Comparative evaluationoftherapeuticDNAvaccines againstTrypanosoma cruzi inmiceGilma Sanchez-Burgos1, R. Gabino Mezquita-Vega1, Javier Escobedo-Ortegon1, Maria JesusRamirez-Sierra1, Arletty Arjona-Torres1, Ali Ouaissi2, Mauricio M. Rodrigues3 & Eric Dumonteil1

1Laboratorio de Parasitologıa, Centro de Investigaciones Regionales ‘Dr Hideyo Noguchi’, Universidad Autonoma de Yucatan, Merida, Yucatan,

Mexico; 2INSERM, IRD, Unite de Recherche no. 008 ‘Pathogenie des Trypanosomatides’, Centre IRD de Montpellier; Montpellier, France; and3CINTERGEN- Centro Interdisciplinar de Terapia Genica, Departamento de Microbiologia, Inmunologia e Parasitologia, Universidade Federal de Sao

Paulo, Sao Paulo, SP, Brazil

Correspondence: Eric Dumonteil,

Laboratorio de Parasitologıa, Centro de

Investigaciones Regionales ‘Dr Hideyo

Noguchi’, Universidad Autonoma de Yucatan,

Av. Itzaes 490 x 59, Centro, 97000, Merida,

Yucatan, Mexico. Tel.: 151 999 924 5910,

Ext. 118; fax: 152 999 923 6120; e-mail:

oliver@uady.mx

Received 19 January 2006; revised 6 March

2007; accepted 14 March 2007.

DOI:10.1111/j.1574-695X.2007.00251.x

Editor: Willem van Eden

Keywords

protozoa; chagas disease; therapeutic vaccine;

immunotherapy.

Abstract

Chagas disease, caused by the protozoan parasite Trypanosoma cruzi, is a major

public health problem in most of Latin America. A key priority is the development

of new treatments, due to the poor efficacy of current ones. We report here the

comparative evaluation of therapeutic DNA vaccines encoding various T. cruzi

antigens. ICR mice infected with 500 parasites intraperitoneally were treated at

5 and 12 days postinfection with 20mg of plasmid DNA encoding T. cruzi antigens

TSA-1, TS, ASP-2-like, Tc52 or Tc24. Treatment with plasmid encoding TS and/or

ASP-2-like antigens had no significant effect on parasitemia or survival. Treatment

with Tc52 DNA significantly reduced parasitemia, as well as cardiac parasite

burden, and improved survival, although myocarditis was not significantly

affected. Finally, treatment with plasmids encoding Tc24 and TSA-1 induced the

most complete control of disease as evidenced by significant reductions in

parasitemia, mortality, myocarditis and heart parasite burden. These data demon-

strate that therapeutic vaccine efficacy is dependent on the antigen and suggest that

DNA vaccines encoding Tc24, TSA-1, and Tc52 represent the best candidates for

further studies of a therapeutic vaccine against Chagas disease.

Introduction

Chagas disease, or American trypanosomiasis, is caused by the

protozoan parasite Trypanosoma cruzi, and it affects an esti-

mated 16–18 million persons, with close to 100 million people

at risk of infection in the Americas. About 30–40% of infected

patients develop chronic chagasic cardiomyopathy, which

represents a dramatic burden in public health (WHO, 2002).

There has been extensive debate on the mechanisms

involved in this pathology (Kierszenbaum, 1999; Tarleton,

2001; Girones & Fresno, 2003). Part of the susceptibility of

patients to develop chronic chagasic cardiomyopathy has been

associated with specific major histocompatibility complex

(MHC) haplotypes (Colorado et al., 2000; Cruz-Robles et al.,

2004). In addition, some studies suggested that tissue damage

was associated with the presence and replication of intracel-

lular amastigotes, and others proposed that autoimmunity

induced by parasite antigens mimicking host proteins was

responsible for tissue damage (Kierszenbaum, 1999; Tarleton,

2001; Girones & Fresno, 2003). It is now accepted that the

presence of parasites in cardiac tissue is necessary to initiate

and maintain the inflammatory response, and that therapeutic

treatments or vaccines aimed at eliminating T. cruzi would

limit or prevent the progression towards chronic chagasic

cardiomyopathy (Bhatia & Garg, 2005).

Current chemotherapy relies on nitrofurans (Nifurtimox),

or nitroimidazoles (Benznidazole). However, the usefulness

of these drugs is limited by their reduced efficacy (mostly

during early stages of the infection), serious side effects, and

the emergence of drug-resistant strains of parasites (Castro

et al., 2006). Efforts are thus urgently needed to identify new

drug candidates. A number of compounds have been eval-

uated in preclinical models for the chemotherapy of T. cruzi

infection and are providing some variable but encouraging

results (Buckner et al., 2003; Urbina & Docampo, 2003;

Steverding & Tyler, 2005). Nonetheless, a major limitation of

chemotherapy is that most treatments require very long

administration regimens to be effective.

Therapeutic vaccines, aimed at reinforcing the immune

response of an infected host, represent a novel and attractive

FEMS Immunol Med Microbiol ]] (2007) 1–9 c� 2007 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

alternative to chemotherapy against chronic diseases

(Autran et al., 2004). The major advantages of this strategy

are that it relies on short treatment regimens (Lai et al.,

1996; Boyer et al., 1997; Lowrie et al., 1999; Lodmell &

Ewalt, 2001; Bahloul et al., 2003), and the induction of

multiple effector mechanisms against the pathogen may

have high efficacy and lower the possibilities of resistance.

In particular, we provided proof-of-concept data demon-

strating that two doses of therapeutic DNA vaccines encod-

ing parasite antigens TSA-1 or Tc24 could reduce disease

severity in mice infected with an otherwise lethal dose of

T. cruzi (Dumonteil et al., 2004). Importantly, this treatment

is effective at reducing disease development when adminis-

tered at various times during both the acute and the chronic

phase of the infection, although efficacy decreases when

treatment is delayed (Dumonteil et al., 2004). The efficacy of

such therapeutic DNA vaccines seems to rely, at least in part,

on the induction of parasite-specific interferon gamma

(IFN-g)-producing CD41 and CD81 T cells (Zapata-Estrel-

la et al., 2006), confirming that stimulation of the immune

response by the vaccine limits disease progression rather

than exacerbates tissue inflammation and damage. This is

also in agreement with several studies showing that a T

helper (Th) 1 type immune response is required for clearing

the parasite from infected mice (Silva et al., 1995; Miller

et al., 1996; Santori et al., 1996; Paiva et al., 1999; Hoft &

Eickhoff, 2002) and that less severe disease is observed in

patients with higher frequency of IFN-g-producing T cells

(Laucella et al., 2004). Various vaccine studies have further

established that to be protective against T. cruzi, antigens

need to contain both MHC I- and II epitopes, and lead to a

full activation of the immune response, including helper

CD41 and cytotoxic CD81 cells, as well as lytic antibodies

(Bhatia & Garg, 2005).

Nonetheless, most of these studies have focused on antigens

from the blood-form trypomastigote stage of the parasite, and

antigens from intracellular amastigotes have been much less

explored (Low et al., 1998; Garg & Tarleton, 2002; Boscardin

et al., 2003). There is indeed a good rationale for designing

vaccines aimed at either stages of the parasite, and it would be

expected that vaccines targeting the circulating or the intra-

cellular stages would be equally effective at controlling disease

progression. Thus, it remains unclear how the nature of the

antigens may affect vaccine efficacy and which may be the

most promising for the detailed study of the immune

mechanisms underlying their therapeutic efficacy.

To address this issue and identify new therapeutic vaccine

candidates, we report here the comparative evaluation of the

efficacy of vaccines encoding several T. cruzi antigens, using

a convenient acute phase model. We selected ASP-2-like

clone 9, an antigen whose mRNA is observed in all develop-

mental stages of the parasite, but the full length protein is

only detected in amastigotes (Boscardin et al., 2003).

Similarly, T. cruzi 52 kDa antigen (Tc52) is mostly expressed

in amastigotes and epimastigotes, and downregulated in

trypomastigotes, and it is considered a virulence factor

(Ouaissi et al., 1995). We also investigated two trypomasti-

gote-specific antigens from the trans-sialidase family, the

trans-sialidase (TS) (Abuin et al., 1999) and the trypomasti-

gote-surface antigen 1 (TSA-1) (Fouts et al., 1991), although

some members of this family are also expressed in amasti-

gotes, and may provide some cross-reactions. Finally, we

included T. cruzi 24 kDa antigen (Tc24), which is present in

all developmental stages of the parasite (Ouaissi et al., 1992;

Taibi et al., 1993). Well-defined MHC I and II epitopes have

been identified in most of these antigens and they are able to

induce a strong and complete immune response in mice

(Taibi et al., 1993; Wrightsman et al., 1994; Wizel et al., 1998;

Rodrigues et al., 1999). These antigens can also provide

significant protection as prophylactic DNA or recombinant

protein vaccines (Costa et al., 1998; Wizel et al., 1998;

Fujimura et al., 2001; Ouaissi et al., 2002; Boscardin et al.,

2003), and TSA-1 and Tc24 have been shown to be effective

as therapeutic DNA vaccines (Dumonteil et al., 2004).

Materials and methods

Experimental infection of mice

To avoid potential genetic restriction of vaccine efficacy in

inbred mice, we used outbred ICR mice, which show MHC

polymorphism. Six-week-old female mice were infected by

intraperitoneal injection of a lethal dose of 500 blood

trypomastigotes of the H1 strain, previously isolated from a

human case in Yucatan, Mexico, as before (Dumonteil et al.,

2004; Zapata-Estrella et al., 2006). Infection was monitored

by counting peripheral blood parasites every 3 days with a

Neubauer cell, and mortality was recorded daily. For statis-

tical comparisons, the area under the curve of parasitemia

was calculated for 42 days of infection. Mice were sacrificed

at the end of the acute phase, after 50 days of infection. The

hearts were removed and processed for histopathologic

analysis of tissue damage, and quantification of T. cruzi

parasite burden as indicators of disease progression.

Plasmids construction and immunization

Plasmids based on the pcDNA3.1 plasmid vector (Invitro-

gen, USA) and encoding T. cruzi antigens TSA-1 (GenBank

accession no. M58466) and Tc24 (U70035) have been

described previously (Dumonteil et al., 2004). Plasmids

pIgSPclone9 (Boscardin et al., 2003) and p154/13 (Costa

et al., 1998) encode T. cruzi antigens ASP-2-like clone 9

(SPclone9, AY186572) and trans-sialidase (TS, D50685),

respectively, and are also based on the same plasmid vector.

Tc52 cDNA (AF117240) was digested with BamHI and

EcoRI to generate a 1900-bp fragment containing the full

FEMS Immunol Med Microbiol ]] (2007) 1–9c� 2007 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

2 G. Sanchez-Burgos et al.

length gene and subcloned into pcDNA3.1 by standard

molecular biology protocols. We also included in our study

a plasmid encoding Leishmania donovani NH36 (Aguilar-Be

et al., 2005) as an additional control for the specificity of the

therapy. All plasmid DNAs were prepared using BIO-RAD

Maxi-Prep kit (BIO-RAD, USA) and stored at � 20 1C until

use.

Infected mice were treated with two doses of plasmid

DNA during the acute phase, at days 5 and 12 postinfection

(Dumonteil et al., 2004). Although these times may be

of limited practical usefulness, they represent an appro-

priate model for the rapid evaluation of vaccine candidates.

Mice were anesthetized with pentobarbital and injected in

the tibialis anterioris with 20 mg DNA and 45 mg of alumi-

num phosphate as adjuvant (Ulmer et al., 1999; Rosado-

Vallado et al., 2005). Control groups of mice received

20 mg of empty pcDNA3.1 plasmid with adjuvant or saline

solution.

Histopathologic analysis

Surviving mice were sacrificed after 50 days of infection and

hearts were removed for histopathologic analysis. Samples

were fixed in 10% formaldehyde and included in paraffin.

Five-micrometer sections were then stained with hematox-

ylin and eosin, and examined for the presence of inflamma-

tion and parasites with a Nikon Eclipse E600 optical

microscope at � 10 magnification. Inflammation was

quantified by image analysis from four to 10 digital

micrographs per animal using Multispec 3.0 (Purdue Uni-

versity, IN). Pixels corresponding to inflammatory cell

nuclei were quantified to estimate the number of inflamma-

tory cells per area of muscle fiber (Zapata-Estrella et al.,

2006).

Trypanosoma cruzi detection andsemiquantitation

Semiquantitation of parasite DNA was performed by com-

petitive PCR (Roberts et al., 2000; Zapata-Estrella et al.,

2006). Briefly, a parasite-specific 90-bp sequence of the

b-tubulin gene was amplified from 100 ng DNA from

dissected cardiac tissue using the following primers: forward

50-ACGTTCGGTGACCTGAACCA-30 and reverse: 50-CAG

GTCAGAGTTCAGCTGGC-30. PCR amplification was per-

formed in the presence of serial dilutions of a competing

70-bp synthetic oligonucleotide: 50-ACGTTCGGTGACCT

GAACCAGCGTCCAGCCGTTCGTGGCTGTCCAGTCCG

GCCAGCTGAACTCTGACCTGC. The amount of T. cruzi

DNA was estimated by comparing band intensities of

T. cruzi and competitor amplicons (Roberts et al., 2000;

Zapata-Estrella et al., 2006).

Statistical analysis

Comparisons between treatment groups was performed

using ANOVA, and followed, when significant, by Tukey’s post

hoc test to identify the significantly different groups. The

Log rank test of Kaplan–Meier survival curves was per-

formed to assess differences in survival between groups.

Correlation analysis was performed to evaluate the relation-

ship of some variables between the different vaccine groups.

All tests were performed using JMP 5.0 software (SAS

Institute, Cary, NC).

Results

To initially evaluate the efficacy of therapeutic vaccination

encoding various T. cruzi antigens to reduce pathology,

outbred ICR mice were infected with a sublethal dose of

500 blood trypomastigotes, and treated with two doses of

20 mg of DNA vaccines encoding the selected antigens, at

days 5 and 12 postinfection. The time course of the

parasitemia of infected and treated mice was monitored

during the acute phase of the infection (Fig. 1a and b) and

the area under the curve was calculated for statistical

comparisons (Fig. 1c). As expected, mice treated with saline

solution or empty plasmid DNA developed very high

parasitemia (Fig. 1a and c). Similarly, the parasitemia was

unaffected in mice treated with plasmid DNA encoding the

heterologous antigen NH36 from Leishmania donovani (not

shown). On the other hand, mice treated with the T. cruzi

DNA vaccines presented various profiles of parasitemia,

depending on the encoded antigen. Mice treated with

pIgSPclone9, TS (p154/13) or a combination of both

plasmids presented parasitemia not significantly different

for that of control mice (Fig. 1b and c), whereas mice treated

with TSA-1, Tc52 or Tc24 DNA presented significant

reductions in their parasitemia compared with controls

(Fig. 1a and c,ANOVA F = 5.04, Po 0.001, Tukey: Po 0.05).

The survival of mice during the acute phase was also

significantly different depending on the treatment. As

shown in Fig. 2, mice treated with plasmids encoding

L. donovani NH36, TS or ASP-2-like clone 9 presented low

survival rates at 50 days postinfection, similar to that of

control mice treated with saline or empty vector (Kaplan–

Meier survival analysis, P4 0.05). Similarly, the survival of

mice treated with a combination of both pIgSPclone9 and

p154/13 plasmids was not significantly different from the

survival of control mice (P = 0.22). On the other hand,

therapeutic vaccination with plasmid DNA encoding Tc24,

TSA-1 and Tc52, respectively, resulted in significant in-

creases in the survival of treated mice (Po 0.05). There

was an overall significant inverse correlation between para-

sitemia (taken as the average area under the curve for each

group) and survival rate at 50 days postinfection (r2 = 0.78,

FEMS Immunol Med Microbiol ]] (2007) 1–9 c� 2007 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

3Trypanosoma cruzi therapeutic DNA vaccine

P = 0.003), with the higher survival rate being found in the

groups of mice presenting lower parasitemia.

To evaluate in more detail the extent of the control of

Chagas disease progression by the therapeutic vaccines, we

investigated tissue inflammation and parasite burden in the

hearts of treated mice. We used digital image analysis to

quantify inflammatory cell density in micrographs of

cardiac tissue sections. Significant differences were observed

between treatments (ANOVA F = 12.03, Po 0.001). At 50 days

postinfection, the hearts of control mice presented an

intense diffuse inflammatory reaction (Fig. 3a and b),

characterized by a high density of inflammatory cells (Fig.

4). Treatment with a combination of pIgSPclone 9 and

p154/13 plasmids did not prevent tissue inflammation (Figs

3c and 4). Similarly, treatment with pcDNA3-Tc52 did not

significantly affect the overall inflammatory cell density

(Figs 3d and 4). Only treatments with TSA-1 and Tc24

DNA vaccines were able to significantly reduce cardiac tissue

inflammation (Fig. 4, Tukey: Po 0.05), and this was mostly

focal (Fig. 3e and f).

Examination of parasite burden in the heart by semi-

quantitative PCR further showed that treatment with a

combination of pIgSPclone9 and p154/13 plasmids had no

significant effect on parasite burden, although it was slightly

decreased. On the other hand, treatment with plasmid

encoding the antigens TSA-1, Tc52 and Tc24 significantly

reduced T. cruzi parasite burden by about 2–3 log (ANOVA

F = 6.02, P = 0.001, Tukey: Po 0.05). Overall, there was a

significant positive correlation between parasite burden and

the density of inflammatory cells (r2 = 0.62, P = 0.03). An

increased survival was also correlated with a lower parasite

burden (r2 = 0.84, P = 0.009) but not with tissue inflamma-

tion (P = 0.13). Taken together, these results demonstrate

that DNA vaccines encoding antigens Tc24, TSA-1 and Tc52

can clearly reduce Chagas disease development at 50 days

postinfection.

Discussion

The present comparative evaluation of therapeutic DNA

vaccines against T. cruzi infection demonstrates that efficacy

is critically dependent on the antigen encoded. Our data first

show that parasite-specific antigens are required as a vaccine

encoding a Leishmania donovani antigen, otherwise very

effective against Leishmania ssp. (Aguilar-Be et al., 2005),

was completely ineffective for T. cruzi therapy. This observa-

tion and the fact that the vector alone had negligible efficacy

indicate that a nonspecific adjuvant-like effect of the DNA

vaccine can be ruled out. Strain-specific polymorphism of

the antigens may have also influenced the efficacy of the

Fig. 1. Effect of therapeutic vaccination on

T. cruzi parasitemia. Mice were infected with

500 blood trypomastigotes and the time course

of their parasitemia was monitored by counting

peripheral blood parasites every 3 days with a

Neubauer cell, for up to 50 days postinfection

(a and b). Error bars have been omitted for

clarity, and the saline group is repeated for easier

comparison. Overall parasitemia was calculated

as the area under the curve (c). Groups of

mice were treated at days 5 and 12 with the

indicated DNA vaccines. Data are presented as

mean� SEM of 12–18 mice per group from

three separate experiments. �A significant

difference with the saline group. # A significant

difference with the pcDNA3 control group.

FEMS Immunol Med Microbiol ]] (2007) 1–9c� 2007 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

4 G. Sanchez-Burgos et al.

DNA vaccines tested here and this is a growing concern in

vaccine development (Urwin et al., 2004; Kumkhaek et al.,

2005), as some polymorphisms of T-cell restricted epitopes

have been described, in particular for TS antigens (Martin

et al., 2006), and we did not use antigen sequences derived

from the same strain used for experimental infection.

However, it is of key importance to identify antigens

sufficiently conserved to allow for the induction of a

protective/therapeutic immunity against most if not all

T. cruzi strains, and further studies would be required to

assess vaccine efficacy against different parasite strains.

Alternatively, differences in the level of protein expression

from the different plasmids may have affected their efficacy.

This is, however, unlikely because all the vaccines were based

on the same plasmid backbone and very similar levels of

expression can thus be expected.

The lack of therapeutic efficacy of DNA vaccines encoding

ASP-2-like and TS antigens was unexpected given the high

protective efficacy of these antigens when used as prophy-

lactic vaccines (Costa et al., 1998; Boscardin et al., 2003).

Even treatment with a combination of plasmids encoding

these two antigens, which could have been expected to

provide an improved efficacy compared with the respective

antigens alone, was unable to control disease progression.

Rather, this combination of vaccines mimicked the treat-

ment with ASP-2-like DNA alone, suggesting that this

antigen may be immunodominant over TS. The contrast

between the prophylactic and therapeutic efficacy of these

vaccines may be due to differences in immunogenicity

towards different strains of parasites as mentioned above,

but may also be due to differences in plasmid doses and

immunization protocols. Indeed, previous prophylactic stu-

dies used a higher plasmid dose and cardiotoxin pretreat-

ment (Costa et al., 1998; Boscardin et al., 2003), which is

known to increase vaccine efficacy.

On the other hand, Tc24, TSA-1 and Tc52 DNA vaccines

provided a significant control of disease progression, as

evidenced by a reduction in parasitemia, mortality and

cardiac tissue inflammation. We also show for the first time

that treatment with these vaccines significantly reduced

parasite burden in cardiac tissue. The contrasting therapeu-

tic efficacy of trypomastigote-specific antigens TSA-1 and

TS, which both belong to the trans-sialidase family of

proteins, may be related to their rather low sequence

similarity (27% amino acid identity and 55% similarity),

resulting in distinct T-cell epitopes (Taibi et al., 1993;

Wrightsman et al., 1994; Wizel et al., 1998; Rodrigues et al.,

1999). Also, some epitopes may be shared or not within this

extremely large family of proteins of over 1400 members

(El-Sayed et al., 2005), and thus cause potential cross-

reaction with other trans-sialidases in the case of TSA-1.

Tc24 DNA seemed to induce the best therapeutic effect as

it was able to induce strong reductions in all the parameters

measured to evaluate disease progression. As this antigen is

present in all developmental stages of T. cruzi (Ouaissi et al.,

1992; Taibi et al., 1993), it may target both circulating and

intracellular parasites, which may explain this higher effi-

cacy in controlling disease progression. In this respect, the

efficacy of Tc52 DNA vaccine may thus be related to the low

but significant expression of this antigen in trypomastigotes

in addition to its elevated expression in amastigotes. Taken

together, these results suggest that efficacy of T. cruzi

therapeutic vaccines may be related, in part, to their devel-

opmental stage-specificity, and constitutive antigens such as

Tc24 that make it possible to target both circulating and

intracellular parasites may represent better candidates. Test-

ing of additional antigens should help clarify this point.

Alternatively, the efficacy of Tc52 may be related to the fact

that it is an excreted/secreted protein that is released from

the parasite (Fernandez-Gomez et al., 1998), and has a

potent immunomodulatory activity (Ouaissi et al., 2002).

Indeed, this antigen has been proposed as a virulence factor

as the targeted deletion of this gene reduced the pathogeni-

city of the mutant parasites (Garzon et al., 2003).

Finally, the observation of a significant correlation be-

tween parasite burden and inflammatory cell density in

cardiac tissue agrees with the growing amount of evidence

indicating that parasite presence and persistence results in

Fig. 2. Effect of therapeutic vaccination on survival. Mice were infected

with 500 blood trypomastigotes and treated on days 5 and 12 with the

indicated DNA vaccines. The time course of their survival rate is shown

and the saline group is repeated for easier comparison. Data are

presented for 12–18 mice per group from three separate experiments.�A significant difference with the saline group. #A significant difference

with the pcDNA3 control group (Log rank test).

FEMS Immunol Med Microbiol ]] (2007) 1–9 c� 2007 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

5Trypanosoma cruzi therapeutic DNA vaccine

chronic inflammatory reactivity (Zhang & Tarleton, 1999;

Monteon-Padilla et al., 2001). This strengthens the relevance

of targeting the parasite for the control of Chagas disease, as

decreased parasite burden may imply a better prognosis

during chronic infection (Bhatia & Garg, 2005), and provide

additional support for the concept of therapeutic

Fig. 3. Effect of therapeutic vaccination on cardiac tissue damage. After 50 days of infection, treated mice were sacrificed and their hearts were

removed, fixed, and included in paraffin. Sections were stained with hematoxylin and eosin and observed at �10 magnification. Representative

micrographs of tissue sections from infected mice treated with saline solution (a); empty plasmid vector (b); a combination of pIgSPClone9 and p154/13

DNA vaccines (c); Tc52 (d); TSA-1 (e); and Tc24 (f) DNA vaccines are shown.

FEMS Immunol Med Microbiol ]] (2007) 1–9c� 2007 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

6 G. Sanchez-Burgos et al.

vaccination aimed at reducing cardiac tissue damage. Also,

the present study was limited to an acute phase model, and it

would be important to confirm the present results when

treatment is given during the chronic phase, when novel

treatments are most needed. We previously showed that

therapeutic administration of DNA encoding TSA-1

remains effective during the chronic phase (Dumonteil

et al., 2004; Zapata-Estrella et al., 2006), but the therapeutic

potential of other antigens at this stage remains to be

optimized.

In conclusion, we show here that treatment with DNA

vaccines encoding Tc52, Tc24 and TSA-1 antigens is able to

reduce parasitemia, mortality, cardiac tissue inflammation

and parasite burden during acute T. cruzi infection in mice,

indicating a significant control of disease progression. These

results warrant further studies of these therapeutic DNA

vaccines and of the immune mechanisms that underly their

efficacy, and confirm the potential of this strategy as a

promising alternative or complement to conventional che-

motherapy for the control of Chagas disease.

Acknowledgements

This work was funded by a Albert Sezary research prize from

the Academie Nationale de Medecine, Paris, France, and

grant #SEP-2004-C01-47122 from CONACYT to ED, and by

grants from Fundacao de Amparo a Pesquisa do Estado de

Sao Paulo, The Millennium Institute for Vaccine Develop-

ment and Technology (CNPq – 420067/2005-1) and The

Millennium Institute for Gene Therapy to MMR.

References

Abuin G, Freitas-Junior LH, Colli W, Alves MJ & Schenkman S

(1999) Expression of trans-sialidase and 85-kDa glycoprotein

genes in Trypanosoma cruzi is differentially regulated at the

post-transcriptional level by labile protein factors. J Biol Chem

274: 13041–13047.

Aguilar-Be I, da Silva Zardo R, Paraguai de Souza E, Borja-

Cabrera GP, Rosado-Vallado M, Mut-Martin M, Garcia-Miss

MR, Palatnik de Sousa CB & Dumonteil E (2005) Cross-

protective efficacy of a prophylactic Leishmania donovani DNA

vaccine against visceral and cutaneous murine leishmaniasis.

Infect Immun 73: 812–819.

Autran B, Carcelain G, Combadiere B & Debre P (2004)

Therapeutic vaccines for chronic infections. Science 305:

205–208.

Bahloul C, Ahmed SB, B’Chir BI, Kharmachi H, Hayouni el A &

Dellagi K (2003) Post-exposure therapy in mice against

experimental rabies: a single injection of DNA vaccine is as

effective as five injections of cell culture-derived vaccine.

Vaccine 22: 177–184.

Bhatia V & Garg N (2005) Current status and future prospects for

a vaccine against American trypanosomiasis. Expert Rev

Vaccines 4: 867–880.

Boscardin SB, Kinoshita SS, Fujimura AE & Rodrigues MM

(2003) Immunization with cDNA expressed by amastigotes of

Trypanosoma cruzi elicits protective immune response against

experimental infection. Infect Immun 71: 2744–2757.

Boyer JD, Ugen KE, Chattergoon M et al. (1997) DNA vaccination

as anti-human immunodeficiency virus immunotherapy in

infected chimpanzees. J Infect Dis 176: 1501–1509.

Buckner F, Yokoyama K, Lockman J, Aikenhead K, Ohkanda J,

Sadilek M, Sebti S, Van Voorhis W, Hamilton A & Gelb MH

Fig. 4. Effect of therapeutic vaccination on cardiac tissue inflammation

and parasite load. The density of inflammatory cells in cardiac tissues (a)

was determined by image analysis of digital micrographs from tissue

sections after 50 days of infection in groups of mice treated with the

indicated DNA vaccines. Parasite burden in the heart (b) was estimated

by semiquantitative PCR. Data are presented as mean� SEM of 5–7 mice

per group from three separate experiments. �A significant difference

with the saline group. #A significant difference with the pcDNA3 control

group.

FEMS Immunol Med Microbiol ]] (2007) 1–9 c� 2007 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

7Trypanosoma cruzi therapeutic DNA vaccine

(2003) A class of sterol 14-demethylase inhibitors as anti-

Trypanosoma cruzi agents. Proc Natl Acad Sci USA 100:

15149–15153.

Castro JA, de Mecca MM & Bartel LC (2006) Toxic side effects of

drugs used to treat Chagas’ disease (American

trypanosomiasis). Hum Exp Toxicol 25: 471–479.

Colorado IA, Acquatella H, Catalioti F, Fernandez MT & Layrisse

Z (2000) HLA class II DRB1, DQB1, DPB1 polymorphism and

cardiomyopathy due to Trypanosoma cruzi chronic infection.

Hum Immunol 61: 320–325.

Costa F, Franchin G, Pereira-Chioccola VL, Ribeirao M,

Schenkman S & Rodrigues MM (1998) Immunization with a

plasmid DNA containing the gene of trans-sialidase reduces

Trypanosoma cruzi infection in mice. Vaccine 16: 768–774.

Cruz-Robles D, Reyes PA, Monteon-Padilla VM, Ortiz-Muniz AR

& Vargas-Alarcon G (2004) MHC class I and class II genes in

Mexican patients with Chagas disease. Hum Immunol 65:

60–65.

Dumonteil E, Escobedo-Ortegon J, Reyes-Rodriguez N, Ramirez-

Sierra MJ & Arjona-Torres A (2004) Immunotherapy of

Trypanosoma cruzi infection with DNA vaccines in mice. Infect

Immun 72: 46–53.

El-Sayed NM, Myler PJ, Bartholomeu DC et al. (2005) The

genome sequence of Trypanosoma cruzi, etiologic agent of

Chagas disease. Science 309: 409–415.

Fernandez-Gomez R, Esteban S, Gomez-Corvera R, Zoulika K &

Ouaissi A (1998) Trypanosoma cruzi: Tc52 released protein-

induced increased expression of nitric oxide synthase and

nitric oxide production by macrophages. J Immunol 160:

3471–3479.

Fouts DL, Ruef BJ, Ridley PT, Wrightsman RA, Peterson DS &

Manning JE (1991) Nucleotide sequence and transcription of a

trypomastigote surface antigen gene of Trypanosoma cruzi.

Mol Biochem Parasitol 46: 189–200.

Fujimura AE, Kinoshita SS, Pereira-Chioccola VL & Rodrigues

MM (2001) DNA sequences encoding CD41 and CD81

T-cell epitopes are important for efficient protective immunity

induced by DNA vaccination with a Trypanosoma cruzi gene.

Infect Immun 69: 5477–5486.

Garg N & Tarleton RL (2002) Genetic immunization elicits

antigen-specific protective immune responses and decreases

disease severity in Trypanosoma cruzi infection. Infect Immun

70: 5547–5555.

Garzon E, Borges MC, Cordeiro-da-Silva A, Nacife V, Meirelles

Mde N, Guilvard E, Bosseno MF, Guevara AG, Breniere SF &

Ouaissi A (2003) Trypanosoma cruzi carrying a targeted

deletion of a Tc52 protein-encoding allele elicits attenuated

Chagas’ disease in mice. Immunol Lett 89: 67–80.

Girones N & Fresno M (2003) Etiology of Chagas disease

myocarditis: autoimmunity, parasite persistence, or both?

Trends Parasitol 19: 19–22.

Hoft DF & Eickhoff CS (2002) Type 1 immunity provides optimal

protection against both mucosal and systemic Trypanosoma

cruzi challenges. Infect Immun 70: 6715–6725.

Kierszenbaum F (1999) Chagas’ disease and the autoimmunity

hypothesis. Clin Microbiol Rev 12: 210–223.

Kumkhaek C, Phra-Ek K, Renia L et al. (2005) Are extensive T cell

epitope polymorphisms in the Plasmodium falciparum

circumsporozoite antigen, a leading sporozoite vaccine

candidate, selected by immune pressure? J Immunol 175:

3935–3939.

Lai WC, Pakes SP, Ren K, Lu Y-S & Bennett M (1996) Therapeutic

effect of DNA immunization of genetically susceptible mice

infected with virulent Mycoplasma pulmonis. J Immunol 158:

2513–2516.

Laucella SA, Postan M, Martin D, Hubby Fralish B, Albareda MC,

Alvarez MG, Lococo B, Barbieri G, Viotti RJ & Tarleton RL

(2004) Frequency of interferon-gamma-producing T cells

specific for Trypanosoma cruzi inversely correlates with disease

severity in chronic human Chagas disease. J Infect Dis 189:

909–918.

Lodmell DL & Ewalt LC (2001) Post-exposure DNA vaccination

protects mice against rabies virus. Vaccine 19: 2468–2473.

Low HP, Santos MAM, Wizel B & Tarleton RL (1998) Amastigote

surface proteins of Trypanosoma cruzi are targets for

CD81CTL. J Immunol 160: 1817–1823.

Lowrie DB, Tascon RE, Bonato VLD, Lima VMF, Faccioli LH,

Stravropoulos E, Colston MJ, Hewinson RG, Moelling K &

Silva CL (1999) Therapy of tuberculosis in mice by DNA

vaccination. Nature 400: 269–271.

Martin DL, Weatherly DB, Laucella SA et al. (2006) CD81T-Cell

responses to Trypanosoma cruzi are highly focused on strain-

variant trans-sialidase epitopes. PLoS Pathog 2: e77.

Miller MJ, Wrightsman RA & Manning JE (1996) Trypanosoma

cruzi: protective immunity in mice immunized with

paraflagellar rod proteins is associated with a T-helper type 1

response. Exp Parasitol 84: 156–167.

Monteon-Padilla V, Hernandez-Becerril N, Ballinas-Verdugo

MA, Aranda-Fraustro A & Reyes PA (2001) Persistence of

Trypanosoma cruzi in chronic chagasic cardiopathy patients.

Arch Med Res 32: 39–43.

Ouaissi A, Aguirre T, Plumas Marty B et al. (1992) Cloning and

sequencing of a 24-kDa Trypanosoma cruzi specific antigen

released in association with membrane vesicles and defined by

a monoclonal antibody. Biol Cell 75: 11–17.

Ouaissi MA, Dubremetz JF, Schoneck R et al. (1995)

Trypanosoma cruzi: a 52-kDa protein sharing sequence

homology with glutathione S-transferase is localized in

parasite organelles morphologically resembling reservosomes.

Exp Parasitol 81: 453–461.

Ouaissi A, Guilvard E, Delneste Y, Caron G, Magistrelli G,

Herbault N, Thieblemont N & Jeannin P (2002) The

Trypanosoma cruzi Tc52-released protein induces human

dendritic cell maturation, signals via Toll-like receptor 2, and

confers protection against lethal infection. J Immunol 168:

6366–6374.

Paiva CN, Castelo-Branco MT, Lannes-Vieira J & Gattass CR

(1999) Trypanosoma cruzi: protective response of vaccinated

mice is mediated by CD81cells, prevents signs of polyclonal T

FEMS Immunol Med Microbiol ]] (2007) 1–9c� 2007 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

8 G. Sanchez-Burgos et al.

lymphocyte activation, and allows restoration of a resting

immune state after challenge. Exp Parasitol 91: 7–19.

Roberts LJ, Foote SJ & Handman E (2000) A new standard for the

assessment of disease progression in murine cutaneous

leishmaniasis. Parasite Immunol 22: 231–237.

Rodrigues MM, Ribeirao M, Pereira-Chioccola V, Renia L &

Costa F (1999) Predominance of CD4 Th1 and CD8 Tc1 cells

revealed by characterization of the cellular immune response

generated by immunization with a DNA vaccine containing a

Trypanosoma cruzi gene. Infect Immun 67: 3855–3863.

Rosado-Vallado M, Mut-Martin M, Garcia-Miss MR &

Dumonteil E (2005) Aluminium phosphate potentiates DNA

vaccines against Leishmania mexicana. Vaccine 23: 5372–5379.

Santori FR, Paranhos Bacalla GS, Franco DASJ, Yamauchi LM,

Araya JE & Yoshida N (1996) A recombinant protein based

on the Trypanosoma cruzi metacyclic trypomastigote

82-kilodalton antigen that induces an effective immune

response to acute infection. Infect Immun 64: 1093–1099.

Silva JS, Vespa GN, Cardoso MA, Aliberti JC & Cunha FQ (1995)

Tumor necrosis factor alpha mediates resistance to

Trypanosoma cruzi infection in mice by inducing nitric oxide

production in infected gamma interferon-activated

macrophages. Infect Immun 63: 4862–4867.

Steverding D & Tyler KM (2005) Novel antitrypanosomal agents.

Expert Opin Investig Drugs 14: 939–955.

Taibi A, Plumas-Marty B, Guevara-Espinoza A et al. (1993)

Trypanosoma cruzi: immunity-induced in mice and rats by

trypomastigote excretory-secretory antigens and identification

of a peptide sequence containing a T cell epitope with

protective activity. J Immunol 151: 2676–2689.

Tarleton RL (2001) Parasite persistence in the aetiology of Chagas

disease. Int J Parasitol 31: 550–554.

Ulmer JB, DeWitt CM, Chastain M, Friedman A, Donnelly JJ,

McClements WL, Caulfield MJ, Bohannon KE, Volkin DB &

Evans RK (1999) Enhancement of DNA vaccine potency using

conventional aluminum adjuvants. Vaccine 18: 18–28.

Urbina JA & Docampo R (2003) Specific chemotherapy of

Chagas disease: controversies and advances. Trends Parasitol

19: 495–501.

Urwin R, Russell JE, Thompson EA, Holmes EC, Feavers IM &

Maiden MC (2004) Distribution of surface protein variants

among hyperinvasive meningococci: implications for vaccine

design. Infect Immun 72: 5955–5962.

WHO (2002) Control of Chagas disease. World Health Organ

Tech Rep Ser 905: 1–109.

Wizel B, Garg N & Tarleton RL (1998) Vaccination with

trypomastigote surface antigen 1-encoding plasmid DNA

confers protection against lethal Trypanosoma cruzi infection.

Infect Immun 66: 5073–5081.

Wrightsman RA, Dawson BD, Fouts DL & Manning JE (1994)

Identification of immunodominant epitopes in Trypanosoma

cruzi trypomastigote surface antigen-1 protein that mask

protective epitopes. J Immunol 153: 3148–3154.

Zapata-Estrella H, Hummel-Newell C, Sanchez-Burgos G,

Escobedo-Ortegon J, Ramirez-Sierra MJ, Arjona-Torres A &

Dumonteil E (2006) Control of Trypanosoma cruzi infection

and changes in T cell populations induced by a therapeutic

DNA vaccine in mice. Immunol Lett 103: 186–191.

Zhang L & Tarleton RL (1999) Parasite persistence correlates with

disease severity and localization in chronic Chagas’ disease.

J Infect Dis 180: 480–486.

FEMS Immunol Med Microbiol ]] (2007) 1–9 c� 2007 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

9Trypanosoma cruzi therapeutic DNA vaccine