Pyramiding of modified cry1Ab and cry1Ac genesof Bacillus thuringiensis in transgenic chickpea(Cicer arietinum L.) for improved resistance to pod borerinsect Helicoverpa armigera

Meenakshi Mehrotra • Aditya K. Singh •

Indraneel Sanyal • Illimar Altosaar • D. V. Amla

Received: 11 January 2010 / Accepted: 23 July 2011 / Published online: 11 August 2011

� Springer Science+Business Media B.V. 2011

Abstract The modified cry1Ab and cry1Ac insecti-

cidal genes of Bacillus thuringiensis (Bt) under the

control of two different constitutive promoters have

been introduced into chickpea (Cicer arietinum L.) by

Agrobacterium-mediated transformation of pre-condi-

tioned cotyledonary nodes. 118 stable transformed T0

plants as independent transformation events were

obtained expressing individual cry1Ab, cry1Ac or both

pyramided genes for their co-expression driven by either

cauliflower mosaic virus 35S promoter with duplicated

enhancer (CaMV35S) or synthetic constitutive promoter

(Pcec) and their combinations. Integration and inheri-

tance of transgenes in T0 and T1 population of transgenic

chickpea plants were determined by PCR, RT-PCR and

Southern hybridization. Results of Southern hybridiza-

tion showed single copy integration of cry1Ab or cry1Ac

genes in most of the transgenic plants developed with

either single or pyramided genes and reflected

Mendelian inheritance of transgenes in T1 progeny.

Real time PCR of pyramided transgenic plants clearly

showed differential expression of transcripts for both the

genes driven by CaMV35S and Pcec promoters. Quan-

titative assessment of Bt Cry toxins by ELISA of T0

transgenic chickpea plants showed expression of toxin

ranging from 5 to 40 ng mg-1 of total soluble protein

(TSP) in leaves of transgenic plants. Insect bioassay

performed with transgenic plants showed relatively

higher toxicity for plants expressing Cry1Ac protein as

compared to Cry1Ab to Helicoverpa armigera. Pyram-

ided transgenic plants with moderate expression levels

(15–20 ng mg-1 of TSP) showed high-level of resis-

tance and protection against pod borer larvae of

H. armigera as compared to high level expression of a

single toxin. These results have shown the significance

of pyramiding and co-expression of two Cry toxins for

efficient protection against lepidopteran pests of

chickpea.

Keywords Bacillus thuringiensis � Transgenic

chickpea plants � Genetic transformation � Gene

pyramiding � Helicoverpa armigera � Bt-Cry toxin

Introduction

Chickpea (Cicer arietinum L.) is second important

grain legume grown worldwide as a major source of

dietary protein for human consumption and feed for

livestock. In spite of its large demand, the global yield

Electronic supplementary material The online version ofthis article (doi:10.1007/s10681-011-0501-3) containssupplementary material, which is available to authorized users.

M. Mehrotra � A. K. Singh � I. Sanyal � D. V. Amla (&)

Plant Transgenic Lab, National Botanical Research

Institute, Rana Pratap Marg, P.O. Box 436,

Lucknow 226 001, India

e-mail: dvamla@rediffmail.com

I. Altosaar

Department of Biochemistry, Microbiology and

Immunology, University of Ottawa, 451 Smyth Road,

Ottawa, ON, Canada

123

Euphytica (2011) 182:87–102

DOI 10.1007/s10681-011-0501-3

of chickpea and some other large seeded grain legumes

is stagnating for last two decades primarily due to large

number of biotic and abiotic stresses and slow progress

of genetic improvements for yield parameters (Pop-

elka et al. 2004; Dita et al. 2006). Grain yield of

chickpea suffers massive loss due to field infestation of

lepidopteran pod borer Helicoverpa armigera and few

other insects (Romeis et al. 2004). Development of

improved varieties of grain legumes particularly of

chickpea for resistance to pathogens and insect pests

by conventional breeding has been slow and difficult

due to narrow genetic base, limited genetic diversity

for these traits, barriers for sexual incompatibility and

high degree of autogamy (Ahmad et al. 1988; Van

Rheenen et al. 1993; Somers et al. 2003). Considering

the limitations of conventional approaches, introduc-

tion and expression of insecticidal delta endotoxin

genes of Bacillus thuringiensis into chickpea, is a

potential option for developing resistance against pod

borer lepidopteran insects as demonstrated success-

fully into a wide variety of crop plants (Christou et al.

2006; Gatehouse 2008; James 2009).

Since most of the insect resistant transgenic plants

released for commercial cultivation harbour single

insecticidal Bt-cry gene and the target insects pop-

ulation are consistently being exposed to the single

toxin protein, therefore the possibility of insects

evolving resistance to single Bt toxin is high (Zhao

et al. 2005; Gunning et al. 2005). In recent years,

several Bt cotton hybrid lines expressing cry1Ac have

been approved for commercial cultivation in India

and due to small farm holdings, diverse cropping

system and immigration of insects to alternative

hosts, the possibility of developing heterogeneous

insect population are very high (James 2009). More-

over, pink bollworm resistant to Bt cotton harbouring

the Bt-cry1Ac gene has been reported in the fields in

India, where farmer compliance with refugia strategy

has been low (Tabashnik et al. 2010). Several

strategies have been proposed for the management

of resistance development in herbivorous field insects

including the application of diverse mixture of toxins,

high expression of Bt-toxin, weedy refugia, hybrid

and pyramiding of different Bt-toxin genes and use of

sterile insect (Gatehouse 2008; Tabashnik et al.

2010). In recent years, transgenic plants expressing

two dissimilar insect toxins have been developed and

the most successful example is Bt-cotton ‘‘Bollgard

II’’ expressing cry1Ac and cry2Ab2 genes (Perlak

et al. 2001; Zhao et al. 2005). The efficacy and

sustainability of transgenic plants towards develop-

ment of resistance in insects rely on the pyramiding

and co-expression of two or more diverse transgenes

without affecting the yield parameters (Zhao et al.

2003; Gatehouse 2008).

In the present study, we have obtained stable

transgenic plants of recalcitrant grain legume chick-

pea using Agrobacterium-mediated transformation of

cotyledonary nodes (CN) with dicot-preferred mod-

ified truncated synthetic cry1Ab and cry1Ac genes.

Our results of insect bioassay have indicated that

transgenic plants co-expressing both the Bt-cry genes

were highly toxic and showed relatively higher and

effective protection against H. armigera as compared

to plants expressing single cry genes.

Materials and methods

Bt insecticidal crystal protein genes, plasmids

and Agrobacterium culture

Codon optimized 1,845 bp sequences of modified,

Bt-cry1Ab and cry1Ac genes (Sardana et al. 1996)

with a 38 bp AMV (Alfalfa mosaic virus) 50 UTR

sequence flanking on 50 of the gene were cloned in

binary vector pBIN20 (Hennegan and Danna 1998)

under the control of 620 bp cauliflower mosaic virus

35S double enhancer promoter (CaMV35S), and nos

terminator to generate binary vectors pBIN200 and

pRD400 respectively along with nptII gene cassette

for kanamycin resistance as plant selection marker in

T-DNA region (Fig. 1a, b). Sub-cloning of 2,753 bp

HindIII fragment from pBIN200 containing

CaMV35S-cry1Ab-nos cassette into pRD400 vector

resulted into pRD401 vector harbouring both cry1Ab

and cry1Ac genes driven by independent CaMV35S

promoter in cis orientation (Fig. 1d). The 450 bp

synthetic constitutive expression promoter (Pcec)

comprised of 138 bp minimal expression cassette

(Pmec) and 312 bp activation module (Sawant et al.

2001) with cry1Ac gene and nos terminator was

cloned at SalI and EcoRI site in pBIN20 vector to

generate pCEC.Ac vector where cry1Ac is driven by

Pcec promoter and carry the nptII gene as the

selectable marker (Fig. 1c). The 2,753 bp HindIII

cassette containing CaMV35S-cry1Ab-nos from

pBIN200 was sub-cloned in pCEC.Ac vector to

88 Euphytica (2011) 182:87–102

123

result into pCEC.Ab.Ac vector having cry1Ab and

cry1Ac gene driven by CaMV35S and Pcec promoter

respectively (Fig. 1e). The binary vectors harbouring

cry1Ab (pBIN200), cry1Ac (pRD400 and pCEC.Ac)

and cry1Ab ? cry1Ac (pRD401 and pCEC.Ab.Ac)

were mobilized into competent Agrobacterium tum-

efaciens strain LBA4404 (Hoekema et al. 1983) via

electroporation and utilized for transformation of

chickpea cotyledonary nodes.

Agrobacterium co-cultivation and transgenic plant

regeneration

Mature breeder seeds of chickpea variety P-362 were

obtained from Indian Agricultural Research Institute,

New Delhi and used routinely for genetic transfor-

mation. The seeds were surface sterilized and soaked

overnight in sterile distilled water supplemented with

2.0 mg l-1 BAP. The seeds were incubated on basal

medium consisting of MS salts (Murashige and

Skoog 1962), B5 vitamins, 30 g l-1 (w/v) sucrose,

solidified with 0.8% (w/v) agar and supplemented

with 2.0 mg l-1 BAP for germination to obtain

multiple shoots (Sanyal et al. 2003). Excised non-

transformed CN on MS medium resulted into 8–10

adventitious shoots per explant after 4 weeks of

incubation. The CN explants were prepared and

co-cultivated as described earlier (Sanyal et al. 2005).

Excised 21-day-old chickpea CNs were pre-condi-

tioned for 24 h on MS basal medium supplemented

with sodium thiosulphate (100 mg l-1) and DTT

(100 lM) before using them for Agrobacterium co-

cultivation. Culture of A. tumefaciens strain

LBA4404, harbouring the individual binary vectors

pBIN200, pRD400, pCEC.Ac, pRD401 and pCE-

C.Ab.Ac were used for genetic transformation of the

pre-conditioned chickpea CNs under optimized con-

ditions as described earlier (Sanyal et al. 2005). The

primary transgenic shoots recovered after selection

on kanamycin were either transferred to root induc-

tion medium, for root development within a week of

incubation or micro-grafted onto 10-days-old scion of

same genotype followed by acclimatization and

hardening under controlled conditions. Complete

plantlets were transferred to pots for seed setting in

contained transgenic growth chambers. All cultures

were incubated in culture room maintained at

24 ± 1�C under cool white light of intensity

60 lmol m-2 s-1 for 16 h photoperiod while rooted

chickpea plants in pots were grown in contained

Fig. 1 Schematic diagram of T-DNA regions of different

binary vectors used for genetic transformation of chickpea. The

backbone of binary vector for all the constructs is pBIN20

harbouring nptII gene driven by nos promoter (Pnos) and nosterminator (Tnos). a, b pRD400 and pBIN200 containing

cry1Ac and cry1Ab gene respectively driven by CaMV35Spromoter; c pCEC.Ac containing cry1Ac gene driven by

synthetic promoter Pcec; d pRD401containing both cry1Aband cry1Ac genes driven by CaMV35S; e pCEC.Ab.Ac

containing cry1Ab and cry1Ac genes driven by CaMV35Sand Pcec promoters respectively. Different PCR primers used

in the study are shown with arrow marks at their respective

binding positions: nptII-F, nptII-R for amplification of nptII;Ab-F, Ab-R for cry1Ab and Ac–F, Ac-R for cry1Ac genes

respectively. Bold lines below nptII, cry1Ab and cry1Ac genes

represent 678 bp PstI fragment of nptII, 1.8 kb BamHI and

EcoRI fragment of cry1Ab and 1.8 kb BamHI and SacI

fragment of cry1Ac respectively, used for the preparation of

radiolabelled probes for Southern analysis in the present study.

The abbreviations denote; RB right border, LB left border,

AMV Alfalfa mosaic virus 50 UTR sequence

Euphytica (2011) 182:87–102 89

123

glasshouse under similar conditions. Percent trans-

formation efficiency in absolute terms was calculated

as the number of primary transgenic plants (T0)

recovered after three successive selection cycles on

kanamycin divided by total number of adventitious

shoots that would have been recovered on shoot

induction medium from an equivalent number of non-

transformed explants under similar conditions. Selfed

seeds of the primary transformants were sown in

solidified half-strength MS medium supplemented

with 50 mg l-1 kanamycin. The plants germinated on

selection medium were considered as T1 progeny and

used for further analysis.

Polymerase chain reaction (PCR) for screening

and characterization of transgenic plants

Genomic DNA from kanamycin-resistant chickpea

shoots was isolated by homogenizing 100 mg of leaf

tissue in liquid nitrogen followed by addition of

extraction buffer containing 50 mM Tris–Cl, 1%

sarcosyl, 0.25 M sucrose, 50 mM NaCl, 20 mM

EDTA (pH 8.0). PCR assays were performed with

the genomic DNA of T0 primary transformants and T1

transgenic plants using Gene Amp 9700 thermocycler

(Perkin Elmer, USA). Set of specific primers for

cry1Ac, cry1Ab and nptII genes were designed to

amplify 995, 800 and 678 bp amplicons for respective

genes as shown in Table 1. The 25 ll PCR mixture

was prepared containing 100 ng plant genomic DNA,

100 lM dNTPs mix, 25 ng of each primer, 2 mM

MgSO4 and 1 U Taq DNA polymerase (NEB, USA).

Amplification was performed with initial denaturation

at 95�C for 5 min followed by 30 cycles, each

comprising of denaturation at 94�C for 90 s, annealing

at 58�C (cry1Ac) or at 55�C (cry1Ab) for 1 min and

extension at 68�C for 3 min followed by final exten-

sion for 5 min at 68�C. Amplified DNA fragments of

PCR assays were electrophoresed on 1% agarose gels,

visualized, documented and analyzed on Gel Doc XR

(Bio-Rad, USA).

Southern blot analysis

Southern blot hybridization analysis was performed to

confirm the integration of T-DNA into transformants

according to Sambrook and Russell (2001). Approx-

imately 10 lg genomic DNA from chickpea transgenic

plants was digested overnight with SalI for transgenic

plants developed with pBIN200, while EcoRI for

transgenic plants developed with pRD400 and pCE-

C.Ac vectors, that would restrict the T-DNA at one site.

HindIII restriction of genomic DNA was performed for

transgenic plants developed with pRD401 and pCE-

C.Ab.Ac vectors that would restrict the T-DNA at two

places generating one 2.2 kb fragment bearing cry1Ab

cassette and another fragment having cry1Ac gene with

flanking genomic DNA from the transgenic plants. The

digested genomic DNA samples were electrophoresed

on 0.8% (w/v) agarose gel and transferred onto Zeta

probe GT nylon membrane (Bio-Rad, USA). The blots

were hybridized at 58�C for 24 h with a[32P] dCTP

radiolabelled probe, comprising of full-length 1.8 kb

cry1Ac and 678 bp fragment of nptII gene. The blots

were then exposed to Fuji screen for 48 h and scanned

on Molecular Imager FX (Bio-Rad, USA).

RT-PCR and quantitative real-time PCR

RT-PCR was performed with *20 ng total RNA

isolated from 100 mg fresh leaves of independent

transgenic and non-transgenic control chickpea plants

Table 1 PCR primers used for each gene and the expected size of the PCR products

Target gene Forward primer (50–30) Reverse primer (50–30) Product size (bp)

Primers for PCR and RT-PCR

cry1Ab TGGTACAACACTGGCTTGGA ATGGGATTTGGGTGATTTGA 800

cry1Ac ATTCCTGGTGCAAATTGAGC CGATTCCGCTCTTTCTGTAA 995

nptII TATTCGGCTATGACTTGGGC GCGAACGCTATGTCCTGATA 678

Primers for quantitative real-time PCR, designed by using DNASTAR software (Lasergene Inc.)

cry1Ab AAGGATTCTCCCACAGGTTG ATGGGATTTGGGTGATTTGAG 157

cry1Ac TCAGGGTGTCTACAGAACCT CGGTTCCGCTCTTTCTGTAA 155

b-actin GCTGGATTTGCTGGAGATGATGA TCCATGTCATCCCAATTGCTAAC 194

90 Euphytica (2011) 182:87–102

123

using TRI reagent (Sigma, USA). Two-step RT-PCR

was performed for cry1Ab and cry1Ac genes with

specific set of primers (Table 1) using the enhanced

avian HS RT-PCR kit (Sigma, USA). The relative

quantity of cry1Ab and cry1Ac transcripts in transgenic

chickpea plants developed with different vectors were

analysed by real-time quantitative RT-PCR. The

reactions were carried out in StepOne real-time PCR

system (Applied Biosystems, USA) using Quantifast

SYBR green RT-PCR kit (Qiagen, Germany). Chick-

pea b-actin gene was used as endogenous control in all

real-time RT-PCR. Total RNA extracted from 100 mg

of leaf tissues was reverse transcribed into cDNA and

used as template in real-time PCR with cry1Ab, cry1Ac

and b-actin gene specific primers (Table 1). Reverse

transcription reaction was performed at 50�C for

10 min and initial denatruation at 95�C for 5 min for

activation of hot-start Taq polymerase followed by 40

amplification cycles each comprising 10 s denatur-

ation at 95�C and combined annealing and extension

for 30 s at 60�C in 25 ll reaction mixture according to

manufacturer’s instructions. The specificity and iden-

tity of the reaction products were verified by agarose

gel electrophoresis and melt curve analyses. The

relative values obtained from the quantitation of

mRNA were expressed as 2-DDCt where DCt repre-

sents the difference between Ct (cycle threshold)

values of a target and the endogenous control (b-actin)

in the same sample and DDCt is the difference between

the DCt value of a particular sample and that of the

reference sample. The quantitative data of real-time

RT-PCR represent mean values and standards errors of

three independent experiments with three replicates of

the transgenic plants developed with different vectors.

Enzyme-linked immunosorbent assay (ELISA)

for quantitative estimation of Bt-toxin

Quantitative estimation of insecticidal Cry1A endo-

toxin proteins expressed by cry1Ac and cry1Ab genes

in leaves of transgenic chickpea plants was performed

by double antibody sandwich ELISA using the Cry1Ac

monoclonal antibodies (Agdia, USA). Cell-free

extracts of leaves from transgenic and control untrans-

formed plants were added into the wells of ELISA plate

pre-coated with primary monoclonal antibody and

detection of Cry1Ab and Cry1Ac toxins was monitored

with peroxidase labelled PathoScreen kit for Cry1Ab/

Cry1Ac protein according to the manufacturer’s

instructions (Agdia, USA). The optical density of the

reaction was monitored at 650 nm using Spectra Max

340PC spectrophotometer (Molecular Devices, USA).

Expression levels of Bt-toxins in transgenic plants are

shown as ng mg-1 total soluble protein (ng mg-1 TSP)

and were quantified on a linear standard curve plotted

with pure Bt-Cry protein (Agdia, USA). Each trans-

genic plant was assayed twice with three replicates and

the data was statistically analyzed.

Insect bioassays

Entomocidal activity of Cry1Ab and Cry1Ac toxins

expressed in transgenic chickpea plants harbouring

either cry1Ab, cry1Ac or both the genes were assayed

through no-choice test on detached leaflets, by larval

feeding bioassay using second instar larvae of H. ar-

migera. Larvae of H. armigera were reared on artificial

diet enriched with gram flour (Gupta et al. 2004)

followed by feeding on castor leaves to complete their

life cycle and to obtain the adult moths for egg laying.

About 200–250 mg fresh leaves of transgenic plants

were placed in plastic petri dishes on moist filter paper

and 10 neonate larvae from lab-reared moths were

infested. Plates were sealed with Parafilm to prevent

desiccation and kept in the insect rearing room at

26 ± 1�C for 16 h photoperiod and 70% relative

humidity. Feeding was allowed for 4 days with one

change of fresh leaves on alternate days and data were

taken on larval weight, percentage survival and

mortality. Each treatment was respected with three

replicates and data were analyzed statistically.

Statistical analysis

Values reported are mean ± SE of three replicates

and minimum of 40–50 CN explants and 10 insect

larvae per replicate were used in each experiment.

The data were analyzed by Bonferroni t-test using

statistical package for social sciences (SPSS).

Results

Agrobacterium-mediated transformation

and recovery of transgenic chickpea plants

Co-cultivation of total 991 cotyledonary node explants

of chickpea variety Pusa-362 with A. tumefaciens

Euphytica (2011) 182:87–102 91

123

strain LBA4404 harbouring different binary vectors

pRD400, pBIN200, pCEC.Ac, pRD401 and pCEC.A-

b.Ac shown in Fig. 1 were carried out in three different

experiments. A total of 118 T0 transgenic plants were

recovered after three cycles of kanamycin selection

and actual numbers of transgenic plants developed

with different vectors are summarized in Table 2.

Transformation frequency achieved was ranging

between 1.69 and 2.77% on the basis of total adven-

titious shoots that would have been recovered from

same number of untransformed cotyledonary nodes

(Table 2). T0 transgenic chickpea plants were suc-

cessfully grafted and grown to maturity for collection

of T1 seeds for further analysis.

Quantitative assay of Cry toxin in transgenic

chickpea plants

Quantitative assessment of Cry1A delta endotoxins in

T0 and T1 transgenic chickpea plants developed with

different binary vectors was monitored by DAS-

ELISA using cell-free extracts of leaves. The quantity

of Cry1A endotoxin amongst independent T0 trans-

genic plants developed with different cry gene con-

structs varied from 5 to 40 ng mg-1 TSP (Fig. 2).

Based on the level of toxin expression in T0 transgenic

population, the plants were categorized into three

groups; as plants expressing low (B10 ng mg-1 TSP),

moderate (10–20 ng mg-1 TSP) and high levels

(C20 ng mg-1 TSP) of delta-endotoxin (Table 2).

Interestingly, the proportion of T0 plants expressing

higher levels of endotoxin ([20–40 ng mg-1 TSP)

were high amongst the transgenic population

developed with pRD401, pCEC.Ab.Ac vectors having

both the cry genes on T-DNA as compared to single

gene transformants. The levels of endotoxin in T1

progeny of few randomly selected T0 plants was the

same or improved over the parent T0 plant and have

shown corresponding high toxicity to insects

(Table 3). The expression profile of Cry1A toxin was

monitored in various tissues like leaf, flower, pod,

developing seeds and shoots during different stages of

plant growth and development, in promising T0 plants

Table 2 Genetic transformation of chickpea with different binary vectors

Gene construct Bt-cry gene(s)a No. of

explantsbT0 plants

recovered

% Plants expressing Bt-Cry

toxin (ng mg-1 TSP)

Transformation

frequency (%)c

Low (5–10) Moderate (10–20) High (20–40)

pRD400 cry1Ac 226 22 18.18 68.18 13.68 1.86

pBIN200 cry1Ab 230 33 21.42 50.00 28.57 2.77

pRD401 cry1Ab ? cry 1Ac 315 33 15.15 48.48 36.36 1.85

pCEC.Ac cry1Ac 102 14 28.58 50.00 21.42 1.71

pCEC.Ab.Ac cry1Ab ? cry 1Ac 118 16 25.00 31.25 43.75 1.69

a Bt-cry gene driven by either CaMV35S or Pcec promoter as described in ‘‘Materials and methods’’ sectionb Total pre-conditioned CNs co-cultivated with Agrobacteriumc Transformation frequency calculated on absolute terms as described in ‘‘Materials and methods’’ section

Fig. 2 Quantitative DAS-ELISA assay (open bars) showing

Bt-Cry1A protein expression in T0 transgenic chickpea plant

population developed with five different vectors (pBIN200,

pRD400, pRD401, pCEC.Ac and pCEC.Ac.Ab) harbouring

single and pyramided Bt-cry genes driven by different

promoters. Average quantity of total Bt-Cry protein for the

transgenic population is represented as ng mg-1 TSP ± stan-

dard deviation on the top of histogram bars and also indicated

by individual points for the individual transgenic plant (filledbars). n is the number of T0 transgenic plants

92 Euphytica (2011) 182:87–102

123

and in their T1 progeny which showed consistent level

of toxin till the stage of seed setting (data not shown).

Molecular characterization of transgenic chickpea

plants

Screening of putative T0 primary transformants

initially obtained after kanamycin selection was

performed through PCR assay for cry1Ab and cry1Ac

genes and Southern hybridization analyses and finally

118 T0 transgenic chickpea plants developed with

different vectors were selected. PCR analysis of the

transformants, using set of primers for amplification

of conserved internal sequences (amplicons) specific

to cry1Ac and cry1Ab showed amplification of

expected amplicons of 995 and 800 bp for cry1Ab

and cry1Ac genes respectively which were similar to

that of positive control DNA. The results of PCR

analysis of T0 transgenic plants developed with

different vectors have shown the amplification of

expected fragments for the corresponding Bt-cry

genes whereas, no such amplicon were observed in

non-transformed control chickpea plants under iden-

tical assay conditions (Fig. 3a–p). PCR analyses of

putative T0 transgenic plants after kanamycin selec-

tion showed that 98% of the plants were positive for

cry1Ab and cry1Ac genes. The results of PCR assay

of T0 transgenic plants developed with different

vectors for the corresponding gene(s) are shown in

Fig. 3.

The Southern blot analyses of genomic DNA from

independent transgenic plants (B1–B11 and B34–44)

developed with pBIN200 vector, digested with SalI

revealed hybridization of a single DNA fragment

ranging from 3.5 to 5.2 kb in comparison to 1.8 kb in

the positive control (Fig. 3a0, b0). Genomic DNA of

T0 transgenic plants (C1 to C22) developed with

pRD400 vector following digestion with EcoRI

showed distinct hybridization signals with single

fragment of DNA ranging between 3.6 and 4.4 kb

(Fig. 3c0, d0). Southern hybridization of seven ran-

domly selected independent T0 transgenic plants

PAc1 to 4, PAc7, 8 and 10 transformed with

pCEC.Ac vector harbouring cry1Ac gene driven by

constitutive synthetic promoter Pcec showed hybrid-

ization signals with single DNA fragment ranging

from 2.0 to 3.5 kb (Fig. 3l, m). Southern blots of

HindIII digested genomic DNA of T0 transgenic

plants developed with pRD401 and pCEC.Ab.Ac

vectors for pyramiding and co-expression of cry1Ab

and cry1Ac genes showed hybridization signals with

two fragments, one for cry1Ab of consistent size

*2.2 kb and second variable size fragment ranging

between 3.2 and 3.8 kb for cry1Ac gene (Fig. 3g, h, i,

p). Results of Southern hybridization showed inser-

tion of both the cry genes mostly as single copy

integration in transgenic plant pyramided for cry1Ab

and cry1Ac.

Transcript analysis by RT-PCR and quantitative

real-time PCR

Transcription of cry1Ab and cry1Ac genes in prom-

ising T0 transgenic chickpea plants selected on

kanamycin-supplemented medium was analyzed by

RT-PCR. Results of RT-PCR analysis of few ran-

domly selected T0 transgenic chickpea plants showed

the presence of desired transcript of 800 bp for

cry1Ab and 995 bp amplicon for cry1Ac respectively

with set of gene specific primers (Fig. 3q–v). Results

of RT-PCR assay of four T0 plants namely B1, B5,

B34 and B42 developed with vector pBIN200

showed amplification of expected transcript of

800 bp for cry1Ab whereas seven T0 plants devel-

oped with vector pRD400 designated as C3, C5, C7,

C11, C15, C16 and C20 and seven T0 plants

developed with vector pCEC.Ac namely PAc1–4,

PAc7, 8 and 10 showed amplification of expected

transcript of 995 bp for cry1Ac gene (Fig. 3r, u).

Results of RT-PCR performed with four T0 trans-

genic plants co-transformed with cry1Ac and cry1Ab

genes namely BC1, BC10, BC15 and BC20 devel-

oped with vector pRD401 and 11 plants designated as

pTBC1–11 developed with vector pCEC.Ab.Ac

showed the amplification of expected transcripts for

cry1Ac and cry1Ab genes (Fig. 3s, t, v). RT-PCR

results clearly depicted the formation of mRNA for

cry1Ac and cry1Ab genes and demonstrated the

expression of stable transcripts for both the genes in

transgenic chickpea plants transformed with both the

cry genes.

The relative levels of cry gene transcripts in the

leaves of promising transgenic chickpea plants

developed with different vectors such as pBIN200,

pRD400, pRD401, pCEC.Ac and pCEC.Ab.Ac was

analysed by real-time quantitative RT-PCR using

chickpea b-actin gene (accession No. EU 529707) as

endogenous control (Fig. 4). The relative values

Euphytica (2011) 182:87–102 93

123

Table 3 Expression of Bt-toxin in T0 and T1 chickpea transgenic plants and toxicity to H. armigera larvae

T0 plant (cry toxin

ng mg-1 TSP)aBt-gene

(construct)

Damage to

plant (%)bInsect

mortality

(%)b

T1 progeny

developed

Bt toxin expression

(ng mg-1 TSP)

Damage to

plant (%)

Insect

mortality

(%)

Control – 95–100 0.00 – – – –

B2 (22 ± 1) cry1Ab(pBIN200)

56–62 44 ± 2 B2-1 20 ± 1 58–64 40 ± 2

B2-2 23 ± 2 54–58 45 ± 2

B2-3 24 ± 2 54–56 46 ± 2

B2-4 19 ± 1 58–64 40 ± 2

B10 (17 ± 1) cry1Ab(pBIN200)

65–70 34 ± 2 B10-1 18 ± 1 65–70 36 ± 2

B10-2 20 ± 2 60–64 34 ± 2

B10-3 20 ± 1 60–64 34 ± 2

B10-4 16 ± 1 66–72 36 ± 2

C4 (23 ± 1) cry1Ac(pRD400)

22–26 84 ± 2 C4-1 25 ± 2 20–22 88 ± 2

C4-2 24 ± 1 22–24 86 ± 2

C4-3 24 ± 2 22–24 86 ± 2

C6 (29 ± 1) cry1Ac(pRD400)

18–24 89 ± 2 C6-1 30 ± 1 17–19 93 ± 2

C6-2 32 ± 2 15–17 96 ± 2

C6-3 28 ± 1 18–20 92 ± 2

C17 (16 ± 1) cry1Ac(pRD400)

28–32 70 ± 2 C17-1 16 ± 1 28–30 76 ± 2

C17-2 19 ± 2 24–26 78 ± 2

C17-3 18 ± 1 24–27 78 ± 2

PAc3 (16 ± 2) cry1Ac(pCEC.Ac)

60–65 30 ± 2 PAc3-1 20 ± 1 70–75 50 ± 1

PAc3-2 18 ± 2 60–65 40 ± 1

PAc3-3 14 ± 1 45–50 28 ± 2

BC1 (15 ± 1) cry1Ab ? Ac(pRD401)

26–30 81 ± 2 BC1-1 16 ± 1 26–28 86 ± 2

BC1-2 15 ± 1 26–29 86 ± 2

BC1-3 17 ± 1 25–28 90 ± 2

BC1-4 16 ± 1 26–30 88 ± 2

BC6 (36 ± 1) cry1Ab ? Ac(pRD401)

16–20 97 ± 2 BC6-1 35 ± 2 16–18 99 ± 1

BC6-2 39 ± 2 10–12 100.0

BC6-3 40 ± 2 10–14 98 ± 1

BC6-4 26 ± 1 12–14 98 ± 1

BC6-5 29 ± 2 18–20 98 ± 1

BC18 (26 ± 1) cry1Ab ? Ac(pRD401)

20–22 94 ± 2 BC18-1 28 ± 2 18–21 98 ± 1

BC18-2 26 ± 1 20–23 96 ± 1

BC18-3 26 ± 1 16–18 97 ± 1

BC18-4 24 ± 1 16–18 96 ± 1

TBC2 (18 ± 1) cry1Ab ? Ac(pCEC.Ab.Ac)

20–24 84 ± 2 TBC2-1 19 ± 1 18–20 92 ± 2

TBC2-2 20 ± 1 17–19 89 ± 2

TBC2-3 18 ± 1 20–22 91 ± 2

TBC10 (28 ± 1) cry1Ab ? Ac(pCEC.Ab.Ac)

16–20 95 ± 2 TBC10-1 30 ± 2 16–18 98 ± 1

TBC10-2 28 ± 1 15–18 98 ± 1

TBC10-3 31 ± 2 16–19 98 ± 1

a Determined by DAS-ELISA assayb Determined by insect mortality bioassay

94 Euphytica (2011) 182:87–102

123

obtained for transcript quantitation is expressed as

2-DDCt where DCt represents the differences between

the Ct values of Cry protein transcript and b-actin

among different transgenic plants and DDCt is the

difference between the DCt values in reference to that

of pRD400. Results of comparative qRT-PCR of 11

independent transgenic chickpea plants transformed

with different vectors showed almost 2.5-fold higher

transcript formation for both cry1Ab and cry1Ac

genes in transgenic plants developed either with

pRD401 or pCEC.Ab.Ac harbouring both the genes

driven by CaMV35S promoter or combination of

CaMV35S and Pcec for cry1Ab and cry1Ac respec-

tively (Fig. 4). These results clearly showed that

pyramiding of two genes with either similar or

different promoters has increased the transcript

formation and stability as compared to transcript in

transgenic plant developed with single gene con-

structs. The relative quantitation of the cry gene

transcripts among the T0 transgenic chickpea plants

transformed with single cry gene showed enhanced

level of transcript for cry1Ac gene driven either by

CaMV35S or Pcec promoter as compared to that of

cry1Ab gene driven by CaMV35S promoter. The

quantitative transcript in transgenic plants co-trans-

formed with both the cry genes have shown corre-

sponding increase in the transcript levels of both the

genes driven either by CaMV35S, Pcec or combina-

tion of both the promoters (Fig. 4). This difference in

transcript levels among transgenic plants could be

attributed to independent event for gene integration

site rather than the type of promoter.

Inheritance analysis of cry genes in T1 progeny

T0 transgenic chickpea plants showed normal flow-

ering pattern, except that the number of flowers were

less which could be due to physiological conditions

from culture room to contained glasshouse. Number

of pods and seeds in T0 transgenic plants was very

low as compared to tissue culture raised and field

grown untransformed plants (data not shown). The

inheritance pattern of cry1A and nptII genes in the T1

progeny of primary transformants was analyzed by

germinating the seeds on kanamycin-supplemented

medium (100 mg l-1). Antibiotic screening of T1

seeds followed by PCR analysis revealed segregation

according to Mendelian ratio 3:1 (resistant: suscep-

tible, P B 0.05, v2 = 3.841) for kanamycin tolerance

(Table 3). PCR and Southern analysis of the genomic

DNA from T1 progenies of selected T0 plants showed

amplification of expected amplicons of 800 and

995 bp for cry1Ab and cry1Ac genes respectively

similar to the positive controls (Fig. 5a–c). Result of

Southern blot hybridization showed single DNA

fragments of size ranging from 4.16 to 6.57 kb

hybridizing with 1.845 kb radiolabelled cry1Ab/

c probe in T1 transgenic plants developed with

pBIN200 and pRD400 vectors harbouring individual

cry1Ab or cry1Ac gene respectively and DNA

fragments of 2.82 to 8.62 kb in transgenic plants

developed with pRD401vector for co-expressing two

cry genes. Results of Southern hybridization also

showed insertion of cry1Ab and cry1Ac genes as

single copy integrations (Fig. 5a0–c0).

Insect bioassay of transgenic plants

The T0 and T1 chickpea transgenic plants expressing

moderate to high levels of Bt-toxins (Cry1Ab and

Cry1Ac) were evaluated for entomocidal activity by

insect feeding bioassays performed with second instar

larvae of H. armigera. Leaves from 30 days old T0 and

T1 transgenic chickpea plants were fed to the larvae

and response of their feeding on weight gain, life cycle

and mortality of insect was monitored. Data of insect

bioassay on leaves of transgenic plants expressing

Cry1Ac toxin (^20 ng mg-1 TSP) showed relatively

restricted damages to leaves while caused significant

weight loss and higher mortality to larvae compared to

the plants expressing similar levels of Cry1Ab toxin

(Table 3). Larvae challenged on leaves of trans-

genic plants with higher levels of Cry1Ac toxin

([20–40 ng mg-1 TSP) showed severely retarded

growth after 2 days of feeding and significantly high

rate of mortality ([90%) as compared to leaves with

Cry1Ab toxin. The pyramided transgenic plants co-

expressing both the toxins at moderate levels

(10–20 ng mg-1 TSP) showed 80–90% mortality of

insects after 4 days of feeding and leaves of these

plants suffered very little feeding damage (Table 3;

Fig. 6) whereas, transgenic chickpea plants co-

expressing higher levels of Cry1Ab and Cry1Ac

toxins ([20 ng mg-1 TSP) showed [90–95% mor-

tality in the challenged insects after 48 h of feeding

and very little damage to leaves. Bioassays performed

with T1 progenies of few promising T0 transgenic

plants reflected similar response to insect protection

Euphytica (2011) 182:87–102 95

123

96 Euphytica (2011) 182:87–102

123

corresponding to the level of expressed toxin(s). The

ratio of plants expressing higher levels of Bt-toxin was

increased in segregating population as per Mendelian

pattern for single dominant character. The larvae

exposed on non-transformed control plants continued

to feed and showed normal development of larvae with

average length of individual larvae up to 0.6 ± 0.1 cm

and body weight of *40 mg after 4 days of feeding

(Fig. 6). Insecticidal response and protection to insect

damages was relatively higher in transgenic chickpea

plants expressing Cry1Ac than Cry1Ab with equal

levels of toxins whereas transgenic plants co-express-

ing moderate levels of both the toxins (*20 ng mg-1

TSP) showed significant protection to insect damage

and mortality of H. armigera (Table 3).

Discussion

Transgenic crop plants expressing different insecti-

cidal proteins from B. thuringiensis have shown

significant resistance to important agricultural insect

pests in addition to reduced application of synthetic

pesticides and improved yield (Perlak et al. 2001;

James 2009). However, there is always a risk that

field insects could develop resistance to these toxins

after prolonged and consistent exposure (Bates et al.

2005). Adaptation of insect resistance to insecticidal

toxins of B. thuringiensis can reduce the efficacy of

toxins and thereby the benefits of the technology.

The predominant strategy for delaying pest resistance

to Bt crops requires either refuges of non-Bt host

plants to provide susceptible insects to mate with

resistant insects or the sufficient expression of

insecticidal toxins for efficient mortality of insects

(Tabashnik et al. 2010). The most practical

approaches for sustained efficacy of Bt-transgenics

are the expression of Bt-endotoxin at high level and

weedy refugia or stacking of two or more different

cry genes into the same plant (Zhao et al. 2005; Cao

et al. 2008). Cry1Ab and Cry1Ac are two most

effective larvicidal toxins against large number of

lepidopteran insects including H. armigera, infecting

several economically important crop plants in the

Fig. 4 Relative quantitation of cry1Ab (gray bar) and cry1Ac(black bar) transcripts in T0 transformed chickpea plantlets by

real time PCR assay using Quantifast SYBR green RT-PCR

kit. C4 and C6 plants were developed with pRD 400 vector

expressing cry1Ac driven by CaMV35S promoter; pAc.3 and

pAc.10 plants were transformed with pCEC.Ac vector express-

ing cry1Ac driven by Pcec promoter; B2 and B6 plants are

developed with pBIN 200 vector expressing cry1Ab driven by

CaMV35S promoter; BC1 and BC6 plants are developed with

pRD 401 vector showing transcript formation for both cry1Aband cry1Ac genes driven by CaMV35S promoter while TBC2,

TBC 10 and TBC 11 plants are developed with pCEC.Ab.Ac

vector showing transcript formation for both cry1Ab and

cry1Ac genes driven by CaMV35S and Pcec promoters

respectively. b-actin gene of chickpea served as the internal

control

Fig. 3 Molecular characterization of T0 transgenic chickpea

plants developed with different gene constructs by PCR,

Southern and RT-PCR analyses. a, b PCR amplification of

800 bp fragment of cry1Ab gene of transgenic plants developed

with pBIN200 vector and a0, b0 Southern blotting of 22

randomly selected plants following digestion of their genomic

DNA with SalI, while lane -C and ?C are DNA from non-

transformed control plant and plasmid as positive control

respectively; c, d PCR amplification of 995 bp for cry1Ac gene

of transgenic plants developed with pRD400 vector and c0, d0

the corresponding Southern blotting after digesting the

genomic DNA with EcoRI; e, e0 and f, f0 PCR amplification

of 995 bp for cry1Ac gene and 800 bp for cry1Ab gene

respectively of transgenic plants developed with pRD401

vector and g, h, i Southern blotting of T0 transgenic chickpea

plants and the genomic DNA was digested with HindIII;

j, k PCR amplification of 995 bp for cry1Ac and 678 bp for

nptII genes in T0 transgenic plants developed with pCEC.Ac

vector; l, m Southern blotting of T0 transgenic chickpea plants

digested with EcoRI for cry1Ac and nptII genes respectively; n,

o PCR amplification of 995 bp for cry1Ac and 800 bp for

cry1Ab gene respectively of transgenic chickpea plants

developed with pCEC.Ab.Ac vector; p Southern blotting of

T0 transgenic plants and their genomic DNA was digested with

HindIII; q–v RT-PCR analyses of few randomly selected T0

transgenic plants; q for cry1Ab gene (pBIN 200); r for cry1Acgene (pRD 400); s for cry1Ab and cry1Ac genes (pRD 401);

t for cry1Ac gene (pCEC.Ac); u, v for cry1Ac and cry1Abgenes with plants transformed with pCEC.Ab.Ac vector

respectively

b

Euphytica (2011) 182:87–102 97

123

field (Cheng et al. 1998; Homrich et al. 2008). In the

present study a recalcitrant grain legume chickpea

has been transformed with modified synthetic cry1Ab

and cry1Ac genes individually as well as pyramided

(co-expression) to assess the synergistic effect of both

the genes for toxicity to susceptible insects including

pod borer. Stacking of both the modified truncated

cry1Ab and cry1Ac genes in chickpea was performed

by Agrobacterium-mediated transformation of coty-

ledonary node explant with vectors having both the

genes in one replicon. Transformation efficiency

ranging from 1.69 to 2.77% was observed for co-

transformation of both the cry genes driven by

CaMV35S promoter or by two different constitutive

promoters. The observed transformation frequencies

for two Bt-genes are comparable to that observed for

other recalcitrant plants like cotton, rice and mustard

(Perlak et al. 2001; Riaz et al. 2006; Cao et al. 2008).

Results obtained from PCR, Southern blotting and

RT-PCR analyses of transgenic chickpea plants have

clearly confirmed the stable single copy integration

without any rearrangements of cry1Ab and cry1Ac

genes in transgenic plants and also into subsequent T1

generation. The different sizes of hybridizing genomic

DNA fragments of transgenic plants with the probes

indicated that they resulted from the independent stable

T-DNA integration event into the chickpea genome

and not from endophytic Agrobacterium contamina-

tion. However, presence of the expected hybridization

signals with genomic DNA fragments ([4.5 kb) in

majority of the transformed plants with two genes

showed that the probed genes cry1Ab and cry1Ac

Fig. 5 Molecular

characterization of T1

transgenic chickpea

progenies developed with

different vectors. a, a0 PCR

amplification of cry1Abgene and corresponding

Southern blots of plants

transformed with pBIN 200

vector; b, b0 T1 plants

transformed with pRD 400

vector and c, c0 for T1 plants

transformed with pRD 401

vector harbouring both

cry1Ab and cry1Ac genes

Fig. 6 Insect bioassay performed on Bt-transgenic chickpea

plants with 2nd instar larvae of Helicoverpa armigera.

a Control untransformed chickpea plants challenged with pod

borer larvae resulted into extensive consumption of leaves and

normal growth of the larvae. b Leaf of transgenic plant

expressing low levels of Bt-Cry toxin (\10 ng mg-1 TSP).

c Leaves of transgenic plant expressing moderate levels of Bt-

Cry toxin (^10–20 ng mg-1 TSP). d Leaves of transgenic

plant expressing higher levels of Bt-Cry toxin ([20 ng mg-1

TSP) surrounded by dead larvae

98 Euphytica (2011) 182:87–102

123

remained intact when integrated into the chickpea

genome. The T0 population of primary transgenic

chickpea plants have reflected independent pattern of

transgene expression due to complex and random

integration of foreign genes in the host genome

following Agrobacterium-mediated transformation.

Therefore, inheritance of foreign genes in transgenic

plants may display complex patterns for single as well

as two genes. Results obtained from Southern blot and

RT-PCR analyses have clearly confirmed the stable

integration and segregation of cry1Ab and cry1Ac

genes in T1 generation.

Quantitative analysis of transcript expression in

transgenic chickpea plants with cry1Ab ? cry1Ac

genes, independently driven by the constitutive

CaMV35S promoter, showed simultaneous co-expres-

sion of both the transcripts as found in transgenic

chickpea plants expressing cry1Ab and cry1Ac driven

by Pcec and CaMV35S promoters respectively. These

results override the assumptions of co-suppression due

to multiple copy integration of same promoter

sequences on single T-DNA associated with low level

of transgene expression (Wang and Waterhouse 2002).

The silencing of transgene expression, however, still

seems to be a puzzling issue and dependent on several

post-transcriptional factors including copy number of

transgene(s) and position effect of T-DNA insertion

particularly in recalcitrant plant species (Olhoft et al.

2004; Butaye et al. 2005). In order to avoid possible

silencing of cry gene(s) expression in chickpea trans-

genics, co-transformed with two genes, due to co-

suppression phenomenon of copy number of the same

promoter in expression vector, we considered the

option of using Pcec a different constitutive promoter

which is earlier reported for higher expression of gusA

and gfp reporter genes compared to CaMV35S in

tobacco transgenics (Sawant et al. 2001; Chaturvedi

et al. 2006). The CaMV35S promoter contains two

major enhancer domains and five sub-domains that

synergistically confer developmental and tissue-spe-

cific expression (Benfey and Chua 1990). Whereas

multifactorial expression cassette Pcec has been

designed and developed by deploying several cis

elements and conserved motifs commonly present in

promoter region of highly expressed plant genes. The

synergistic interaction of different motifs and archi-

tecture of Pcec seems to interact better with wide range

of native gene enhancer sequences for higher expres-

sion of transgenes compared to other natural promoters

(Sawant et al. 2001, 2005). Hence, CaMV35S and Pcec

were used to develop insect resistant transgenic plants

expressing cry1Ab or cry1Ac genes alone or in

combination within the same vector for increasing

the possibility of obtaining promising transgenic

events expressing very high levels of Bt-toxin(s). Our

results of ELISA for Bt-Cry toxin in T0 transgenic

population developed with either of the cry gene or

combination of promoters have revealed variation in

cry1A gene expression in T0 population, which

reflected corresponding level of resistance to insects.

These results are consistent with earlier observations

for differential expression of Bt-endotoxins in T0

plants (Perlak et al. 1991; Nayak et al. 1997; Husnain

et al. 2002). This variation in expression of heterolo-

gous protein like Bt-endotoxin amongst population of

primary T0 transgenics may be attributed to position

effect of gene integration, flanking sequences, chro-

matin context of the locus, increase in DNA methyl-

ation with increase in plant age and physiological

changes of the foreign protein in the plant tissues

(Peach and Velten 1991; Down et al. 2001; Husnain

et al. 2002).

The maximum co-expression of Cry1Ab and

Cry1Ac toxins in transgenic chickpea was up to

40 ng mg-1 TSP, irrespective of using identical or

two different promoters. The expression level of Bt-

toxins in the present study was higher than earlier

reports for other large-seeded grain legumes (Parrott

et al. 1994; Stewart et al. 1996; Sanyal et al. 2005)

except for transgenic peanut plants where expression

of Cry1A(c) protein up to 0.18% of TSP has been

documented (Singsit et al. 1997). High-level expres-

sion of Cry protein in transgenic chickpea co-

expressing both the genes may be attributed to some

or all the possible options such as specific modifica-

tions and codon optimization of the cry genes for

dicot plants, use of constitutive promoters, simulta-

neous co-expression of both the genes, AMV 50 UTR

element, optimum translation initiation and to the

integration of the transgene into transcriptionally

active region of the host genome (Sardana et al. 1996;

Cheng et al. 1998). The modified cry1Ab and cry1Ac

genes were designed for improved mRNA stability,

codon optimization for dicots, removal of polyade-

nylation sites, splicing sequences and optimization of

ATG consensus flanking nucleotides for proper

translation initiation (Perlak et al. 1991; Sardana

et al. 1996). The modified Bt-cry genes have been

Euphytica (2011) 182:87–102 99

123

extensively used for genetic transformation and

expression of insect-resistant trait in several plant

species (Ferry et al. 2004; Riaz et al. 2006). However,

the efficiency of Agrobacterium-mediated transfor-

mation and recovery of transgenics of grain legumes

are restricted due to several inherent limitations

including their complex genome (Eapen 2008; Dita

et al. 2006). To achieve higher expression of Cry

toxins we have used the multifactorial synthetic

expression cassette Pcec along with CaMV35S. The

designing of Pcec has several positive regulatory

elements and conserved motifs and has shown several

folds increased expression of gusA transgene in

tobacco and cotton compared to CaMV35S (Sawant

et al. 2001, 2005). Although we could not recover the

transgenic event of chickpea expressing very high-

level of Bt toxins from modified cry genes driven

either by CaMV35S, Pcec or their combinations but

we have obtained relatively high proportion of T0

transgenic plants with increased level of Cry1A

toxins ([20 ng mg -1 soluble protein) at population

level with combination of these promoters. The

overall performance of the synthetic expression

module Pcec in chickpea is comparable to CaMV35S

and our results are similar to earlier reports where

transcription factors binding to known sequence

motifs resulted in higher level of transgene expres-

sion (Rushton et al. 2002; Bhullar et al. 2003). The

wide range of cry gene expression in T0 transgenic

population of chickpea developed with different gene

constructs may be due to integration of the transgenes

at different positions in the genome of independently

selected event plants (Peach and Velten 1991; Perlak

et al. 2001). However, we could not obtain T0

transgenic chickpea event expressing higher Cry

toxin as ([1.0% of TSP) reported earlier for trans-

genic tobacco, maize, rice, cotton and tomato (Perlak

et al. 2001; James 2009). This suggests screening of a

larger population of primary transformants for

obtaining an event with higher expression of Bt-

toxin in recalcitrant plant species particularly the

grain legumes (Somers et al. 2003).

Entomocidal analysis and assessment of toxicity to

H. armigera have demonstrated that transgenic

chickpea plants co-expressing both the genes have

reflected higher toxicity and protection to insects as

compared to plants expressing single cry1Ab or

cry1Ac gene at relatively higher levels. Transgenic

chickpea plants harbouring both the genes have

reflected significant mortality ([95%) to second

instar larvae of H. armigera at toxin levels of

15 ng mg-1 TSP while plants expressing cry1Ac

gene could result similar toxicity at much higher

levels of expression ([22–25 ng mg-1 TSP). The

combined expression of Cry1Ab and Cry1Ac toxins

not only preserving the effectiveness of Bt-transgen-

ics for delaying the evolution of resistance but also

develop a more effective plant protection strategy

against the major Lepidopteran insect pests due to

combined synergistic action of two toxins, as

reported earlier (Zhao et al. 2005; Cao et al. 2008).

It is suggested that Cry1Ab and Cry1Ac bind to a

common receptor in H. armigera, but use different

epitopes and vary in their binding affinity to BBMV of

target insect, therefore co-expression of both the toxins

in same plant is complementary to enhance the

protection against H. armigera and delaying the

development of resistance in heterogenous field pop-

ulation of lepidopteran insects (Ferre and Van Rie

2002; Estela et al. 2004; James 2009). Therefore,

synergetic response of Cry1Ab and Cry1Ac toxins in

transgenic chickpea has reflected better and sustain-

able protection even at moderate level of expression

against the pod borer H. armigera and expected to

provide enhanced protection against several lepidop-

teran insects attacking the immature pods and foliage

of chickpea as reported earlier for pyramiding of

different Bt-cry genes (Maqbool et al. 2001; Zhao et al.

2003). In summary, we have reported the development

of stable transgenic plants of recalcitrant grain legume

chickpea expressing pyramided modified cry1Ab and

1Ac genes that are segregating in Mendelian fashion.

These transgenic plants have shown relatively better

and effective protection against H. armigera and

potential to delay the development of resistance in

target insect population more effectively than the

plants expressing the single cry gene.

Acknowledgments The authors are grateful to Director,

National Botanical Research Institute, Lucknow, India for

laboratory facilities. Thanks are due to Dr. Samir Sawant,

Scientist, National Botanical Research Institute, Lucknow,

India for providing the synthetic constitutive promoter Pcecand Prof. I. Altosaar, University of Ottawa, Canada for

providing modified synthetic truncated Bt-cry1Ab and cry1Acgenes. We thank Mr.S. M. H.Abidi for insect rearing and

bioassay studies. We acknowledge Council of Scientific and

Industrial Research, New Delhi for financial support and

fellowships to MM and AKS. This work was carried out under

the CSIR Network Project NWP003.

100 Euphytica (2011) 182:87–102

123

References

Ahmad F, Slinkard AE, Scoles GJ (1988) Investigations into

the barrier(s) to inter-specific hybridization between Cicerarietinum L. and eight other annual Cicer species. Plant

Breed 100:193–198

Bates SL, Zhao J, Roush RT, Shelton AM (2005) Insect

resistance management in GM crops: past, present and

future. Nat Biotech 23:57–62

Benfey PN, Chua N-H (1990) The cauliflower mosaic virus

35S promoter: combinatorial regulation of transcription in

plants. Science 250:959–966

Bhullar S, Chakravarthy S, Advani S, Datta S, Pental D, Burma

PK (2003) Strategies for development of functionally

equivalent promoters with minimum sequence homology

for transgene expression in plants: cis-elements in a novel

DNA context versus domain swapping. Plant Physiol

132:988–998

Butaye KMJ, Cammue BPA, Delaure SL, DeBolle MFC

(2005) Approaches to minimize variation of transgene

expression in plants. Mol Breed 16:79–91

Cao J, Shelton AM, Earle ED (2008) Sequential transformation

to pyramid two Bt genes in vegetable Indian mustard

(Brassica juncea L.) and its potential for control of dia-

mondback moth larvae. Plant Cell Rep 27:479–487

Chaturvedi CP, Sawant SV, Kiran K, Mehrotra R, Lodhi N,

Ansari SA, Tuli R (2006) Analysis of polarity in the

expression from a multifactorial bidirectional promoter

designed for high-level expression of transgenes in plants.

J Biotech 123:1–12

Cheng X, Sardana R, Kaplan H, Altosaar I (1998) Agro-bacterium-transformed rice plants expressing synthetic

cry1Ab and cry1Ac gene are highly toxic to striped stem

borer and yellow stem borer. Proc Natl Acad Sci USA

95:2767–2772

Christou P, Capell T, Kohli A, Gatehouse JA, Gatehouse AMR

(2006) Recent developments and future prospects in insect

pest control in transgenic crops. Trends Plant Sci 11:302–308

Dita MA, Rispail N, Prats E, Rubiales D, Singh KB (2006)

Biotechnology approaches to overcome biotic and abiotic

stress constraints in legumes. Euphytica 147:1–24

Down RE, Ford L, Bedford SJ, Gatehouse LN, Newell C,

Gatehouse JA, Gatehouse AMR (2001) Influence of plant

development and environment on transgene expression in

potato and consequences for insect resistance. Transgenic

Res 10:223–236

Eapen S (2008) Advances in development of transgenic pulse

crops. Biotech Adv 26:162–168

Estela A, Eschriche B, Ferre J (2004) Interaction of Bacillusthuringiensis toxins with larval midgut binding sites of

Helicoverpa armigera (Lepidoptera:Noctuidae). Appl

Environ Microbiol 70:1378–1384

Ferre J, Van Rie J (2002) Biochemistry and genetics of insect

resistance to Bacillus thuringiensis. Ann Rev Entomol

47:501–533

Ferry N, Edwards MG, Mulligan EA, Emami K, Petrova AS,

Frantescu M, Davison GM, Gatehouse AMR (2004)

Engineering resistance to insect pests. In: Christou P, Klee

H (eds) Handbook of plant biotechnology. John Wiley and

Sons Ltd, New York, pp 373–394

Gatehouse JA (2008) Biotechnological prospects for engi-

neering insect-resistant plants. Plant Physiol 146:881–887

Gunning RV, Dang HT, Kemp FC, Nicholson IC, Moores GD

(2005) New resistance mechanism in Helicoverpa armi-gera threatens transgenic crops expressing Bacillus thur-ingiensis Cry1Ac toxin. Appl Environ Microbiol

71:2558–2563

Gupta GP, Birah A, Ravi S (2004) Development of artificial

diet for mass rearing of American bollworms (Heli-coverpa armigera). Indian J Agri Sci 74:548–557

Hennegan KP, Danna KJ (1998) pBIN20: an improved binary

vector for Agrobacterium-mediated transformation. Plant

Mol Biol Rep 16:129–131

Hoekema A, Hirsch PR, Hooykaas PJJ, Schilperoort RA (1983)

A binary plant vector strategy based on separation of vir-

and T-region of the Agrobacterium tumefaciens Ti-plas-

mid. Nature 303:179–180

Homrich MS, Passaglia LMP, Pereira JF et al (2008) Resis-

tance to Anticarsia gemmatalis Hubner (Lepidoptera,

Noctuidae) in transgenic soybean [Glycine max (L.)

Merrill Fabales, Fabaceae] cultivar IAS5 expressing a

modified Cry1Ac endotoxin. Genet Mol Biol 31:522–531

Husnain T, Jan A, Maqbool SB, Datta SK, Riazuddin S (2002)

Variability in expression of insecticidal cry1Ab gene in

Indica basmati rice. Euphytica 128:121–128

James C (2009) Global status of commercialized biotech/GM

crops: briefs 41. ISAAA publication, Ithaca, New York

Maqbool SB, Riazuddin S, Loc NT, Gatehouse AMR, Gate-

house JA, Christou P (2001) Expression of multiple

insecticidal genes confers broad resistance against a range

of different rice pests. Mol Breed 7:85–93

Murashige T, Skoog F (1962) A revised medium for rapid

growth and bioassay with tobacco tissue cultures. Physiol

Plant 15:473–479

Nayak P, Basu D, Das S, Basu A, Ghosh D, Ramakrishnan NA,

Ghosh M, Sen SK (1997) Transgenic elite indica rice

plants expressing Cry1Ac d-endotoxin of Bacillus thur-ingiensis are resistant against yellow stem borer (Scrip-ophaga incertulas). Proc Natl Acad Sci USA 94:

2111–2116

Olhoft PM, Flagel LE, Somers DA (2004) T-DNA locus

structure in a large population of soybean plants trans-

formed using the Agrobacterium-mediated cotyledonary-

node method. Plant Biotech J 2:289–300

Parrott WA, All JN, Adang MJ, Bailey MA, Boerma HR,

Stewart CN Jr (1994) Recovery and evaluation of soybean

plants transgenic for a Bacillus thuringiensis var. kurstaki.insecticidal gene. In Vitro Cell Dev Biol Plant 30:

144–149

Peach C, Velten J (1991) Transgene expression variability

(position effect) of CAT and GUS reporter genes driven

by linked divergent T-DNA promoters. Plant Mol Biol

17:49–60

Perlak FJ, Fuchs RL, Dean DA, McPherson SL, Fischoff DA

(1991) Modification of the coding sequence enhances

plant expression of insect control protein genes. Proc Natl

Acad Sci USA 88:3324–3328

Perlak FJ, Oppenhuizen M, Gustafson K, Voth K, Sivasupr-

amaniam S, Heering D, Carey B, Ihrig RA, Roberts JK

(2001) Development and commercial use of Bollgard

Euphytica (2011) 182:87–102 101

123

cotton in the USA-early promises versus today’s reality.

Plant J 27:489–501

Popelka JC, Terryn N, Higgins TJV (2004) Gene technology

for grain legumes: can it contribute to the food challenge

in developing countries. Plant Sci 167:195–206

Riaz N, Husnain T, Fatima T, Makhdoom R, Bashir K, Masson

L, Altosaar I, Riazuddin S (2006) Development of indica

basmati rice harboring two insecticidal genes for sus-

tainable resistance against lepidopteran insects. South

African J Bot 72:217–223

Romeis J, Sharma HC, Sharma KK, Das S, Sarmah BK (2004)

The potential of transgenic chickpeas for pest control and

possible effects on non-target arthropods. Crop Prot

23:923–938

Rushton PJ, Reinstadler A, Lipka V, Lippok B, Somssich IE

(2002) Synthetic plant promoters containing defined reg-

ulatory elements provide novel insights into pathogen and

wound induced signaling. Plant Cell 14:749–762

Sambrook J, Russell DW (2001) Molecular cloning: a labora-

tory manual, 3rd edn. Cold Spring Harbor Press, NY

Sanyal I, Singh AK, Amla DV (2003) Agrobacterium tum-efaciens-mediated transformation of chickpea (Cicer ari-etinum L.) using mature embryo axes and cotyledonary

nodes. Indian J Biotech 2:524–532

Sanyal I, Singh AK, Kaushik M, Amla DV (2005) Agrobac-terium-mediated transformation of chickpea (Cicer ariet-inum L.) with Bacillus thuringiensis cry1Ac gene for

resistance against pod borer insect Helicoverpa armigera.

Plant Sci 168:1135–1146

Sardana R, Dukiandjiev S, Giband M, Cheng X, Cowan K,

Sauder C, Altosaar I (1996) Construction and rapid testing

of synthetic and modified toxin gene sequences CryIA (b

& c) by expression in maize endosperm culture. Plant Cell

Rep 15:677–681

Sawant S, Singh PK, Madanala R, Tuli R (2001) Designing of

an artificial expression cassette for the high-level

expression of transgenes in plants. Theor Appl Genet

102:635–644

Sawant SV, Kiran K, Mehrotra R, Chaturvedi CP, Ansari SA,

Singh P, Lodhi N, Tuli R (2005) A variety of synergistic

and antagonistic interactions mediated by cis-acting DNA

motifs regulate gene expression in plant cells and modu-

late stability of the transcription complex formed on a

basal promoter. J Exp Bot 56:2345–2353

Singsit C, Adang MJ, Lynch RE, Anderson WF, Wang A,

Cardineau G, Ozias-Akins P (1997) Expression of a

Bacillus thuringiensis cry1A(c) gene in transgenic peanut

plants and its efficacy against lesser cornstalk borer.

Transgenic Res 6:169–176

Somers DA, Samac DA, Olhoft PM (2003) Recent advances in

legume transformation. Plant Physiol 131:892–899

Stewart CN Jr, Adang MJ, All JN, Boerma HR, Cardineau G,

Tucker D, Parrott WA (1996) Genetic transformation,

recovery, and characterization of fertile soybean trans-

genic for a synthetic Bacillus thuringiensis cryIAc gene.

Plant Physiol 112:121–129

Tabashnik BE, Sisterson MS, Ellsworth PC, Dennehy TJ,

Antilla L, Liesner L, Whitlow M, Staten RT, Fabrick JA,

Unnithan GC, Yelich AJ, Ellers-Kirk C, Harpold VS, Li

X, Carriere Y (2010) Suppressing resistance to Bt cotton

with sterile insect release. Nature Biotech 28:1304–1307

Van Rheenen HR, Pundir RPS, Miranda JH (1993) How to

accelerate the genetic improvement of a recalcitrant crop

species such as chickpea. Curr Sci 654:414–417

Wang MB, Waterhouse PM (2002) Application of gene

silencing in plants. Curr Opin Plant Biol 5:146–150

Zhao J-Z, Cao J, Li Y, Collins HL, Roush RT, Earle ED,

Shelton AM (2003) Transgenic plants expressing two

Bacillus thuringiensis toxins delay insect resistance evo-

lution. Nature Biotech 21:1493–1497

Zhao J-Z, Cao J, Collins HL, Bates SL, Roush RT, Earle ED,

Shelton AM (2005) Concurrent use of transgenic plants

expressing a single and two Bacillus thuringiensis genes

speeds insect adaptation to pyramided plants. Proc Natl

Acad Sci USA 102:8426–8430

102 Euphytica (2011) 182:87–102

123