c-Jun and Hypoxia-Inducible Factor 1 Functionally Cooperate in Hypoxia-Induced Gene Transcription

MOLECULAR AND CELLULAR BIOLOGY,0270-7306/02/$04.00�0 DOI: 10.1128/MCB.22.1.12–22.2002

Jan. 2002, p. 12–22 Vol. 22, No. 1

Copyright © 2002, American Society for Microbiology. All Rights Reserved.

c-Jun and Hypoxia-Inducible Factor 1 Functionally Cooperatein Hypoxia-Induced Gene Transcription

Arantzazu Alfranca, M. Dolores Gutierrez, Alicia Vara, Julian Aragones, Felipe Vidal,and Manuel O. Landazuri*

Servicio de Inmunologıa, Hospital de la Princesa, Universidad Autonoma de Madrid, 28006 Madrid, Spain

Received 2 August 2001/Accepted 20 September 2001

Under low-oxygen conditions, cells develop an adaptive program that leads to the induction of several genes,which are transcriptionally regulated by hypoxia-inducible factor 1 (HIF-1). On the other hand, there are otherfactors which modulate the HIF-1-mediated induction of some genes by binding to cis-acting motifs present intheir promoters. Here, we show that c-Jun functionally cooperates with HIF-1 transcriptional activity indifferent cell types. Interestingly, a dominant-negative mutant of c-Jun which lacks its transactivation domainpartially inhibits HIF-1-mediated transcription. This cooperative effect is not due to an increase in the nuclearamount of the HIF-1� subunit, nor does it require direct binding of c-Jun to DNA. c-Jun and HIF-1� are ableto associate in vivo but not in vitro, suggesting that this interaction involves the participation of additionalproteins and/or a posttranslational modification of these factors. In this context, hypoxia induces phosphor-ylation of c-Jun at Ser63 in endothelial cells. This process is involved in its cooperative effect, since specificblockade of the JNK pathway and mutation of c-Jun at Ser63 and Ser73 impair its functional cooperation withHIF-1. The functional interplay between c-Jun and HIF-1 provides a novel insight into the regulation of somegenes, such as the one for VEGF, which is a key regulator of tumor angiogenesis.

Tissue oxygen tension is an essential regulatory factor inmany physiological as well as pathological processes. Underlow-oxygen conditions, cells develop a series of adaptive re-sponses, including changes in their patterns of gene expression.Thus, hypoxia has been shown to induce the expression oferythropoietin (45), VEGF (15), tyrosine hydroxylase (37),transferrin receptor (50), glycolytic enzymes and glucose trans-porters (46), LDH A (14), and others.

The expression of the genes for most of these proteins istranscriptionally regulated by hypoxia-inducible factor 1 (HIF-1). HIF-1 is a heterodimer comprising � and � (also calledARNT) subunits, which belong to the bHLH PAS family oftranscription factors (23). Both HIF-1� and HIF-1� mRNAsare constitutively transcribed; the HIF-1� protein level is notmodified by oxygen tension, whereas HIF-1� protein is rapidlydegraded by the proteasome under normoxic conditions (42) ina process in which the VHL tumor supressor protein is directlyinvolved (32). The mechanism for HIF-1� stabilization by hyp-oxia is beginning to be elucidated. In this regard, it has beenreported that prolyl hydroxilation in normoxia targets HIF-1�for VHL-mediated degradation (19, 21). Phosphatidic acidproduction is involved in HIF-1� stabilization (1), and hy-poxia-induced generation of reactive species at mitochondriahas also been shown to participate in this process, though thisis currently a controversial issue (10, 48, 54). HIF-1� translo-cates into the nucleus, where it dimerizes with the � subunitand binds to cognate sequences in the regulatory regions of itstarget genes (the hypoxia response element [HRE]). HIF-1binding to DNA and transcriptional activity have been pro-

posed to be regulated by phosphorylation. In this regard, it hasrecently been shown that HIF-1 is a substrate for p42 mitogen-activated protein kinase (39). In addition, the p300 transcrip-tional coactivator has been shown to associate with HIF-1 andseems to be essential for its transcriptional activity (2, 24).HIF-1 has been demonstrated to be crucial in tumor angio-genesis and embryonic vascularization (8, 20, 31, 41), processesin which endothelial cells play a key role, since they are able toform new vascular structures upon stimulation by proangio-genic factors, such as VEGF (47).

Low oxygen tension has also been shown to induce theexpression of several AP-1 proteins, including c-Jun, JunB, andc-Fos (3), and it modulates their DNA binding activity in somecases (4, 59). On the other hand, members of the AP-1 familyof transcription factors bind to cis-acting elements present inthe promoters of the VEGF, tyrosine hydroxylase, and endo-thelin-1 genes, where they potentiate their HIF-1-mediatedhypoxic induction (12, 37, 58). This seems to be a recurrentfeature in hypoxia-regulated genes, since ATF/CREB proteinsbind constitutively to the HIF-1 consensus sequence in theEPO 3� enhancer (27) and have been shown to cooperate withHIF-1 in the induction of the lactate dehydrogenase A gene(14). IRF-1 and HIF-1 can also cooperate in the induction ofthe NOS2 gene in macrophages (51).

c-Jun is a member of the basic region-leucine zipper (bLZ)family of transcription factors. This protein can form a varietyof dimeric complexes with other bLZ factors, such as Jun-Junand Jun-Fos dimers (which recognize AP-1 sites), as well asJun-ATF dimers (which bind CRE-like sequences) (17). c-Junhas also been shown to associate with and enhance the tran-scriptional activity of other transcription factors, such as p65,Sp1, and PU.1 (6, 25, 49). In addition, several proteins, includ-ing Rb and members of the Smad family, are able to interact

* Corresponding author. Mailing address: Servicio de Inmunologıa,Hospital de la Princesa, Diego de Leon 62, 28006 Madrid, Spain.Phone: 34-91-5202662. Fax: 34-91-5202374. E-mail: [email protected].

12

on January 1, 2015 by guesthttp://m

cb.asm.org/

Dow

nloaded from

http://mcb.asm.org/

with c-Jun and potentiate AP-1-dependent transcription (36,62).

c-Jun is involved in many cellular processes, including pro-liferation, transformation, differentiation, apoptosis, and stress-adaptive responses (53, 57). This transcription factor is regu-lated by different extracellular stimuli, such as growth factors,cytokines, heat shock, oxidative and osmotic stresses, and UVirradiation, which can act through transcriptional and posttran-scriptional mechanisms. In this regard, the phosphorylation ofc-Jun at Ser63 and Ser73 by kinases of the JNK/SAPK familyincreases its DNA binding and transcriptional activity and con-tributes to the stability of this factor (18, 35). Among the varietyof stimuli which can regulate the JNK pathway, hypoxia and/orreoxygenation have been described as activating some of thesekinases; however, this effect seems to depend largely on the celltype and the degree of oxygen deprivation (29, 34, 44).

In this report, we show that the c-Jun transcription factorfunctionally cooperates with HIF-1, potentiating its transcrip-tional activity. This effect is not mediated by an increase inHIF-1 nuclear protein content and does not depend on directbinding of c-Jun to DNA. On the other hand, c-Jun and HIF-1associate with each other in vivo, and this interaction probablyrequires an additional protein or a posttranslational modifica-tion of these factors. In addition, we have found that phosphor-ylation of c-Jun at Ser63 by JNK in hypoxia seems to be in-volved in the transcriptional cooperation between thesefactors.

MATERIALS AND METHODS

Cell cultures and hypoxic conditions. Human umbilical vein cells (HUVEC)were isolated from normal human umbilical cord veins. The umbilical vein wascannulated and incubated with 1% collagenase for 15 min at 37°C. Followingremoval of the collagenase, cells were pooled and established as primary culturesin medium 199 (Biowhittaker, Walterville, Md.) containing 20% fetal calf serum(FCS). HUVEC were serially passaged and maintained using medium 199 sup-plemented with 20% FCS, 50 �g of bovine brain extract/ml, and 100 �g ofheparin (Sigma, St. Louis, Mo.)/ml in tissue culture dishes precoated with 0.5%gelatin. The cells were used within the first three passages. The human dermalmicrovascular endothelial cell line HMEC-1 was kindly provided by E. W. Adesand T. J. Lawly (Centers for Disease Control and Prevention and Emory Uni-versity School of Medicine, Atlanta, Ga.). HMEC-1 cells were grown in MCDB131 medium (Life Technologies, Paisley, Scotland) supplemented with 20% FCS,10 ng of epidermal growth factor (Promega, Madison, Wis.)/ml, and 1 mg ofhydrocortisone (Sigma)/ml. The F9 murine teratocarcinoma cell line was main-tained in Dulbecco’s modified Eagle’s medium (Biochrom KG, Berlin, Germany)supplemented with 10% FCS, and COS-7 cells were cultured in RPMI 1640 (LifeTechnologies) with 10% FCS. The murine hepatoma Hepa-1c1c7 cell line andmutant Hepa-1c4 cells were a gift of O. Hankinson (Department of Pathologyand Laboratory Medicine, UCLA Medical Center, Los Angeles, Calif.), andwere grown in minimal essential medium alpha (Life Technologies) supple-mented with 10% FCS.

To achieve a hypoxic atmosphere, cells were placed in an airtight chamber,infused with a mixture of 1% O2–5% CO2–94% N2 (S. E. Carburos MetalicosS.A., Madrid, Spain) for 30 min and then cultured under these conditions fordifferent periods of time.

Plasmids. To generate the p1HIF1Luc and p9HIF1Luc reporter plasmids, oneor nine copies, respectively, of an oligonucleotide corresponding to the HIF-1binding sequence located between the �984 and �950 positions of the 5� humanVEGF gene promoter (�984 ccacagtgcaTACGTGGGctccaacaggtcctctt �950;the core HIF-1 binding sequence is in capital letters) were cloned in front of therat prolactin minimal promoter, followed by the luciferase cDNA. p1HIF1mLucwas generated as described above, but the oligonucleotide sequence was 5�ccacagtgcaTAAAAGGGctccaacaggtcctctt 3� (mutated bases at the HIF-1 bind-ing site are underlined). pcDNA3�1 and pARNT were kindly provided by E.Huang (Brigham and Women’s Hospital, Harvard Medical School, Boston,Mass.). pRSV c-Jun was a gift of P. Angel (Deutsches Krebsforschungszentrum,

Heidelberg, Germany). pKBF-Luc and 2XAP1 Luc were kindly provided by A.Israel (Institut Pasteur, Paris, France) and M. Rincon (Yale University School ofMedicine, New Haven, Conn.), respectively. The human NFATc expressionvector pSH107c was a gift of G. R. Crabtree (Howard Hughes Medical Institute,Stanford University School of Medicine, Palo Alto, Calif.). pCMV TAM67 andpcDNA3-Flag-JBD (JIP1) were kindly provided by R. Pope (Department ofMedicine, Northwestern University Medical School, Chicago, Ill.) and PuraMunoz (Institut de Reserca Oncologica, Barcelona, Spain), respectively. pRSVc-Jun S63A/S73A was a gift of M. Karin (Department of Pharmacology, Uni-versity of California).

Transfections and analysis of luciferase activity. In transient-transfection ex-periments, 1.75 � 105 F9 cells were plated on 35-mm-diameter culture dishes andgrown overnight. Then, the cells were transfected in OPTI-MEM medium (LifeTechnologies) containing 7.8 �g of Lipofectin (Life Technologies), 0.5 �g of thedifferent reporter plasmids, and 1 �g of each expression vector or empty controlplasmid to a total DNA amount of 2.6 �g. Transfection efficiency was normalizedby cotransfection of Renilla expression vector. After 5 h, the Lipofectin-contain-ing medium was removed, and the cells were incubated in normoxia (21% O2) orhypoxia (1% O2) for 12 h. Then, the cells were lysed, and luciferase activity wasmeasured and normalized using the Dual-Luciferase Reporter assay system(Promega) with a Lumat LB9501 luminometer (Berthold, Wildbad, Germany).HMEC-1, Hepa-1c1c7, and Hepa-1c4 cells were plated at near confluence on24-well culture plates and transfected in Dulbecco’s modified Eagle’s medium–10% fetal bovine serum using a standard calcium phosphate method. Theamounts of the different reporter plasmids were 0.2 �g for HMEC-1 and 0.25 �gfor Hepa cells, and 0.2 (HMEC-1 cells) or 0.5 �g (Hepa cells) of each expressionvector or empty control plasmid was used. After 8 h in the presence of DNAprecipitates, the cells were washed with phosphate-buffered saline and culturedin fresh medium for 16 h. The transfected cells were then cultured in normoxiaor hypoxia for 8 h and processed as for F9 cells. COS-7 cells were electroporated(960 �F; 200 V) with 8 �g of each expression vector or control empty vector andcarrier DNA to a total amount of 25 �g per 107 cells. After 40 h, the cells wereincubated in normoxia or hypoxia for 5 h, and nuclear extracts were obtained.Transfection efficiency was estimated by cotransfecting the pEGFP-C1 plasmid(Clontech, Palo Alto, Calif.) and analyzing the percentage of positive cells byflow cytometry.

Expression of proteins in vitro. Expression of proteins in vitro was performedusing the coupled in vitro transcription-translation system (TNT) (Promega)according to the manufacturer’s instructions. In some cases, in vitro-expressedproteins were labeled by including [35S]methionine in the TNT reaction mixture.

Nuclear extracts. After different treatments, nuclear extracts were preparedaccording to a procedure described elsewhere (1) with some modifications.Briefly, cell plates were washed once with ice-cold phosphate-buffered saline andincubated with 1 ml of buffer A (10 mM HEPES [pH 7.3], 10 mM KCl, 0.1 mMEDTA, 0.75 mM spermidine, 0.15 mM spermine, 1 mM dithiothreitol [DTT], 0.5mM phenylmethylsulfonyl fluoride [PMSF], 10 mM Na2MoO4, 1 �g of pepstatin/ml, 6 �g of aprotinin/ml, and 3 �g of leupeptin/ml) on an orbital platform. Then62.5 �l of Nonidet P-40 (10%) was added, and the cell nuclei were harvested witha cell scraper and collected by centrifugation for 30 s at 14,000 � g. The nuclearpellet was washed twice with buffer A, and then nuclear protein was extractedwith 25 to 30 �l of buffer C (20 mM HEPES [pH 7.3], 400 mM NaCl, 1 mMEDTA, 1 mM DTT, 0.5 mM PMSF, 10 mM Na2MoO4, 1 �g of pepstatin/ml, 6�g of aprotinin/ml, and 3 �g of leupeptin/ml). After 30 min on a rocking platformand further centrifugation at 14,000 � g for 10 min, the supernatants werecollected and stored at �80°C. All steps were performed on ice or at 4°C.Nuclear extract protein concentrations were determined by Bradford assay.

Electrophoretic mobility shift assays. Nuclear extracts (3 �g per lane) or invitro-translated proteins were incubated with 0.5 �g of poly(dI-dC), 100 ng ofcalf thymus DNA, and 2.5 �l of 5� DNA binding buffer (50 mM Tris buffer [pH7.5], 130 mM KCl, 5 mM MgCl2, 2.5 mM ZnCl2, 25 mM DTT, 5 mM EDTA,25% [vol/vol] glycerol) for 10 min at room temperature. For supershift assays, wegenerated a polyclonal antibody raised against the first 13 amino acids of thehuman HIF-1� protein following standard methods; 1 �l of this antibody orpolyclonal antibodies against c-Jun (D) and c-Fos (K-25) (Santa Cruz Biotech-nology, Santa Cruz, Calif.) was added to the binding reaction and incubated for10 min. Next, 0.5 to 1 ng of avian myeloblastosis virus reverse transcriptase(Promega) 32P-labeled double-stranded oligonucleotide were added. After 15min of incubation at room temperature, DNA-protein complexes were resolvedby electrophoresis on a 4% nondenaturing polyacrylamide gel in 0.5� Tris-borate-EDTA buffer. The sequences of the oligonucleotides used as probes inthese assays were as follows (5� to 3�; HIF-1 and AP-1 consensus binding sites areunderlined): TCGACCACAGTGCATACGTGGGCTCCAACAGGTCCTCTTCand its complementary strand (the nucleotides spanning from �984 to �950 of

VOL. 22, 2002 c-Jun AND HIF-1 FUNCTIONAL COOPERATION 13


cb.asm.org/

Dow

nloaded from

http://mcb.asm.org/

the human VEGF 5� gene promoter), and GCCCCCTCTGACTCATGCTGACA and its complementary strand (nucleotides �68 to �46 of the CD11c genepromoter).

Western blot and immunoprecipitation assays. For Western blot experiments,10 to 20 �g of protein per lane was resolved by sodium dodecyl sulfate-polyac-rylamide gel electrophoresis (SDS-PAGE) and transferred to nitrocellulosemembranes. The membranes were probed with anti-HIF-1� (Transduction Lab-oratories, Lexington, Ky.), anti-c-Jun (D or H-79; Santa Cruz Biotechnology), oranti-phospho c-Jun (KM-1; Santa Cruz Biotechnology) antibody. Immunoreac-tive bands were detected by an enhanced chemiluminiscent substrate (Supersig-nal; Pierce, Rockford, Ill.). For immunoprecipitation assays, COS-7 cells weretransfected as described above, and nuclei were extracted and lysed at 4°C in lysisbuffer (50 mM Tris-HCl [pH 7.5], 150 mM NaCl, 1 mM EDTA, 2.5 mM EGTA,0.2% NP-40, 1 mM DTT, 10 mM �-glycerophosphate, 1 mM sodium vanadate,1 mM NaF, 1 mM PMSF, and 1 mg each of aprotinin, leupeptin, and pepstatin/ml). The lysates were precleared with rabbit preimmune serum for 30 min at 4°Cand then incubated with either anti-HIF-1�, anti c-Jun (D or H-79), or controlpolyclonal antibodies coupled to protein A-Sepharose (Amersham PharmaciaBiotech, Uppsala, Sweden) for 3 h at 4°C. After being washed, immunocom-plexes were resolved by SDS-PAGE, transferred to nitrocellulose membranes,and blotted with anti-HIF-1� or anti-c-Jun monoclonal antibody (TransductionLaboratories). As a control, aliquots of cell lysates were subjected to directimmunoblotting. In some cases, in vitro-translated, [35S]methionine-labeled pro-teins were immunoprecipitated as described above, and immunocomplexes wereresolved by SDS-PAGE and detected by autoradiography.

Statistical analysis. Experimental data were analyzed by the analysis of vari-ance test followed by the Newman-Keuls test; the P values obtained are indicatedin the text and/or in the figure legends when statistically significant.

RESULTS

c-Jun potentiates HIF-1-dependent transcription. To ana-lyze the effect of c-Jun on HIF-1 transcriptional activity, thec-Jun-defective F9 cell line was transiently transfected with thep9HIF1Luc reporter plasmid (which contains nine copies ofthe HRE from the VEGF 5� untranslated region [UTR]) alongwith expression vectors for c-Jun and the �1 subunit of HIF-1or their corresponding control vectors. After transfection, thecells were incubated in either a normoxic (21% O2) or a hy-poxic (1% O2) atmosphere (Fig. 1A). The overexpression ofc-Jun alone had little effect under normoxic conditions, but itsignificatively enhanced transcription from the HIF-1-depen-dent construct in hypoxia (P � 0.001). The transfection of the�1 subunit was sufficient to transactivate p9HIF1Luc in F9cells, both in normoxia and in hypoxia (Fig. 1A), probablybecause they have enough endogenous � subunit to dimerizewith overexpressed �1. Interestingly, c-Jun was able to increaseHIF-1 transcriptional activity when cotransfected with the �1subunit of this factor under hypoxic conditions (P � 0.01).Similar experiments were performed with p1HIF1Luc, whichcontains a single copy of the HIF-1 DNA binding sequencefrom the VEGF 5� UTR (Fig. 1B). Despite the lower levels ofinduction, the results were similar to those obtained withp9HIF1Luc, ruling out a cis-acting cooperation between thesetwo transcription factors due to the use of a multimerizedsequence within the reporter plasmid.

The cooperative effect between c-Jun and �1 was not due toa nonspecific activation of transcription, since it could not beobserved when these expression vectors were cotransfectedwith other reporter plasmids, such as pKBF-Luc (with a trimerof the NFKB motif of the H-2Kb gene) and 2xAP1 Luc (whichcontains two AP-1 sites from the human collagenase promoter)(Fig. 1C). In addition, cotransfection of an NFATc expressionvector, alone or in combination with the HIF-1 � subunit, didnot have any effect on HIF-1-dependent transcription (Fig.

1D). These results strongly suggest that c-Jun is able to func-tionally cooperate with HIF-1, markedly enhancing its tran-scriptional activity.

In order to assess whether the effect of c-Jun was dependenton the presence of HIF-1, transient-transfection experimentswere carried out in mouse hepatoma Hepa-1c4 cells. This cellline is derived from Hepa-1c1c7 cells and contains a mutantHIF-1 � subunit which fails to form functional HIF-1 het-erodimers (16). As expected, when the p9HIF1Luc reportervector was transfected alone, there was no transcriptional ac-tivation of this construct in hypoxia (Fig. 2A, top). In contrast,cotransfection of wild-type HIF-1�, which allows the formationof functional HIF-1 heterodimers in hypoxia, restored hypoxicinduction of p9HIF1Luc in these cells. Transient transfectionof the c-Jun expression vector alone did not give rise to anytranscriptional activation of the p9HIF1Luc reporter plasmid,under either normoxic or hypoxic conditions. Interestingly,cotransfection of both HIF-1� and c-Jun expression vectorssignificantly restored c-Jun cooperative effect (P � 0.01). Todiscard any nonspecific effect due to HIF-1� overexpression,similar experiments were performed with parental Hepa-1c1c7cells, in which c-Jun was able to potentiate HIF-1 transcrip-tional activity in hypoxia (Fig. 2A, bottom). In order to inves-tigate whether the cooperative effect of c-Jun requires thepresence of a functional HIF-1 DNA binding site, we per-formed experiments with a construct containing a mutatedversion of the HRE (p1HIF1mLuc). As shown in Fig. 2B, themutagenesis of the HIF-1 DNA binding site also abrogated thecooperative effect of c-Jun, suggesting that this factor acts in anHRE-dependent fashion. Altogether, these data indicate thatc-Jun transcription factor enhances HIF-1-dependent tran-scription and that this effect requires the presence of a func-tional HIF-1 and the integrity of its DNA binding site topromote this cooperative effect.

A dominant-negative form of c-Jun partially inhibits HIF-1-dependent transcriptional activation. HIF-1 has been dem-onstrated to be crucial in tumor angiogenesis and embryonicvascularization, processes in which endothelial cells play anessential role (41). Once it was established that overexpressedc-Jun functionally cooperates with HIF-1, we wanted to inves-tigate whether, in this cell type, endogenous c-Jun was alsoable to modulate HIF-1 transcriptional response in a similarfashion. For this purpose, the HMEC-1 endothelial cell linewas transiently transfected with the p9HIF1Luc reporter plas-mid, together with an expression vector for the dominant-negative form of c-Jun, TAM67, which lacks its transactivationdomain (60). As shown in Fig. 3A, this c-Jun mutant wascapable of partially inhibiting hypoxic induction of thep9HIF1Luc reporter plasmid (P � 0.05). In order to confirmthe specificity of this effect, we transiently transfected c-Jun-defective F9 cells with p9HIF1Luc, along with expression vec-tors for wild-type c-Jun or its dominant-negative version,TAM67 (Fig. 3B). In the absence of c-Jun, the dominant-negative construct did not significantly affect the endogenousHIF-1 transcriptional activity in hypoxia, whereas wild-typec-Jun again had a cooperative effect. These findings are inconcordance with those shown in Fig. 1A and indicate thatendogenous c-Jun transcription factor is involved in the induc-tion of HIF-1-dependent genes in hypoxia. In addition, these

14 ALFRANCA ET AL. MOL. CELL. BIOL.


cb.asm.org/

Dow

nloaded from

http://mcb.asm.org/

results suggest that the transactivation domain of c-Jun is nec-essary for enhancing HIF-1 transcriptional response.

c-Jun overexpression does not modify nuclear HIF-1 proteinlevel. We next decided to analyze whether the overexpressionof wild-type c-Jun or its dominant-negative version, TAM67,could modulate the endogenous HIF-1� protein level as amechanism for their functional cooperation. COS-7 cells wereused as a model, because transient-transfection assays yieldeda high efficiency (70 to 80%) and functional cooperation be-tween c-Jun and HIF-1 was also observed in this cell line (datanot shown). COS-7 cells were transiently transfected with con-trol empty vector or increasing amounts of wild-type c-Junexpression vector. After transfection, the cells were grown un-der normoxic or hypoxic conditions, and nuclear extracts wereobtained. Western blot analysis of these extracts showed thatthe overexpression of c-Jun does not significantly modify the

amount of endogenous HIF-1� (Fig. 4A). Parallel experimentsshowed that overexpression of the c-Jun dominant-negativeform, TAM67, did not alter the endogenous HIF-1� proteinlevel either, indicating that the inhibitory effect of this mutanton HIF-1-dependent transcription is not due to a decrease inthe nuclear amount of the transcription factor (Fig. 4B).

c-Jun is present in the DNA-protein complexes obtainedwith the HIF-1 consensus sequence of the VEGF 5� UTR. Wenext decided to investigate whether the functional cooperationbetween c-Jun and HIF-1 required c-Jun binding to the HIF-1recognition site present in the VEGF 5� UTR, used as a targetsequence in our functional assays. To address this issue, elec-trophoretic mobility shift assays were performed with nuclearextracts from HUVEC grown under normoxic or hypoxic con-ditions. These extracts were incubated with a 32P-labeled probecontaining the above-mentioned sequence (Fig. 5A). A hy-

FIG. 1. Cooperative effect of c-Jun on HIF-1 transcriptional activity. (A) c-Jun-defective F9 teratocarcinoma cells were transiently transfectedwith 0.5 �g of the p9HIF1Luc luciferase reporter plasmid together with 1 �g of pcDNA3�1 (�1) or the empty vector pcDNA3 (C) and pRSV c-Jun(solid bars) or control pUCRSV empty vector (open bars). After transfection, the cells were incubated in 1% O2 (Hx) or 21% O2 (N) for 12 h andthen analyzed for luciferase activity. (B) F9 cells were transfected and processed as for panel A, but the luciferase reporter plasmid was p1HIF1Luc.The data in panels A and B are the means � standard errors of the mean of five independent experiments performed in duplicate. �, P � 0.05;��, P � 0.01; ��, P � 0.001 compared to controls in normoxia. (C) F9 cells were transfected as described above, but the luciferase reporterplasmids were pKBF-luc and 2XAP1Luc. (D) F9 cells were transiently transfected with the p9HIF1Luc luciferase reporter plasmid (0.5 �g)together with 1 �g of pcDNA3�1 (�1) or control pcDNA3 (C) and expression vectors for c-Jun (solid bars), NFATc (shaded bars), or controlempty vector (open bars) and processed as for panel A. The data are the means � standard deviations of a representative experiment out of threeperformed in duplicate.



cb.asm.org/

Dow

nloaded from

http://mcb.asm.org/

poxia-inducible complex was observed, which could be identi-fied as HIF-1 in supershift experiments with a specific poly-clonal antibody against the �1 subunit of this factor. Interestingly,a specific antibody against c-Jun also supershifted a DNA-protein complex, whereas a control antibody against c-Fos didnot have any effect (Fig. 5A). Parallel assays were carried outwith a 32P-labeled probe containing a consensus AP-1 site fromthe CD11c promoter as a control (Fig. 5A). A constitutiveDNA-protein complex was formed, in which both c-Jun andc-Fos could be detected with specific antibodies. Despite theseresults, no apparent AP-1 consensus site (5�-TGAC/GTCA-3�)is present in the sequence used for functional assays and bind-ing experiments (see Materials and Methods). Electrophoreticmobility shift assays carried out with in vitro-translated c-Jun(Fig. 5B) showed that c-Jun alone is not able to bind directly tothe HIF-1 recognition site of the VEGF 5� UTR or its flankingsequences, though it does form a specific complex with an AP-1

FIG. 2. Lack of c-Jun cooperative effect in the absence of a func-tional HIF-1 or a preserved HIF-1-response element. (A) (Top) HIF-1�-defective Hepa-1c4 mouse hepatoma cells (C4) were transfectedwith 0.25 �g of p9HIF1Luc reporter plasmid together with 0.5 �g ofpARNT (�) or the empty vector pcDNA3 (C) and pRSV c-Jun (solidbars) or control pUCRSV empty vector (open bars). Sixteen hoursafter transfection, the cells were grown under normoxic (N) or hypoxic(Hx) conditions for 8 h, and luciferase activity was determined. Thehistogram shows the means � standard errors of the mean of threeindependent experiments performed in duplicate; �, P � 0.05, and ��,P � 0.001 compared to control in normoxia. (Bottom) The Hepa-1c1c7mouse hepatoma cell line (C1) was transfected with the p9HIF1Lucreporter plasmid together with pRSV c-Jun (solid bars) or controlpUCRSV empty vector (open bars) and processed as C4 cells. Thedata are means � standard deviations of a representative experimentout of four performed in triplicate. (B) F9 cells were transfected with0.5 �g of p1HIF1mLuc luciferase reporter plasmid (which contains amutated HRE) together with 1 �g of pcDNA3 �1 (�1) or empty vectorpcDNA3 (C) and pRSV c-Jun (solid bars) or control pUCRSV emptyvector (open bars). After transfection, the cells were processed as forpanel A. The data are means � standard errors of the mean of threeindependent experiments performed in duplicate.

FIG. 3. Effect of c-Jun dominant-negative mutant on HIF-1-depen-dent transcription. (A) The HMEC-1 endothelial cell line was tran-siently transfected with 0.2 �g of p9HIF1Luc reporter plasmid to-gether with 0.2 �g of pCMV TAM67 (TAM 67), or control vectorpCMV (C). Sixteen hours after transfection, the cells were either leftuntreated (N) or grown in 1% O2 for 8 h (Hx) and analyzed forluciferase activity. The data are means � standard errors of the meanof four independent experiments performed in duplicate. �, P � 0.05compared to control in hypoxia. (B) F9 cells were transiently trans-fected with 0.5 �g of p9HIF1Luc together with 1 �g of pRSVc-Jun(c-Jun), pCMV TAM67, or control empty vector. After transfection,the cells were incubated under normoxic (N) or hypoxic (Hx) condi-tions for 12 h, and then luciferase activity was measured. The data aremeans plus standard errors of the mean of three independent exper-iments performed in duplicate.



cb.asm.org/

Dow

nloaded from

http://mcb.asm.org/

site-containing probe, suggesting that it requires interactionwith another protein(s) to bind this sequence in vivo.

Association between c-Jun and HIF-1�. In order to investi-gate whether functional cooperation between c-Jun andHIF-1� requires a physical interaction of these proteins invivo, coimmunoprecipitation experiments were conducted withCOS-7 cells transiently transfected with expression vectors forboth transcription factors. After transfection, the cells werecultured in normoxia or hypoxia. Then, nuclear extracts wereobtained and immunoprecipitated with a polyclonal antibodyagainst c-Jun or a control antibody and subjected to Westernblot analysis. Under hypoxic conditions, HIF-1� could be de-tected in c-Jun immunocomplexes (Fig. 6A, left). These find-ings indicate that c-Jun and HIF-1 can associate in vivo inhypoxic cells and suggest that this association can be involvedin the functional cooperation between the factors. On theother hand, coimmunoprecipitation assays performed withCOS-7 cells transiently transfected with TAM67 and HIF-1�expression vectors (Fig. 6A, right) showed that TAM67 alsoassociates with this transcription factor, suggesting that the

c-Jun domain(s) involved in its interaction with HIF-1 is pre-served in this truncated form.

These experiments indicate that HIF-1� and c-Jun associatewith each other, but they do not demonstrate a direct interac-tion between the factors. To elucidate this issue, coimmuno-precipitation experiments were carried out with in vitro-trans-lated proteins and polyclonal antibodies specific to c-Jun andHIF-1� (Fig. 6B). Neither c-Jun antibody was able to immu-noprecipitate cotranslated HIF-1�, nor was associated c-Jundetected in HIF-1� immunocomplexes. As controls for theexperimental conditions, the HIF-1 � subunit and ATF-2 tran-scription factor were cotranslated in some of the reactions, andthey could be coimmunoprecipitated with their dimerizationpartners, HIF-1� and c-Jun, respectively. The presence of HIF-1� did not interfere with the interaction between HIF-1� andc-Jun, since similar results were obtained when HIF-1� was notincluded in the reaction (data not shown). These results indi-cate that the association of c-Jun and HIF-1� found in in vivoexperiments is probably mediated through another protein(s)or that it requires a posttranslational modification of one orboth transcription factors, which takes place only in the cell.

Hypoxia-induced phosphorylation of c-Jun at Ser63 is in-volved in the functional cooperation between HIF-1 and c-Jun.There are previous reports that JNK can be activated by hyp-oxia and/or reoxygenation in several cell types (29, 34, 44). Inorder to analyze whether hypoxia induced the phosphorylationof endogenous c-Jun in endothelial cells, Western blot assayswere carried out with nuclear extracts of HUVEC, blotted withan antibody which specifically recognizes c-Jun phosphorylatedat Ser63. Hypoxia induced a transient c-Jun phosphorylation,with a peak between 2.5 and 5 h (Fig. 7A). To investigatewhether this phosphorylation of c-Jun in hypoxia was involvedin the enhancement of HIF-1-dependent transcription, F9 cellswere transiently transfected with the p9HIF1Luc reporter vec-tor, together with expression vectors for wild-type c-Jun or aconstruct in which Ser63 and Ser73 were mutated to Ala resi-dues. As shown in Fig. 7B, a significant (P � 0.05) reduction inthe cooperative effect of c-Jun on HIF-1 transcriptional activityin hypoxia was found in c-Jun S63A-S73A compared with thewild type. Western blot assays of nuclear extracts from F9 cellstransfected as described above showed no differences in thelevels of expression of both constructs which could be respon-sible for this transcriptional effect. To confirm the involvementof the JNK pathway in the c-Jun cooperative effect, we carriedout transient-transfection experiments with HMEC-1 cells withan expression vector for the JNK-binding domain (JBD) of theJIP1 scaffold protein. Overexpression of this protein has beenshown to specifically block JNK-regulated signal transduction(13). As shown in Fig. 7C, JIP1 partially inhibited hypoxicinduction of the p9HIF1Luc reporter plasmid (P � 0.05).These data indicate that JNK-mediated phosphorylation ofc-Jun can contribute to the cooperative effect of c-Jun andHIF-1 under hypoxic conditions.

DISCUSSION

Here, we show that c-Jun is able to functionally cooperatewith HIF-1, enhancing transcription from a HIF-1-dependentconstruct in hypoxia. This construct contains the HIF-1 bindingsequence of the VEGF 5� UTR. Three AP-1 binding elements

FIG. 4. Effect of c-Jun or its dominant-negative mutant on HIF-1�expression. (A) COS-7 cells were transfected with control empty vector(MOCK) or increasing amounts of c-Jun expression vector (c-Jun).After transfection, the cells were grown under normoxic (N) or hypoxic(Hx) conditions for 5 h. Nuclear extracts were obtained and subjectedto immunoblotting (20 �g per lane) with an anti-HIF-1� antibody(top) or an anti-c-Jun antibody (bottom). (B) COS-7 cells were trans-fected with 8 �g of control empty vector (MOCK) or pCMV TAM67(TAM67) and processed as for panel A. Molecular weight markers areshown on the left.



cb.asm.org/

Dow

nloaded from

http://mcb.asm.org/

which have been involved in the regulation of the VEGF genein hypoxia have been described throughout this promoter se-quence (12). For this reason, we decided to restrict the targetsequence for functional and binding experiments (see Materi-als and Methods) so that we could analyze the modulatoryeffect of c-Jun only on HIF-1-dependent transcription.

Though both factors functionally cooperate in hypoxia, insome cases c-Jun seems to transactivate the HIF-1-dependentconstructs in normoxia also (Fig. 1A). The statistical analysisindicates that the data on c-Jun cooperation in normoxia arenot significant. Nevertheless, this effect could be due to thepresence of residual amounts of HIF-1 under normoxic con-ditions; in this regard, targeted disruption of HIF-1� or -�results in a reduced basal transcription level of some hypoxia-inducible genes; it has been proposed that �1� dimers presentin normoxia would maintain a basal expression of a series of

genes which are necessary for cellular metabolism (20, 31). Inaddition, it has been reported that some culture conditions,such as confluence status and cytokine stimulation, can mod-ulate HIF-1� expression in different cell types (40, 56, 61). Inagreement with this possibility, experiments with Hepa-1c4cells (Fig. 2A) indicate that c-Jun effect can only be observedin the presence of a functional HIF-1. In fact, these assaysshow that HIF-1 �-subunit expression is able to transactivatep9HIF1Luc in normoxia, suggesting that there might be somebasal HIF-1� under these conditions, since HIF-1� dimers areunable to bind to the HIF-1 consensus sequence (55). Alter-natively, c-Jun could act in an HRE-independent manner, butexperiments with p1HIF1mLuc indicate that c-Jun needs theintegrity of the HIF-1 DNA binding site to display its cooper-ative effect (Fig. 2B).

A key step in the regulation of HIF-1 transcriptional activity

FIG. 5. c-Jun binding to VEGF 5� UTR HIF-1 consensus sequence in endothelial cells. (A) Electrophoretic mobility shift assay of nuclearextracts obtained from primary endothelial cells either untreated or subjected to hypoxia (Hx) for 4 h; these extracts were incubated (3 �g per lane)with a 32P-labeled probe which contains the HIF-1 DNA binding consensus sequence of the VEGF 5� UTR (HIF-1; 0.5 ng per lane), showing ahypoxia-inducible DNA-protein complex (arrows). In some cases, nuclear extracts were incubated with specific antibodies (Ab) against the HIF-1�subunit (�1) (left) or c-Jun or c-Fos (middle) before the probe was added. The autoradiographs show supershifted complexes with anti-HIF-1�(asterisk) and c-Jun (arrowhead) antibodies, whereas anti-c-Fos had no effect; (right) electrophoretic mobility shift assay performed as describedabove but with a 32P-labeled probe containing an AP-1 consensus sequence from the CD11c promoter (AP-1) used as a positive control.Supershifted complexes can be observed with both anti-c-Jun (open arrow) and anti c-Fos (open arrowhead) antibodies. (B) In vitro-translated(Ret.) pcDNA3 (C), c-Jun, or HIF-1 (�1 plus � subunits) was incubated with the same labeled probes as for panel A (1 ng per lane). Specificcomplexes with AP-1 (asterisk) and HIF-1 (arrow) probes could be observed, which could be identified, respectively, as c-Jun and the HIF-1 �subunit (arrowhead) with specific antibodies (Ab) against these factors. �, present; �, absent.



cb.asm.org/

Dow

nloaded from

http://mcb.asm.org/

is the stabilization of its � subunit in hypoxia. The tumorsuppressor proteins VHL and p53 are involved in the HIF-1degradation process (32, 38). It has been reported that c-Junacts as a negative regulator of p53 expression (43). In addition,the HIF-1� promoter region contains several AP-1 bindingelements (33). Thus, it was possible that c-Jun could modulatethe HIF-1� protein level by transcriptional or posttranscrip-tional events as a mechanism for its cooperative effect onHIF-1 transcriptional activity. Transfection experiments withCOS-7 cells (Fig. 4) show that c-Jun does not affect the en-dogenous HIF-1� protein level. An additional regulatory pointis the active nuclear translocation of the HIF-1 � subunit to thenucleus induced by hypoxia (24). The fact that the nuclearHIF-1� amount is not modified in c-Jun-transfected COS-7cells suggests that it does not interfere with this process either,though further experiments will be necessary to demonstratethis point.

Several reports reveal the importance of some transcriptionfactors that functionally cooperate with HIF-1 by binding to cis

regulatory regions of some genes, such as the tyrosine hydrox-ylase, lactate dehydrogenase A, endothelin-1, and NOS2 genes(14, 37, 51, 58). In contrast, our experiments (Fig. 5) show thatdirect binding of c-Jun to DNA is not necessary to achieve afunctional cooperation with HIF-1. A similar mechanism hasbeen proposed for macrophage colony-stimulating factor re-ceptor regulation and p21 promoter transactivation, where c-Jun acts as a coactivator of PU.1 and Sp1, respectively, withoutbinding to DNA (6, 25). Another member of the bLZ family oftranscription factors, CHOP, has also been demonstrated topotentiate AP-1-mediated transcription by “tethering” CHOPto preexisting AP-1 DNA-protein complexes (52). On theother hand, c-Jun has been shown to enhance the DNA bind-ing activity of NF-B p65 (49); however, we have been unableto demonstrate a similar mechanism for HIF-1 (data notshown). Some articles report an increase in AP-1 binding toDNA under hypoxic conditions in certain cell types (59) thatcould be mediated by the nuclear redox factor Ref-1, which isinduced in hypoxia and has also been shown to participate in

FIG. 6. Association between c-Jun and HIF-1�. (A) COS-7 cells were cotransfected with 8 �g of pcDNA3�1 and pRSV c-Jun (left) or pCMVTAM67 (right) expression vector. After 40 h, the cells were incubated in normoxia or hypoxia (Hx) for 4 h, and nuclear extracts were obtained.These extracts were immunoprecipitated (IP) with polyclonal antibodies against the DNA binding domain (c-Jun and c-Jun 1) or the transacti-vation domain (c-Jun 2) of c-Jun or a control antibody (C) and immunoblotted with anti-HIF-1� (top) and anti-c-Jun (bottom) antibodies; as acontrol for protein expression, aliquots of the lysates (representing 1/10 of each immunoprecipitation reaction) (�) were also subjected to Westernblotting with antibodies against HIF-1� and c-Jun. (B) HIF-1� (�1), c-Jun, HIF-1� (�), and ATF-2 were in vitro translated or cotranslated in thepresence of [35S]methionine and immunoprecipitated with antibodies against HIF-1� (�1), c-Jun, or ATF-2. The immunocomplexes were analyzedby SDS-PAGE (right); the autoradiograph on the left shows 1/10 of each translation reaction as a control. �, present; �, absent. Molecular weightmarkers are shown on the right.



cb.asm.org/

Dow

nloaded from

http://mcb.asm.org/

HIF-1 transcriptional activity (9). We have not found any sig-nificant variation in AP-1 binding in hypoxia (Fig. 5A), whichis in agreement with a number of other reports (3, 4).

In this study, we show that c-Jun and HIF-1� are able toassociate in vivo, but we have not detected any interactionbetween them when carrying out coimmunoprecipitation ex-periments with in vitro-translated proteins (Fig. 6B). This sug-gests either that the association between the factors may bedependent on posttranslational events which only occur in acellular context or that it is mediated by an additional pro-tein(s). In this regard, it has been recently reported thatHIF-1� is targeted for degradation in normoxia by the hy-droxylation of a conserved proline residue. This proline hy-droxylase activity requires molecular oxygen and Fe2� and hasbeen shown to be present in the rabbit reticulocyte lysate usedto generate the in vitro-translated proteins (19, 21). Given thefact that c-Jun associates with HIF-1� under hypoxic condi-tions, it is possible that this interaction could be negativelyregulated by proline hydroxilation of HIF-1�. It will be of greatinterest to perform additional experiments to confirm this pos-sibility. On the other hand, the dominant-negative mutant ofc-Jun, TAM67, also interacts with this factor in transfectedCOS-7 cells (Fig. 6A). This construct lacks the c-Jun transac-tivation domain and has been shown to inhibit the function ofendogenous AP-1 proteins through a “quenching” mechanism(7). In the case of HIF-1, it could act in a similar fashion andsequester this factor in low-activity complexes, thus impairingHIF-1-dependent transcription.

JNK has been demonstrated to phosphorylate c-Jun at res-idues Ser63 and Ser73 and to enhance its transcriptional activity(18). Activation of the stress kinases JNK and p38 by hypoxiahas been widely described (11, 29, 34, 44), though there areimportant discrepancies depending on the cell type and theexperimental conditions utilized. The induction of MKP-1phosphatase by low oxygen tension has also been reported as a

FIG. 7. Involvement of JNK pathway in functional cooperation be-tween c-Jun and HIF-1. (A) Western blot analysis of phosphorylatedc-Jun in endothelial cells under hypoxic conditions. (Top) Nuclearextracts were obtained from HUVEC grown in 1% O2 (Hx) for 30 min(30�) and 1, 2.5, 5, and 15 h or under normoxic conditions (C) andsubjected to immunoblotting with an antibody which specifically rec-ognizes c-Jun phosphorylated at Ser63. (Bottom) The same membranewas stripped and reblotted with an anti-c-Jun antibody to show equiv-alent amounts of protein in each lane. (B) (Top) F9 cells were trans-fected with 0.5 �g of p9HIF1Luc luciferase reporter plasmid, togetherwith 1 �g of pRSVc-Jun (WT), pRSVc-Jun S63A-S73A (S63/73A), orpUCRSV control vector (C); after transfection, the cells were grownunder hypoxic conditions (Hx) for 16 h, and luciferase activity wasdetermined. Data from three separate experiments are shown, nor-malized to control in hypoxia (set as 1); the bars represent the meansof the different values for each experimental condition. �, P � 0.05.(Bottom) F9 cells were transfected as described above, and nuclearextracts were obtained and subjected to immunoblotting (20 �g perlane) with a specific antibody against c-Jun. Molecular weight markersare shown on the left. (C) The HMEC-1 endothelial cell line wastransiently transfected with 0.2 �g of p9HIF1Luc reporter plasmidtogether with 0.2 �g of JIP1 or control vector (C). Sixteen hours aftertransfection, the cells were either left untreated (N) or grown in 1% O2for 8 h (Hx) and analyzed for luciferase activity. Data from threeseparate experiments are shown, normalized to control in normoxia;the bars represent the means of the different values for each experi-mental condition. �, P � 0.05.



cb.asm.org/

Dow

nloaded from

http://mcb.asm.org/

regulatory step for JNK activity under these conditions (28). Inour hands, hypoxia induces an increase in endogenous c-Junphosphorylation at Ser63 (Fig. 7A) which could contribute tothe cooperative effect of c-Jun and HIF-1 in hypoxia. In fact,experiments with c-Jun S63A-S73A (Fig. 7B) show an impor-tant reduction in c-Jun potentiation of HIF-1 transcriptionalactivity versus the wild type. The JIP1 scaffold protein aggre-gates components of the mitogen-activated protein kinase cas-cade to form a functional JNK signaling module. Its overex-pression causes cytoplasmic retention of JNK and inhibitsJNK-regulated gene expression (13). As shown in Fig. 7C, JIP1partially inhibited hypoxic induction of the p9HIF1Luc re-porter plasmid, suggesting a modulatory role of JNK-depen-dent phosphorylation of c-Jun on the expression of hypoxia-regulated genes.

Both c-Jun and HIF-1� bind to the transcriptional coactiva-tors CBP/p300 and SRC-1, which are essential for their tran-scriptional activities (2, 9, 30). In the case of HIF-1�, therecruitment of CBP/p300 and SRC-1 has been shown to beredox regulated. These transcription factors bind to differentregions of the p300 molecule (the C/H1 domain for HIF-1�and the CREB binding region for c-Jun), so it is feasible thatboth proteins could bind simultaneously to this coactivator. Itis also possible that c-Jun could positively modulate HIF-1�binding to CBP/p300 or SRC-1, thus enhancing its transcrip-tional activity. On the other hand, c-Jun association with CBP/p300 has been shown to depend on the integrity of residuesSer63 and Ser73 in a phosphorylation-independent manner (5),so that the impairment of the cooperative effect in the exper-iments with c-Jun S63A-S73A (Fig. 7B) could also be due to aninefficient interaction with such transcriptional coactivators.Preliminary experiments show that p300 enhances the func-tional cooperation between c-Jun and HIF-1 (data not shown),but further research will be necessary to address this issue.

HIF-1 plays a pivotal role in the development of many can-cers, mainly by regulating the expression of VEGF and pro-moting the neovascularization of solid tumors (8, 41). HIF-1 isupregulated in the hypoxic areas of these tumors, but it canalso be induced by the inactivation of some tumor suppressorgenes, such as VHL, p53, and PTEN genes, or by the action ofsome oncogenes, such as the v-SRC gene (22, 32, 38, 63). c-Junparticipates in cellular growth control and is also able to trans-form cells by itself. It has been shown that some tumors de-rived from c-Jun-transformed cells exhibit a higher level ofneovascularization than those derived from other oncogenes(26). The findings reported in this study provide an additionalmechanism for solid-tumor development in which c-Jun notonly would facilitate cell proliferation but also would potenti-ate VEGF induction in tumor hypoxic areas by functionalcooperation with HIF-1.

ACKNOWLEDGMENTS

We thank E. Huang and R. Davis for their generous gifts of HIF-1expression vectors and GST constructs; we also thank P. Angel, R.Pope, and M. Karin for kindly providing us their c-Jun plasmids and A.Israel, M. Rincon, P. Munoz, and G. R. Crabtree for their p 75 BFLuc,2XAP1Luc, pcDNA3-Flag-JBD (JIP1), and pSH107c plasmids, re-spectively. We are very grateful to L. del Peso, R. Ramos, J. M.Redondo, M. Lopez-Cabrera, F. Sanchez-Madrid, and M. C. Castel-lanos for their critical reading of the manuscript.

This work was supported by grants from the Ministerio de Educa-

cion y Cultura (PM 98/0024), from Fondo de Investigaciones Sanitarias(Fis 98/1382), and from Comunidad Autonoma de Madrid (CAM08.3/0022/00). A.A. and F.V. were supported by fellowships from theMinisterio de Educacion y Cultura; M.D.G. and J.A. were supportedby fellowships from Comunidad Autonoma de Madrid.

REFERENCES

1. Aragones, J., D. R. Jones, S. Martin, M. A. San Juan, A. Alfranca, F. Vidal,A. Vara, I. Merida, and M. O. Landazuri. 2001. Evidence for the involve-ment of diacylglycerol kinase in the activation of hypoxia-inducible transcrip-tion factor-1 by low oxygen tension. J. Biol. Chem. 276:10548–10555.

2. Arany, Z., L. E. Huang, R. Eckner, S. Bhattacharya, C. Jiang, M. A. Gold-berg, H. F. Bunn, and D. M. Livingston. 1996. An essential role for p300/CBP in the cellular response to hypoxia. Proc. Natl. Acad. Sci. USA 93:12969–12973.

3. Ausserer, W. A., B. Bourrat-Floeck, C. J. Green, K. R. Laderoute, and R. M.Sutherland. 1994. Regulation of c-jun expression during hypoxic and low-glucose stress. Mol. Cell. Biol 14:5032–5042.

4. Bandyopadhyay, R. S., M. Phelan, and D. V. Faller. 1995. Hypoxia inducesAP-1-regulated genes and AP-1 transcription factor binding in human en-dothelial and other cell types. Biochim. Biophys. Acta 1264:72–78.

5. Bannister, A. J., T. Oehler, D. Wilhelm, P. Angel, and T. Kouzarides. 1995.Stimulation of c-Jun activity by CBP: c-Jun residues Ser63/73 are requiredfor CBP induced stimulation in vivo and CBP binding in vitro. Oncogene11:2509–2514.

6. Behre, G., A. J. Whitmarsh, M. P. Coghlan, T. Hoang, C. L. Carpenter, D. E.Zhang, R. J. Davis, and D. G. Tenen. 1999. c-Jun is a JNK-independentcoactivator of the PU.1 transcription factor. J. Biol. Chem. 274:4939–4946.

7. Brown, P. H., T. K. Chen, and M. J. Birrer. 1994. Mechanism of action of adominant-negative mutant of c-Jun. Oncogene 9:791–799.

8. Carmeliet, P., Y. Dor, J. M. Herbert, D. Fukumura, K. Brusselmans, M.Dewerchin, M. Neeman, F. Bono, R. Abramovitch, P. Maxwell, C. J. Koch, P.Ratcliffe, L. Moons, R. K. Jain, D. Collen, E. Keshert, and E. Keshet. 1998.Role of HIF-1 alpha in hypoxia-mediated apoptosis, cell proliferation andtumor angiogenesis. Nature 394:485–490.

9. Carrero, P., K. Okamoto, P. Coumailleau, S. O’Brien, H. Tanaka, and L.Poellinger. 2000. Redox-regulated recruitment of the transcriptional coacti-vators CREB-binding protein and SRC-1 to hypoxia-inducible factor 1alpha.Mol. Cell. Biol. 20:402–415.

10. Chandel, N. S., D. S. McClintock, C. E. Feliciano, T. M. Wood, J. A. Me-lendez, A. M. Rodriguez, and P. T. Schumacker. 2000. Reactive oxygenspecies generated at mitochondrial complex III stabilize hypoxia-induciblefactor-1alpha during hypoxia: a mechanism of O2 sensing. J. Biol. Chem.275:25130–25138.

11. Conrad, P. W., R. T. Rust, J. Han, D. E. Millhorn, and D. Beitner-Johnson.1999. Selective activation of p38alpha and p38gamma by hypoxia. Role inregulation of cyclin D1 by hypoxia in PC12 cells. J. Biol. Chem. 274:23570–23576.

12. Damert, A., E. Ikeda, and W. Risau. 1997. Activator-protein-1 binding po-tentiates the hypoxia-inducible factor-1-mediated hypoxia-induced transcrip-tional activation of vascular-endothelial growth factor expression in C6 gli-oma cells. Biochem. J. 327:419–423.

13. Dickens, M., J. S. Rogers, J. Cavanagh, A. Raitano, Z. Xia, J. R. Halpern,M. E. Greenberg, C. L. Sawyers, and R. Davis. 1997. A cytoplasmic inhibitorof the JNK signal transduction pathway. Science 277:693–696.

14. Firth, J. D., B. L. Ebert, and P. J. Ratcliffe. 1995. Hypoxic regulation oflactate dehydrogenase A. Interaction between hypoxia-inducible factor 1 andcAMP response elements. J. Biol. Chem. 270:21021–21027.

15. Forsythe, J. A., B. H. Jiang, N. V. Iyer, F. Agani, S. W. Leung, R. D. Koos,and G. L. Semenza. 1996. Activation of vascular endothelial growth factorgene transcription by hypoxia-inducible factor 1. Mol. Cell. Biol. 16:4604–4613.

16. Gassmann, M., I. Kvietikova, A. Rolfs, and R. H. Wenger. 1997. Oxygen- anddioxin-regulated gene expression in mouse hepatoma cells. Kidney Int. 51:567–574.

17. Hai, T., and T. Curran. 1991. Cross-family dimerization of transcriptionfactors Fos/Jun and ATF/CREB alters DNA binding specificity. Proc. Natl.Acad. Sci. USA 88:3720–3724.

18. Hibi, M., A. Lin, T. Smeal, A. Minden, and M. Karin. 1993. Identification ofan oncoprotein- and UV-responsive protein kinase that binds and potenti-ates the c-Jun activation domain. Genes Dev. 7:2135–2148.

19. Ivan, M., K. Kondo, H. Yang, W. Kim, J. Valiando,, M. Ohh, A. Salic, J. M.Asara, W. S. Lane, and W. G. Kaelin, Jr. 2001. HIF� targeted for VHL-mediated destruction by proline hydroxylation: implications for O2 sensing.Science 292:464–468. (First published 5 April 2001; 10.1126/science.1059817.)

20. Iyer, N. V., L. E. Kotch,, F. Agani, S. W. Leung, E. Laughner,, R. H. Wenger,M. Gassmann, J. D. Gearhart, A. M. Lawler, A. Y. Yu, and G. L. Semenza.1998. Cellular and developmental control of O2 homeostasis by hypoxia-inducible factor 1 alpha. Genes Dev. 12:149–162.

21. Jakkola, P., D. R. Mole, Y. Tian, M. I. Wilson, J. Gielbert, S. J. Gaskell, A.



cb.asm.org/

Dow

nloaded from

http://mcb.asm.org/

Kriegsheim, H. F. Hebestreit, M. Mukherji, C. J. Schofield, P. H. Maxwell,C. W. Pugh, and P. J. Ratcliffe. 2001. Targeting of HIF-1� to the vonHippel-Lindau ubiquitylation complex by O2-regulated prolyl hydroxylation.Science 292:468–472.

22. Jiang, B. H., F. Agani, A. Passaniti, and G. L. Semenza. 1997. V-SRCinduces expression of hypoxia-inducible factor 1 (HIF-1) and transcription ofgenes encoding vascular endothelial growth factor and enolase 1: involve-ment of HIF-1 in tumor progression. Cancer Res. 57:5328–5335.

23. Jiang, B. H., E. Rue, G. L. Wang, R. Roe, and G. L. Semenza. 1996. Dimer-ization, DNA binding, and transactivation properties of hypoxia-induciblefactor 1. J. Biol. Chem. 271:17771–17778.

24. Kallio, P. J., K. Okamoto, S. O’Brien, P. Carrero, Y. Makino, H. Tanaka,and L. Poellinger. 1998. Signal transduction in hypoxic cells: inducible nu-clear translocation and recruitment of the CBP/p300 coactivator by thehypoxia-inducible factor-1alpha. EMBO J. 17:6573–6586.

25. Kardassis, D., P. Papakosta, K. Pardali, and A. Moustakas. 1999. c-Juntransactivates the promoter of the human p21(WAF1/Cip1) gene by actingas a superactivator of the ubiquitous transcription factor Sp1. J. Biol. Chem.274:29572–29581.

26. Kraemer, M., R. Tournaire, V. Dejong, N. Montreau, D. Briane, C. Derbin,and B. Binetruy. 1999. Rat embryo fibroblasts transformed by c-Jun displayhighly metastatic and angiogenic activities in vivo and deregulate gene ex-pression of both angiogenic and antiangiogenic factors. Cell Growth Differ.10:193–200.

27. Kvietikova, I., R. H. Wenger, H. H. Marti, and M. Gassmann. 1995. Thetranscription factors ATF-1 and CREB-1 bind constitutively to the hypoxia-inducible factor-1 (HIF-1) DNA recognition site. Nucleic Acids Res. 23:4542–4550.

28. Laderoute, K. R., H. L. Mendonca, J. M. Calaoagan, A. M. Knapp, A. J.Giaccia, and P. J. Stork. 1999. Mitogen-activated protein kinase phospha-tase-1 (MKP-1) expression is induced by low oxygen conditions found insolid tumor microenvironments. A candidate MKP for the inactivation ofhypoxia-inducible stress-activated protein kinase/c-Jun N-terminal proteinkinase activity. J. Biol. Chem. 274:12890–12897.

29. Laderoute, K. R., and K. A. Webster. 1997. Hypoxia/reoxygenation stimu-lates Jun kinase activity through redox signaling in cardiac myocytes. Circ.Res. 80:336–344.

30. Lee, S., H. Kim, S. Na, T. Kim, H. Choi, S. Im, and L. Lee. 1998. Steroidreceptor coactivator-1 coactivates activating protein-1-mediated transactiva-tions through interaction with the c-Jun and c-Fos subunits. J. Biol. Chem.273:16651–16654.

31. Maltepe, E., J. V. Schmidt, D. Baunock, C. A. Bradfield, and M. C. Simon.1997. Abnormal angiogenesis and responses to glucose and oxygen depriva-tion in mice lacking the protein ARNT. Nature 386:403–407.

32. Maxwell, P. H., M. S. Wiesener, G. W. Chang, S. C. Clifford, E. C. Vaux,M. E. Cockman, C. C. Wykoff, C. W. Pugh, E. R. Maher, and P. J. Ratcliffe.1999. The tumour suppressor protein VHL targets hypoxia-inducible factorsfor oxygen-dependent proteolysis. Nature 399:271–275.

33. Minet, E., I. Ernest, G. Michel, I. Roland, J. Remacle, M. Raes, and C.Michiels. 1999. HIF1A gene transcription is dependent on a core promotersequence encompassing activating and inhibiting sequences located up-stream from the transcription initiation site and cis elements located withinthe 5�UTR. Biochem. Biophys. Res. Commun. 261:534–540.

34. Mizukami, Y., K. Yoshioka, S. Morimoto, and K. Yoshida. 1997. A novelmechanism of JNK1 activation. J. Biol. Chem. 272:16657–16662.

35. Musti, A., M. Treier, and D. Bohmann. 1997. Reduced ubiquitin-dependentdegradation of c-Jun after phosphorylation by MAP kinases. Science 275:400–402.

36. Nishitani, J., T. Nishinaka, C. H. Cheng, W. Rong, K. K. Yokoyama, and R.Chiu. 1999. Recruitment of the retinoblastoma protein to c-Jun enhancestranscription activity mediated through the AP-1 binding site. J. Biol. Chem.274:5454–5461.

37. Norris, M. L., and D. E. Millhorn. 1995. Hypoxia-induced protein binding toO2-responsive sequences on the tyrosine hydroxylase gene. J. Biol. Chem.270:23774–23779.

38. Ravi, R., B. Mookerjee, Z. M. Bhujwalla, C. H. Sutter, D. Artemov, Q. Zeng,L. E. Dillehay, A. Madan, G. L. Semenza, and A. Bedi. 2000. Regulation oftumor angiogenesis by p53-induced degradation of hypoxia-inducible factor1alpha. Genes Dev. 14:34–44.

39. Richard, D. E., E. Berra, E. Gothie, D. Roux, and J. Pouyssegur. 1999.p42/p44 mitogen-activated protein kinases phosphorylate hypoxia-induciblefactor 1alpha (HIF-1alpha) and enhance the transcriptional activity ofHIF-1. J. Biol. Chem. 274:32631–32637.

40. Richard, D. E., E. Berra, and J. Pouyssegur. 2000. Nonhypoxic pathwaymediates the induction of hypoxia-inducible factor 1alpha in vascular smoothmuscle cells. J. Biol. Chem. 275:26765–26771.

41. Ryan, H. E., J. Lo, and R. S. Johnson. 1998. HIF-1 alpha is required for solid

tumor formation and embryonic vascularization. EMBO J. 17:3005–3015.42. Salceda, S., and J. Caro. 1997. Hypoxia-inducible factor 1alpha (HIF-1al-

pha) protein is rapidly degraded by the ubiquitin-proteasome system undernormoxic conditions. Its stabilization by hypoxia depends on redox-inducedchanges. J. Biol. Chem. 272:22642–22647.

43. Schreiber, M., A. Kolbus, F. Piu, A. Szabowski, U. Mohle-Steinlein, J. Tian,M. Karin, P. Angel, and E. F. Wagner. 1999. Control of cell cycle progressionby c-Jun is p53 dependent. Genes Dev. 13:607–619.

44. Scott, P. H., A. Paul, C. M. Belham, A. J. Peacock, R. M. Wadsworth, G. W.Gould, D. Welsh, and R. Plevin. 1998. Hypoxic stimulation of the stress-activated protein kinases in pulmonary artery fibroblasts. Am. J. Respir. Crit.Care Med. 158:958–962.

45. Semenza, G. L. 1994. Regulation of erythropoietin production. New insightsinto molecular mechanisms of oxygen homeostasis. Hematol. Oncol. Clin. N.Am. 8:863–884.

46. Semenza, G. L., P. H. Roth, H. M. Fang, and G. L. Wang. 1994. Transcrip-tional regulation of genes encoding glycolytic enzymes by hypoxia-induciblefactor 1. J. Biol. Chem. 269:23757–23763.

47. Shweiki, D., A. Itin, D. Soffer, and E. Keshet. 1992. Vascular endothelialgrowth factor induced by hypoxia may mediate hypoxia-initiated angiogen-esis. Nature 359:843–848.

48. Srinivas, V., I. Leshchinsky, N. Sang, M. P. King, A. Minchenko, andJ. Caro. 2001. Oxygen sensing and HIF-1 activation does not require anactive mitochondrial respiratory chain electron-transfer pathway. J. Biol.Chem. 276:21995–21998.

49. Stein, B., A. S. Baldwin, W. B. Dean, W. C. Greene, P. Angel, and P. Herrlich.1993. Cross-coupling of the NF-KB p65 and Fos/Jun transcription factorsproduces potentiated biological function. EMBO J. 12:3879–3891.

50. Tacchini, L., L. Bianchi, A. Bernelli-Zazzera, and G. Cairo. 1999. Trans-ferrin receptor induction by hypoxia. HIF-1-mediated transcriptional activa-tion and cell-specific post-transcriptional regulation. J. Biol. Chem. 274:24142–24146.

51. Tendler, D. S., C. Bao, T. Wang, E. L. Huang, E. A. Ratovitsky, D. A. Pardoll,and C. J. Lowenstein. 2001. Intersection of interferon and hypoxia signaltransduction pathways in nitric oxide-induced tumor apoptosis. Cancer Res.61:3682–3688.

52. Ubeda, M., M. Vallejo, and J. F. Habener. 1999. CHOP enhancement ofgene transcription by interactions with Jun/Fos AP-1 complex proteins. Mol.Cell. Biol 19:7589–7599.

53. Van Dam, H., S. Huguier, K. Kooistra, J. Baguet, E. Vial, A. Van der Erb, P.Herrlich, P. Angel, and M. Castellazi. 1998. Autocrine growth and anchor-age independence: two complementing Jun-controlled genetic programs ofcellular transformation. Genes Dev. 12:1227–1239.

54. Vaux, E. C., E. Metzen, K. M. Yeates, and P. J. Ratcliffe. 2001. Regulationof hypoxia-inducible factor is preserved in the absence of a functioningmitochondrial respiratory chain. Blood 98:296–302.

55. Whitelaw, M., I. Pongratz, A. Wilhelmsson, J.-A. Gustafsson, and L. Poel-linger. 1993. Ligand-dependent recruitment of the Arnt coregulator deter-mines DNA recognition by the dioxin receptor. Mol. Cell. Biol. 13:2504–2514.

56. Wiesener, M. S., H. Turley, W. E. Allen, C. Willam, K. U. Eckardt, K. L.Talks, S. M. Wood, K. C. Gatter, A. L. Harris, C. W. Pugh, P. J. Ratcliffe, andP. H. Maxwell. 1998. Induction of endothelial PAS domain protein-1 byhypoxia: characterization and comparison with hypoxia-inducible factor-1al-pha. Blood 92:2260–2268.

57. Wisdom, R., R. S. Johnson, and C. Moore. 1999. c-Jun regulates cell cycleprogression and apoptosis by distinct mechanisms. EMBO J. 18:188–197.

58. Yamashita, K., D. J. Discher, J. Hu, N. H. Bishopric, and K. A. Webster.2001. Molecular regulation of the endothelin-1 gene by hypoxia. J. Biol.Chem. 276:12645–12653.

59. Yao, K. S., S. Xanthoudakis, T. Curran, and P. J. O’Dwyer. 1994. Activationof AP-1 and of a nuclear redox factor, Ref-1, in the response of HT29 coloncancer cells to hypoxia. Mol. Cell. Biol 14:5997–6003.

60. Zagariya, A., M. Shubangee, M. Birrer, S. Ness, B. Thimmapaya, and R.Pope. 1998. Tumor necrosis factor alpha gene regulation: enhancement ofC/EBP�-induced activation by c-Jun. Mol. Cell. Biol 18:2815–2824.

61. Zelzer, E., Y. Levy, C. Kahana, B. Z. Shilo, M. Rubinstein, and B. Cohen.1998. Insulin induces transcription of target genes through the hypoxia-inducible factor HIF-1alpha/ARNT. EMBO J. 17:5085–5094.

62. Zhang, Y., X. H. Feng, and R. Derynck. 1998. Smad3 and Smad4 cooperatewith c-Jun/c-Fos to mediate TGF-beta-induced transcription. Nature 394:909–913.

63. Zundel, W., C. Schindler, D. Haas-Kogan, A. Koong, F. Kaper, E. Chen,A. R. Gottschalk, H. E. Ryan, R. S. Johnson, A. B. Jefferson, D. Stokoe, andA. J. Giaccia. 2000. Loss of PTEN facilitates HIF-1-mediated gene expres-sion. Genes Dev. 14:391–396.



cb.asm.org/

Dow

nloaded from

http://mcb.asm.org/

c-Jun and Hypoxia-Inducible Factor 1 Functionally Cooperate in Hypoxia-Induced Gene Transcription

Documents

Transcript of c-Jun and Hypoxia-Inducible Factor 1 Functionally Cooperate in Hypoxia-Induced Gene Transcription