jansen PLM, Müller M. Farnesoid X receptor and bile salts are involved in transcriptional regulation of the gene encoding the human bile salt export pump. Hepatology 2002; 35:589-96.

16. Denson LA, Sturm E, Echevarria W, Zimmerman TL, Makishima M, Mangelsdorf DJ, Karpen SJ. The orphan nuclear receptor, shp, mediates bile acid-induced inhibition of the rat bile acid transporter, ntcp. Gastroenterology 2001; 121:140-7.

17. Chen F, Ma L, Dawson PA, Sinal CJ, Sehayek E, Gonzalez FJ, Breslow J, Ananthanarayanan M, Shneider BL. Liver receptor homologue-1 mediates species- and cell line-specifi c bile acid-dependent negative feedback regulation of the apical sodium-dependent bile acid transporter. J Biol Chem 2003; 278:19909-16.

18. Grober J, Zaghini I, Fujii H, Jones SA, Kliewer SA, Willson TM, Ono T, Besnard P. Identifi cation of a bile acid-responsive element in the human ileal bile acid-binding protein gene. Involvement of the farnesoid X receptor/9-cis-retinoic acid receptor heterodimer. J Biol Chem 1999; 274:29749-54.

19. Li-Hawkins J, Gafvels M, Olin M, Lund EG, Andersson U, Schuster G, Bjorkhem I, Russell DW, Eggertsen G. Cholic acid mediates negative feedback regulation of bile acid synthesis in mice. J Clin Invest 2002; 110:1191-200.

20. Miyake JH, Doung XD, Strauss W, Moore GL, Castellani LW, Curtiss LK, Taylor JM, Davis RA. Increased production of apolipoprotein B-containing lipoproteins in the absence

102

Chapter 5

of hyperlipidemia in transgenic mice expressing cholesterol 7alpha-hydroxylase. J Biol Chem 2001; 276:23304-11.

21. Hulzebos CV, Renfurm L, Bandsma RHJ, Verkade HJ, Boer T, Boverhof R, Tanaka H, Mierau I, Sauer PJJ, Kuipers F, Stellaard F. Measurement of parameters of cholic acid kinetics in plasma using a microscale stable isotope dilution technique: application to rodents and humans. J Lipid Res 2001; 42:1923-9.

22. Kuipers F, van Ree JM, Hofker MH, Wolters H, In ‘t Veld G, Havinga R, Vonk RJ, Princen HM, Havekes LM. Altered lipid metabolism in apolipoprotein E-defi cient mice does not affect cholesterol balance across the liver. Hepatology 1996; 24:241-7.

23. Heid CA, Stevens J, Livak KJ, Williams PM. Real time quantitative PCR. Genome Res 1996; 6:986-94.

24. Hulzebos CV, Wolters H, Plösch T, Kramer W, Stengelin S, Stellaard F, Sauer PJJ, Verkade HJ, Kuipers F. Cyclosporin A and enterohepatic circulation of bile salts in rats: decreased cholate synthesis but increased intestinal reabsorption. J Pharmacol Exp Ther 2003; 304:356-63.

25. Plösch T, Kok T, Bloks VW, Smit MJ, Havinga R, Chimini G, Groen AK, Kuipers F. Increased hepatobiliary and fecal cholesterol excretion upon activation of the liver X receptor is independent of ABCA1. J Biol Chem 2002; 277:33870-7.

26. Schmitz J, Preiser H, Maestracci D, Ghosh BK, Cerda JJ, Crane RK. Purifi cation of the human intestinal brush border membrane. Biochim Biophys Acta 1973; 323:98-112.

27. Lowry OH, Rosebrough AL, Farr AL, Randal RJ. Protein measurement with the Folin phenol reagent. J Biol Chem 1951; 193:265-75.

28. Labonte ED, Li Q, Kay CM, Agellon LB. The relative ligand binding preference of the murine ileal lipid binding protein. Protein Expr Purif 2003; 28:25-33.

29. Torchia EC, Stolz A, Agellon LB. Differential modulation of cellular death and survival pathways by conjugated bile acids. BMC Biochem 2001; 2:11.

30. Mashige F, Imai K, Osuga T. A simple and sensitive assay of total serum bile acids. Clin Chim Acta 1976; 70:79-86.

31. Kuipers F, Havinga R, Bosschieter H, Toorop GP, Hindriks FR, Vonk RJ. Enterohepatic circulation in the rat. Gastroenterology 1985; 88:403-11.

32. Parmentier G, Eyssen H. Thin-layer chromatography of bile salt sulphates. Journal of Chromatography 1978; 152:285-9.

33. Verkade HJ, Vonk RJ, Kuipers F. New insights into the mechanism of bile acid-induced biliary lipid secretion. Hepatology 1995; 21:1174-89.

34. Pircher PC, Kitto JL, Petrowski ML, Tangirala RK, Bischoff ED, Schulman IG, Westin SK. Farnesoid X receptor regulates bile acid-amino acid conjugation. J Biol Chem 2003; 278:27703-11.

35. Bull LN, van Eijk MJ, Pawlikowska L, DeYoung JA, Juijn JA, Liao M, Klomp LW, Lomri N, Berger R, Scharschmidt BF, Knisely AS, Houwen RH, Freimer NB. A gene encoding a P-type ATPase mutated in two forms of hereditary cholestasis. Nat Genet 1998; 18:219-24.

36. Chiang JY. Bile Acid regulation of gene expression: roles of nuclear hormone receptors. Endocr Rev 2002; 23:443-63.

37. Russell DW. The Enzymes, Regulation, and Genetics of Bile Acid Synthesis. Annu Rev Biochem 2003; 72:137-74.

38. Setchell KD, Street JM, Sjövall J. The bile acids: Chemistry, Physiology,and Metabolism. Plenum Publishing Corp, New York. 1988: 457-62.

39. Lu TT, Repa JJ, Mangelsdorf DJ. Orphan nuclear receptors as eLiXiRs and FiXeRs of sterol metabolism. J Biol Chem 2001; 276:37735-8.

40. Lambert G, Amar MJ, Guo G, Brewer HB, Gonzalez FJ, Sinal CJ. The farnesoid X-receptor is an essential regulator of cholesterol homeostasis. J Biol Chem 2003; 278:2563-70.

41. Kok T, Bloks VW, Wolters H, Havinga R, Jansen PLM, Staels B, Kuipers F. Peroxisome proliferator-activated receptor alpha (PPARalpha)-mediated regulation of multidrug resistance 2 (Mdr2) expression and function in mice. Biochem J 2003; 369:539-47.

42. Wolters H, Elzinga BM, Baller JF, Boverhof R, Schwarz M, Stieger B, Verkade HJ, Kuipers F. Effects of bile salt fl ux variations on the expression of hepatic bile salt transporters in vivo in mice. J Hepatol 2002; 37:556-63.

43. Kuipers F, Enserink M, Havinga R, van der Steen AB, Hardonk MJ, Fevery J, Vonk RJ. Separate transport systems for biliary secretion of sulfated and unsulfated bile acids in

103


the rat. J Clin Invest 1988; 81:1593-9.44. Paulusma CC, Bosma PJ, Zaman GJ, Bakker CT, Otter M, Scheffer GL, Scheper RJ,

Borst P, Oude Elferink RPJ. Congenital jaundice in rats with a mutation in a multidrug resistance-associated protein gene. Science 1996; 271:1126-8.

45. Ballatori N, Truong AT. Glutathione as a primary osmotic driving force in hepatic bile formation. Am J Physiol 1992; 263:G617-G624.

46. Kast HR, Goodwin B, Tarr PT, Jones SA, Anisfeld AM, Stoltz CM, Tontonoz P, Kliewer S, Willson TM, Edwards PA. Regulation of multidrug resistance-associated protein 2 (ABCC2) by the nuclear receptors pregnane X receptor, farnesoid X-activated receptor, and constitutive androstane receptor. J Biol Chem 2002; 277:2908-15.

47. Schuetz EG, Strom S, Yasuda K, Lecureur V, Assem M, Brimer C, Lamba J, Kim RB, Ramachandran V, Komoroski BJ, Venkataramanan R, Cai H, Sinal CJ, Gonzalez FJ, Schuetz JD. Disrupted bile acid homeostasis reveals an unexpected interaction among nuclear hormone receptors, transporters, and cytochrome P450. J Biol Chem 2001; 276:39411-8.

48. Yu L, Li-Hawkins J, Hammer RE, Berge KE, Horton JD, Cohen JC, Hobbs HH. Overexpression of ABCG5 and ABCG8 promotes biliary cholesterol secretion and reduces fractional absorption of dietary cholesterol. J Clin Invest 2002; 110:671-80.

49. Yu L, Hammer RE, Li-Hawkins J, Von Bergmann K, Lutjohann D, Cohen JC, Hobbs HH. Disruption of Abcg5 and Abcg8 in mice reveals their crucial role in biliary cholesterol secretion. Proc Natl Acad Sci U S A 2002; 99:16237-42.

50. Kosters A, Frijters RJ, Schaap FG, Vink E, Plösch T, Ottenhoff R, Jirsa M, De Cuyper IM, Kuipers F, Groen AK. Relation between hepatic expression of ATP-binding cassette transporters G5 and G8 and biliary cholesterol secretion in mice. J Hepatol 2003; 38:710-6.

51. Smit JJ, Schinkel AH, Oude Elferink RPJ, Groen AK, Wagenaar E, van Deemter L, Mol CA, Ottenhoff R, van der Lugt NM, van Roon MA. Homozygous disruption of the murine mdr2 P-glycoprotein gene leads to a complete absence of phospholipid from bile and to liver disease. Cell 1993; 75:451-62.

52. Oude Elferink RPJ, Ottenhoff R, van Wijland M, Smit JJ, Schinkel AH, Groen AK. Regulation of biliary lipid secretion by mdr2 P-glycoprotein in the mouse. J Clin Invest 1995; 95:31-8.

53. Kerr TA, Saeki S, Schneider M, Schaefer K, Berdy S, Redder T, Shan B, Russell DW, Schwarz M. Loss of nuclear receptor SHP impairs but does not eliminate negative feedback regulation of bile acid synthesis. Dev Cell 2002; 2:713-20.

54. Wang L, Lee YK, Bundman D, Han Y, Thevananther S, Kim CS, Chua SS, Wei P, Heyman RA, Karin M, Moore DD. Redundant pathways for negative feedback regulation of bile acid production. Dev Cell 2002; 2:721-31.

55. Stellaard F, Sackmann M, Sauerbruch T, Paumgartner G. Simultaneous determination of cholic acid and chenodeoxycholic acid pool sizes and fractional turnover rates in human serum using 13C-labeled bile acids. J Lipid Res 1984; 25:1313-9.

Chapter 6

Effects of pharmacological FXR activation on the enterohepatic circulation of bile salts in rats: inhibition of cholate synthesis rate and reduced cholate pool size despite increased expression of the intestinal bile acid-binding

protein (Ibabp)

Christian V. Hulzebos*1, Tineke Kok*1, Henk Wolters1, Fjodor van der Sluijs1, Theo Boer1, Rick Havinga1, Luis B. Agellon2,

Frans Stellaard1, Pieter J.J. Sauer1, Folkert Kuipers1


1 Center for Liver, Digestive and Metabolic Diseases, Laboratory of Pediatrics, University Hospital, Groningen, The Netherlands.

2 Canadian Institutes of Health Research Group in Molecular and Cell Biology of Lipids and the Department of Biochemistry, University of Alberta,

Edmonton, Canada.

Submitted

106

Chapter 6

ABSTRACT

Background/ Aims: The farnesoid X receptor (FXR; NR1H4) controls transcription

of genes involved in bile salt metabolism. We studied the physiological

consequences of treatment of rats with the FXR agonist GW4064 (25 mg.kg-1.day-1

for 6 days) on kinetics of cholate, the major bile salt species in rats.

Methods: Pool size, fractional turnover rate, synthesis rate and cycling time of

cholate were determined by stable isotope dilution and related to expression of

relevant hepatic and intestinal transporters.

Results: Cholate synthesis rate was decreased by 50%, which was associated

with a reduction of the cholate pool size upon GW4064 treatment. Reduced cholate

synthesis coincided with a ~50% decrease in hepatic sterol 12α-hydroxylase

(Cyp8b1) expression. Expression of the ileal bile acid-binding protein (Ibabp) was

increased with a shift towards proximal parts of the ileum upon FXR activation.

Yet, fractional turnover rate, cycling time, as well as the calculated intestinal loss

of cholate were not signifi cantly affected.

Conclusions: Cholate synthesis rate and cholate pool size are reduced in rats

treated with an FXR agonist. FXR induced expression of intestinal Ibabp apparently

did not enhance bile salt reabsorption to maintain pool size under these conditions

of impaired bile salt synthesis.

107

Pharmacological FXR activation and enterohepatic circulation of bile salts

INTRODUCTION

Bile salts serve a number of important functions in the body. Hepatobiliary

excretion of bile salts provides the main driving force for generating bile fl ow1.

Secondly, due to their detergent properties, bile salts aid in the solubilization

of biliary lipids (phospholipids, cholesterol) and facilitate intestinal absorption

of dietary fats including fat-soluble vitamins1. Thirdly, bile salts participate in

regulation of pancreatic enzyme activities and release of cholecystokinine2. Finally,

bile salts are essential in cholesterol homeostasis: conversion of cholesterol into

bile salts and their subsequent fecal excretion provides the major route for

elimination of excess cholesterol3. In addition, bile salts also act as signaling

molecules. Bile salts exert regulatory actions on expression of specifi c genes

via activation of a nuclear receptor, i.e, the farnesoid X receptor (FXR;NR1H4)4.

Bile salt-activated FXR controls expression of several genes considered crucial in

maintenance of bile salt and cholesterol homeostasis3;5. Activated FXR inhibits

transcription of the Cyp7a1 gene, encoding cholesterol 7α-hydroxylase which

catalyzes the fi rst and rate-limiting step in bile salt synthesis6. This repression

is achieved indirectly via a coordinated regulatory cascade involving other

liver-specifi c factors, including small heterodimer partner (SHP;NROB2)7. Sterol

12α-hydroxylase (Cyp8b1), the enzyme that controls the ratio in which the

primary bile salt species cholate and chenodeoxycholate are being formed, is also

negatively controlled by FXR8. Furthermore, activated FXR controls expression

of hepatic and intestinal bile salt transporters. It directly induces the expression

of Bsep (Abcb11)9 and down-regulates the expression of Na+-taurocholate

co-transporting polypeptide (Ntcp;Slc10a1) via SHP10. Two intestinal proteins

are considered to facilitate intestinal bile salt reabsorption; the apical sodium-

dependent bile salt transporter (Asbt;Slc10a2) and the ileal bile acid-binding

protein (Ibabp)11. Chen et al. demonstrated that murine Asbt appears to be

subjected to negative feedback regulation mediated by FXR activation in a species-

dependent manner, although recent studies did not confi rm this12;13. Intestinal

expression of Ibabp, considered to be involved in intracellular traffi cking of bile

salts, is strongly induced by bile salts via FXR4;14. In agreement with this concept,

FXR-defi ciency in mice results in a strong downregulation of Ibabp mRNA and

protein levels13. It has also been demonstrated that FXR regulates genes involved

in control of plasma lipids15-17. Consequently, FXR may represent a novel drug for

treatment or prevention of cardiovascular disease.

In view of the broad spectrum of genes controlled by FXR, it is essential

to understand the impact of pharmacologically induced alterations in FXR activity,

not only on expression of individual genes, but also on physiological parameters.

We have evaluated the effects of prolonged treatment with the FXR agonist

GW4064 on whole body kinetics of the enterohepatic circulation of cholate, the

major primary bile salt in rats. Pool size, fractional turnover rate, synthesis rate

and intestinal absorption of cholate were determined by stable isotope dilution

and related to expression of relevant transporters in liver and intestine.

108

Chapter 6

EXPERIMENTAL PROCEDURES

Animals

Male Wistar rats (Harlan Laboratories, Zeist, The Netherlands), were fed standard

rodent diet (RMH-B, Hope Farms BV, Woerden, The Netherlands) and tapwater ad

libitum. Experimental protocols were approved by the local Ethical Committee for

Animal Experiments.

Materials

[2,2,4,4-2H4]-cholate [2H

4]-cholate, isotopic purity 98%) was obtained from

Isotech Inc. (Miamisburg, OH). Cholylglycine hydrolase from Clostridium

perfringens (welchii) was purchased from Sigma Chemicals (St. Louis, MO).

Pentafl uorobenzylbromide (PFB) was purchased from Fluka Chemie (Buchs, Neu-

Ulm, Switzerland).


Rats were equipped with a permanent heartcatheter under halothane anesthesia18.

After recovery during 2 days, rats were treated with the FXR agonist GW4064

(dose 25 mg.kg-1.day-1) or solvent (DMSO 0.5%; cremophor 0.5%; 5% water/

mannitol) by gavage for 6 days. GW4064 was kindly provided by Dr. B. Shan

and Dr. M. Schwarz (Tularik Incorporated, South San Franscisco, CA). At day

6, [2H4]-cholate (5 mg/rat) was intravenously administered to GW4064-treated

and control rats. Blood samples (0.25 mL) were collected before and at 6, 12,

24, 36 and 48 hours after administration of [2H4]-cholate. Plasma was obtained

by centrifugation at 9000 rpm for 10 minutes and stored at -20 °C. At day 8,

animals were anaesthesized by intraperitoneal injection of Hypnorm (1 ml/kg)

and Diazepam (10 mg/kg) (Janssen Pharmaceutica, Beerse, Belgium) and after

collection of a single 15-minute bile sample via a bile fi stula the liver and small

intestine were removed. The distal end of the small intestine was rinsed with cold

phosphate-buffered saline containing phenyl-methyl-sulfonylfl uoride (PMSF) to

prevent protein degradation and divided in proximal, medial and distal segments.

Tissue samples were immediately frozen in liquid nitrogen and stored at -80°C for

membrane preparation and RNA isolation.

Analytical procedures

Plasma alanine transaminase (ALAT), aspartate transaminase (ASAT) and bilirubin

were determined by routine laboratory techniques. Total bile salts in plasma

and bile were determined according to Mashige19. Plasma triglycerides, HDL

cholesterol and total cholesterol were determined using kits (Roche Molecular

Biochemicals, Mannhein, Germany). Levels of biliary cholesterol and phospholipids

were measured as described by Kuipers et al.18.

Gas chromatography

Bile salt composition of bile samples was determined by capillary gas

chromatography as methylester-trimethylsilyl derivatives on a Hewlett Packard

gas chromatograph (HP 5880 A), equipped with a 50m x 0.32mm, CP-Sil-19 fused

silica column (Chrompack BV, Middelburg, The Netherlands).

109


Gas-Liquid Chromatography Electron Capture Negative Chemical

Ionization Mass Spectrometry

Plasma samples were prepared for bile salt analysis by gas chromato graphy/

electron capture negative chemical ionization mass spectrometry (GC-MS) as

described by Hulzebos et al.20. All analyses were performed on a Finnigan

SSQ7000 Quadrupole GC-MS instrument (Finnigan MAT, San José). GC separation

was performed on a 15m x 0.25mm column, 0.25µm fi lm thickness (AT-5MS,

Alltech Associates Inc., Deerfi eld, IL).

Western blotting

Intestinal brush border membranes were isolated as described by Schmitz et al.21.

Protein concentration was determined as described by Lowry et al.22. Separation

of proteins was performed on 4-15% gradient gels (BioRad, Hercules, USA) and

proteins were transferred to ECL-Hybond nitrocellulose (Amersham Little Chalfont,

CA) by Western blotting. Ibabp content of intestinal homogenates and Asbt con-

tent of brush border membranes, were determined as described by Kok et al.13.

Intensities of the protein bands were measured by densitometry.

RNA isolation and PCR procedures

Total RNA from liver and the three intestinal sections per animal was isolated

and quantifi ed using Ribogreen (Molecular Probes, Inc., Leiden, The Netherlands).

cDNA synthesis was done as previously described13. Primers were obtained

from Invitrogen (Carlsbad, USA). Fluorogenic probes, labeled with 6-carboxy-

fl uorescein (FAM) and 6-carboxy-tetramethyl-rhodamine (TAMRA), were made by

Eurogentec (Seraing, Belgium). Primers and probes sequences for β-actin, Fxr

(Nr1h4), Asbt (Slc10a2), truncated Asbt (t-Asbt) and Ibabp have been described

by Hulzebos et al.23. Primer and probe sequences for Bsep (Abcb11), Cyp7a1,

Cyp27, and Ntcp (Slc10a1) have been described by Plösch et al.24. Primer and

probes of Mrp2 (Abcc2) Cyp8b1, Shp (Nr0b2), Fic1 (Atp8b1) and for Mrp3 (Abcc3)

have been described by Kok et al.13. Realtime PCR was performed as previously

described13. All expression data were standardized for β-actin, which was analyzed

in separate runs.

Isotope dilution technique calculations

The area ratio M4-CA/M

0-CA was calculated as described by Hulzebos et al.20.

Enrichment was expressed as the natural logarithm of atom % excess (ln APE)

value. The decay of ln APE in time was calculated by linear regression analysis.

The fractional turnover rate (FTR) (day-1) equals the slope of the regression

line. The pool size (µmol.100g-1) was determined according to the formula:

(D.b.100) / ea)-D, where D is the administered amount of label, b is the isotopic

purity, and a is the intercept on the y-axis of the ln APE versus time curve. Cholate

synthesis rate (µmol.100g-1.day-1) was determined by multiplying pool size and

FTR.

Enterohepatic cycling time and intestinal reabsorption of cholate

The cholate cycling time, i.e., the time it takes the cholate pool to circulate a

single time in the enterohepatic circulation, was calculated by dividing the cholate

110

Chapter 6

pool size (µmol.100g-1) by the biliary secretion rate of cholate (µmol.100g-1.h-1).

The biliary secretion of cholate was calculated by multiplying the bile fl ow

(µL.100g-1.h-1) with the cholate concentration (mM) in a single 15-minute bile

fraction. The amount of cholate reabsorbed per day was calculated by multiplying

pool size and cycling frequency (cycling frequency is equal to 24 /cycling time)

and subtracting daily synthesis rate.

Statistical analysis

All results are presented as means ± standard deviation. Differences between

GW4064-treated and control rats were evaluated by Mann Whitney U-test. Level

of signifi cance for statistical analyses was set at p < 0.05. Analysis was performed

using SPSS 10 for Windows software (SPSS, Chicago, IL).

RESULTS

Animal characteristics and effects of treatment with the FXR agonist

GW4064 on liver function parameters and plasma lipid levels

Treatment with GW4064 neither affected body weights nor liver weights (Table 1).

There were no signifi cant differences in aspartate and alanine transaminase activi-

ties nor in plasma bilirubin concentrations between GW4064-treated and control

rats (Table 1). Plasma bile salt concentrations were somewhat decreased in the

GW4064-treated rats. Levels of plasma HDL cholesterol were signifi cantly ele-

vated, whereas total cholesterol levels remained unaffected. Plasma triglycerides

were slightly, but not signifi cantly lower after treatment with GW4064.

Table 1. Animal characteristics, parameters of liver function and plasma lipids. Control GW4064

Body weight (g) 320 ± 29 329 ± 18Liver weight (g) 12 ± 1.0 12 ± 0.5Liver/body weight ratio 0.037 ± 0.002 0.036 ± 0.001Bile salts (µmol/L) 50 ± 31 29 ± 30Total bilirubin (µmol/L) 7.3 ± 1.2 7.2 ± 0.8Alanine transaminase (U/L) 85 ± 113 43 ± 6Aspartate transaminase (U/L) 117 ± 105 71 ± 17Cholesterol (mmol/L) 1.8 ± 0.2 1.8 ± 0.2HDL cholesterol (mmol/L) 1.1 ± 0.1 1.3 ± 0.1*Triglycerides (mmol/L) 0.76 ± 0.27 0.53 ± 0.14

Male Wistar rats were treated with GW4064 or solvent only for 6 days. GW4064 was administered orally at a dose of 25 mg.kg-1.day-1. Means ± SD of control and GW4064-treated rats (n = 5-6 per group). The asterisk indicates signifi cant difference (Mann-Whitney U test, p < 0.05).

Effects of GW4064 treatment on kinetic parameters of cholate metabolism

Figure 1 shows plasma cholate enrichments over time and demonstrates that

deuterated cholate disappeared from plasma at the same rate after treatment

with GW4064 or with its solvent. The cholate pool size (Figure 2A), calculated

from the y-intercept of the linear regression line (Figure 1), was reduced by ~45%

after treatment with the FXR agonist (13±2 µmol.100g-1 vs. 24±5 µmol.100g-1,

111


Figure 1. Decay of intravenously administered [2H4]-cholate in male Wistar rats treated with

the FXR agonist GW4064 or its solvent. A dose of 5 mg of [2H4]-cholate was intravenously

injected in male Wistar rats treated with GW4064 (closed bars) or solvent only (open bars).

Blood samples were collected at 12, 24, 36, and 48h after injection for determination of

plasma cholate enrichments by GC-MS as described under Experimental procedures. Data

represent means ± SD of n = 4 rats per group. The asterisks indicate signifi cant difference

(Mann-Whitney U test, p < 0.05).

Figure 2. Effects of treatment with the FXR agonist GW4064 on pool size (A), fractional

turnover rate (B), synthesis rate (C), cycling time (D), and cholate reabsorption (E) of

cholate as derived from [2H4]-cholate isotope enrichment measurements in plasma. Pool

size, fractional turnover rate, synthesis rate, cycling time and fecal loss were calculated as

described under Experimental Procedures. Data represent means ± standard deviation of

n = 4 rats per group. The asterisks indicate signifi cant difference (Mann-Whitney U test,

p < 0.05).

112

Chapter 6

Figure 3. Hepatic mRNA expression levels of genes involved in bile salt metabolism and

transport in male Wistar rats treated with the FXR agonist GW4064 or its solvent measured

by real-time PCR. Steady-state mRNA levels of Fxr, Shp, Cyp7a1, Cyp27, Cyp8b1, Ntcp,

Mrp2 and Bsep. Total mRNA was isolated from male Wistar rats treated with the FXR agonist

GW4064 (closed bars) or solvent only (open bars), transcribed into cDNA, and subjected to

real-time PCR as described under Experimental Procedures (n = 5 per group). All data were

standardized for β-actin. Expression in control rats receiving solvent only was set to 1.00.

GW4064-treated rats signifi cantly different from controls, *:p < 0.05; **:p < 0.01.

GW4064-treated rats vs. controls; p < 0.01). The fractional turnover rate of

cholate (Figure 2B), calculated from the slope of the linear regression curve (Figure

1), was similar in GW4064-treated rats and controls (0.34±0.06 pools.day-1 vs.

0.37±0.07 pools.day-1, respectively). GW4064 decreased the cholate synthesis

rate (Figure 2C) by ~50% compared with controls (4.5±0.6 µmol.100g-1.day-1

vs. 8.5±0.6 µmol.100g-1.day-1, GW4064-treated rats vs. controls; p < 0.001).

The cholate cycling time (Figure 2D) was not affected upon treatment with

the FXR agonist (2.0±1.1 h vs. 2.1±0.6 h, GW4064-treated rats vs. controls;

NS). Consequently, the calculated absolute amount of cholate lost per cycle

was decreased upon GW4064 treatment (0.34±0.15 µmol.100g-1 vs. 0.73±0.21

µmol.100g-1, GW4064-treated rats vs. controls; p < 0.05). The calculated amount

of cholate reabsorbed per day (Figure 2E) tended to be reduced upon treatment,

but the difference between both groups did not reach statistical signifi cance

(196±94 µmol.100g-1.day-1 vs. 293±94 µmol.100g-1.day-1, GW4064-treated rats

vs. controls; NS).

Effects of GW4064 treatment on steady-state hepatic mRNA levels of

genes involved in bile salt synthesis and bile salt transport

Expression levels of Fxr and Shp were unaffected upon treatment with GW4064

(Figure 3). Levels of Cyp7a1 mRNA tended to decrease upon treatment, but,

like those of Cyp27, were not signifi cantly affected. In contrast, mRNA levels of

Cyp8b1 were signifi cantly decreased. Moreover, mRNA levels of the gene encoding

the canalicular bile salt transporter Bsep were signifi cantly increased upon treat-

ment with GW4064. Expression of other transporters relevant to bile salt uptake

and bile formation, like Ntcp and Mrp2, were not changed by treatment with the

FXR agonist.

113


Table 2. Biliary bile salt# composition in male Wistar rats after treatment with the FXR agonist GW4064 or its solvent.

Strain α-MC β-MC ∆22β-MC C CDC HDC DC

Control 4 ± 1 4 ± 2 10 ± 3 66 ± 2 4 ± 1 6 ± 2 4 ± 2GW4064 4 ± 1 6 ± 3 11 ± 5 56 ± 5* 7 ± 1* 9 ± 2 4 ± 1

Male Wistar rats were treated with GW4064 or solvent only for 6 days. GW4064 was administered orally at a dose of 25 mg.kg-1.day-1. #:> 90% of all bile salt species represented. α-MC = α-Muricholate, β-MC = β-Muricholate, ∆22β-MC = ∆22β-Muricholate, C = Cholate, CDC = Chenodeoxycholate, HDC = Hyodeoxycholate, DC = Deoxycholate. Values are expressed as a percentage of the total amount. Means ± SD of control and GW4064-treated rats (n = 5-6 per group). The asterisks indicate signifi cant difference (Mann-Whitney U test, p < 0.05).

Table 3. Bile fl ow and biliary output rates in male Wistar rats treated with the FXR agonist GW4064 or its solvent.

Control GW4064

Bile fl ow (µl/min/100 g BW) 5.9 ± 0.3 6.5 ± 0.6Biliary output (nmol/min/100 g BW) Bile salt output 313 ± 92 268 ± 109 Cholate output 209 ± 66 151 ± 63 Phospholipid output 30.6 ± 2.9 32.2 ± 11.3 Cholesterol output 3.37 ± 1.10 3.35 ± 0.95

Male Wistar rats were treated with GW4064 or solvent only for 6 days. GW4064 was administered orally at a dose of 25 mg.kg-1.day-1. Means ± SD of control and GW4064-treated rats (n = 3-5 per group). BW = body weight.

Effects of GW4064 treatment on bile formation and bile composition

Total biliary bile salt concentration was similar in both groups (53±18 mmol/L

vs. 41±16 mmol/L, GW4064-treated rats vs. controls; NS). As expected from

reduced Cyp8b1 expression, the cholate fraction in bile was decreased and the

relative proportion of chenodeoxycholate was signifi cantly increased upon treat-

ment with GW4064 (Table 2). GW4064 treatment did not affect bile fl ow rate after

interruption of the enterohepatic circulation (Table 3). Biliary bile salt secretion

rate was not signifi cantly altered upon GW4064 treatment and biliary phospholipid

and cholesterol output rates, which are coupled to secretion of bile salts, were

also similar.

Effects of GW4064 treatment on steady-state intestinal mRNA levels and

protein expression of Ibabp

The mRNA levels of genes encoding proteins involved in intestinal bile salt

transport were measured in different sections of the terminal small intestine.

GW4064 treatment did not affect mRNA levels of Asbt, Fic1 (both putatively

involved in bile salt uptake25;26), tAsbt and Mrp3 (both putatively involved in baso-

lateral effl ux25) and Fxr and Shp (data not shown). GW4064 treatment caused

a huge increase in Ibabp expression in the proximal and medial parts of the

ileum (Figure 4A). In agreement with this, an increase in Ibabp protein levels was

114

Chapter 6

observed upon treatment with GW4064 (Figure 4B). In control rats, Ibabp protein

level was exclusively detectable in the distal part, while after GW4064 treatment

Ibabp protein was also clearly present in the medial segments. Asbt protein levels

varied among individual animals of the same group, but were not signifi cantly

changed between treated and control rats (data not shown).

Figure 4. Ibabp mRNA (A) and protein expression (B) in the small intestine of male Whistar

rats treated with the FXR agonist GW4064 or its solvent measured by real-time PCR and

Western blot. Wistar rats were treated with GW4064 (closed bars) or solvent only (open

bars) for 6 days (n = 4 per group); the 30 cm distal end of the small intestine was removed,

rinsed with cold phosphate-buffered saline, and analyzed as described under Experimental

Procedures. (A) Steady-state Ibabp mRNA levels (insert) and relative GW4064-induced

changes in Ibabp expression in subsequent ileal sections and (B) Ibabp protein levels in

the 30 cm distal end of the small intestine of control and GW4064-treated rats, detected

by Western blot analysis (upper panel). Quantifi cation of Ibabp protein expression with

densitometry in proximal (P), medial (M), and distal (D) ileum after GW4064 treatment

(lower panel). Ibabp protein levels were expressed as percentage of the distal ileum of the

control group. Analysis was done as described in the Materials and Methods section.

Results are shown for three sequential distal brush border membrane fractions per animal,

and for two animals per group that are representative for n = 4 per group. GW4064-treated

rats signifi cantly different from controls, *:p < 0.05.

115


DISCUSSION

To evaluate the physiological consequences of pharmacological FXR activation

by GW4064 on the enterohepatic circulation of bile salts, kinetic parameters of

cholate metabolism were determined using a stable isotope dilution method20.

Cholate synthesis rate was ~2-fold reduced upon FXR activation by treatment

with GW4064 in rats in accordance with current concepts3,27. Impaired cholate

synthesis coincided with a 50% decrease in mRNA levels of Cyp8b1, encoding

sterol 12α-hydroxylase, which regulates the ratio in which the primary bile salts

cholate and chenodeoxycholate are being formed3. Accordingly, the amount of

cholate in bile was reduced relative to that of chenodeoxycholate upon treatment

with the FXR agonist. Cyp7a1 mRNA expression levels tended to be decreased

after treatment with GW4064. The absence of signifi cantly reduced Cyp7a1 mRNA

levels may be related to several factors. Harvesting of liver was performed

~4 h into the light phase, i.e., when expression is low28. Under the conditions

employed, expression of Shp, putatively involved in transcriptional regulation of

Cyp7a1, was also unaffected. Cyp7a1 expression is regulated via Shp-dependent

as well as via Shp-independent pathways29;30. Our data delineate the fact that

hepatic Cyp7a1 mRNA expression levels not always refl ect bile salt synthesis

rate in rats. The combination of slightly reduced hepatic expression of Cyp7a1

mRNA and the major induction of intestinal Ibabp exression could well be related

to a poor bioavailability after enteral administration of GW406431. The poor

solubility and relatively short half-life of GW4064 may, at least in part, explain

the discrepancy with Liu et al. who reported decreased expression of bile salt

biosynthetic genes, increased Shp expression and increased expression of genes

involved in bile salt uptake and hepatobiliary transport upon intraperitoneal

injection of GW406431;32. An increase in liver gene expression four to six hours

after a single enteral dose has been observed in other studies using this

compound (personal communication Stacey Jones, Nuclear Receptor Functional

Analysis, High Throughput Biology, GlaxoSmithKline, NC). Therefore, for longer

term studies dosing GW4064 twice daily by oral gavage is preferable as well as

sacrifi cing the rats four hours following a dose. Upon treatment with GW4064, the

cholate pool size was reduced, related to FXR induced reduction of the cholate

synthesis rate. Recently, Liu et al. reported that GW4064 treatment resulted in

signifi cant reductions in serum and histological parameters of liver damage in rat

models of extrahepatic and intrahepatic cholestasis32. Thus, hepatoprotection by

the synthetic FXR agonist seen in these animal models of cholestasis suggests

that clinical application of selective FXR-ligands may be benefi cial in treatment of

cholestatic liver disease.

Under steady state conditions, bile salt pool size is maintained by

compensation of hepatic de novo bile salt synthesis, which compensates for fecal

bile salt loss. Several studies indicate that regulation of the bile salt pool size may

not only occur at the level of hepatic biosynthesis, but that intestinal events can

infl uence the bile salt pool size independently33. The maintenance of cholate pool

size and a reduced cholate synthesis in cyclosporin A-treated rats was associated

with increased Asbt protein expression in the distal ileum23. Disruption of the

Slc10a2 gene, encoding Asbt, results in an increased bile salt synthesis in the

116

Chapter 6

presence of a decreased bile salt pool size in Asbt (-/-) mice34. In the current study,

administration of the FXR agonist had no clear effect on mRNA expression of

Asbt localized in the terminal ileum. In contrast, expression of the FXR target

gene Ibabp, was increased in the terminal ileum and this protein expression

shifted towards more proximal segments upon GW4064-treatment. Yet, these

intestinal adaptations did not fully compensate for the impaired bile salt synthesis,

considering the smaller bile salt pool size upon FXR activation. In FXR-defi cient

mice, in which Ibabp protein was undetectable, the absolute amount of cholate

reabsorbed by the intestine was increased rather than decreased13. Awaiting

defi nitive data on Ibabp knockout mice, these results suggest that the presumed

role of Ibabp in bile salt transport needs revision4;14.

Bile formation per se was not affected upon treatment with GW4064 in rats.

No changes occured in the biliary output of cholesterol, phospholipids or bile salts.

Biliary bile salt output was unchanged despite the signifi cant increase of mRNA

levels of Bsep. It has been postulated that Bsep, at normal expression levels,

has already a marked overcapacity, at least in mice35. Considering the constancy

of bile salt secretion, the ~50% increase of Bsep expression could be a direct

consequence of treatment with GW4064. Mrp2 mRNA levels were unaffected upon

treatment with GW4064, although Mrp2 has been identifi ed as an FXR target

gene36. Yet, various other studies indicate that FXR-defi ciency in mice does not

affect hepatic Mrp2 mRNA levels13;37.

Apart from its central role in bile salt metabolism, FXR plays an important

role in control of plasma lipid concentrations17. Fxr (-/-) mice exhibit increased

plasma lipid concentrations (Elzinga et al., unpublished data)8. Selective ligands

for FXR could therefore, in theory, contribute to novel therapeutic approaches

to treat hyperlipidemia. Indeed, triglyceride levels were reduced by 30% under

the conditions employed. Although statistically non-signifi cant, a decrease of this

magnitude can still be relevant in clinical practice38. In Fischer rats treated with

the same FXR ligand the decrease of plasma triglyceride levels appeared to be

dose-dependent39.

In conclusion, treatment with the FXR agonist GW4064 in rats is associated

with inhibition of the cholate synthesis rate and reduction of the cholate pool size.

Induction of intestinal Ibabp expression does not enhance bile salt reabsorption

to maintain pool size under this condition of impaired bile salt synthesis.

ACKNOWLEDGEMENTS

We thank Stacey Jones, Nuclear Receptor Functional Analysis, High Throughput

Biology, GlaxoSmithKline, Research Triangle Park, NC for assistance in preparing

the manuscript and Renze Boverhof for technical assistance.

117


REFERENCES


2. Koop I, Schindler M, Bosshammer A, Scheibner J, Stange E, Koop H. Physiological control of cholecystokinin release and pancreatic enzyme secretion by intraduodenal bile acids. Gut 1996; 39: 661-7.

3. Russell DW. The Enzymes, Regulation, and Genetics of Bile Acid Synthesis. Annu Rev Biochem 2003.

4. Makishima M, Okamoto AY, Repa JJ, Tu H, Learned RM, Luk A, Hull MV, Lustig KD, Mangelsdorf DJ, Shan B. Identifi cation of a nuclear receptor for bile acids. Science 1999; 284: 1362-5.

5. Lu TT, Repa JJ, Mangelsdorf DJ. Orphan nuclear receptors as eLiXiRs and FiXeRs of sterol metabolism. J Biol Chem 2001; 276: 37735-8.

6. Russell DW, Setchell KD. Bile acid biosynthesis. Biochemistry 1992; 31: 4737-49.7. Goodwin B, Jones SA, Price RR, Watson MA, McKee DD, Moore LB, Galardi C, Wilson

JG, Lewis MC, Roth ME, Maloney PR, Willson TM, Kliewer SA. A regulatory cascade of the nuclear receptors FXR, SHP-1, and LRH-1 represses bile acid biosynthesis. Mol Cell 2000; 6: 517-26.

8. Sinal CJ, Tohkin M, Miyata M, Ward JM, Lambert G, Gonzalez FJ. Targeted disruption of the nuclear receptor FXR/BAR impairs bile acid and lipid homeostasis. Cell 2000; 102: 731-44.

9. Plass JR, Mol O, Heegsma J, Geuken M, Faber KN, Jansen PL, Muller M. Farnesoid X receptor and bile salts are involved in transcriptional regulation of the gene encoding the human bile salt export pump. Hepatology 2002; 35: 589-96.

10. Denson LA, Sturm E, Echevarria W, Zimmerman TL, Makishima M, Mangelsdorf DJ, Karpen SJ. The orphan nuclear receptor, shp, mediates bile acid-induced inhibition of the rat bile acid transporter, ntcp. Gastroenterology 2001; 121: 140-7.

11. Trauner M, Boyer JL. Bile salt transporters: molecular characterization, function, and regulation. Physiol Rev 2003; 83: 633-71.

12. Chen F, Ma L, Dawson PA, Sinal CJ, Sehayek E, Gonzalez FJ, Breslow J, Ananthanarayanan M, Shneider BL. Liver receptor homologue-1 mediates species- and cell line-specifi c bile acid-dependent negative feedback regulation of the apical sodium-dependent bile acid transporter. J Biol Chem 2003; 278: 19909-16.


14. Landrier JF, Grober J, Zaghini I, Besnard P. Regulation of the ileal bile acid-binding protein gene: an approach to determine its physiological function(s). Mol Cell Biochem 2002; 239: 149-55.

15. Edwards PA, Kast HR, Anisfeld AM. BAREing it all: the adoption of LXR and FXR and their roles in lipid homeostasis. J Lipid Res 2002; 43: 2-12.

16. Claudel T, Inoue Y, Barbier O, Duran-Sandoval D, Kosykh V, Fruchart J, Fruchart JC, Gonzalez FJ, Staels B. Farnesoid X receptor agonists suppress hepatic apolipoprotein CIII expression. Gastroenterology 2003; 125: 544-55.

17. Claudel T, Sturm E, Duez H, Torra IP, Sirvent A, Kosykh V, Fruchart JC, Dallongeville J, Hum DW, Kuipers F, Staels B. Bile acid-activated nuclear receptor FXR suppresses apolipoprotein A-I transcription via a negative FXR response element. J Clin Invest 2002; 109: 961-71.

18. Kuipers F, Vonk RJ. Enterohepatic circulation in the rat. Gastroenterology 1985; 88: 403-11.

19. Mashige F, Imai K, Osuga T. A simple and sensitive assay of total serum bile acids. Clin Chim Acta 1976; 70: 79-86.

20. Hulzebos CV, Renfurm L, Bandsma RH, Verkade HJ, Boer T, Boverhof R, Tanaka H Mierau I, Sauer PJJ, Kuipers F and Stellaard F. Measurement of cholic acid kinetics in plasma using a micro scale stable isotope technique: application to rodents and man. J Lipid Res 2001; 42:1923-1929.

21. Schmitz J, Preiser H, Maestracci D, Ghosh BK, Cerda JJ, Crane RK. Purifi cation of the

118

Chapter 6

human intestinal brush border membrane. Biochim Biophys Acta 1973; 323: 98-112.22. Lowry OH, Rosebrough AL, Farr AL, Randal RJ. Protein measurement with the Folin

phenol reagent. J Biol Chem 1951; 193: 265-75.23. Hulzebos CV, Wolters H, Plosch T, Kramer W, Stengelin S, Stellaard F, Sauer PJJ,

Verkade HJ, Kuipers F. Cyclosporin A and enterohepatic circulation of bile salts in rats: decreased cholate synthesis but increased intestinal reabsorption. J Pharmacol Exp Ther 2003; 304: 356-63.

24. Plosch T, Kok T, Bloks VW, Smit MJ, Havinga R, Chimini G, Groen AK, Kuipers F. Increased hepatobiliary and fecal cholesterol excretion upon activation of the liver X receptor is independent of ABCA1. J Biol Chem 2002; 277: 33870-7.

25. Meier PJ, Stieger B. Bile salt transporters. Annu Rev Physiol 2002; 64:635-61.: 635-61.

26. Bull LN, van Eijk MJ, Pawlikowska L, DeYoung JA, Juijn JA, Liao M, Klomp LW, Lomri N, Berger R, Scharschmidt BF, Knisely AS, Houwen RH, Freimer NB. A gene encoding a P-type ATPase mutated in two forms of hereditary cholestasis. Nat Genet 1998; 18: 219-24.


28. Noshiro M, Nishimoto M, Okuda K. Rat liver cholesterol 7 alpha-hydroxylase. Pretranslational regulation for circadian rhythm. J Biol Chem 1990; 265: 10036-41.

29. Kerr TA, Saeki S, Schneider M, Schaefer K, Berdy S, Redder T, Shan B, Russell DW, Schwarz M. Loss of nuclear receptor SHP impairs but does not eliminate negative feedback regulation of bile acid synthesis. Dev Cell 2002; 2: 713-20.

30. Davis RA, Miyake JH, Hui TY, Spann NJ. Regulation of cholesterol-7alpha-hydroxylase: BAREly missing a SHP. J Lipid Res 2002; 43: 533-43.


32. Liu Y, Binz J, Numerick MJ, Dennis S, Luo G, Desai B, MacKenzie KI, Mansfi eld TA, Kliewer SA, Goodwin B, Jones SA. Hepatoprotection by the farnesoid X receptor agonist GW4064 in rat models of intra- and extrahepatic cholestasis. J Clin Invest 2003; 112: 1678-87.

33. Xu G, Shneider BL, Shefer S, Nguyen LB, Batta AK, Tint GS, Arrese M, Thevananther S, Ma L, Stengelin S, Kramer W, Greenblatt D, Pcolinsky M, Salen G. Ileal bile acid transport regulates bile acid pool, synthesis, and plasma cholesterol levels differently in cholesterol-fed rats and rabbits. J Lipid Res 2000; 41: 298-304.

34. Dawson PA, Haywood J, Craddock AL, Wilson M, Tietjen M, Kluckman K, Maeda N, Parks JS. Targeted deletion of the ileal bile Acid transporter eliminates enterohepatic cycling of bile acids in mice. J Biol Chem 2003; 278: 33920-7.


36. Kast HR, Goodwin B, Tarr PT, Jones SA, Anisfeld AM, Stoltz CM, Tontonoz P, Kliewer S, Willson TM, Edwards PA. Regulation of multidrug resistance-associated protein 2 (ABCC2) by the nuclear receptors pregnane X receptor, farnesoid X-activated receptor, and constitutive androstane receptor. J Biol Chem 2002; 277: 2908-15.

37. Zollner G, Fickert P, Fuchsbichler A, Silbert D, Wagner M, Arbeiter S, Gonzalez FJ, Marschall HU, Zatloukal K, Denk H, Trauner M. Role of nuclear bile acid receptor, FXR, in adaptive ABC transporter regulation by cholic and ursodeoxycholic acid in mouse liver, kidney and intestine. J Hepatol 2003; 39: 480-8.

38. Law MR, Wald NJ, Thompson SG. By how much and how quickly does reduction in serum cholesterol concentration lower risk of ischaemic heart disease? BMJ 1994; 308: 367-72.

39. Willson TM, Jones SA, Moore JT, Kliewer SA. Chemical genomics: functional analysis of orphan nuclear receptors in the regulation of bile acid metabolism. Med Res Rev 2001; 21: 513-22.

Chapter 7

Bile duct proliferation associated with bile salt-induced hypercholeresis in Mdr2

P-glycoprotein-defi cient mice

Christian V. Hulzebos*1, Peter J. Voshol*1,2, Henk Wolters1, Janine K. Kruit1, Roelof Ottenhof3, Albert K. Groen3,

Frans Stellaard1, Henkjan J. Verkade1 and Folkert Kuipers1.


1 Center for Liver, Digestive and Metabolic Diseases, Department of Pediatrics, University Hospital Groningen, Groningen,

2 TNO Prevention and Health, Leiden, 3 Department of Gastrointestinal and Liver Diseases, Academic Medical Center,

Amsterdam, The Netherlands.

Liver International, 2004 (in press)

120

Chapter 7

ABSTRACT

Background/Aims: Bile fl ow consists of bile salt-dependent bile fl ow (BSDF),

generated by canalicular secretion of bile salts, and bile salt-independent fl ow

(BSIF), probably of combined canalicular and ductular origin. Bile salt transport

proteins have been identifi ed in cholangiocytes, suggesting a role in control of

BSDF and/or in control of bile salt synthesis through cholehepatic shunting.

Methods: We studied effects of bile duct proliferation under non-cholestatic

conditions in Mdr2 P-glycoprotein (Abcb4)-defi cient (Mdr2(-/-)) mice. BSDF and

BSIF were determined in wild-type and Mdr2(-/-) mice during infusion of step-wise

increasing dosages of tauroursodeoxycholate (TUDC). Cholate synthesis rate

was determined by [2H4]-cholate dilution. Results were related to expression of

transport proteins in liver and intestine.

Results: During TUDC infusion, BSDF was increased by ~50% and BSIF by

~100% in Mdr2(-/-) mice compared to controls. Cholate synthesis rate was

unaffected in Mdr2(-/-) mice. Hepatic expression of the apical sodium-dependent bile

salt transporter (Asbt), its truncated form (tAbst) and the multidrug resistance-

related protein (Mrp3) were up-regulated in Mdr2(-/-) mice.

Conclusions: Bile duct proliferation in Mdr2(-/-) mice enhances cholehepatic

shunting of bile salts, which is associated with a disproportionally high bile fl ow

but does not affect bile salt synthesis.

121

Bile duct proliferation enhances bile fl ow

INTRODUCTION

Bile fl ow is generated via canalicular and ductular processes and is composed

of bile salt-dependent (BSDF) and bile salt-independent fl ow (BSIF)1. Active

transport of bile salts by hepatocytes into bile canaliculi is responsible for the

bile salt-dependent canalicular bile fl ow2. Bile salt-independent generation of

bile is considered to result from net transport into bile of organic solutes (e.g.,

glutathione) and inorganic electrolytes by hepatocytes or cholangiocytes, followed

by osmotic movement of water, putatively mediated by aquaporins3;4.

Several studies support the concept that cholangiocytes interact with biliary

bile salts. Cholangiocytes are able to conjugate bile salts to taurine or glycine

and bile salts increase proliferation of cholangiocytes in vitro5;6. In vivo, bile

salt feeding in rats induces cholangiocyte proliferation and an increases secretin-

induced, i.e., bile salt independent, ductular bile fl ow7;8. Cholangiocytes have also

been suggested to infl uence the BSDF, via their role in the so-called “cholehepatic

shunt pathway”, originally proposed to explain the hypercholeresis observed after

administration of certain (unconjugated) bile salt species9;10. According to this

concept, cholangiocytes absorb unconjugated bile salts after their protonation

by passive diffusion. Subsequently, these bile salts return to the liver to be

resecreted into the bile, thereby promoting additional movement of water. The

apical sodium-dependent bile salt transporter (Asbt/ Slc10a2) is, in addition to the

terminal ileum, present at the apical membrane of cholangiocytes lining the large

hepatic bile ducts in rats and facilitates uptake of conjugated bile salt species11;12.

Bile salt effl ux from the basolateral membrane of cholangiocytes may involve

a truncated isoform of Asbt (t-Asbt) and/ or the multidrug-resistance protein 3

(Mrp3/ Abcc3)13-15.

Cholehepatic circulation could play a role in feedback repression of de novo

bile salt synthesis and control expression of hepatocytic transport systems for

bile salts, i.e., Ntcp and Bsep, via activation of the farnesoid X receptor (FXR;

NR1H4)16;17. Especially during conditions associated with bile duct proliferation

such as extrahepatic cholestasis, cholehepatic circulation of bile salts could

thus protect the liver from further bile salt toxicity by limiting intracellular

accumulation.

Bile duct proliferation has been shown to enhance de novo secretin-stimulated bile

fl ow in rat models and humans8;18-20. It is not known whether bile duct proliferation

is associated with changes in BSDF and/or bile salt synthesis. Therefore, we

studied whether bile duct proliferation without cholestasis is associated with

altered BSDF, BSIF and/or bile salt synthesis. As a model for bile duct proliferation

without cholestasis we made use of Mdr2 P-glycoprotein (or Abcb4) -defi cient

(Mdr2(-/-)) mice that are unable to secrete phospholipids into bile and develop

progressive bile duct proliferation in the absence of obstructive cholestasis21;22.

MATERIALS AND METHODS

Animals

Mice homozygous for disruption of the multidrug resistance gene-2 (Mdr2(-/-))

and control (Mdr2(+/+)) mice of the same FVB background were obtained from

122

Chapter 7

the Animal Facility of the AMC, Amsterdam. Mice were ~4 months old, were

housed in a light- and temperature-controlled facility and fed standard lab-chow.

Experiments were approved by the ethical committee on animal testing.


Gallbladders of anaesthesized mice were cannulated for bile collection to analyze

biliary bile salt composition and output rate, before and during intravenously

infusion of tauroursodeoxycholate (TUDC) as described23. Bile fl ow was determined

gravimetrically. Determination of [2H4]-cholate kinetics was performed in six male

Mdr2(+/+) and six male Mdr2(-/-) mice as reported previously24. At the end of the

experiment, liver and intestine were removed. The intestine was divided in three

segments: proximal, medial and distal. The proximal part includes the duodenum

and proximal jejunum, the medial part consists of jejunum and the distal part

includes the terminal ileum. Samples were frozen in liquid nitrogen and stored at

-80oC for membrane and RNA isolation.

Bile salt analyses

Plasma samples were prepared for bile salt enrichments by gas chromato graphy

mass spectrometry (GC-MS) as described24. Biliary bile salt composition was

determined by capillary gas chromatography as described25. Biliary bile salt

concentrations were determined by an enzymatic fl uorimetic assay26.

Steady state mRNA levels in liver and intestine

Total RNA was isolated using TRIzol (GIBCO BRL, Grand Island, NY).

Reverse transcription was performed with random primers and real time

quantitative PCR was performed as described previously27. Primer and probe

sequences have been described for β-actin, Fxr, Asbt, truncated Abst and

Ibabp28, for Bsep29, and for Mrp2 and Mrp330, except for Cftr (sense:

5’-CCGGTGACAACATGGAACAC-3; antisense: 5’-AGAAGCAGCCACCTCAACCA-3’,

probe:5’-TCTCCATAAAGGCTTACTGCTAGTGCTGATTTG-3’; accession number:

NM_021050). Probes were labelled with a reporter (6-carboxy-fl uorescein) and a

quenching dye (6-carboxy-tetramethyl-rhodamine). Fluorescence was measured

by an ABI Prism 7700 Sequence Detector v. 1.6 software (Perkin-Elmer Corp.,

Foster City, California). β-actin was used as internal control. The mRNA levels

of -actin and Asbt in intestine were determined by semi-quantitative RT-PCR

using the following primers; β-actin (sense: AACACCCCAGCCATGTACG; antisense:

ATGTCACGCACGATTTCCC), Asbt (sense primer: GCTTCTGTGGACTTGGCCAT;

antisense primer: TGGAGCAAGTGGTCATGCTA). Relative intensity of the bands

was determined using a the ImageMaster VDS system (Pharmacia, Upsalla,

Sweden).

Immunohistochemistry

To localize the Asbt protein in liver and intestine, 4 µm sections were cut of

these tissues and fi xed with acetone. The fi rst antibody, anti-Asbt (guinea pig

anti-Asbt in 1% BSA/PBS)31 was incubated and washed with PBS. Endogenous

peroxidase was inhibited using 30% methanol, 0.3% H2O

2 and detection was done

with peroxidase-linked rabbit anti-guinea pig-Ig (Dako A/S, Glostrup, Denmark)

123


with an amplifi cation step using goat anti-rabbit-Ig (Dako A/S). 3-Amino-9-

ethylcarbozole (Sigma, St. Louis, MO) was used as a substrate and tissue was

counterstained with haematoxylin.

Western blotting

Liver homogenates and total membranes were isolated as decribed by Wolters et

al.32. Intestinal brush border membranes were isolated as described by Schmitz

et al.33. Protein concentrations were determined according to Lowry et al.34.

Hepatic total membranes (30 µg protein), intestinal homogenates and intestinal

brush border membranes (2.5 µg of protein) were separated using 4-15% Tris-

HCL ready gradient gels (Bio-Rad Laboratories, Hercules, CA) and transferred to

nitrocellulose (Amersham, Little Chalfont, UK), using a tankblotting system (Bio-

Rad laboratories, Hercules, CA). Mrp3 and Asbt protein content were determined

using goat polyclonal antibody (Santa Cruz Biotechnology Inc., Santa Cruz, CA,

USA), and polyclonal anti-rat Asbt antibody31, respectively. Ibabp protein content

was determined using anti-murine Ibabp antibody35. Immunecomplexes were

detected using horseradish peroxidase - conjugated antibodies, and ECL detection

(Amersham, Little Chalfont, UK).

Calculations

Isotope dilution technique

The isotope dilution technique was performed as described by Hulzebos et al.24.

Enrichment was defi ned as the increase of M4-CA/M


measurements after administration of [2H4]-CA and expressed as the natural

logarithm of atom % excess (ln APE)36. The fractional turnover rate (FTR) and pool

size of CA were calculated from the decay of ln APE. The FTR (day-1) equals the

slope of the regression line. The pool size (µmol.100g-1) is determined according

to the formula: (D.b.100)/ea )-D, where D is the administered amount of label, b

is the isotopic purity, and “a” is the intercept on the y-axis of the ln APE curve.

Cholate synthesis rate (µmol.100g-1.day-1) was determined by multiplying pool

size and FTR.

Cycling time

Cholate cycling time was estimated by dividing mean cholate pool size by mean

biliary secretion rate of cholate. The fraction of cholate lost per enterohepatic

cycle was calculated by dividing fractional cholate synthesis rate by cholate cycling

frequency and expressed as percentage of total cholate pool size25.

Statistical analysis

Results are presented as means ± standard deviation for the number of animals

indicated. Differences between groups were determined by Student’s t-test or

Mann Whitney exact 2-tailed U-test. Level of signifi cance for all statistical analyses

was p < 0.05. Analysis was performed using SPSS 10.0 (SPSS, Chicago, IL,

USA).

124

Chapter 7

Table 1. Biliary bile salt output rates and bile salt composition (% total) in chow-fed male wild-type and Mdr2(-/-) mice.

Strain Wild-type Mdr2(-/-)

Bile salt output (nmol⋅min-1⋅100g body wt-1) 309 ± 88 394 ± 88 Cholate output (nmol⋅min-1⋅100g body wt-1) 130 ± 37 109 ± 24Bile salt composition (% total) Cholate 42.2 ± 5.4 27.7 ± 4.3*Deoxycholate 2.0 ± 0.6 0.6 ± 0.4*α-Muricholate 3.8 ± 0.7 1.9 ± 0.2β-Muricholate 31.3 ± 4.5 47.3 ± 0.7*ω-Muricholate 14.0 ± 1.5 13.4 ± 4.3Lithocholate 5.4 ± 0.4 8.6 ± 0.2*Chenodeoxycholate 1.3 ± 0.1 0.8 ± 0.1*

Total bile salt and cholate biliary output rates determined in Mdr2(-/-) and Mdr2(+/+) mice. The gallbladders of the mice were cannulated and bile was collected for 30 minutes. Biliary bile salts represent >90% of all bile salt species. Values are expressed as means ± SD (n = 3 per group). *Signifi cant difference between wild-type and Mdr2(-/-) mice, p < 0.05.

RESULTS

Bile salt independent fl ow and bile salt dependent fl ow in control and

Mdr2(-/-) mice

To examine the consequence of bile duct proliferation on bile fl ow, the gallbladders

of Mdr2(-/-) and control mice were cannulated and the bile salt pool was depleted

to exclude potential effects of differences in bile salt pool composition. Analysis of

biliary bile salt composition revealed relatively decreased proportions of cholate

and increased proportions of β-muricholate in Mdr2(-/-) mice compared to control

mice (Table 1), in accordance with previously published results23. Total biliary bile

salt secretion tended to be higher in Mdr2(-/-) mice than in controls (p = 0.06), but

cholate secretion rates were similar (Table 1).

TUDC was infused intravenously in step-wise increasing dosages. Analysis of the

relationship between bile fl ow and biliary bile salt output (Figure 1) revealed a

~50% higher choleretic activity of TUDC in Mdr2(-/-) mice compared to controls

(7.2 ± 1.6 µL/µmol vs. 4.7 ± 0.9 µL/µmol, Mdr2(-/-) vs. control mice; p < 0.05).

The BSIF, i.e, the theoretical value of the bile fl ow in the absence of bile salt

output was 2-fold increase in Mdr2(-/-) mice (10.8 ± 1.7 µL.min-1.100g-1 vs.

5.4 ± 1.1 µL.min-1.100g-1, Mdr2(-/-) vs. control mice; p < 0.05).

Effects of Mdr2-Pgp defi ciency on expression of hepatic bile salt transport

proteins

Hepatic mRNA levels of genes encoding transporters considered to be involved in

bile salt transport in cholangiocytes, i.e., Asbt, and tAsbt were clearly increased

in Mdr2(-/-) mice (Figure 2A). Moreover, hepatic mRNA levels of Mrp3, putatively

involved in bile salt effl ux from the cholangiocyte was also markedly increased in

Mdr2(-/-) mice. Yet, Mrp3 is also expressed in hepatocytes and these results do not

allow to differentiate hepatocytes and cholangiocytes. Levels of Fxr mRNA were

increased in Mdr2-P-glycoprotein defi cient mice. Expression of hepatocytic Mrp2

125


Figure 1. Relation between bile fl ow and biliary bile salt output for Mdr2(-/-) (closed circles)

and control (open circles) mice.

After cannulation of the gallbladder and depletion of the bile salt pool, TUDC in phosphate-

buffered saline was infused intravenously in a step-wise increasing dose as described

previously23. Data represent means ± standard deviation of 4 animals per group. The slope

of the line yields the bile salt-dependent fl ow (BSDF), i.e., the choleretic activity of TUDC

in µL/µmol. The mean values for the apparent choleretic activity were 4.7 ± 0.9 and

7.2 ± 1.6 µL/µmol for control and Mdr2(-/-) mice, respectively (p < 0.05). The bile salt-

independent bile fl ow (BSIF), obtained by extrapolation to the Y-axis was also signifi cantly

increased in Mdr2(-/-) mice (5.2 ± 1.1 µL.min-1.100g-1 vs. 10.9 ± 0.3 µL.min-1.100g-1, Mdr2(-/-)

vs. control mice; p < 0.05).

(Abcc2), crucially involved in hepatobiliary transport of glutathione and identifi ed

as an FXR-target gene, was ~ 50% higher in Mdr2(-/-) mice. On the other hand,

expression of Shp, and Bsep (Abcc11) were not signifi cantly affected. Expression

of Cftr (Abcc7) encoding for a chloride transport protein present in cholangiocytes,

but not on hepatocytes, was 6-fold induced in livers of Mdr2(-/-) mice Asbt and

Mrp3 protein levels were increased in livers of Mdr2(-/-) mice when compared to

those of controls (Figure 2B). Immunohistochemistry on frozen sections of the

liver and intestines of Mdr2(-/-) and control mice showed clear Asbt staining of the

apical membrane of cholangiocytes (data not shown) and enterocytes (Figure 3),

respectively.

In vivo kinetics of 2H4-Cholate. We investigated whether bile duct proliferation

affects in cholate kinetics in the Mdr2(-/-) and Mdr2(+/+) mice. Deuterated

[2H4]-cholate disappeared from plasma at the same rate in Mdr2(-/-) and wild-type

mice (Figure 4). The fractional turnover rate of cholate (Figure 5A) was similar in

both groups of mice (0.4 ± 0.1 day-1 vs. 0.5 ± 0.1 day-1, Mdr2(-/-) mice vs. wild-type,

NS). Pool sizes of cholate (Figure 5B), estimated from the Y-intercept of the ln APE

126

Chapter 7

[2H4]-CA vs. time plot, were also similar for Mdr2(+/+) and Mdr2(-/-) mice (18.7 ±

2.1 µmol.100g-1 vs. 16.9 ± 2.2 µmol.100g-1, Mdr2(-/-) vs. wild-type mice; NS)

Consequently, the calculated cholate synthesis rate (Figure 5C) did not differ

between both strains (9.9 ± 2.9 µmol.100g-1.day-1 vs. 7.3 ± 1.6 µmol.100g-1.day-1,

Mdr2(-/-) vs. wild-type mice; NS).

Effects of Mdr2 defi ciency on intestinal protein levels of Asbt and Ibabp.

Asbt mRNA levels were clearly most abundant in the distal parts of the small

intestine (Figure 6A) and no differences were observed between Mdr2(-/-) and

wild-type mice. In accordance with mRNA expression patterns, Asbt protein

was mainly present in the distal part of the intestine of Mdr2(-/-) and wild-type

mice (Figure 6B). Ibabp protein expression was also confi ned to the distal

Figure 2. (A) Effects of Mdr2-Pgp defi ciency on steady-state mRNA levels of genes involved

in hepatocytic and cholangiocytic bile salt transport in Mdr2(+/+) and Mdr2(-/-) mice.

Total mRNA was isolated from Mdr2(+/+) mice (white bars) and Mdr2(-/-) mice (black bars),

transcribed into cDNA, and subjected to real-time PCR . Data represent hepatic mRNA levels

of Fxr, Shp, Bsep, Mrp2, Mrp3, Asbt, Cftr, and tAsbt, respectively. All data were standardized

for β-actin. Expression in wild-type mice was set to 1.00. The asterisks indicate signifi cant

difference, p < 0.05. Values are expressed as means ± standard deviation of RNA isolated

from 4 animals in each group. (B) Effects of Mdr2-Pgp defi ciency on hepatic protein levels

of Asbt and Mrp3. Hepatic Asbt and Mrp3 protein levels were increased in Mdr2(-/-) mice

when compared to wild-type mice. Data are shown as typical examples of two independent

preparations of each group isolated from 4 animals in each group.

127


Figure 3. Immunohistochemical staining

for Asbt on frozen sections of terminal

small intestine from control (A) and

Mdr2(-/-) (B) mice. The arrow heads indi-

cate the apical staining by anti-Asbt anti-

bodies (magnifi cation 40x). No clear dif-

ferences were observed in the intensities

of staining between Mdr2(-/-) mice and con-

trol mice. No signal was obtained when

primary or secondary antibodies were

omitted from the incubation medium.

Figure 4. Decay of intravenously

administered [2H4]-cholate in wild-type

(open circles) and Mdr2(-/-) (closed circles)

mice. A solution of with 210 µg [2H4]-

cholate, 0.5% NaHCO3

and phosphate-

buffered saline (PBS) was intravenously

injected into six Mdr2(+/+) and six Mdr2(-/-)

mice. Blood samples were collected and

plasma was analyzed for the increase

of M4-CA/ M


measurements and expressed as the

natural logarithm of atom % excess (ln

APE) enrichment of cholate. Deuterated

[2H4]-cholate disappeared from plasma at

the same rate in Mdr2(-/-) and wild-type

mice. Data are expressed as means ±

standard deviation of n = 3-6 mice per

time point.

128

Chapter 7

Figure 6: Expression of Asbt mRNA, Asbt

protein and Ibabp protein levels in proximal

(P), medial (M) and distal (D) segments of the

intestines of Mdr2(+/+) and Mdr2(-/-) mice.

Asbt mRNA (A) and protein levels (B)

increased towards the distal end of the

small intestine and no clear differences were

observed between Mdr2(-/-) and wild-type

mice. Ibabp protein expression (Fig. 6B) was

also confi ned to the distal terminal ileum

in both groups of mice. Samples shown are

representative for 3-4 individual intestinal

preparations.

Figure 5: Effects of Mdr2- P glycoprotein-

defi ciency on fractional turnover rate (A),

pool size (B) and synthesis rate (C) of cho-

late.

Derived from [2H4]-cholate isotope enrich-

ment measurements in plasma of wild-type

and Mdr2(-/-) mice (n=6 per group), fractional

turnover rate, pool sizes and synthesis rates

of cholate were calculated in wild-type (white

bars) and Mdr2(-/-) (black bars) mice. The

fractional turnover rate of cholate, calculated

from the slope of the linear regression curve,

was similar in both groups of mice (A).

Pool sizes of cholate (B), estimated from

the Y-intercept of the ln APE [2H4]-CA vs.

time plot, were also similar for Mdr2(+/+) and

Mdr2(-/-) mice. The cholate synthesis rate (C),

calculated by multiplying pool size and FTR

did not differ. Data represent means ± SD.

129


terminal ileum in both groups of mice. No signifi cant differences existed upon

semiquantitative analysis (average of 3-4 mice per group) in intestinal Asbt or

Ibabp expression between Mdr2(+/+) and Mdr2(-/-) mice.

DISCUSSION

In the present study we investigated whether bile duct proliferation without

cholestasis affects BSDF, BSIF and/or bile salt synthesis in mice. The results

show that bile duct proliferation in (non-cholestatic) Mdr2 P-glycoprotein-defi cient

mice is not only associated with a higher BSIF but also with an increased BSDF.

The increased BSIF and BSDF coincided with an increased hepatic expression of

Asbt, tAsbt, and Mrp3, i.e., bile salt transporters putatively involved in cholehepatic

shunting of bile salts.

We made use of a mouse model of bile duct proliferation without obstructive

cholestasis. Mdr2 P-glycoprotein-defi ciency in mice leads to the formation of

phospholipid-free bile, resulting in exposure of the bile ducts to the detergent

actions of bile salts leading to proliferation22. Mdr2(-/-) mice thus represent a

“spontaneous” model of bile duct proliferation unlike other experimental models,

i.e., bile duct ligation, bile salt feeding, or partial hepatectomy. Previously, the

increased bile fl ow in Mdr2(-/-) mice has been attributed to an increase in BSIF23.

Accordingly, BSIF in the Mdr2(-/-) mice in the present study was twice as high as in

controls. An increase in BSIF is also seen in other experimental models of bile duct

proliferation and is characterized by increased basal and secretin-stimulated bile

fl ow7;8;19;20. This increment of BSIF in the Mdr2(-/-) mice coincided with a decreased

glutathione secretion, as previously reported by Smit et al.22. Biliary glutathione

secretion occurs almost exclusively via the canalicular organic anion transporter

Mrp2 and is an important contributor to BSIF in rodents3;37. Since Mrp2 mRNA

expression was increased in Mdr2(-/-) mice, reduced synthesis or enhanced turnover

probably underlie decreased glutathione secretion. Secretion of other organic anions

in combination with other mechanisms, e.g., increased net ductular secretion,

might therefore contribute to a larger extent to enhanced BSIF in Mdr2(-/-) mice.

Upregulation of Cftr expresion, a gene involved in biliary chloride secretion at

the apical membrane of the cholangiocyte, could also contribute to enhanced bile

fl ow in Mdr2(-/-) mice. Indeed, an increase in biliary chloride secretion in Mdr2(-/-)

mice has been reported22. Although theoretically, another localization of Cftr

protein than at the apical membrane or at a subapical domain of cholangiocytes

is possible, this has not been described sofar38.

Cholehepatic shunting will be associated with an increased amount of fl uid per

mole of biliary bile salt, i.e., an increased BSDF or choleretic activity, as a result

of the amplifi ed osmotic activity per molecule. The amount of fl uid generated per

mole of biliary TUDC was higher in Mdr2(-/-) mice than in wild-type mice, i.e., 7.2

µL/µmol in the Mdr2(-/-) mice and 4.7 µL/µmol in wild-type mice. Although this

fi nding is consistent with TUDC-induced hypercholeresis, it obviously does not

provide defi nitive proof for the presence of cholehepatic shunting of TUDC. Bile

duct-specifi c delivery of Asbt inhibitors or Mdr2/Asbt double knock-out mice would

be suitable models to address this hypothesis. Yet, the combination of increased

expression of Asbt, tAbst, and Mrp3 with the increased choleretic activity does

130

Chapter 7

strongly support the existence of cholehepatic shunting. Absence of mixed micelle

formation, as occurs in Mdr2(-/-) mice, is not a major determinant of the choleretic

activity of bile salt. The choleretic actitivity of conjugates of dihydroxy bile salts,

such as TUDC, is comparable to that of tauroursocholate (TUC), a conjugated

trihydroxy bile salt that does not induce biliary lipid secretion39. In another

model of bile duct proliferation, i.e., bile duct ligation, infusion of TUDC and of

taurohyodeoxycholate (THDC) induced hypercholeresis to a greater extent than

in normal rats, suggesting a ductal origin for enhanced bile fl ow by these bile

salts40. For UDC, used as a therapeutic agent in various liver diseases, indications

for cholehepatic shunting have been reported previously41;42.

Data on some hepatocellular transporters in Mdr2(-/-) mice, i.e., Ntcp, have

been previously published43. Yet, to the best of our knowledge, this study is

the fi rst to describe bile salt-induced hypercholeresis in relation to induced

Asbt, tAsbt, and Mrp3 expression. Since Mdr2(-/-) mice develop marked bile duct

proliferation, the increased protein and mRNA levels of transport proteins in their

livers are most likely be attributed to increased numbers of cholangiocytes. Yet,

it can not be excluded that the amount of protein or mRNA per cholangiocyte

has changed. Literature data on other bile duct proliferation models are not

conclusive. In bile duct-ligated rats, the content of Asbt protein in liver increases

while Asbt mRNA expression in isolated cholangiocytes remains unchanged,

suggesting an increased number of cholangiocytes with an unaffected amount

of protein per cell44. In contrast, bile salt feeding in rats stimulates proliferation

of cholangiocytes associated with overexpression of the Asbt gene in isolated

cholangiocytes45.

Cholehepatic circulation of bile salts could be involved in feedback repression of

de novo bile salts synthesis and serve to protect the liver from further bile salt

toxicity in conditions with extrahepatic cholestasis11. To evaluate the physiological

Figure 7: Estimated fl uxes and kinetics of the enterohepatic circulation of cholate in

Mdr2(+/+) and Mdr2(-/-) mice. The values represent calculations based on the mean values

for biliary cholate secretion, cholate pool sizes and synthesis rates. Mdr2 Pgp-defi ciency

associated with bile duct proliferation and increased expression of bile salt transport proteins

enhances cholehepatic shunting (represented by the spring), increases cycling time (CT) of

cholate and increases the calculated percentage of cholate lost per enterohepatic cycle.

131


consequences of Mdr2 P-glycoprotein-defi ciency on the synthesis rate of bile salts,

cholate kinetics were compared in the Mdr2(+/+) and Mdr2(-/-) mice, using a stable

isotope procedure24. As demonstrated previously, the contribution of cholate to

the bile salt pool is reduced in Mdr2(-/-) mice, but its biliary secretion rate is

unaffected23. Upregulation of bile salt transporters mainly confi ned to the biliary

epithelium did not affect synthesis rate of cholate nor its pool size. Bile salts

mediate feedback regulation at the level of cholesterol 7α-hydroxylase (Cyp7A1),

which encodes the rate-limiting enzyme in the neutral bile salt synthetic pathway

via the farnesoid receptor (FXR)17. Cholate synthesis was not repressed in Mdr2(-/-)

mice. This is in accordance with earlier fi ndings that Cyp7A1 expression at the

mRNA level is not affected in livers of Mdr2(-/-) mice 25.

Based on the data provided in this study it is possible to estimate the cycling time

(CT) of cholate, i.e., the time it takes the cholate pool to circulate a single time.

Cycling time for cholate was found to be ~2 h and ~3 h in control and Mdr2(-/-)

mice, respectively (Figure 7). The cholate pool thus cycled ~11 versus ~8 per day

in control and Mdr2(-/-) mice, respectively. The calculated fraction of cholate lost

per enterohepatic cycle was increased by ~50% (~4 versus ~6 % for control and

Mdr2(-/-) mice, respectively). Thus, in Mdr2(-/-) mice cholate tends to complete its

enterohepatic cycle at a slower rate and to partially escape intestinal reabsorption.

Yet, Mdr2 Pgp-defi ciency did not affect mRNA and/or protein expression of ileal

bile salt transporters considered to facilitate intestinal bile salt reabsorption, i.e.,

the apical sodium-dependent bile salt transporter (Asbt; Slc10a2) and the ileal

bile acid-binding protein (Ibabp). It is tempting to speculate that an increased

cholehepatic shunting in Mdr2(-/-) mice contributes to a slower enterohepatic

circulation.

In conclusion, bile duct proliferation in Mdr2 Pgp-defi ciency results in an

increased choleretic activity of biliary bile salts, which is associated with increased

hepatic expression of Asbt, tAsbt, and Mrp3, suggestive for Asbt/tAsbt/Mrp3-

mediated cholehepatic circulation. In spite of indications for cholehepatic shunting

in Mdr2 P-glycoprotein-defi ciency, cholate synthesis was unaffected. Our results

support the concept that bile duct proliferation can be a protective response

against toxic stimuli by enhancing bile fl ow. Rather than previously thought, this

protective response may not remain confi ned to stimulation of BSIF, but may also

involve an enhanced BSDF through cholehepatic shunting.

ACKNOWLEDGEMENTS

The authors would like to thank Juul RM Baller, Theo Boer, Renze Boverhof, Rick

Havinga, Bert Hellinga, Hermi Kingma and Fjodor van de Sluijs for technical

assistance. The authors are indebted to L. Agellon (Edmonton, Canada) for

providing antibodies.

132

Chapter 7

REFERENCES

1. Hofmann AF. Bile acid secretion, bile fl ow and biliary lipid secretion in humans. Hepatology 1990; 12: 17S-22S.

2. Wheeler HO. Secretion of bile acids by the liver and their role in the formation of hepatic bile. Arch Intern Med 1972; 130: 533-41.

3. Ballatori N, Truong AT. Glutathione as a primary osmotic driving force in hepatic bile formation. Am J Physiol 1992; 263: G617-G624.

4. Tietz PS, Marinelli RA, Chen XM, Huang B, Cohn J, Kole J, McNiven MA, Alper S, LaRusso NF. Agonist-induced coordinated traffi cking of functionally related transport proteins for water and ions in cholangiocytes. J Biol Chem 2003; 278: 20413-9.

5. Hylemon PB, Bohdan PM, Sirica AE, Heuman DM, Vlahcevic ZR. Cholesterol and bile acid metabolism in cultures of primary rat bile ductular epithelial cells. Hepatology 1990; 11: 982-8.

6. Alpini G, Glaser S, Robertson W, Phinizy JL, Rodgers RE, Caligiuri A, LeSage G. Bile acids stimulate proliferative and secretory events in large but not small cholangiocytes. Am J Physiol 1997; 273: G518-G529.

7. Alpini G, Glaser S, Alvaro D, Ueno Y, Marzioni M, Francis H, Baiocchi L, Stati T, Barbaro B, Phinizy JL, Mauldin J, LeSage G. Bile acid depletion and repletion regulate cholangiocyte growth and secretion by a phosphatidylinositol 3-kinase-dependent pathway in rats. Gastroenterology 2002; 123: 1226-37.

8. Alpini G, Glaser SS, Ueno Y, Rodgers R, Phinizy JL, Francis H, Baiocchi L, Holcomb LA, Caligiuri A, LeSage GD. Bile acid feeding induces cholangiocyte proliferation and secretion: evidence for bile acid-regulated ductal secretion. Gastroenterology 1999; 116: 179-86.

9. Palmer KR, Gurantz D, Hofmann AF, Clayton LM, Hagey LR, Cecchetti S. Hypercholeresis induced by norchenodeoxycholate in biliary fi stula rodent. Am J Physiol 1987; 252: G219-G228.

10. Gurantz D, Schteingart CD, Hagey LR, Steinbach JH, Grotmol T, Hofmann AF. Hypercholeresis induced by unconjugated bile acid infusion correlates with recovery in bile of unconjugated bile acids. Hepatology 1991; 13: 540-50.

11. Lazaridis KN, Pham L, Tietz P, Marinelli RA, deGroen PC, Levine S, Dawson PA, LaRusso NF. Rat cholangiocytes absorb bile acids at their apical domain via the ileal sodium-dependent bile acid transporter. J Clin Invest 1997; 100: 2714-21.

12. Alpini G, Glaser SS, Rodgers R, Phinizy JL, Robertson WE, Lasater J, Caligiuri A, Tretjak Z, LeSage GD. Functional expression of the apical Na+-dependent bile acid transporter in large but not small rat cholangiocytes. Gastroenterology 1997; 113: 1734-40.

13. Lazaridis KN, Tietz P, Wu T, Kip S, Dawson PA, LaRusso NF. Alternative splicing of the rat sodium/bile acid transporter changes its cellular localization and transport properties. Proc Natl Acad Sci U S A 2000; 97: 11092-7.

14. Rost D, Konig J, Weiss G, Klar E, Stremmel W, Keppler D. Expression and localization of the multidrug resistance proteins MRP2 and MRP3 in human gallbladder epithelia. Gastroenterology 2001; 121: 1203-8.

15. Soroka CJ, Lee JM, Azzaroli F, Boyer JL. Cellular localization and up-regulation of multidrug resistance-associated protein 3 in hepatocytes and cholangiocytes during obstructive cholestasis in rat liver. Hepatology 2001; 33: 783-91.

16. Lu TT, Makishima M, Repa JJ, Schoonjans K, Kerr TA, Auwerx J, Mangelsdorf DJ. Molecular basis for feedback regulation of bile acid synthesis by nuclear receptors. Mol Cell 2000; 6: 507-15.


18. Bode C, Zelder O, Goebell H, Neuberger HO. Choleresis induced by secretin: distinctly increased response in cirrhotics. Scand J Gastroenterol 1972; 7: 697-9.

19. Tietz PS, Alpini G, Pham LD, LaRusso NF. Somatostatin inhibits secretin-induced ductal hypercholeresis and exocytosis by cholangiocytes. Am J Physiol 1995; 269: G110-G118.

20. LeSage G, Glaser SS, Gubba S, Robertson WE, Phinizy JL, Lasater J, Rodgers RE, Alpini G. Regrowth of the rat biliary tree after 70% partial hepatectomy is coupled to

133


increased secretin-induced ductal secretion. Gastroenterology 1996; 111: 1633-44.21. Van Nieuwerk CM, Groen AK, Ottenhoff R, van Wijland M, van den Bergh Weerman

MA, Tytgat GN, Offerhaus JJ, Oude Elferink RP. The role of bile salt composition in liver pathology of mdr2(-/-) mice: differences between males and females. J Hepatol 1997; 26: 138-45.

22. Smit JJ, Schinkel AH, Oude Elferink RP, Groen AK, Wagenaar E, van Deemter L, Mol CA, Ottenhoff R, van der Lugt NM, van Roon MA, . Homozygous disruption of the murine mdr2 P-glycoprotein gene leads to a complete absence of phospholipid from bile and to liver disease. Cell 1993; 75: 451-62.

23. Oude Elferink RP, Ottenhoff R, van Wijland M, Smit JJ, Schinkel AH, Groen AK. Regulation of biliary lipid secretion by mdr2 P-glycoprotein in the mouse. J Clin Invest 1995; 95: 31-8.

24. Hulzebos CV, Renfurm L, Bandsma RHJ, Verkade HJ, Boer T, Boverhof R, Tanaka H, Mierau I, Sauer PJJ, Kuipers F, Stellaard F. Measurement of parameters of cholic acid kinetics in plasma using a microscale stable isotope dilution technique: application to rodents and humans. J Lipid Res 2001; 42:1923-9.

25. Voshol PJ, Havinga R, Wolters H, Ottenhoff R, Princen HM, Oude Elferink RP, Groen AK, Kuipers F. Reduced plasma cholesterol and increased fecal sterol loss in multidrug resistance gene 2 P-glycoprotein-defi cient mice. Gastroenterology 1998; 114: 1024-34.

26. Murphy GM BB, Baron DN. A fl uorimetric and enzymatic method for the estimation of serum total bile acids. J Clin Pathol 1970; 23: 594-8.

27. Heid CA, Stevens J, Livak KJ, Williams PM. Real time quantitative PCR. Genome Res 1996; 6: 986-94.

28. Hulzebos CV, Wolters H, Plosch T, Kramer W, Stengelin S, Stellaard F, Sauer PJ, Verkade HJ, Kuipers F. Cyclosporin a and enterohepatic circulation of bile salts in rats: decreased cholate synthesis but increased intestinal reabsorption. J Pharmacol Exp Ther 2003; 304: 356-63.

29. Plosch T, Kok T, Bloks VW, Smit MJ, Havinga R, Chimini G, Groen AK, Kuipers F. Increased hepatobiliary and fecal cholesterol excretion upon activation of the liver X receptor is independent of ABCA1. J Biol Chem 2002; 277: 33870-7.


31. Kramer W. Topological photoaffi nity labeling of the rabbit ileal Na+/bile-salt-co-transport system. Eur J Biochem 1997; 249: 456-64.


33. Schmitz J, Crane RK. Purifi cation of the human intestinal brush border membrane. Biochem Biophys Acta 1973; 323: 98-112.

34. Lowry OH RNFA, Randall RL. Protein measurement with the folin reagens. J Biol Chem 1951; 193: 265-75.

35. Labonte ED, Li Q, Kay CM, Agellon LB. The relative ligand binding preference of the murine ileal lipid binding protein. Protein Expr Purif 2003; 28: 25-33.

36. Campbell IM. Incorporation and dilution values: their calculation in mass spectrally assayed stable isotopes labeling experiments. Bioorg Chem 1974; 3: 386-97.

37. Kuipers F, Enserink M, Havinga R, van der Steen AB, Hardonk MJ, Fevery J, Vonk RJ. Separate transport systems for biliary secretion of sulfated and unsulfated bile acids in the rat. J Clin Invest 1988; 81: 1593-9.

38. Cohn JA, Strong TV, Picciotto MR, Nairn AC, Collins FS, Fitz JG. Localization of the cystic fi brosis transmembrane conductance regulator in human bile duct epithelial cells. Gastroenterology 1993; 105: 1857-64.

39. Gurantz D, Hofmann AF. Infl uence of bile acid structure on bile fl ow and biliary lipid secretion in the hamster. Am J Physiol 1984; 247: G736-G748.

40. Baiocchi L, Alpini G, Glaser S, Angelico M, Alvaro D, Francis H, Marzioni M, Phinizy JL, Barbaro B, LeSage G. Taurohyodeoxycholate- and tauroursodeoxycholate-induced hypercholeresis is augmented in bile duct ligated rats. J Hepatol 2003; 38: 136-47.

134

Chapter 7

41. Elsing C, Sagesser H, Reichen J. Ursodeoxycholate-induced hypercholeresis in cirrhotic rats: further evidence for cholehepatic shunting. Hepatology 1994; 20: 1048-54.

42. Dumont M, Erlinger S, Uchman S. Hypercholeresis induced by ursodeoxycholic acid and 7-ketolithocholic acid in the rat: possible role of bicarbonate transport. Gastroenterology 1980; 79: 82-9.

43. Koopen NR, Wolters H, Voshol P, Stieger B, Vonk RJ, Meier PJ, Kuipers F, Hagenbuch B. Decreased Na+-dependent taurocholate uptake and low expression of the sinusoidal Na+-taurocholate cotransporting protein (Ntcp) in livers of mdr2 P-glycoprotein-defi cient mice. J Hepatol 1999; 30: 14-21.

44. Lee J, Azzaroli F, Wang L, Soroka CJ, Gigliozzi A, Setchell KD, Kramer W, Boyer JL. Adaptive regulation of bile salt transporters in kidney and liver in obstructive cholestasis in the rat. Gastroenterology 2001; 121: 1473-84.

45. Alpini G, Ueno Y, Glaser SS, Marzioni M, Phinizy JL, Francis H, LeSage G. Bile acid feeding increased proliferative activity and apical bile acid transporter expression in both small and large rat cholangiocytes. Hepatology 2001; 34: 868-76.

Chapter 8

General discussion

136

General discussion

Bile and bile salts in health and disease

Bile has been implicated in health and disease since ancient times. The Greek

physician Hippocrates (468 - 377 BC) proposed the idea of four humors or

elemental fl uids in the body, which must be in balance with each other for health

to be attained. Bile plays a crucial role in this so-called humoral theory. The

four humors included yellow and black bile (Gk. xanthê cholê and mela cholê,

respectively), blood (L. sanguinis), and phlegm (Gk. phlégma). Diseases were

considered to be caused by the overmanufacturing of one of these substances

causing disharmony. Psychopathology could also result from an excess or an

insuffi cient amount of a humor. For example, overproduction of black bile

caused persons to become melancholic, depressed or manic dependent upon

its temperature: “Cold black bile leads to apoplexy, numbness, fearfulness, and

being disheartened. Hot black bile produces cheerfulness, bursting into song, and

ecstasies, and the eruption of sores”1. Claudius Galen (131 - 200 AD) believed

strongly in the humoral system of medicine and developed it further. Galen

proposed the notion that cancer is caused by an excess of black bile. This theory

survived several hundred years and was only superseded at the end of the

eighteenth century2. As a consequence of the proposed important role of bile in

health and disease, research on bile salt metabolism has fascinated scientist for

many centuries. An intriguing feature of bile salts is the existence of enterohepatic

cycling of these bile components, which was already predicted as early as in the

17th century, whereas experimental proof was provided in 18703. The integrated

physiology of the enterohepatic circulation and the concept of bile salt-dependent

bile fl ow, the function of bile salts in solubilization of biliary lipids (phospholipids,

cholesterol) into mixed micelles and facilitation of intestinal absorption of dietary

fats, including fat-soluble vitamins (A, D, E and K) was generally accepted by

the end of the previous century4. The enterohepatic circulation was considered

a physiological utility that ensured optimal concentrations of bile salts in the

intestine, with only minimal energy expenditure for bile salt synthesis in the liver.

Isotope dilution techniques provided opportunities to study the kinetics of the

enterohepatic circulation of bile salts in vivo and these techniques have provided

further insight into various (patho)physiological aspects of bile salt metabolism5-12.

The isotope dilution method allows simultaneous determination of the pool size, i.e.,

the amount of bile salts in the body, its fractional turnover rate, i.e., the portion of

the pool that is lost per day, and bile salt synthesis rate, without interruption of the

enterohepatic circulation. Yet, a serious limitation of the “conventional” approaches

was the requirement to collect a series of relatively large blood samples,

which precluded its use in children or commonly used (small) experimental

animal models. In chapter 2 an adapted stable isotope dilution technique using

[2H4]-cholate with novel derivatisation modalities and analytical procedures is

described that overcomes this limitation as only extremely small bloodsamples

are required13. After its validation, this novel isotope dilution method has been

applied in vivo in humans and in animal models for the studies described in this

thesis. Studies on bile salt kinetics in children may improve our understanding

of adaptation of bile salt metabolism to maturational processes, to certain

disease states, or to administration of specifi c drugs. Experimental animal

137

General discussion

models, amongst other applications, allow to delineate adaptive changes of the

enterohepatic circulation attributable to “knocking-out” individual proteins.

Bile salts act as intracellular signaling molecules in enterohepatic

tissues

In the last two decades, application of molecular cloning techniques has led to

identifi cation of several proteins putatively involved in the regulation of synthesis

and enterohepatic cycling of bile salts. This has contributed enormously to the

present knowledge of the (patho)physiology of bile salt metabolism. The recent

proclammation of bile salts as signaling molecules, affecting transcriptional control

of genes through nuclear receptors, has revolutionized the traditional concept of

bile salts serving solely as detergents of cholesterol in bile and as intestinal lipid

solubilizers. Nuclear receptors, belonging to a highly conserved gene family and

located in the nuclei of cells, are ligand-activated transcription factors. About

50 distinct members have been identifi ed to date14. Several of these receptors

were designated “orphan receptors”, because they were identifi ed before their

ligands were known. Molecular mechanisms of nuclear receptor regulation have

been excellently reviewed elsewhere14-16. In short, unactivated nuclear receptors

form a complex with co-repressors, which repress transcriptional activity. Nuclear

receptors are activated upon ligand-binding, which induces a conformational

change, resulting in the dissociation of co-repressors and the recruitment of

co-activators that facilitate transcription of target genes. Nuclear receptors that

regulate transcription of genes in bile salt and cholesterol metabolism (NR1

family) are predominantly localized in cells involved in bile salt metabolism,

and consist of the presently identifi ed Pregnane X Receptor (PXR), Peroxisome

Proliferator-Activated Receptor (PPAR), Liver X Receptor (LXR) and the Farnesoid

X Receptor (FXR)14. The activity of nuclear receptors is controlled by the binding

of endogenous (bile salts, lipids or steroids) or exogenous (drugs) ligands. Upon

activation, these nuclear receptors dimerize to Retinoid X Receptor (RXR) and bind

specifi c responsive elements of target genes, which encode proteins involved in

various metabolic pathways.

Regulation of hepatic bile salt synthesis by nuclear receptors

The fi nding that interruption of the enterohepatic circulation of bile salts resulted

in an increased hepatic bile salt synthesis provided the fi rst experimental

evidence for the existence of feedback regulation on bile salt synthesis, without

understanding how this was achieved at the molecular level17. It was previously

anticipated that the coordinated action of enterohepatic tissues involved in

enterohepatic cycling of bile salts was regulated at the level of the hepatocyte,

with respect to bile salt synthesis and transport, presumably by the intracellular

bile salt concentration18. Now it has been shown that transcriptional repression of

Cyp7a1 (bile salt synthesis) and Ntcp (bile salt uptake), as well as upregulation

of Bsep (bile salt effl ux) is mediated by the bile salt-activated nuclear receptor

FXR to prevent intracellular bile salt accumulation and toxicity19. Although the

role of FXR as a bile salt sensor coordinating the expression of genes involved in

138

General discussion

various aspects of bile salt metabolism has been fi rmly established, predominantly

in in vitro studies20;21, the physiological role of FXR in controlling the enterohepatic

circulation of bile salts has not been addressed sofar.

FXR in the liver: an intracellular bile salt sensor affecting bile formation

and bile salt kinetics

The role of FXR in control of in vivo bile formation and the kinetics of the

enterohepatic circulation of bile salts has been determined by quantifying bile salt

kinetics using a stable isotope dilution method in FXR-knockout mice (chapter 5)

and in rats upon treatment with a synthetic FXR agonist (chapter 6)22.

FXR-defi ciency in mice was associated with an enhanced bile fl ow, which could

be attributed to a higher bile salt output22. Yet, mRNA levels of Bsep, pivotal for

hepatobiliary bile salt transport, were decreased. As biliary bile salt concentra-

tion and secretion rates were clearly enhanced in Fxr (-/-) mice, decreased Bsep

expression levels apparently do not correlate with defective bile salt transport and

indicate an excess transport capacity of Bsep, as previously suggested23. The bile

formation process per se was not affected by FXR-defi ciency as is evident from

similar linear correlations between bile fl ow and biliary bile salt output in wild-

type, Fxr (+/-), and Fxr

(-/-) mice, i.e., similar values for the choleretic activity of

biliary bile salts and the bile salt-independent fraction of bile fl ow22. In accordance

with current concepts of the role of FXR in control of bile salt synthesis, Fxr (-/-)

mice showed an increased cholate synthesis rate, coinciding with signifi cantly

increased hepatic Cyp7a1 mRNA levels. The absolute fecal bile salt excretion was

also increased, in agreement with the augmented calculated cholate synthesis

rate. Yet, the calculated amount of bile salts reabsorbed from the intestine was

twice that calculated in wild-type mice. As bile salt synthesis under physiological

conditions is repressed by bile salt activated-FXR, enhanced intestinal bile salt fl ux

is obviously not a major determinant of bile salt synthesis rate in FXR-defi cient

mice. As a consequence of defective feedback inhibition of hepatic bile salt syn-

thesis, Fxr (-/-) mice developed an increased bile salt pool size22. Apparently, intes-

tinal processes did not affect bile salt reabsorption suffi ciently to maintain pool

size under these conditions of enhanced bile salt synthesis. In addition to these

fi ndings, FXR null mice showed elevated serum bile salt concentrations. Yet,

in contrast to the huge increase in plasma bile salts, as reported previously

by other investigators, these changes were modest in our study22;24. In fact,

several other fi ndings were in contrast with those reported earlier24. Although

largely speculative due to the lack of directly comparative studies, differences in

methodology, including another background of the FXR null mice, may contribute

to these contrasting results.

In addition to the description of phenotypic abnormalities attributable to the

dysfunction of individual proteins, treatment with a specifi c FXR ligand (GW4064)

may provide insight in the regulatory role of FXR in vivo in pathways of bile

salt metabolism (chapter 6)25;26. Upon FXR activation by GW4064, anticipated

opposite results compared to those in FXR-defi cient mice were obtained. The mRNA

levels of the gene encoding the canalicular bile salt transporter Bsep were signifi -

cantly increased upon treatment with GW4064. Yet, bile fl ow and biliary bile salt

139

General discussion

output rate were not affected after interruption of the enterohepatic circulation.

In accordance with reduced Cyp8b1 expression, the cholate:chenodeoxycholate

ratio in bile was decreased upon treatment with GW4064. Bile salt synthesis rate

was signifi cantly inhibited coinciding with a reduced bile salt pool size upon FXR

activation by GW4064. The calculated amount of bile salts reabsorbed from the

intestine was not signifi cantly affected upon FXR activation. As bile salts normally

repress their synthesis via bile salt activated-FXR, intestinal bile salt fl ux is obvi-

ously not a major determinant of bile salt synthesis rate under conditions in which

FXR is already pharmacologically activated. As a consequence of this pharma-

cologically disrupted feedback inhibition of hepatic bile salt synthesis, GW4064-

treated rats developed a decreased bile salt pool size. Apparently, intestinal proc-

esses did not compensate to maintain pool size under these conditions of impaired

bile salt synthesis.

Pharmacological-activated FXR may provide hepatoprotection and be of use

in the treatment of cholestatic liver disease. Although it is unlikely that cholesta-

sis is caused by increased bile salt synthesis, it would be benefi cial to suppress

bile salt synthesis and, at the same time, stimulate bile salt excretion and

reduce cellular uptake under cholestatic conditions to maintain cellular integrity.

Recently, the synthetic FXR agonist GW4064 was parenterally provided in rat

models of extrahepatic and intrahepatic cholestasis27. GW4064 treatment resulted

in decreased expression of bile salt biosynthetic genes and increased expression

of genes involved in bile salt uptake and hepatobiliary transport in association

with signifi cant reductions in serum and histological markers of liver damage27.

A number of fi ndings were in contrast to our study, merely with respect to gene

expression levels in the liver. Although the same FXR ligand was administered,

other treatment regimes (dose, route of administration) may, at least in part,

underlie some of these differences.

FXR in the intestine: an intracellular bile salt sensor affecting intestinal

bile salt reabsorption?

The “classic view” of bile salt homeostasis implies that bile salt pool size is

maintained at the level of the hepatocyte, with respect to bile salt synthesis,

which, under steady state conditions, compensates for fecal loss of bile salts.

This view is supported by the observed increase in bile salt synthesis in rodents

and in humans after surgical or pharmacological interruption of the enterohepatic

circulation. The role of the enterocytes, with respect to bile salt reabsorption, in

regulation of the bile salt pool size of the enterohepatic circulation has remained

unclear for a long time.

Initially, confl icting reports on up- or down-regulation of bile salt reabsorption by

intestinal bile salts have been published28;29. Functional ileal bile salt transport was

found to be up-regulated by cholestyramine and down-regulated by glycocholate

feeding30, each of which may serve to maintain a constant bile salt pool size. Yet,

a number of studies31;32, including the one presented in chapter 3, indicate that

regulation of the bile salt pool size may not only occur at the level of hepatic

biosynthesis in response to intestinal events. Our data clearly demonstrate that

decreased bile salt synthesis caused by administration of cyclosporin A does not

140

General discussion

necessarily lead to a reduced bile salt pool size in rats. Three arguments are

described implying that the lower bile salt synthesis is compensated for by a

more effi cient intestinal bile salt conservation upon CsA treatment. First, we were

able to calculate that, upon CsA treatment, the percentage of cholate lost per

enterohepatic cycle was markedly reduced. Second, fecal bile salt excretion was

strongly reduced in the presence of an unchanged biliary bile salt secretion rate

during CsA treatment. Third, the increased expression of the ileal apical sodium

bile acid cotransporter Asbt (Slc10a2) in the distal ileum of CsA-treated rats

favors the possibility that Asbt contributed to maintenance of bile salt pool size

by enhancing intestinal bile salt absorption effi ciency at this level. Recently, it

was discovered that Asbt is pivotal for intestinal reabsorption of bile salts33.

Mutations in patients of the gene encoding ASBT results in bile salt malabsorption,

steatorrhea, and reduced plasma cholesterol levels, whereas mice in which this

gene is disrupted show an increased fecal loss and synthesis rate of bile salts,

but a decreased bile salt pool size34. This body of work established the essential

role of Asbt in bile salt reabsorption and implicates that the intestine, in addition

to the liver, is involved in regulation of the bile salt pool within the enterohepatic

circulation35. Recently, it was shown that the gene encoding Asbt is under negative

feedback regulation by bile salts mediated by FXR in the mouse36. In mice, FXR

mediates suppression of Asbt expression via Shp repression of Lrh-1, which acts

as a transcriptional activator of mouse Asbt. Derepression by FXR-defi ciency

should therefore lead to increased Asbt expression. Although not observed in FXR

null mice described in chapter 5, Asbt expression levels were indeed increased in

chow-fed FXR null mice relative to controls in another study36. Although rat Asbt

is not activated by Lrh-1, other mechanisms by which FXR indirectly regulates

rat Asbt cannot be excluded. Yet, upon FXR activation in GW4064-treated rats

(chapter 6) no consistent change in expression of Asbt was observed.

In contrast to Asbt, which is apparently negatively regulated by bile salts,

the intestinal bile acid binding protein (Ibabp), also named ileal lipid-binding

protein (Ilbp), is positively regulated by bile salt-activated FXR. Previously, it was

shown that Ibabp was downregulated in cholesterol 7α-hydroxylase knock-out

mice, which showed markedly reduced bile salt synthesis37. Moreover, intestinal

expresion of Ibabp increased in wild-type mice on a bile salt-enriched diet36.

These fi ndings have enforced the hypothesis that Ibabp acts as a facilitator of

intestinal bile salt reabsorption. However, we have demonstrated in chapter 5

that mRNA and protein expression of Ibabp were markedly reduced in FXR null

mice, whereas enterohepatic circulation of cholate was not perturbed and the

calculated amount of bile salts reabsorbed from the intesine was even increased22.

Moreover, increased expression of Ibabp was observed in rats treated with a

synthetic FXR ligand, coinciding with unchanged intestinal bile salt reabsorpion.

It thus appears that Ibabp rather functions as a negative regulator of bile salt

reabsorption. Upregulation of Ibabp by bile salts could also prevent intracellular

accumulation and toxicity of unbound bile salts upon entrance in the enterocytes.

Results of bile salt kinetics in Ibabp knockout mice are eagerly awaited for to

explore the exact physiological role of Ibabp; these studies are in progress.

141

General discussion

Enterohepatic circulation of bile salts: interactions with lipid

metabolism.

Before the recognition that bile salts are able to activate nuclear receptors, it

has been known for several decades that bile salts are essential for cholesterol

homeostasis18;38. Hepatic synthesis of bile salts and their subsequent fecal

excretion acounts for the majority of cholesterol removal from the body (~90%).

Interruption of the enterohepatic circulation of bile salts by sequestrants, such

as cholestyramine, induces bile salt and cholesterol biosynthesis and effi ciently

lowers plasma levels of cholesterol by promoting receptor-mediated Low Density

Lipoprotein (LDL) catabolism39;40. The discovery of the LDL receptor-pathway,

particularly its upregulation in response to cholesterol depletion of the liver, has

been exploited for the development of novel therapies for hypercholesterolemia

(e.g., statins)41. A physiologic interaction between bile salt and lipid metabolism

has emerged from various studies. Bile salts inhibit VLDL secretion in rat

and human hepatocytes in vitro and, to a limited extent, in rodents in

vivo42. The relationship between bile salt biosynthesis and VLDL formation in

humans in vivo seems bi-directional; treatment with cholestyramine results in

increased hepatic VLDL secretion43, whereas familial hypertriglyceridemia (type IV

phenotype) is associated with an augmented bile salt synthesis rate and bile salt

malabsorption44-46. Conversely, plasma triglyceride levels decrease upon treatment

with the bile salt chenodeoxycholate43;47. Moreover, human CYP7A1 defi ciency is

associated with disturbed bile salt synthesis and hyperlipidemia48.

In this thesis, we demonstrated in chapter 4 that cyclosporin A (CsA)

treatment inhibits bile salt synthesis and increases plasma concentration of

(LDL) cholesterol and triglycerides in pediatric liver transplant patients49.

Suppression of bile salt synthesis by long-term CsA treatment may thus

contribute to hyperlipidemia. Increased levels of plasma LDL cholesterol as well as

elevated triglyceride levels are associated with an increased risk for accellerated

atherosclerosis and coronary heart disease.

Upregulation of LDL receptor activity in the liver is an important mechanism

for reducing plasma LDL cholesterol levels in humans50. This may be achieved

by inhibition of cholesterol biosynthesis or an enhanced bile salt synthesis51;52.

Although largely speculative, the observed augmented bile salt synthesis rate

upon withdrawal of CsA, coinciding with lower plasma lipid levels, favours the

hypothesis of hepatic cholesterol depletion that results in an increased plasma

LDL-clearance and thereby lowers plasma cholesterol levels. In agreement with

this is the notion that, in humans, plasma LDL clearance and bile salt synthesis

are age-dependent53;54. With aging, plasma LDL clearance and bile salt synthesis

decrease in parallel with increased plasma cholesterol levels. It is tempting to

speculate that these effects are mediated by proteins involved in both metabolic

pathways, e.g., FXR.

In addition to FXR as a key regulator of bile salt homeostasis, FXR also

regulates genes involved in of cholesterol metabolism. As discussed in chapter 5,

FXR-defi cient mice show elevated serum cholesterol and triglyceride levels.

Selective ligands for FXR could therefore, in theory, contribute to novel ther-

apeutic approaches to treat hyperlipidemia. Indeed, triglyceride levels were

reduced by 30% in rats treated with GW4064 under the conditions described in

142

General discussion

chapter 6. Although statistically non-signifi cant, a decrease of this magnitude

can be relevant in clinical practice55. The GW4064-induced decrease of plasma

triglyceride levels appeared to be dose-dependent56. Although total plasma cho-

lesterol levels were not affected by treatment with GW4046, plasma HDL-choles-

terol increased after FXR activation, in agreement with other studies56. Yet, FXR-

defi ciency in mice leads also to raised plasma HDL-cholesterol levels (Elzinga

et al., unpublished data)57. FXR negatively regulates human apoA-I expression

and FXR activation is associated with reduced plasma concentrations of apoA-I

in mice, whereas treatment of rats with the FXR agonist GW4046 did not affect

hepatic mRNA expression of ApoA-I (data not shown in chapter 6)58. Species-

differences in the FXR-mediated control of ApoA-I or in expression of other

genes regulating HDL metabolism, for example peroxisome proliferator-activated

receptors (PPARs), may contribute to these divergent results. Alternatively, other

factors may be involved. For example, in the rat, the age-dependent reduction of

bile salt synthesis and concomitant increase of plasma cholesterol can be reversed

by growth hormone (GH) treatment59;60. Hepatic LDL receptor expression and

activity are stimulated by GH. Interestingly, the administration of GH stimulates

bile salt synthesis and reduces plasma cholesterol even in mice lacking LDL

receptors61. In addition, growth hormone induces LDL clearance but not bile salt

synthesis in humans, suggesting additional factors to be involved62;63.

Cholehepatic shunting of bile salts: a functional shortcut?

Apart from an enterohepatic circulation, cholehepatic shunting of bile salts has

been proposed as an physiologically important entity62;64. According to this concept,

cholangiocytes absorb (un)conjugated bile salts by passive diffusion or active

transport. Subsequently, these bile salts return to the liver to be resecreted into

bile, thereby promoting additional movement of water. Cholehepatic circulation

could play a role in feedback repression of de novo bile salt synthesis and control

expression of hepatocytic transport systems for bile salts, i.e., Ntcp and Bsep, via

activation of FXR (NR1H4)20;65. Especially during conditions associated with bile duct

proliferation such as extrahepatic cholestasis, cholehepatic shunting of bile salts

could thus protect the liver from further bile salt toxicity by limiting intracellular

accumulation. Because bile duct proliferation has been shown to enhance bile fl ow,

we have evaluated in chapter 7 whether bile duct proliferation without cholestasis

is associated with altered bile fl ow and/or bile salt synthesis making use of Mdr2

P-glycoprotein (Abcb4)-defi cient (Mdr2 (-/-)) mice66. The combination of increased

expression of Asbt, tAbst, and Mrp3, putatively involved in cholangiocytic bile salt

transport, and the observed increased choleretic activity of bile salts in Mdr2 (-/-) mice

strongly supports the existence of cholehepatic shunting. In spite of this, cholate

synthesis and pool size were unaffected. These results support the concept that bile

duct proliferation can be a protective response against toxic stimuli by enhancing

bile fl ow.

In summary, bile salts play an important role in bile salt and cholesterol

metabolism and our understanding of the integrated control by nuclear receptors

as the key regulators of the activity of critical structures involved in bile

143

General discussion

salt and cholesterol metabolism has improved considerably during the last few

years. Although the mechanisms for the regulation of bile salt uptake, bile salt

synthesis rate, hepatobiliary transport and intestinal reabsorption have been well

documented, the application of stable isotope procedures is necessary to provide

an integrated view on kinetics of the enterohepatic circulation to fully comprehend

the novel insights into bile salt metabolism and their (patho)physiologic role in

health and disease.

144

General discussion

References

1. http://interzone.com/~cheung/SUM.dir/med10a.html.2. http://www.cancerdecisions.com/speeches/galen1989.html.3. Schiff M. Gallenbildung, äbhangig von der Aufsäugung der Gallenfarbstoffe. Pfl ueger

Arch Ges Physiol 3, 598-613. 1870. 4. Redinger RN. Nuclear receptors in cholesterol catabolism: molecular biology of the

enterohepatic circulation of bile salts and its role in cholesterol homeostasis. J Lab Clin Med 2003; 142: 7-20.

5. Pauletzki J, Stellaard F, Paumgartner G. Bile acid metabolism in human hyperthyroidism. Hepatology 1989; 9: 852-5.

6. Berr F, Pratschke E, Fischer S, Paumgartner G. Disorders of bile acid metabolism in cholesterol gallstone disease. J Clin Invest 1992; 90: 859-68.

7. Kullak-Ublick GA, Paumgartner G, Berr F. Long-term effects of cholecystectomy on bile acid metabolism. Hepatology 1995; 21: 41-5.

8. Watkins JB, Jarvenpaa AL, Szczepanik-Van Leeuwen P, Klein PD, Rassin DK, Gaull G, Raiha NC. Feeding the low-birth weight infant: V. Effects of taurine, cholesterol, and human milk on bile acid kinetics. Gastroenterology 1983; 85: 793-800.

9. Koopman BJ, Kuipers F, Bijleveld CM, van der Molen JC, Nagel GT, Vonk RJ, Wolthers BG. Determination of cholic acid and chenodeoxycholic acid pool sizes and fractional turnover rates by means of stable isotope dilution technique, making use of deuterated cholic acid and chenodeoxycholic acid. Clin Chim Acta 1988; 175: 143-55.

10. Stellaard F, Sackmann M, Sauerbruch T, Paumgartner G. Simultaneous determination of cholic acid and chenodeoxycholic acid pool sizes and fractional turnover rates in human serum using 13C-labeled bile acids. J Lipid Res 1984; 25: 1313-9.

11. Watkins JB, Ingall D, Szczepanik P, Klein PD, Lester R. Bile-salt metabolism in the newborn. Measurement of pool size and synthesis by stable isotope technic. N Engl J Med 1973; 288: 431-4.

12. Lindstedt S. The turnover of cholic acid in man: bile acids and steroids. Acta Physiol Scand 1957; 40: 1-9.

13. Hulzebos CV, Renfurm L, Bandsma RH, Verkade HJ, Boer T, Boverhof R, Tanaka H, Mierau I, Sauer PJJ, Kuipers F, et al. Measurement of cholic acid kinetics in plasma using a micro scale stable isotope technique: application to rodents and man. J Lipid Res 2001;42: 1923-1929.

14. Francis GA, Fayard E, Picard F, Auwerx J. Nuclear receptors and the control of metabolism. Annu Rev Physiol 2003; 65:261-311.

15. Redinger RN. The role of the enterohepatic circulation of bile salts and nuclear hormone receptors in the regulation of cholesterol homeostasis: Bile salts as ligands for nuclear hormone receptors. Can J Gastroenterol 2003; 17: 265-71.


17. Redinger RN. The economy of the enterohepatic circulation of bile acids in the baboon. 2. Regulation of bile acid synthesis by enterohepatic circulation of bile acids. J Lipid Res 1984; 25: 437-47.


19. Kullak-Ublick GA, Stieger B, Meier PJ. Enterohepatic bile salt transporters in normal physiology and liver disease. Gastroenterology 2004; 126: 322-42.


21. Wang H, Chen J, Hollister K, Sowers LC, Forman BM. Endogenous bile acids are ligands for the nuclear receptor FXR/BAR. Mol Cell 1999; 3: 543-53.


23. Wolters H, Elzinga BM, Baller JF, Boverhof R, Schwarz M, Stieger B, Verkade HJ, Kuipers F. Effects of bile salt fl ux variations on the expression of hepatic bile salt transporters

145

General discussion

in vivo in mice. J Hepatol 2002; 37: 556-63.24. Sinal CJ, Tohkin M, Miyata M, Ward JM, Lambert G, Gonzalez FJ. Targeted disruption of

the nuclear receptor FXR/BAR impairs bile acid and lipid homeostasis. Cell 2000; 102: 731-44.


26. Goodwin B, Jones SA, Price RR, Watson MA, McKee DD, Moore LB, Galardi C, Wilson JG, Lewis MC, Roth ME, Maloney PR, Willson TM, Kliewer SA. A regulatory cascade of the nuclear receptors FXR, SHP-1, and LRH-1 represses bile acid biosynthesis. Mol Cell 2000; 6: 517-26.

27. Liu Y, Binz J, Numerick MJ, Dennis S, Luo G, Desai B, MacKenzie KI, Mansfi eld TA, Kliewer SA, Goodwin B, Jones SA. Hepatoprotection by the farnesoid X receptor agonist GW4064 in rat models of intra- and extrahepatic cholestasis. J Clin Invest 2003; 112: 1678-87.

28. Stravitz RT SAPWVZBJ, Dawson PA. Induction of sodium-dependent bile acid transporter messenger RNA, protein, and activity in rat ileum by cholic acid. Gastroenterology 1997; 113: 1599-608.

29. Arrese M, Shneider BL. Neither intestinal sequestration of bile acids nor common bile duct ligation modulate the expression and function of the rat ileal bile acid transporter. Hepatology 1998; 28: 1081-7.

30. Lillienau J, Hofmann AF. Negative feedback regulation of the ileal bile acid transport system in rodents. Gastroenterology 1993; 104: 38-46.

31. Dawson PA. Intestinal bile acid transport; molecules, mechanisms, and malabsorption. In: Paumgartner G, Leuschner U, eds. Bile acids and cholestasis. London: Kluwer Academic Publishers, 1998;1-31.

32. Xu G, Salen G. Ileal bile acid transport regulates bile acid pool, synthesis, and plasma cholesterol levels differently in cholesterol-fed rats and rabbits. J Lipid Res 2000; 41: 298-304.

33. Meier PJ, Stieger B. Bile salt transporters. Annu Rev Physiol 2002; 64: 635-61.34. Dawson PA, Haywood J, Craddock AL, Wilson M, Tietjen M, Kluckman K, Maeda N, Parks

JS. Targeted deletion of the ileal bile acid transporter eliminates enterohepatic cycling of bile acids in mice. J Biol Chem 2003; 278: 33920-7.

35. Hulzebos CV, Wolters H, Plosch T, Kramer W, Stengelin S, Stellaard F, Sauer PJ, Verkade HJ, Kuipers F. Cyclosporin A and enterohepatic circulation of bile salts in rats: decreased cholate synthesis but increased intestinal reabsorption. J Pharmacol Exp Ther 2003; 304: 356-63.

36. Chen F, Ma L, Dawson PA, Sinal CJ, Sehayek E, Gonzalez FJ, Breslow J, Ananthanarayanan M, Shneider BL. Liver receptor homologue-1 mediates species- and cell line-specifi c bile acid-dependent negative feedback regulation of the apical sodium-dependent bile acid transporter. J Biol Chem 2003; 278: 19909-16.

37. Schwarz M, Russell DW, Dietschy JM, Turley SD. Marked reduction in bile acid synthesis in cholesterol 7alpha-hydroxylase-defi cient mice does not lead to diminished tissue cholesterol turnover or to hypercholesterolemia. J Lipid Res 1998; 39: 1833-43.

38. Chawla A, Repa JJ, Evans RM, Mangelsdorf DJ. Nuclear receptors and lipid physiology: opening the X-fi les. Science 2001; 294: 1866-70.

39. Shepherd J, Packard CJ, Bicker S, Lawrie TD, Morgan HG. Effect of cholestyramine on low-density lipoproteins. N Engl J Med 1980; 303: 943-4.

40. Shepherd J, Packard CJ, Bicker S, Lawrie TD, Morgan HG. Cholestyramine promotes receptor-mediated low-density-lipoprotein catabolism. N Engl J Med 1980; 302: 1219-22.

41. Goldstein JL, Brown MS. Regulation of low-density lipoprotein receptors: implications for pathogenesis and therapy of hypercholesterolemia and atherosclerosis. Circulation 1987; 76: 504-7.

42. Elzinga BM, Havinga R, Baller JF, Wolters H, Bloks V, Mensenkamp AR, Kuipers F, Verkade HJ. The role of transhepatic bile salt fl ux in the control of hepatic secretion of triacylglycerol-rich lipoproteins in vivo in rodents. Biochim Biophys Acta 2002; 1573: 9-20.

43. Angelin B, Einarsson K, Hellstrom K, Leijd B. Effects of cholestyramine and

146

General discussion

chenodeoxycholic acid on the metabolism of endogenous triglyceride in hyperlipoproteinemia. J Lipid Res 1978; 19: 1017-24.

44. Angelin B, Hershon KS, Brunzell JD. Bile acid metabolism in hereditary forms of hypertriglyceridemia: evidence for an increased synthesis rate in monogenic familial hypertriglyceridemia. Proc Natl Acad Sci U S A 1987; 84: 5434-8.

45. Duane WC. Abnormal bile acid absorption in familial hypertriglyceridemia. J Lipid Res 1995; 36: 96-107.

46. Duane WC, Hartich LA, Bartman AE, Ho SB. Diminished gene expression of ileal apical sodium bile acid transporter explains impaired absorption of bile acid in patients with hypertriglyceridemia. J Lipid Res 2000; 41: 1384-9.

47. Miller NE, Nestel PJ. Triglyceride-lowering effect of chenodeoxycholic acid in patients with endogenous hypertriglyceridaemia. Lancet 1974; 2: 929-31.

48. Pullinger CR, Eng C, Salen G, Shefer S, Batta AK, Erickson SK, Verhagen A, Rivera CR, Mulvihill SJ, Malloy MJ, Kane JP. Human cholesterol 7alpha-hydroxylase (CYP7A1) defi ciency has a hypercholesterolemic phenotype. J Clin Invest 2002; 110: 109-17.

49. Hulzebos CV, Bijleveld CM, Stellaard F, Kuipers F, Fidler V, Slooff MJH, Peeters PM, Sauer PJJ, Verkade HJ. Cyclosporine A-Induced reduction of bile salt synthesis associated with increased plasma lipids in children after liver transplantation. Liver Transpl 2004; 10: 872-80.

50. Brown MS, Goldstein JL. A receptor-mediated pathway for cholesterol homeostasis. Science 1986; 232: 34-47.

51. Rudling M, Angelin B, Stahle L, Reihner E, Sahlin S, Olivecrona H, Bjorkhem I, Einarsson C. Regulation of hepatic low-density lipoprotein receptor, 3-hydroxy-3-methylglutaryl coenzyme A reductase, and cholesterol 7alpha-hydroxylase mRNAs in human liver. J Clin Endocrinol Metab 2002; 87: 4307-13.

52. Rudling MJ, Reihner E, Einarsson K, Ewerth S, Angelin B. Low density lipoprotein receptor-binding activity in human tissues: quantitative importance of hepatic receptors and evidence for regulation of their expression in vivo. Proc Natl Acad Sci U S A 1990; 87: 3469-73.

53. Einarsson K, Nilsell K, Leijd B, Angelin B. Infl uence of age on secretion of cholesterol and synthesis of bile acids by the liver. N Engl J Med 1985; 313: 277-82.

54. Ericsson S, Eriksson M, Vitols S, Einarsson K, Berglund L, Angelin B. Infl uence of age on the metabolism of plasma low density lipoproteins in healthy males. J Clin Invest 1991; 87: 591-6.

55. Law MR, Wald NJ, Thompson SG. By how much and how quickly does reduction in serum cholesterol concentration lower risk of ischaemic heart disease? BMJ 1994; 308: 367-72.

56. Willson TM, Jones SA, Moore JT, Kliewer SA. Chemical genomics: functional analysis of orphan nuclear receptors in the regulation of bile acid metabolism. Med Res Rev 2001; 21: 513-22.

57. Lambert G, Amar MJ, Guo G, Brewer HB, Jr., Gonzalez FJ, Sinal CJ. The farnesoid X-receptor is an essential regulator of cholesterol homeostasis. J Biol Chem 2003; 278: 2563-70.

58. Claudel T, Sturm E, Duez H, Torra IP, Sirvent A, Kosykh V, Fruchart JC, Dallongeville J, Hum DW, Kuipers F, Staels B. Bile acid-activated nuclear receptor FXR suppresses apolipoprotein A-I transcription via a negative FXR response element. J Clin Invest 2002; 109: 961-71.

59. Rudling M, Parini P, Angelin B. Growth hormone and bile acid synthesis. Key role for the activity of hepatic microsomal cholesterol 7alpha-hydroxylase in the rat. J Clin Invest 1997; 99: 2239-45.

60. Parini P, Angelin B, Rudling M. Cholesterol and lipoprotein metabolism in aging: reversal of hypercholesterolemia by growth hormone treatment in old rats. Arterioscler Thromb Vasc Biol 1999; 19: 832-9.

61. Rudling M, Angelin B. Growth hormone reduces plasma cholesterol in LDL receptor-defi cient mice. FASEB J 2001; 15: 1350-6.

62. Palmer KR, Gurantz D, Hofmann AF, Clayton LM, Hagey LR, Cecchetti S. Hypercholeresis induced by norchenodeoxycholate in biliary fi stula rodent. Am J Physiol 1987; 252: G219-G228.

63. Lind S, Rudling M, Ericsson S, Olivecrona H, Eriksson M, Borgstrom B, Eggertsen G,

147

General discussion

Berglund L, Angelin B. Growth hormone induces low-density lipoprotein clearance but not bile acid synthesis in humans. Arterioscler Thromb Vasc Biol 2004; 24: 349-56.

64. Gurantz D, Schteingart CD, Hagey LR, Steinbach JH, Grotmol T, Hofmann AF. Hypercholeresis induced by unconjugated bile acid infusion correlates with recovery in bile of unconjugated bile acids. Hepatology 1991; 13: 540-50.

65. Lu TT, Repa JJ, Mangelsdorf DJ. Orphan nuclear receptors as eLiXiRs and FiXeRs of sterol metabolism. J Biol Chem 2001; 276: 37735-8.

66. Smit JJ, Schinkel AH, Oude Elferink RP, Groen AK, Wagenaar E, van Deemter L, Mol CA, Ottenhoff R, van der Lugt NM, van Roon MA. Homozygous disruption of the murine mdr2 P-glycoprotein gene leads to a complete absence of phospholipid from bile and to liver disease. Cell 1993; 75: 451-62.

SummarySamenvattingDankwoord

Curriculum VitaeList of publications

150

Summary

Bile salts serve a number of important physiological functions in the mammalian

body. Apart from their role in generation of bile fl ow, biliary lipid excretion and

dietary lipid absorption, bile salts are of crucial relevance for removal of excess

cholesterol from the body. Bile salts are maintained in an effi cient enterohepatic

circulation, which implies that, after being secreted, the majority of bile salts

is reabsorbed from the intestine, transported back to the liver and resecreted

into bile. All steps in this enterohepatic circulation are subjected to regulatory

mechanisms, mainly exerted at the level of gene transcription. Recently, it has

become clear that bile salts exert regulatory actions on their own enterohepatic

circulation via control on transcription of genes involved in synthesis and transport.

This control is predominantly exerted via activation of a nuclear receptor called

the farnesoid X receptor (FXR). This receptor is highly expressed in liver and

intestine and, upon its activation by bile salts, controls the expression of a variety

of genes. Recent studies have shown that not only genes involved in bile salt

metabolism and transport are controlled by FXR, but also genes involved in

cholesterol, triglyceride, and even glucose metabolism. Thus, the enterohepatic

circulation of bile salts is of pivotal importance in regulation of metabolism in

a broad sense. To characterize the dynamics of the enterohepatic circulation, we

developed a novel stable isotope dilution method which allows to calculate bile

salt synthesis, pool size and turnover in humans and in rodents. Studies in

children employing this technique will improve our understanding of adaptation of

bile salt metabolism to developmental maturation, certain disease states, or to

administration of specifi c drugs. Experimental animal models are, amongst several

other applications, also suitable to delineate adaptive changes of the enterohepatic

circulation attributable to “knocking-out” of individual genes. Research described

in this thesis addresses various aspects of bile salt metabolism in pediatric

patients after liver transplantation and in animal models. Animal studies include

several (genetically-modifi ed) mouse and rat models with special reference to

hepatic (farnesoid X receptor, multidrug resistance 2 P-glycoprotein) and intestinal

(apical sodium-dependent bile salt transporter) proteins involved in enterohepatic

circulation of bile salts. Moreover, studies were conducted to determine effects

of drugs on bile salt and lipid metabolism in children after liver transplantation

(cyclosporin A) and in rodents (cyclosporin A, synthetic FXR ligand).

Chapter 1 provides an overview of bile formation, biosynthesis of bile salts

and of hepatic and intestinal proteins involved in the enterohepatic circulation of

bile salts. In addition, the regulation of the enterohepatic circulation is described,

with specifi c emphasis on the role of the nuclear receptor FXR. For better

understanding of the clinical relevance of measuring bile salt kinetics, an overview

of current knowledge of the individual parameters on bile salt kinetics is presented

in this chapter.

Information on bile salt metabolism has been succesfully obtained in adult

humans after administration of stable isotopically-labeled bile salts, which

eliminates radiation hazards (associated with the use of radioactive labeled bile

salts) and the need of interrupting the enterohepatic circulation for collection

of bile. Yet, the conventional approach requires a number of relatively large

plasma samples which precludes its use in newborns and commonly used

laboratory animals. Chapter 2 describes a novel stable isotope dilution method

151

Summary

using tetradeuterated cholate ([2,2,4,4-2H4]-CA) that allows measurement of

the kinetics of cholate, the major bile salt species in rodents and humans

requiring relatively small blood volumes (50-100µL). The method was validated by

confi rmation of isotopic equilibrium between biliary and plasma cholate in the rat.

The kinetic data obtained with the novel method agreed well with literature data

obtained with conventional techniques. The applicability was demonstrated by the

observation of an increased synthesis and fractional turnover rate of cholate in

rats fed cholestyramine, a drug known to increase fecal bile salt disposal.

In chapter 3, effects of cyclosporin A (CsA), a commonly used immuno-

suppressant, on bile salt metabolism were studied in rats. CsA has been shown

to inhibit synthesis and hepatobiliary transport of bile salts in vitro and in vivo.

However, effects of CsA on the enterohepatic circulation of bile salts in vivo

were largely unknown. We characterized the effects of CsA on the enterohepatic

circulation of cholate with respect to kinetic parameters and in relation to the

expression of relevant transporters in liver and intestine in rats. CsA treatment

decreased cholate synthesis rate, but did not affect pool size or cycling time.

Interestingly, CsA reduced the amount of cholate lost per enterohepatic cycle.

Protein levels of the apical sodium-dependent bile salt transporter (Asbt) involved

in intestinal bile salt reabsorption were two-fold increased in distal ileum

of CsA-treated rats, due to posttranscriptional events. Thus, CsA seems to

enhance effi cacy of intestinal cholate reabsorption through increased Asbt protein

expression in the distal ileum, which contributes to maintenance of cholate pool

size.

In humans, CsA is widely applied after solid organ transplantation, but also

in auto-immunological disorders. CsA is associated with a number of side effects,

including hyperlipidemia and hepatotoxicity, the latter leading to cholestasis. The

etiology of CsA-associated hyperlipidemia as well as effects of CsA on bile salt

kinetics in humans are largely unknown, but a relationship between bile salt

metabolism and plasma lipid concentrations has emerged from various studies.

For example, familial hypertriglycidemia is associated with bile salt malabsorption

and treatment with the bile salt chenodeoxycholate decreases plasma triglyceride

concentrations. Studies described in chapter 4 aimed to elucidate whether CsA

treatment affects bile salt metabolism in humans in vivo, and whether such effects

would be related to CsA-associated hyperlipidemia. Our results indicate that CsA

reversibly reduced primary bile salt synthesis rate in pediatric patients after liver

transplantation and that the reduction was strongly and inversely correlated with

plasma lipid levels. Although the molecular mechanism has not been identifi ed

yet, candidate proteins involved herein include nuclear hormone receptors, which

control a wide variety of genes important for metabolism of bile salts as well

as of lipids. One of these proteins is the farnesoid X receptor (FXR; NR1H4),

which functions as an intracellular bile salt sensor. The bile salt-activated FXR

effectively regulates the transcription of several genes considered crucial in bile

salt synthesis and transport.

The impact of FXR-defi ciency on bile salt kinetics in FXR-defi cient (Fxr (-/-))

mice is described in chapter 5. Cholate synthesis rate and cholate pool size were

increased in Fxr (-/-) mice, coinciding with an increase in cholesterol 7α-hydroxylase

(Cyp7a1) expression in the liver. Despite a markedly diminished expresion of ileal

152

Summary

bile acid-binding protein (Ibabp) mRNA and protein, considered to be involved in

bile salt reabsoption, the fractional turnover rate and cycling time of the cholate

pool were not affected and the calculated amount of cholate reabsorbed from

the intestine per day was higher in Fxr (-/-) than in wild-type mice. Thus, FXR-

defi ciency in mice is associated with defective feedback inhibition of hepatic

cholate synthesis.

Under cholestatic conditions in which bile formation is perturbed, it might

be benefi cial to suppress bile salt synthesis and, at the same time, stimulate

bile salt excretion and reduce uptake of bile salts to maintain cellular integrity.

Development of selective ligands that activate FXR could therefore, in theory,

contribute to novel therapeutic approaches to treat cholestatic liver diseases. In

chapter 6 we studied the physiological consequences of prolonged treatment of

rats with the synthetic FXR agonist GW4064 on the kinetics of the enterohepatic

cycling of cholate. Cholate synthesis rate was markedly decreased upon FXR

activation. This resulted in a diminished circulating cholate pool with an unaltered

fractional turnover rate. In the small intestine, protein and mRNA expression of

the ileal bile acid-binding protein (Ibabp) were increased with a shift towards

more proximal parts of the ileum upon FXR activation. FXR-induced expression of

intestinal Ibabp apparently did not enhance bile salt reabsorption to maintain pool

size under these conditions of impaired bile salt synthesis.

In addition to an enterohepatic circulation, the existence of cholehepatic

circulation of bile salts has been postulated. The apical sodium-dependent bile

salt transporter (Asbt), its truncated form (tAbst) and the multidrug resistance-

related protein (Mrp3), are putatively involved in cholangiocytic bile salt uptake

and effl ux. Cholehepatic shunting could play a role in feedback repression of de

novo bile salt synthesis and control expression of hepatocytic transport systems

for bile salts. Especially during conditions associated with bile duct proliferation

such as extrahepatic cholestasis, cholehepatic circulation of bile salts could thus

in theory protect the liver from further bile salt toxicity by limiting intracellular

accumulation. In chapter 7 we studied whether bile duct proliferation without

cholestasis is associated with altered bile salt synthesis and/or bile fl ow. As a model

for bile duct proliferation without cholestasis we made use of Mdr2 P-glycoprotein

(or Abcb4) -defi cient (Mdr2 (-/-)) mice that are unable to secrete phospholipids into

bile and develop progressive bile duct proliferation in the absence of obstructive

cholestasis. Cholate synthesis rate was unaffected in Mdr2 knockout mice. During

infusion of step-wise increasing dosages of tauroursodeoxycholate (TUDC), bile

salt-dependent and independent fl ow were increased in Mdr2 knockout mice

compared to controls. Hepatic expression Asbt, tAbst and Mrp3 were up-regulated

in Mdr2 knockout mice. Apparently, bile duct proliferation in Mdr2 knockout

mice enhances cholehepatic shunting of bile salts, which is associated with a

disproportionally high bile fl ow but seems not to represent a major determinant

of bile salt synthesis.

In conclusion, knowledge of the molecular mechanisms of various steps involved

in the enterohepatic circulation of bile salts has emerged in the past couple of

years and still is in fast progress. To fully appreciate the importance of these

proteins at the (patho)physiological level, in vivo techniques that quantify actual

153

Summary

metabolic fl uxes such as stable isotope dilution techniques are required. Studies

described in this thesis clearly demonstrate the relevance of in vivo measurement

of bile salt kinetics in experimental and clinical settings. Future bile salt research

will probably identify novel regulatory proteins and crosstalk between these and

already identifi ed factors will be of crucial importance. The isotope dilution method

will be of eminent value in determining the physiologic consequences of these

interactions on whole body bile salt metabolism in health and disease.

154

Samenvatting

Galzouten worden in de lever uit cholesterol gemaakt en vormen een belangrijk

bestanddeel van gal. Galzouten vervullen diverse essentiële functies in ons

lichaam. Galzouten induceren de vorming van gal en zijn, eenmaal door de lever

in de darm uitgescheiden, onmisbaar voor de absorptie van vetten uit onze

voeding. Tevens is de vorming van galzouten uit cholesterol en de daaropvolgende

uitscheiding van galzouten met de ontlasting de belangrijkste manier om een

overmaat aan cholesterol uit ons lichaam kwijt te raken.

In ons lichaam circuleren galzouten in een zogenaamde darm-lever

(enterohepatische) kringloop. Dit betekent dat de meeste galzouten, na

uitscheiding via de gal in de darm, weer opgenomen worden uit de darm en

retourneren naar de lever. Na heropname door de lever vindt weer uitscheiding

in de gal plaats. De darm-lever kringloop is dus een dynamisch proces; per

dag circuleren de galzouten een aantal keren. Onlangs is bekend geworden dat

galzouten hun eigen darm-lever kringloop kunnen beïnvloeden via diverse genen,

die betrokken zijn bij de produktie en het transport van galzouten. De invloed

van galzouten op deze processen wordt gemedieerd door zogenaamde “nucleaire”

of kern receptoren. Voor galzouten is met name de kern receptor FXR van

belang. Galzouten worden door dit eiwit herkend. Nadat galzouten aan FXR

binden, worden diverse genen betrokken bij de darm-lever kringloop hierdoor

beïnvloed. Het is gebleken dat FXR ook een functie heeft in de cholesterol en

suikerstofwisseling. Zo blijkt dus de essentiële rol van galzouten, die via FXR vele

stofwisselingsprocessen in ons lichaam kunnen beïnvloeden.

In het kader van het in dit proefschrift beschreven onderzoek is een methode

ontwikkeld, waarmee op niet-belastende wijze de dynamiek van de darm-lever

kringloop gekarakteriseerd kan worden (zie fi guur). Hierbij wordt gebruik gemaakt

van onschadelijke stoffen, zogenaamde stabiele isotopen. Dit zijn verbindingen,

die van nature in ons lichaam voorkomen, maar iets zwaarder gemaakt zijn

(“stabiel gelabeld”), waardoor ze in een lichaamsvloeistof (bloed, gal) met speciale

apparatuur te meten zijn. Met deze methode is het mogelijk de produktiesnelheid

van galzouten te berekenen en ook de totale galzoutvoorraad, alsmede de snelheid

waarmee galzouten uit ons lichaam verdwijnen. Voor de conventionele methode

om de dynamiek van de darm-lever kringloop te meten moest per keer een

relatief groot volume (8 mL) bloed afgenomen worden, waardoor dit onderzoek

bij kinderen of kleine proefdieren niet uitgevoerd kon worden. Met de nieuwe

methode is dit wel mogelijk, omdat per keer slechts een kleine hoeveelheid

bloed (50-100µL) nodig is. Hierdoor is het mogelijk kennis op te doen over

effecten van bepaalde ziekten of medicijnen op de galzoutstofwisseling. Ook is nu

onderzoek naar de normale ontwikkeling van de galzoutstofwisseling tijdens groei

van kinderen mogelijk. Deze methode is tevens geschikt om veranderingen van

de darm-lever kringloop te bestuderen in (dier)modellen waarbij deze kringloop

gemanipuleerd wordt, bijvoorbeeld door genetische manipulatie waarmee bepaalde

eiwitten uitgeschakeld kunnen worden.

Hoofdstuk 1 geeft een overzicht van de vorming van gal, de aanmaak

van galzouten en van de darm-lever kringloop, inclusief een beschrijving van de

eiwitten in lever en darm die hierbij betrokken zijn. Ook wordt de regulatie van de

darm-lever kringloop door het FXR eiwit beschreven. Voor een beter begrip van

het nut van het meten van de dynamiek (of kinetiek) van de darm-lever kringloop

155

Samenvatting

wordt een overzicht gegeven van de huidige kennis op dit gebied.

Hoofdstuk 2 beschrijft de nieuwe meetmethode met stabiel gelabeld cholaat

(cholaat is één van de belangrijkste galzouten bij mens en dier), waardoor het

mogelijk wordt om de dynamiek van de darm-lever kringloop van dit galzout

te meten. Behalve het geringe benodigde bloedvolume is het een voordeel dat

het onderzoek onder natuurlijke omstandigheden kan gebeuren. De metingen

hoeven namelijk niet in gal te gebeuren. Het blijkt dat metingen in het bloed net

zo betrouwbaar zijn om de diverse parameters van de darm-lever kringloop te

berekenen. De gegevens die zijn verkregen met deze nieuwe methode komen

goed overeen met in de literatuur beschreven gegevens, verkregen na toepassing

van andere technieken. De praktische toepasbaarheid wordt gedemonstreerd door

het aantonen van een verhoogde produktiesnelheid en uitscheiding van galzouten

in ratten behandeld met cholestyramine, een medicijn dat galzouten in de darm

bindt en zo de galzoutuitscheiding met de ontlasting vergroot.

In hoofdstuk 3 worden de effecten van cyclosporine A (CsA), een veel

gebruikt afweeronderdrukkend medicijn, op het galzoutmetabolisme beschreven.

Schematische weergave van de darm-lever kringloop van lichaams-eigen galzouten (witte bolletjes) en menging van toegediende, stabiel gelabelde galzouten (zwarte bolletjes) met de in het lichaam aanwezige galzoutvoorraad. Veruit de meeste galzouten worden, na uitscheiding met de gal door de lever in de darm, weer opgenomen uit de darm en retourneren naar de lever. Na heropname door de lever vindt weer uitscheiding in de gal plaats. Met behulp van stabiele isotopen is het mogelijk de produktiesnelheid van galzouten te berekenen (pijl in de lever) en ook de totale galzoutvoorraad (witte bolletjes), alsmede de snelheid waarmee galzouten uit ons lichaam verdwijnen (pijl in de darm).

156

Samenvatting

Van CsA is bekend dat het de produktie en het transport van galzouten vanuit

de lever naar de gal remt. Deze gegevens komen vooral uit studies uitgevoerd in

reageerbuizen en in proefdieren. De effecten van CsA op de darm-lever kringloop

van galzouten zijn grotendeels onbekend. Wij hebben de effecten van CsA op de

darm-lever kringloop van galzouten in kaart gebracht en deze gerelateerd aan de

aanwezigheid van de voor de darm-lever kringloop relevante eiwitten in lever en

darm van ratten. Het blijkt dat door behandeling met CsA de cholaatproduktie

afneemt, terwijl de totale cholaat voorraad niet verandert. Verder worden via de

ontlasting minder galzouten verloren na behandeling met CsA. Eén en ander is

geassocieerd met een toename van een eiwit in de darmen, dat betrokken is bij de

reabsorptie van galzouten (het Asbt eiwit). Derhalve lijkt het dat CsA de effi ciency

van de opname van galzouten in de darm vergroot door een toename van het Asbt

eiwit in de darm, waardoor de totale galzoutvoorraad niet verandert.

CsA wordt vooral gebruikt door patiënten na een orgaantransplantatie

(om afstoting te voorkomen), en ook bij auto-immuunziektes (waarbij het

afweersysteem het eigen lichaam beschadigt). CsA kan ook bijwerkingen

veroorzaken, inclusief een stijging van de vetspiegels in het bloed en beschadiging

van de lever, waaronder gestoorde galvorming. De oorzaak van deze bijwerkingen

en de effecten op de darm-lever kringloop door CsA zijn in de mens nog

onbekend. Hoofdstuk 4 beschrijft de effecten van behandeling met CsA op het

galzoutmetabolisme bij kinderen na een levertransplantatie en de relatie met

cholesterol in het bloed. CsA remt de produktie van galzouten. Deze verminderde

produktie van galzouten gaat gepaard met hogere vetspiegels in het bloed. Na

het stoppen van de CsA stijgt de galzoutproduktie en dalen de cholesterolspiegels.

Hoewel het moleculaire mechanisme nog niet duidelijk is, kan FXR, dat een rol

speelt in de galzouten cholesterolstofwisseling, hierbij van belang zijn.

In hoofdstuk 5 wordt de rol van FXR op de darm-lever kringloop bestudeerd

in muizen waarin het gen voor het FXR eiwit niet meer aanwezig is (ook wel “FXR

knockout” muizen genaamd). Zowel de produktie als de voorraad cholaat zijn

toegenomen in de FXR knockout muizen, waarbij in de lever een eiwit, belangrijk

voor de galzoutsynthese, toegenomen is. In de darm van de FXR knockout muizen

is een ander eiwit (afgekort: Ibabp) bijna afwezig. Ondanks afwezigheid van dit

eiwit, welke geacht wordt een belangrijke rol te spelen bij het transport van

galzouten in de darmcellen, is de hoeveelheid cholaat die per dag uit de darm

wordt opgenomen hoger in de FXR knockout muizen dan in controle muizen.

Samenvattend stellen wij dat de afwezigheid van FXR in muizen geassocieerd is

met een minder geremde produktie van cholaat, terwijl de darm-lever kringloop

van cholaat niet noemenswaardig beïnvloed wordt.

Medicijnen die het FXR eiwit activeren zouden toegepast kunnen worden in

nieuwe behandelingen van ziekten waarbij galzouten zich ophopen in het lichaam.

Immers, stimulatie van FXR leidt theoretisch tot een kleinere galzoutproduktie

en vermindert opeenhoping van galzouten in de lever, waardoor leverschade

voorkomen wordt. In hoofdstuk 6 zijn ratten met een FXR stimulerende stof

behandeld en zijn de effecten hiervan op de darm-lever kringloop van cholaat

bestudeerd. Zoals verwacht is de produktie van cholaat sterk gereduceerd

na FXR activatie. Dit resulteert in een kleinere cholaat voorraad, waarbij de

verdwijningssnelheid via de darm niet veranderd is. In de darm van de behandelde

157

Samenvatting

ratten is echter meer Ibabp-eiwit, wat een rol zou spelen bij de opname

van galzouten, aanwezig. Desondanks is de galzoutreabsorptie niet voldoende

toegenomen om de galzoutvoorraad te handhaven onder deze condities. Misschien

is de rol van het Ibabp eiwit bij de opname van galzouten derhalve anders dan tot

nu toe werd verondersteld.

Behalve een darm-lever kringloop van galzouten, bestaat ook een

cholehepatische ofwel gal-lever kringloop van galzouten. Dit houdt in dat galzouten

nog voordat ze de darm bereikt hebben in de galgangen opgenomen worden en

naar de lever retourneren, waarna ze wederom in de gal uitgescheiden worden.

Bij deze processen zijn een drietal eiwitten betrokken (afgekort: Asbt, tAsbt en

Mrp3). De gal-lever kringloop zou de galzoutproduktie kunnen onderdrukken,

wat zinvol zou kunnen zijn bij ziektebeelden met een belemmerde galafvloed.

Zo kan een excessieve ophoping van galzouten in de lever voorkomen worden

en blijven de levercellen intact. In hoofdstuk 7 hebben we dit bestudeerd

in de zogenaamde Mdr2 knockout muizen. Doordat in de levercellen het gen

voor het Mdr2 eiwit niet functioneert, ontbreken in de gal stoffen (zogenaamde

fosfolipiden) die de galgangen beschermen tegen galzouten. Galzouten werken

namelijk als een soort zeep die de vettige wand van de galgangen kunnen

oplossen. In afwezigheid van deze beschermende stoffen worden de galgangen

beschadigd en worden nieuwe galgangen gevormd. Hierdoor neemt het aantal

galgangen progressief toe in de Mdr2 knockout muizen (waardoor er meer

galgangcellen zijn die galzouten naar de lever kunnen transporteren) en blijft

de galafvloed naar de darm goed. De galzoutproduktie en galstroomsnelheid

zijn onderzocht in deze muizen middels de isotopen methode en tijdens het

intraveneus injecteren van galzouten. Indien er een gal-lever kringloop bestaat,

zal een deel van de geïnjecteerde galzouten weer worden opgenomen door

de lever en opnieuw uitgescheiden worden, waardoor de galstroom toeneemt.

Het blijkt dat de cholaatproduktie onveranderd is in Mdr2 knockout muizen. De

stroomsnelheid van galzouten is wel hoger in Mdr2 knockout muizen vergeleken

met controle muizen. Ook werd in de lever van Mdr2 knockout muizen een

toename gevonden van de Abst, tAbst en Mrp3 eiwitten. Ogenschijnlijk is bij een

toegenomen aantal galgangen in Mdr2 knockout muizen de gal-lever kringloop

van galzouten toegenomen, waardoor de stroomsnelheid van gal toeneemt,

zonder dat dit een duidelijk effect op de galzoutproduktie heeft.

Samenvattend, de kennis van eiwitten betrokken bij de darm-lever kringloop

is in de afgelopen jaren enorm toegenomen en maakt nog steeds een snelle

ontwikkeling door. In de nabije toekomst zullen nieuwe regulerende eiwitten van

de darm-lever kringloop ontdekt worden en zal er meer bekend worden over de

onderlinge interacties hiertussen. Om echter te begrijpen welke rol eiwitten in

lever en darm spelen in de darm-lever kringloop en wat de consequenties zijn van

de interacties hiertussen voor de mens, zijn onderzoekstechnieken nodig die de

dynamiek van deze kringloop op onschadelijke wijze in kaart kunnen brengen. De

in dit proefschrift gepresenteerde meetmethode met stabiele isotopen kan hierbij

een belangrijke rol spelen.

158

Dankwoord

Lieve lezers, ik ben me ervan bewust dat de tijd die U besteed hebt aan het

lezen van mijn proefschrift waarschijnlijk met name bepaald wordt door de

lengte van dit dankwoord. Immers, dit is het meest gelezen gedeelte uit het

proefschrift, waarna het verdwijnt in de boekenkast (of niet). Daarmee wordt

tegelijkertijd de betrekkelijkheid van ons dagelijks werk geïllustreerd, maar dit

maakt desalniettemin het onderzoekswerk niet minder interessant. De satisfactie

ligt mijns inziens veeleer in het nieuwsgierig zoeken van antwoorden op vragen

betreffende gezondheid en ziekte inclusief onderliggende pathofysiologische

mechanismen. Eén van de meest opvallende zaken welke ik geleerd heb ten tijde

van mijn onderzoeksperiode is dat iedere onderzoeksvraag zich niet leent voor

een enkel antwoord, maar tegelijkertijd ook weer onderzoeksvragen genereert.

Research is derhalve eigenlijk een soort perpetuum mobile, in stand gehouden

door kritische en nieuwsgierige mensen op zoek om de grenzen van de bestaande

(medische) wetenschap te verkennen en te verleggen. Naar betere inzichten in

(patho)fysiologische processen, zodat uiteindelijk de patiënt ervan profiteert. Dit

is niet een zeer snel proces, wat door één persoon uitgevoerd kan worden. Zeker

niet als arts, niet gehinderd door biochemische kennis, op een laboratorium.

Het vereist allereerst een goede infrastructuur en de bereidheid van velen om

nieuwkomers wegwijs te maken. Die bereidheid heb ik ruimschoots mogen

ervaren, wat maakt dat het schrijven van deze pagina’s vlot is verlopen.

Allereerst wil ik mijn waardering uitspreken voor de kinderen en hun ouders die

betrokken zijn geweest bij de tot standkoming van hoofdstuk 4. De coöperatie,

gastvrijheid en bereidheid om bij jullie thuis een groot aantal malen bloed af te

nemen en een vies smakend galzoutdrankje te drinken heeft diepe indruk op mij

gemaakt. Ik wens jullie allen een gezonde toekomst toe en hoop dat jullie idealen,

conform mijn onderzoek, ooit verwezenlijkt mogen worden.

In aansluiting hierop realiseer ik me dat zonder de proefdieren gebruikt voor

dit onderzoek voorliggend proefschrift er geheel anders uit zou hebben gezien.

Hoewel het wellicht enigszins vreemd over komt deze schepselen te bedanken, is

een klein “eerbetoon” mijns inziens wel gepast, zoals weerspiegeld in de regels

van het omgaan met proefdieren bij leven vastgelegd in de Good Laboratory

Practice richtlijnen.

Onderzoek verrichten is als spoor zoeken, het keer op keer kritisch afwegen van

keuzes om een bepaalde richting op te gaan, waarbij bakens onmisbaar zijn

om de juiste richting te kiezen en op het goede spoor te blijven. Zoals gezegd,

promoveren is niet geheel mijn eigen verdienste.

Mijn promotor, professor F. Kuipers. Beste Folkert, jouw inzet om research van

“bench to bedside” te brengen verdient alle lof. De laagdrempelige manier om

te overleggen heeft er zeker toe bijgedragen dat steeds meer mensen de gang

naar jouw laboratorium weten te vinden. Uiteraard dank ik je voor de inhoudelijke

begeleiding, zonder welke deze kroon op het werk niet geslaagd zou zijn. Ik hoop

op een voorzetting van de wetenschappelijke samenwerking om de brug tussen

laboratorium en kliniek te verbreden en te verstevigen.

159

Dankwoord

Mijn promotor en opleider, professor P.J.J. Sauer. Beste Pieter, jij hebt me de

tijd en alle gelegenheid gegeven de opleiding tot kinderarts te onderbreken, voor

een door jou zo gepropageerde tijdsbesteding: research. Als onderzoeker-pur

sang vertelde je mij dat het onderwerp van studie in essentie niet uitmaakt. Een

opmerking die ik initieel kritisch begroet heb, maar niets bleek minder waar!

Hartelijk dank voor de steun en ik hoop op een goede samenwerking de komende

jaren.

Mijn copromotor, dr. H.J. Verkade. Beste Henkjan, ik heb een enorme bewondering

voor het enthousiasme waarmee je onderzoeksideeën ontvangt en voor de

energie die je in de dialoog met mensen steekt om het beste in ze naar boven

te halen. Van de bevinding dat je altijd iedereen twee stappen voor bent (“of

ga ik nu te langzaam…”), heb ik dankbaar gebruik mogen maken. Je hebt me

geleerd problemen zuiver te analyseren en duidelijke en haalbare doelstellingen

te formuleren, welke ik samen met jou in de nabije toekomst ook nog hoop te

realiseren.

De opvallende bereidheid tot hulp aan een “White Coat” noopt tot het bedanken

van nagenoeg iedereen van het Laboratorium Kindergeneeskunde.

Frans, Theo en Henk Elzinga, als massaspectrometrie-experts hebben jullie mij

ingewijd in de wondere wereld van isotopen. Fijn dat jullie alles begrijpen. Henk

Wolters, “humble servant of many white coats”. Ongelofelijk prettig dat je mij

terzijde gestaan hebt bij de uitvoering van diverse experimenten. Zelfs in de

donkere kamer heb je nog een heldere kijk op de zaak, wat maakt dat anderen

blindelings op je kunnen vertrouwen. Renze, tussen de koffi epauzes door heb je

heel wat gallige samples afgewerkt. Als je nog reagentia van mij vindt, gebruik

ze rustig; ze zijn bereid volgens de regelen der kunst. Vincent, dank je wel voor

het niet bemoeien met mijn proefschrift. Zo heb je alle tijd gehad om andere aio’s

op deskundige manier te begeleiden. Rick, alle lof voor de manier waarop je met

proefdieren omgaat. Dank voor je assistentie. Juul, je bent altijd geïnteresseerd

in de mens achter het onderzoek, dat is een pluim waard.

Ook wil ik alle kamergenoten bedanken voor de gezellige momenten en het delen

van onderzoekservaringen. Feike, Klary (periode 1998-2000), Edmond (die uit het

niemandsland tussen Peize en Altena), Renate (“Roken? We lossen het samen wel

op”), Marion, Yan, Karin (die Westerns deed je best goed) (periode 2002-2003),

Jan Peter (leuk lettertype van je proefschrift, overigens) en Marianne (bedankt

voor de Sultana’s)(periode 2004-heden).

Bij de AIO’s/AGIKO’s denk ik in eerste instantie aan de smakelijke lunches (stipt

11.30 uur), bier- en wijnavonden en het gezamenlijke congresbezoek. Een aantal

van hen zijn reeds gepromoveerd: Arjen, Baukje, Coen, Deanna, Johan, Marieke,

Peter, Robert Bandsma (fi losoof, dichter en dokter die zichzelf afvraagt: “Waarom

ben ik eigenlijk zo goed?”), Tineke en Jenny. Van een aantal AIO’s/AGIKO’s valt

op termijn een promotiefeest te verwachten: Aldo (dat wordt vast cum laude),

Anja (hoelang duurt een jaar in China trouwens?), Anniek (“Eigenlijk best zielig

hè voor die muisjes”), Hans (“Leuk, werken met kerst.”), Janine, Jildou, Jelske,

160

Dankwoord

Karin, Lisette en Marijke. Allen heel veel succes gewenst met promoveren. Ook

de creatieve bazen van “the other lab”, Han en Klaas Nico en hun analisten wens

ik veel wijsheid toe bij de begeleiding van hun aio’s. Dan de postdocs: Han, Olaf,

Thierry en Torsten. Een speciaal woord van dank aan Torsten. Memorabel zijn

diverse momenten, waaronder onze exercitie op het CDL, waarbij we een enkele

keer, behalve de muizen ook ons zelf anesthesie hadden gegeven. En natuurlijk

de diverse grappen (“Oeps, did you see my mice?”); de één gaf de voorzet en

de ander.... Misschien is dat wel de basis geweest voor het gezamenlijke feest

vandaag.

Dan de medewerkers van het metabole laboratorium onder de bezielende leiding

van natuurlijk Folkert, maar ook van Peter Smit en Dirkjan. Albert, Anke, Fettie,

Fjodor (Balloose PCR expert), Greet, Hermie, Janneke, Janny, Jenny, Klaas, Lena,

Nicolette, Pim, Theo van Dijk, Trijnie.

Verder de dokters van de sectie Kindergastroenterologie: Frank, René, Ekkehard,

en natuurlijk Charles. Allen hartelijk bedankt voor de ondersteunende woorden,

tips, adviezen en relativerende opmerkingen. Ook de OLT-verpleegkundigen

Greetje en Anneke verdienen een pluim voor hun inzet bij de klinische studie. Een

speciaal woord van dank aan mijn huidige collega’s van de afdeling Neonatologie.

Beste Arie, Henk, Peter, Anneke, Carin, Jorien, Klasien, Lilly, Nathalie en Margriet

en natuurlijk alle verpleegkundigen, jullie getoonde fl exibiliteit is onmisbaar

gebleken in de laatste fase van de promotie: Hulde hiervoor!

En de secretaresses, onmisbare schakels voor een goede effi ciency zowel in de

patiëntenzorg als in het onderzoekswerk. Jannie, Han, Hilde, Janette en Marieke,

bedankt voor het verlenen van diverse hand- en spandiensten. Piet, bedankt voor

de onmisbare fi nanciële steun. Bert en Peter, hartelijke dank voor jullie grafi sche

ondersteuning.

Natuurlijk wil ik verder een ieder bedanken, wiens naam ik vergeten ben, maar

ooit op de een of ander manier belangstelling heeft getoond voor het verloop van

het onderzoek. Onbeschrijfelijk mooi dat we dit vandaag met zijn allen inclusief

(schoon)familie en vrienden kunnen vieren.

Pa en ma, lieve ouders, jullie hebben altijd een “warm nest” gevormd en me

de mogelijkheden gegeven mijn vleugels uit te slaan. Van de vele dingen die ik

van jullie heb geleerd is de betrekkelijkheid van alle tastbare zaken me zeker

bijgebleven.

Dat de onderzoeksperiode vruchtbaar geweest is, blijkt wel uit de geboortes van

drie kleine Hulzebosjes: Daniël, Marleen en Hannah. Geboren om voor altijd van

te houden. Lieve kinderen, wat ongelofelijk fi jn dat jullie ons leven verrijken,

iedere dag weer. Theresia, mijn liefste, al meer dan 15 jaar zijn we aan elkaar

toevertrouwd. Ook vandaag wilde je graag aan mijn zijde staan. Woorden schieten

tekort om mijn dank uit te drukken. Een zoen. Dat we samen nog een gelukkige

tijd mogen beleven.

161

Curriculum Vitae

Christian Victor Hulzebos werd op 13 februari 1970 (inderdaad op vrijdag) geboren

te Stadskanaal. Na enkele jaren in Assen te hebben gewoond, bracht hij het

grootste gedeelte van zijn jeugd door in Delfzijl. Op de C.B.S. De Noorderkroon

werd de basis gelegd voor het V.W.O, het Fivelcollege. Vanaf 1988 studeerde hij

Geneeskunde te Groningen, alwaar hij in 1992 cum laude het doctoraal behaalde.

De daaropvolgende co-schappen werden afgerond in 1994, waarna hij eerst als

poortarts in het Delfzicht Ziekenhuis te Delfzijl gewerkt heeft. Daarna volgde

een arts-assistentschap kindergeneeskunde in het Medisch Centrum Leeuwarden.

Na deze bijzonder leerzame periode verhuisde hij naar de kinderafdeling van de

Isala Klinieken te Zwolle (opleider prof.dr. W.P.F. Fetter). Eind 1996 werd de fel

begeerde opleidingsplaats Kindergeneeskunde werkelijkheid in het AZG (opleider

destijds prof.dr. J.L.L. Kimpen). De opleiding werd uitgebreid met een drietal

onderzoeksjaren (huidige opleider prof.dr. P.J.J. Sauer), waarvan het resultaat nu

gepresenteerd wordt. Christian werkt sinds 2004 als fellow Neonatologie (opleider

prof.dr. A.F. Bos) in het AZG. Christian is in 1994 getrouwd met Theresia. Samen

hebben ze 3 kinderen: Daniël, Marleen en Hannah.

162

List of publications

Renfurm LN, Bandsma RHJ, Verkade HJ, Hulzebos CV, Van Dijk T, Boer T, Stellaard

F, Kuipers F, Sauer PJJ. Cholesterol synthesis and de novo lipogenesis in premature

infants determined by mass isotopomer distribution analysis. Pediatr Res 2004

Aug 4 [Epub ahead of print].

Hulzebos CV, Voshol PJ, Wolters H, Kruit JK, Ottenhof R, Groen AK, Stellaard

F, Verkade HJ, Kuipers F. Bile duct proliferation associated with bile salt-induced

hypercholeresis in Mdr2 P-glycoprotein-defi cient mice. Liver International 2004

(in press).

Hulzebos CV, De Vries TW, Armbrust W, Sauer PJJ, Kerstjens-Frederikse WS.

Progressive facial hemiatrophy; a complex disorder not only affecting the face. A

report in a monozygotic male twin pair. Acta Paediatrica 2004 (in press).

Hulzebos CV, Bijleveld CMA, F.Stellaard, F.Kuipers, Fidler V, Slooff MJH, Peeters

PMJG, Sauer PJJ, Verkade HJ. Cyclosporin A-induced reduction of bile salt synthesis

associated with increased plasma lipids in children after liver transplantation.

Liver Transplantation 2004;10(7):872-880.

Kok T, Hulzebos CV, Wolters H, Havinga R, Agellon LB, Stellaard F, Shan B,

Schwarz M, Kuipers F. Enterohepatic circulation of bile salts in farnesoid X

receptor-defi cient mice: effi cient intestinal bile salt absorption in the absence of

ileal bile acid-binding protein. J Biol Chem 2003 Oct 24;278(43):41930-7.

Hulzebos CV, Wolters H, Plösch T, Kramer W, Stengelin S, Stellaard F, Sauer PJJ,

Verkade HJ, Kuipers F. Cyclosporin A and the enterohepatic circulation in rats:

decreased cholate synthesis, but increased intestinal reabsorption. J Pharmacol

Exp Ther 2003 Jan;304(1):356-63.

Hulzebos CV. Braken: bij kinderen met diabetes mellitus geen onschuldig

verschijnsel. Ned Tijdschr Geneesk 2002;36:1715-16 (letter).

Hulzebos CV, Renfurm L, Bandsma RH, Verkade HJ, Boer T, Boverhof R, Tanaka

H, Mierau I, Sauer PJJ, Kuipers F, Stellaard F. Measurement of parameters

of cholic acid kinetics in plasma using a micro scale stable isotope dilution

technique:application to rodents and man. J Lipid Res 2001;42:1923-9.

Hulzebos CV, Sauer PJJ. Neonatal thermoregulation. In: Neonatologica. Gadzinowski

J, Vidyasagar D, eds. OWN Poznan 2000. Chapter 8:93-99.

Hulzebos CV, Van Ede C, Tamminga RYJ, Knoester H, De Vries TW. An uncommon

cause of dyspnea in a teenage girl: massive pulmonary embolism. J Ped Hemat

Onc 2000;22(5):481-2.

Hulzebos CV, Koetse HA, Kimpen JLL, Wolfs TFW. Vertebral osteomyelitis associated

with cat-scratch disease. Clin Infect Dis 1999;28(6):1310-2.

163

List of publications

Hulzebos CV, De Vries TW. Plasma concentrations of leptin in prepubertal children

with partial lipodystrophy. Int J Dermatol 1999;38(10):798.

Hulzebos CV, Hulzebos-Bosma TM, Van Lingen RA. Het belang van een juiste

interpretatie van temperatuurmetingen bij pasgeborenen. Kritiek, tijdschrift voor

intensive care medewerkers 1999;17(3):3-7.

Hulzebos CV, Walhof C, De Vries TW. Accidental ingestion of cigarettes by children.

Ned Tijdschr Geneesk 1998;142(47):2569-71.

Hulzebos CV, Peereboom WA, Degener JE, De Vries TW. Urinary antigen test as

a screen for the diagnosis of beta-hemolytic streptococcal infections in newborn

infants. Ned Tijdschr Geneesk 1998;142(35):1954-7.

Hulzebos CV, Leemans R, Halma C, Halma C, De Vries TW. Splenic epithelial cysts

and splenomegaly: diagnosis and management. Neth J Med 1998;53(2):80-4.

Hulzebos CV, Bos WH, Doddema JW, Van Pinxteren-Nagler E, De Vries TW.

Progressive partial lipodystrophy; an external problem with internal abnormalities.

Ned Tijdschr Geneesk 1996;140(13):719-22.

Cyclosporine A-Induced reduction of bile salt synthesis associated with increased plasma lipids in...

Documents

Transcript of Cyclosporine A-Induced reduction of bile salt synthesis associated with increased plasma lipids in...