www.fems-microbiology.org

FEMS Microbiology Letters 244 (2005) 353–358

Characterization of a novel vip3-type gene from Bacillusthuringiensis and evidence of its presence on a large plasmid

Lobna Abdelkefi Mesrati, Slim Tounsi, Samir Jaoua *

Laboratory of Biopesticides, Centre of Biotechnology of Sfax, P.O. Box �K�, 3038 Sfax, Tunisia

Received 17 December 2004; received in revised form 31 January 2005; accepted 7 February 2005

First published online 14 February 2005

Edited by A. Klier

Abstract

A novel vip3-type gene named vip3LB has been isolated from Bacillus thuringiensis strain BUPM95. The corresponding secreted

vegetative insecticidal protein was active against the lepidopteran insect Ephestia kuehniella. The vip3LB gene was shown, for the

first time, to be carried by the large plasmid containing the cry1Ia genes of B. thuringiensis. The nucleotide sequence predicted a

protein of 789 amino acids residues with a calculated molecular mass of 88.5 kDa. Both nucleotide and amino acid sequences sim-

ilarity analysis revealed that vip3LB is a new vip3-type gene, presenting several differences with the other vip3-type genes. Heterol-

ogous expression of the vip3LB under the control of the strong promoter PBAD was performed in Escherichia coli and the produced

protein conferred insecticidal activity against Ephestia kuehniella. This novel vegetative insecticidal protein Vip3LB could be a very

useful biological control agent.

� 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.

Keywords: Bacillus thuringiensis; Plasmid; Vegetative insecticidal proteins; Ephestia kuehniella

1. Introduction

Insecticides derived from the soil bacterium Bacillus

thuringiensis (B. thuringiensis) are gaining world wide

importance as environmentally desirable alternatives tosynthetic chemicals for the control of pests in agriculture

and public health [1]. In fact, B. thuringiensis, a gram-

positive bacterium, is well known for its ability to pro-

duce crystalline inclusions during sporulation. These

inclusions are solubilized in insect midgut, releasing pro-

teins called d-endotoxins that, upon proteolytic activa-

tion, exhibit a highly specific insecticidal activity [2–4].

In the past decades, many B. thuringiensis strains withdifferent insect host spectra have been identified and

0378-1097/$22.00 � 2005 Federation of European Microbiological Societies

doi:10.1016/j.femsle.2005.02.007

* Corresponding author. Tel.:/fax: +216 74440453.

E-mail address: samir.jaoua@cbs.rnrt.tn (S. Jaoua).

their cry genes have been cloned in several microbes

[5,6]. Although industrial formulations of the Cry pro-

teins have been used as biopesticides [7], most Cry pro-

teins are not very effective in controlling some of the

agronomically important insects [8] such as the lepidop-teran black cutworm (Agrotis ipsilon) that attacks more

than 50 crops including cereal grains [9]. Extensive

screening programs are being carried out by various

groups to search for B. thuringiensis strains with new

insecticidal spectra. These evaluations have focused

mainly on the identification of new insecticidal proteins

that are expressed before and during sporulation. Re-

cently, a new family of insecticidal proteins producedby B. thuringiensis during its vegetative growth phase

(Vegetative insecticidal proteins [Vips]) has been identi-

fied [10]. The Vips bear no similarity to d-endotoxinsand have shown a broad insecticidal spectrum, including

. Published by Elsevier B.V. All rights reserved.

354 L.A. Mesrati et al. / FEMS Microbiology Letters 244 (2005) 353–358

activity toward a wide variety of lepidopteran and also

coleptera pests [11,12]. The vip3A gene encodes an

88.5-kDa protein that is secreted into the supernatant

fluid by B. thuringiensis cultures [11]. This protein pos-

sesses insecticidal activity against a wide spectrum of le-

pidopteran insects and displays acute bioactivity towardAgrotis ipsilon. Indeed, the activity of Vip3A protein

against Agrotis ipsilon was 260 times higher than some

of Cry1A proteins shown to be active against this insect

[9,10]. In the present work, we report for the first time

that vip3 genes are carried by endogenous B. thuringien-

sis plasmid. On the other hand, we have cloned and

over-expressed in Escherichia coli a new vip3-type gene

named vip3LB, and the activity of the resultant proteinwas tested on lepidopteran larvae.

2. Materials and methods

2.1. Bacterial strains, growth conditions and plasmids

All 256 B. thuringiensis strains consecutively namedBUPM1 to BUPM256 and used for the screening of veg-

etative insecticidal activity, were isolated from the tuni-

sian soil according to Jaoua et al. [13]. The strain BNS3

is B. thuringiensis subsp. kurstaki H3a, 3b, 3c [14], and

has an insecticidal activity against larvae of several Lep-

idoptera [15]. The strain BUPM95 was characterized by

the insecticidal activity of its protein supernatant against

the lepidopteran Ephestia kuehniella (Data not shown).The acrystalliferous strain BUPM95� (Cry�, Vip�,

Spo+) was obtained by plasmid curing from the B. thur-

ingiensis BUPM95, by cultivating the wild strain at

42 �C for five days. B. thuringiensis subsp. Kurstaki

HD1 and B. thuringiensis subsp. israeliensis 14T were

used as reference strains. For routine use in the labora-

tory, isolates were grown in Luria–Bertani (LB) medium

at 30 �C with shaking at 200 rev min�1, and for long-term storage, the isolates were stored as glycerol stocks

at (�80 �C). E. coli MOSBlue cells: endA1 hsdR17

(rk12 � mk12+) sup E44 thi-1 recA1 gyrA96 relA1 lac

[F� proA+B+ laclqZDM15: Tn10 (TcR)] was obtained

from Amersham and was used as the host organism

for recombinant DNA cloning. Plasmid pMOSBlue

(from Amersham) and pBAD-GFPuv (from Clontech;

GenBank Accession No. U62637) were used in thisstudy as cloning vectors.

2.2. DNA extraction and PCR amplification

Plasmid DNA was extracted from B. thuringiensis

using the alkali lysis method including a lysozyme treat-

ment step [16]. The oligonucleotides used in this study

were synthesized by the ‘‘Centre de Genetique Molecu-laire, CNRS, GENSET, Orsay, France’’. Primers used

to detect and to clone vip-like gene were designed based

on the published sequence vip3A(a) gene [GenBank

Accession No. L48811]. DNA extracted from B. thurin-

giensis strains was used as template for the PCR using a

‘‘Gene Amp PCR System 2700’’ (Applied Biosystems).

PCR was accomplished as described by Jaoua et al. [13].

2.3. Preparation of DNA probe and nucleic acid

hybridization

The vip3-specific probe was prepared from the strain

B. thuringiensis BUPM95 by PCR using the two primers

V1 (5 0 ATGAACAAGAATAATACTA 3 0) and V2 (5 0

TCTATTTGCAGACTTAGCGC 3 0) complementary

to the regions located at the initiation codon (ATG)and at 419 pb from the ATG, respectively. For slot-blot

hybridization, total DNA of PCR positive and negative

B. thuringiensis strains was blotted onto Hybond N+

Nylon membrane (Amersham). For Southern blot

hybridization [17], total DNA of B. thuringiensis strains

was separated by electrophoresis in horizontal 0.7% aga-

rose gel, and transferred to a Hybond N+ Nylon mem-

brane. Then, filters were baked [16], and probed withthe vip3-labeled amplification product or with a cry1Ia

labeled fragment [18].

2.4. Cloning and sequencing of vip3LB from BUPM95

The putative vegetative insecticidal protein-coding

gene designed vip3LB, was amplified by PCR, using to-

tal DNA isolated from strain BUPM95 as template, TaqDNA polymerase (Amersham) and primers V1 (5 0

ATGAACAAGAATAATACTA 3 0) and V3 (5 0

TTACTTAATAGAGACATCGT 3 0) complementary

to the regions located at the initiation codon (ATG)

and the termination codon (TAA), respectively. These

primers were designed on the basis of published se-

quence data of vip3A(a). The amplified fragment

(2.37 kb) corresponding to the Open Reading Frame(ORF) of the vip-gene was purified from the agarose

gel with the MinElute Gel Extraction Kit (Qiagen) and

cloned in pMOSBlue vector generating a recombinant

plasmid pMOSvip3LB. Transformation of E. coli MOS-

Blue cells was performed according to the manufac-

turer�s protocol (Bethesda Research Laboratories

recommended protocol). Selection of E. coli transfor-

mants was performed on LB medium plates containingampicillin (100 lg ml�1). Sequencing of the vip3LB gene

was carried out with a taq DyeDeoxy Terminator Cycle

Sequencing kit and a 3700 ABI Prism DNA sequencer

(Applied Biosystems, Foster City, CA) according to

the instructions of the manufacturer. To be certain of

the real sequence of the gene, several PCR clones were

used. Sequence comparison with the data bases was per-

formed using BLAST through the NCBI E-mail server.Multiple alignments were carried out using CLU-

STALW program [19]. The sequence of vip3LB has been

Fig. 1. B. thuringiensis vip3-like gene analysis by slot-blot hybridiza-

tion. S1, S2, S3, S4, S5 and S6 correspond to B. thuringiensis HD1,

BNS3, BUPM95, BUPM97, BUPM2 and 14T DNA, respectively.

L.A. Mesrati et al. / FEMS Microbiology Letters 244 (2005) 353–358 355

deposited in the GenBank data base under the Acces-

sion No. AY739665.

2.5. Heterologous expression of vip3LB in

Escherichia coli and insect bioassay

Over-expression of vip3LB was achieved by cloning

its ORF in the pBAD-GFPuv vector. In this vector,

expression is under control of the arabinose operon pro-

moter (PBAD), which can be induced in the presence of L-

arabinose [20]. The NheI–EcoRI restriction fragment of

this plasmid, containing the green fluorescent protein

(GFP) coding sequence (positions 1340–2063), was re-

placed by an XbaI–EcoRI restriction fragment contain-ing vip3LB coding sequence obtained from the plasmid

pMOSvip3LB. This cloning step positioned the vip3LB

ORF just downstream of the PBAD promoter and al-

lowed the expression of the latter in E. coli. The recom-

binant plasmid named pBADvip3LB (7 kb) was

introduced in E. coli. Recombinant E. coli clones carry-

ing the vip3LB gene were grown at 37 �C overnight in

LB broth supplemented with 100 lg of ampicillin perml. These cells were used as seed culture to inoculate

fresh cultures (50 ml) with an initial absorbance at

600 nm of 0.05 and when the optical density reached

0.6 at 600 nm, cells were induced with L-arabinose (1%

w/v final concentration) and grown for three hours

post-induction at 37 �C and 200 rev min�1. Then, cells

were harvested by centrifugation at 2400g for 10 min

and the cell pellet was washed with 50 mM sodium phos-phate buffer (pH 8.0) containing 300 mM NaCl. The cell

pellet was resuspended in the same buffer and sonicated

with three pulses of medium intensity for 30 s each. The

suspension was centrifuged at 2400g for 10 min. The

expression of vip was checked in cytosolic supernatant.

A free ingestion technique was used to assess the toxicity

to Ephestia kuehniella of cytosolic supernatant prepara-

tions. Supernatant proteins (500 ll) were incorporatedinto semolina diet and the combination was used to feed

neonate larvae of lepidopteran insects. Mortality was re-

corded up to 6 days.

Fig. 2. Localization of the vip3 gene on a B. thuringiensis plasmid by

PCR analysis. Lanes: 1, B. thuringiensis BUPM95; 2, B. thuringiensis

BUPM95� (cured strain); 3, k DNA-HincII molecular mass markers

(4.7, 3.5, 3.2, 2.8, 2.2, 1.9, 1.6, 1.3, 1.2, 1.1, 0.8, 0.7, 0.5, 0.4, 0.3,

0.2 kb).

3. Results

3.1. PCR screening of B. thuringiensis strains

256 B. thuringiensis isolates of the laboratory were

screened by PCR using V1 and V2 primers for the pres-

ence of vip3-like gene. 30% of these isolates exhibited ex-

pected vip3 amplified fragment of a 0.419 kb

demonstrating that these strains were Vip+. B. thuringi-

ensis subsp. israelensis DNA did not produce any ampli-

fication product. The presence of vip3 like gene in thePCR positive B. thuringiensis strains (HD1, BNS3,

BUPM95 and BUPM2) and the absence of the gene in

B. thuringiensis israelensis strains (BUPM97 and 14T)

were confirmed by slot-blot hybridization (Fig. 1).

3.2. Localization of the vip3 gene on the B. thuringiensisgenome

Plasmid curing by cultivating the Vip3-producing B.

thuringiensis strain BUPM95 at 42 �C was performed

for five days. 200 clones were analyzed and acrystallifer-

ous Cry� mutants were obtained with very high fre-

quency of about 79%. Total DNAs of these 200 cloneswere used to check by PCR the presence of vip3 gene,

by using V1 and V2 primers. The positive control used

in this study was BUPM95 wild type strain. All Cry�

mutants did not give any amplification whereas all

clones Cry+ and the BUPM95 strain gave amplified

fragment of 0.419 kb (Fig. 2). These results evidence

clearly that vip3 gene was lost during plasmid curing,

and would be carried by a plasmid. The fact the cry

and vip3 markers were lost with the same frequency

356 L.A. Mesrati et al. / FEMS Microbiology Letters 244 (2005) 353–358

suppose that these genes could be carried by the same

plasmid. To confirm these results, a Southern blot anal-

ysis was made with total DNA of B. thuringiensis strain

BUPM95 and a Cry� strain using separately the radio-

active probes vip3 and cry1Ia, respectively. Fig. 3(a)

showed clearly the presence of a large plasmid presentin the total DNA of B. thuringiensis strain BUPM95

which was lost in the cured strain. Moreover, the

hybridization experiments demonstrated that this plas-

mid was hybridized with the radioactive probe vip3

(Fig. 3(b)) demonstrating that it carries vip3 gene. On

the other hand, the cry1Ia probe hybridized with the

same plasmid (Fig. 3(b)) demonstrating that vip3 and

cry1Ia genes were localized on that same B. thuringiensisplasmid.

3.3. Cloning and sequence analysis of the vip3LB gene

Due to the interest provided by the insecticidal activ-

ity exhibited by the B. thuringiensis strain BUPM95, a

vip gene named vip3LB was cloned from this strain,

Fig. 3. Determination of the localization of vip3 and cry1Ia genes by molec

Vip�. Lanes: 1 and 3, B. thuringiensis BUPM95; 2 and 4, B. thuringiensis BUP

its mutant Vip� separately with vip3 probe (lanes: 1, wild type BUPM95; 2,

cured strain BUPM95�). Arrows indicate the position of the plasmid carryi

Fig. 4. Comparison of the amino acid sequence encoded by vip3LB with th

differences are presented. The vertical downward arrow indicates amino acid

GenBank Accession Nos. of the vip3 genes and their corresponding proteins: V

and Vip3V, AF373030.

characterized and compared with the few published

vip3 genes. The PCR fragment containing the open read-

ing frame of vip3LB was cloned in the vector pMOS-

Blue. The resultant recombinant plasmid designated

pMOSvip3LB was used for sequencing of the vip3LB

gene. The obtained sequence corresponds to an openreading frame of 2370 pb encoding a protein of 789 ami-

no acid residues. The predicted molecular mass of the

protein was equal to 88.5 kDa. The search for sequence

similarity of vip3LB with the up to now known genes,

using the Blast program revealed that it is a new vip3-

type gene. This result was confirmed with multiple align-

ments using CLUSTALW program. When compared

with all known vip3-type genes [21], there was substitu-tion at position 361 of A for C (transversion), resulting

in the substitution of I(121) for L. Compared with vip3Aa

[11], there was substitution at position 850 of C for A

(transversion), resulting in the substitution of Q(284)

for K. Compared with vip3Ab [11], there were substitu-

tions at positions 617 of G for T (transversion), 871 of C

for A (transversion) and 1217 of G for A (transition),

ular hybridization. (a) Plasmids contents of BUPM95 and its mutant

M95� (cured strain). (b) Hybridization of total DNA of BUPM95 and

cured strain BUPM95�) and cry1Ia probe (3, wild type BUPM95; 4,

ng both of vip3 and cry1Ia genes.

ose encoded by the other vip3-type genes. Only the regions containing

position. The black boxes represent the residues showing variations.

ip3LB, AY739665; Vip3Aa, L48811; Vip3Ab, L48812; Vip-S, Y17158,

L.A. Mesrati et al. / FEMS Microbiology Letters 244 (2005) 353–358 357

resulting in the substitution of R(206) for L, P(291) for T

and G(406) for E, respectively. Compared with vip-S

[22], there was substitution at position 2225 of G for

A (transition), resulting in the substitution of G(742)

for E (Fig. 4).

3.4. Over-expression of vip3LB in E. coli and study of the

insecticidal activity

The vip3LB gene was cloned downstream of the

strong PBAD promoter in the pBAD-GFPuv vector.

After sonication of L-arabinose induced E. coli strain

containing the recombinant plasmid pBADvip3LB

and E. coli containing the plasmid pBAD-GFPuv usedas negative control, supernatant proteins were analyzed

by SDS–PAGE on which the two strains showed

apparently similar arrays of proteins with the major

exception of an 88.5 kDa, Vip3LB-sized protein which

was produced by E. coli containing pBADvip3LB and

was not produced by E. coli containing pBAD-GFPuv

(Fig. 5). The new produced protein corresponds to a

vegetative insecticidal protein and it was partiallycleaved with the E. coli proteases generating an ex-

pected protein of about 62 kDa (Fig. 5). The recombi-

nant E. coli proteins extract was used for insect

bioassays and the new vegetative insecticidal protein

was found to be active on lepidopteran larvae of

Ephestia kuehniella. After six days, the recombinant

E. coli proteins extract caused mortality of 90% of lar-

vae, whereas exposure of larvae to the native E. coli

protein extract (E. coli containing pBAD-GFPuv) did

not result in any aberration in larval growth increase,

weight gain or morphology. These findings demon-

Fig. 5. Heterologous expression of vip3LB in E. coli: SDS–PAGE

analysis of E. coli supernatants. Lanes 1, supernatant proteins of

sonicated culture of E. coli strains containing pBADGFPuv; 2,

supernatant proteins of sonicated culture of E. coli strains containing

pBADvip3LB; 3, molecular weight markers (RPN 800, Amersham):

105, 75, 50 and 35 kDa.

strate clearly that the cloned vip3LB expressed in E.

coli is active against Ephestia kuehniella.

4. Discussion

Several important strategies have been put in place

to address concerns of resistance to B. thuringiensis d-endotoxins, particularly with their presentation in the

form of transgenic crops [23]. In that regard, one strat-

egy involves the presentation of several toxins together,

especially if a differing mode of action involving differ-

ent receptors is available. The Vip3A protein is a novel

insecticidal protein with activity against a broad spec-trum of lepidopteran insects [11]. Lee et al. [24] have

shown that the mode of action of Vip3A differs in sev-

eral steps compared to Cry1Ab, therefore, incorpora-

tion of Vip3A into insect control program may serve

to address d-endotoxin resistance concerns in addition

to its own value as a control agent. It has long been

recognized that the proteins comprising the parasporal

crystal are encoded by large plasmids [25–27]. In thisstudy, the localization of vip3LB gene, a member of a

new family of B. thuringiensis toxins-coding gene, has

been investigated and we demonstrate for the first time

that vip3-like genes were located on a large plasmid of

B. thuringiensis. Moreover, we showed that after B.

thuringiensis plasmids curing, loss of cry1Ia and vip3

genes occurred at the same frequency. On the other

hand, by molecular hybridization experiments, thesame plasmid hybridized separately with both of these

genes demonstrating, for the first time, that the latter

are localized on the same plasmid. Upon computer-

assisted translation of the sequence of vip3 gene cloned

from a tunisian B. thuringiensis strain BUPM95, and

comparison with other known vip3 genes reported so

far, novelty of Vip3LB was evidenced. In fact, the trans-

lated sequence differed at several sites from those of allthe other published Vip3 proteins especially with Vi-

p3A(b). The novel vip3 gene was expressed in E. coli

and the recombinant strains showed a production of

an abundant protein having the same size of 88.5 kDa

than that of Vip3A [11], and the same proteases process-

ing generating a protein of 62 kDa [12]. We noted that

E. coli cells harbouring the cloned vip3LB gene were

shown to be toxic to lepidopteran insects and the pro-duced protein offers a promise of extending the useful-

ness of B. thuringiensis as controlling pest agents.

Acknowledgements

We thank Miss Imen Saadaoui for her help in se-

quences alignments. We also thank Mrs. Najeh BelguithHassine for her technical assistance. This work was

358 L.A. Mesrati et al. / FEMS Microbiology Letters 244 (2005) 353–358

supported by grants from Tunisian Ministere de la

Recherche Scientifique et de la Technologie et du Devel-

oppement des Competences.

References

[1] Van Frankenhuyzen, K. (1993) The Challenge of Bacillus

thuringiensis. In: Bacillus thuringiensis, An Environmental Bio-

pesticide: Theory and Practice (Entwistle, P.E., Cory, J.S., Bailey,

M.J. and Higgs, S., Eds.), Chichester, UK, John Wiley & Sons,

pp. 1–35.

[2] Hofte, H. and Whiteley, H.R. (1989) Insecticidal crystal proteins

of Bacillus thuringiensis. Microbiol. Rev. 53, 242–255.

[3] Crickmore, N., Zeigler, D.R., Feitelson, J., Schnepf, H.E., Van

Rie, J., Lereclus, D., Baum, J. and Dean, D.H. (1998) Revision of

the nomenclature for the Bacillus thuringiensis pesticidal crystal

proteins. Microbiol. Mol. Biol. Rev. 62, 807–813.

[4] Schnepf, H.E., Crickmore, N., Van Rie, J., Lereclus, D., Baum, J.,

Feitelson, J., Zeigler, D.R. and Dean, D.H. (1998) Bacillus

thuringiensis and its pesticidal crystal proteins. Microbiol. Mol.

Biol. Rev. 62, 775–806.

[5] Sekar, V. and Carlton, B.C. (1985) Molecular cloning of delta-

endotoxin gene of Bacillus thuringiensis var. israelensis. Gene 33,

151–158.

[6] Schnepf, H.E., Wong, H.C. and Whiteley, H.R. (1987) Expression

of a cloned Bacillus thuringiensis crystal gene in Escherichia coli. J.

Bacteriol. 169, 4110–4118.

[7] Gelernter, W.D., Green, M.B, LeBaron, H.M. and Moberg, W.K.

(Eds.) (1990) Managing Resistance to Agrochemicals, ACS

Symposium Series, American Chemical Society, Washington,

pp. 105–117.

[8] MacIntosh, S.C., Sone, T.B., Sims, S.R., Hunst, F.L., Green-

plate, J.J., Marrone, P.G., Perlak, F.J., Fischhoff, D.A. and

Fuchs, R.L. (1990) Specificity and efficacy of purified Bacillus

thuringiensis protein against agronomically important insects. J.

Invertebr. Pathol. 56, 258–266.

[9] Rings, R.W., Arnold, F.J., Keaster, A.J. and Musick, G.J. (1974)

A Worldwide Annotat. of Black Cutworm, Ohio Agricultural

Research and Development Center, Ohio State University,

Columbus.

[10] Warren, G.W., Koziel, M.G., Mullins, M.A., Nye, G.J., Carr, B.,

Desai, W.M., Kostochka, K., Duck, N.B. and Estruch, J.J. (1996)

Novel pesticidal protein and strains, Patent WO 96/10083, World

Intellectual Property Organization.

[11] Estruch, J.J., Warren, G.W., Mullins, M.A., Nye, G.J., Craig,

J.A. and Koziel, M.G. (1996) Vip3A, a novel Bacillus thuringiensis

vegetative insecticidal protein with a wide spectrum of activities

against lepidopteran insects. Proc. Natl. Acad. Sci. USA 93, 5389–

5394.

[12] Yu, C.G., Mullins, M.A., Warren, G.W., Koziel, M.G. and

Estruch, J.J. (1997) The Bacillus thuringiensis vegetative insecti-

cidal protein Vip3A lyses midgut epithelium cells of susceptible

insects. Appl. Environ. Microbiol. 63, 532–536.

[13] Jaoua, S., Zouari, N., Tounsi, S. and Ellouz, R. (1996) Study

of the delta-endotoxins produced by three recently isolated

strains of Bacillus thuringiensis. FEMS Microbiol. Lett. 145,

349–354.

[14] Tounsi, S., J�Mal, A., Zouari, N. and Jaoua, S. (1999) Cloning

and nucleotide sequence of a novel cry1Aa-type from Bacillus

thuringiensis subsp. kurstaki. Biotechnol. Lett. 21, 771–775.

[15] Tounsi, S. and Jaoua, S. (2003) Characterization of a novel

cry2Aa-type gene from Bacillus thuringiensis subsp. kurstaki.

Biotechnol. Lett. 25, 1219–1223.

[16] Sambrook, J., Fritsh, E.F. and Maniatis, T. (1989) Molecular

Cloning. A Laboratory Manual, 2nd edn. Cold Spring Harbor

Laboratory, Cold Spring Harbor, NY.

[17] Southern, E.M. (1975) Detection of specific sequences among

DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98,

503–517.

[18] Ausubel, F.M., Brent, R., Kingston, R.E., Morre, D.D., Scidman,

J.G., Smith, J.A. and Struhl, K. (1988) Current Protocols in

Molecular Biology. Wieley, New York.

[19] Thompson, J.D., Higgins, D.G. and Gibson, T.J. (1994) CLUS-

TAL W: improving the sensitivity of progressive multiple

sequence alignment through sequence weighting, position specific

gap penalties and weight matrix choice. Nucl. Acid. Res. 22,

4673–4680.

[20] Guzman, L.M., Belin, D., Carson, M.J. and Beckwith, J. (1995)

Tight regulation, modulation, and high-level expression by

vectors containing the arabinose PBAD promoter. J. Bacteriol.

177, 4121–4130.

[21] Doss, V.A., Kumar, K.A., Jayakumar, R. and Sekar, V. (2002)

Cloning and expression of the vegetative insecticidal protein

(vip3V) gene of Bacillus thuringiensis in Escherichia coli. Protein

Expres. Purif. 26, 82–88.

[22] Selvapandiyan, A., Arora, N., Rajagopal, R., Jalali, S.K.,

Venkatesan, T., Singh, S.P. and Bhatnagar, R.K. (2001) Toxicity

analysis of N- and C-terminus-deleted vegetative insecticidal

protein from Bacillus thuringiensis. Appl. Environ. Microbiol. 67,

5855–5858.

[23] Roush, R.T. (1997) Bt-transgenic crops: just another pretty

insecticide or a chance for a new start in resistance management?

Pest. Sci. 51, 328–334.

[24] Lee, M.K., Walters, F.S., Hart, H., Palekar, N. and Chen, J.S.

(2003) The mode of action of Bacillus thuringiensis Vegetative

Insecticidal Protein Vip3A differs from that of Cry1Ab d-endotoxin. Appl. Environ. Microbiol. 69, 4648–4657.

[25] Gonzalez, J.M., Dulmage, H.T. and Carlton, B.C. (1981) Corre-

lation between specific plasmids and d-endotoxin production in

Bacillus thuringiensis. Plasmid 5, 351–365.

[26] Widner, W.R. and Whiteley, H.R. (1989) Two highly related

insecticidal crystal proteins of Bacillus thuringiensis subsp. Kur-

staki possess different host range specificities. J. Bacteriol. 171,

965–974.

[27] Gleave, A.P., Williams, R. and Hedges, J. (1993) Screening by

polymerase chain reaction of Bacillus thuringiensis serotypes for

the presence of cryV-like gene cloned from B. thuringiensis subsp.

Kurstaki. Appl. Environ. Microbiol. 59, 1683–1687.