ORIGINAL ARTICLE

Butyricicoccus pullicaecorum in inflammatorybowel diseaseVenessa Eeckhaut,1 Kathleen Machiels,2 Clémentine Perrier,2 Carlos Romero,3

Sofie Maes,1 Bram Flahou,1 Marjan Steppe,1 Freddy Haesebrouck,1 Benedikt Sas,4

Richard Ducatelle,1 Severine Vermeire,2 Filip Van Immerseel1

▸ Additional material ispublished online only. To viewplease visit the journal online(http://dx.doi.org/10.1136/gutjnl-2012-303611).1Department of Pathology,Bacteriology and AvianDiseases, Ghent University,Faculty of Veterinary Medicine,Merelbeke, Belgium2Department ofGastroenterology, TranslationalResearch Center forGastrointestinal Disorders(TARGID), University HospitalGasthuisberg, Leuven, Belgium3Department of AnimalScience, School of AgriculturalEngineering, TechnicalUniversity of Madrid, Madrid,Spain4Centre of ExcellenceFood2Know, Ghent University,Ghent, Belgium

Correspondence toProfessor Filip Van Immerseel,Department of Pathology,Bacteriology and AvianDiseases, Ghent University,Faculty of Veterinary Medicine,Salisburylaan 133, Merelbeke9820, Belgium; filip.vanimmerseel@ugent.be

Received 24 August 2012Revised 28 November 2012Accepted 28 November 2012

To cite: Eeckhaut V,Machiels K, Perrier C, et al.Gut Published Online First:21 December 2012doi:10.1136/gutjnl-2012-303611

ABSTRACTObjective Many species within the phylum Firmicutesare thought to exert anti-inflammatory effects. Wequantified bacteria belonging to the genus Butyricicoccusin stools of patients with ulcerative colitis (UC) andCrohn’s disease (CD). We evaluated the effect ofButyricicoccus pullicaecorum in a rat colitis model andanalysed the ability to prevent cytokine-induced increasesin epithelial permeability.Design A genus-specific quantitative PCR was used forquantification of Butyricicoccus in stools from patientswith UC or CD and healthy subjects. The effect of Bpullicaecorum on trinitrobenzenesulfonic (TNBS)-inducedcolitis was assessed and the effect of B pullicaecorumculture supernatant on epithelial barrier function wasinvestigated in vitro.Results The average number of Butyricicoccus in stoolsfrom patients with UC and CD in active (UC: 8.61log10/g stool; CD: 6.58 log10/g stool) and remissionphase (UC: 8.69 log10/g stool; CD: 8.38 log10/g stool)was significantly lower compared with healthy subjects(9.32 log10/g stool) and correlated with disease activityin CD. Oral administration of B pullicaecorum resulted ina significant protective effect based on macroscopic andhistological criteria and decreased intestinalmyeloperoxidase (MPO), tumour necrosis factor α (TNFα)and interleukin (IL)-12 levels. Supernatant of Bpullicaecorum prevented the loss of transepithelialresistance (TER) and the increase in IL-8 secretioninduced by TNFα and interferon γ (IFN gamma) in aCaco-2 cell model.Conclusions Patients with inflammatory bowel diseasehave lower numbers of Butyricicoccus bacteria in theirstools. Administration of B pullicaecorum attenuatesTNBS-induced colitis in rats and supernatant of Bpullicaecorum cultures strengthens the epithelial barrierfunction by increasing the TER.

BACKGROUNDThe pathogenesis of the inflammatory boweldisease (IBD) phenotypes, Crohn’s disease (CD)and ulcerative colitis (UC), involves a complexinterplay of environmental triggers, the immunesystem, the genotype and the intestinal micro-biome.1 The prevalence of IBD is highest in NorthAmerica, northern Europe and the UK and affects100–200 patients per 100 000 people.2 Patientswith IBD experience diverse symptoms and lesionsranging from weight loss, abdominal pain, diar-rhoea and intestinal obstruction to ulceration and

What is already known on this subject?

▸ The gut microbiota composition of patientswith inflammatory bowel disease (IBD) issignificantly altered compared with healthyindividuals.

▸ Multiple studies using metagenomicsequencing tools have identified bacterialgenera that are significantly reduced orupregulated in stools and gut biopsies ofpatients with IBD. The most well known isFaecalibacterium prausnitzii, which is animportant anti-inflammatory bacterium, and isreduced in abundance in stool samples ofpatients with IBD.

▸ The bacterial genus Butyricicoccus was recentlyfound to be reduced in intestinal biopsies andstool samples from patients with IBD. However,no functional studies using a member of thisgenus have been carried out.

What are the new findings?

▸ Quantitative PCR data confirm the decreasedabundance of the genus Butyricicoccus in stoolsamples of patients with IBD.

▸ Butyricicoccus pullicaecorum is able to decreaselesion sizes and inflammation in a rat colitismodel.

▸ Supernatant of B pullicaecorum culturesprevents cytokine-induced epithelial integritylosses in an in vitro cell culture model.

How might it impact on clinical practice inthe foreseeable future?

▸ Butyricicoccus bacteria are conceptuallyattractive as probiotics because they normallyreside in the gut and could potentially result inpermanent alterations of the gastrointestinalmicrobiota.

▸ Preventive use of B pullicaecorum in patientswith IBD may have potential to prevent diseaserelapse.

Eeckhaut V, et al. Gut 2012;0:1–8. doi:10.1136/gutjnl-2012-303611 1

Inflammatory bowel disease Gut Online First, published on December 22, 2012 as 10.1136/gutjnl-2012-303611

Copyright Article author (or their employer) 2012. Produced by BMJ Publishing Group Ltd (& BSG) under licence.

group.bmj.com on June 11, 2013 - Published by gut.bmj.comDownloaded from

perforation of the gastrointestinal tract.3 The conventional treat-ment, which is generally considered supportive rather thancurative, consists of aminosalicylates, corticosteroids, immuno-modulators and antitumor necrosis factor α (TNFα) to counter-act inflammation.4 While these therapies have shown efficacy intreating the symptoms of IBD, they can induce serious sideeffects.5 In addition, these therapies do not directly affect theperturbations in the gut microbiome, termed dysbiosis, which isconsidered an important trigger of disease induction.6 Patientswith IBD exhibit a reduced bacterial biodiversity in the intestinecompared with healthy individuals. Specifically, an increase innumbers of Escherichia coli7 8 and lower counts of specific bac-terial species belonging to the Firmicutes and Bacteroidetesphyla have been documented.1 7 8 At the functional level, thebutyrate producers belonging to clostridial clusters IV and XIVaof the Firmicutes phylum are significantly less abundant in thegastrointestinal microbiome of patients with CD, explaining thedecrease in short chain fatty acid (SCFA) concentrations infaecal extracts of patients with IBD.9 Among the SCFAs, butyr-ate, the key energy source for colonocytes, exerts importanteffects on intestinal function, including the repression ofpro-inflammatory cytokine production.10 The effect of butyratehas been studied in patients with colonic inflammation usingrectal enemas. While some studies revealed an improvement inclinical and inflammatory parameters,11–13 others did not findbeneficial effects.14 Because of the effects of butyrate on gutfunction and because butyrate-producing clostridial cluster IVand XIVa bacteria seem to be depleted in the gut of patientswith IBD, oral administration of such strains may have thera-peutic benefits.

Frank et al7 showed a correlation between shifts in abundanceof the clostridial cluster IV genera Faecalibacterium andButyricicoccus, and the IBD phenotype in resected tissues frompatients with IBD. While the lower abundance of Faecalibacteriumprausnitzii in IBD has been confirmed in stool samples15 and thebeneficial effects of administration of this bacterial species in acolitis model16 has been documented, no data are available on theabundance of strains of the Butyricicoccus genus in IBD versushealthy control subjects and no data are published yet on itsanti-colitic effect. Recently, we succeeded for the first time in iso-lating and culturing a strain of the Butyricicoccus genus and namedit Butyricicoccus pullicaecorum.17 The aim of the present studywas to analyse the abundance of Butyricicoccus bacteria in stoolsamples from patients with IBD versus healthy subjects and tostudy the preventive potential of B pullicaecorum to suppress inflam-mation and concomitantly ameliorate the lesions in a 2,4,6-trinitrobenzenesulfonic acid (TNBS)-induced colitis model in rats.The effect of B pullicaecorum culture supernatant on transepithelialresistance (TER) and interleukin (IL)-8 secretion was investigatedusing a Caco-2 cell model.

METHODSQuantification of Butyricicoccus in human faecal samplesDNA extractionStool samples were collected from 88 healthy subjects (39 menand 49 women, median age 41 years), 51 patients with CD (23men and 28 women, median age 39 years) and 91 patients withUC (54 men and 37 women, median age 44 years). Of thepatients with CD, 24 were in the active phase (Harvey-BradshawIndex (HBI)≥518) and 27 were in the inactive phase (HBI<5). Ofthe patients with UC, 25 were in the active phase (Partial Mayoscore (=Mayo score without endoscopy) 2 or 319) and 66patients were in the inactive phase (score 0 or 1). None of thepatients were following a specific diet, treated with antibiotics or

using probiotics within 4 weeks before the faecal sampling. Uponcollection, the faecal samples were immediately frozen at −80°C.Total bacterial DNAwas extracted from 500 mg faeces accordingto a modified version of the protocol of Pitcher and colleagues.20

Primer designThe 16S rRNA gene sequences of 27 isolates belonging to thegenus Butyricicoccus and 31 closely related genera belonging tothe family Ruminococcaceae were obtained from NCBIGenBank and used for primer design. After multiple sequencealignment, two genus-specific primer sets spanning a targetregion of 69 and 895 bp in the 16S rRNA gene ofButyricicoccus were designed using KODON (Applied MathsBVBA, Sint-Martens-Latem, Belgium) (table 1). The selectedprimer target sites were tested for specificity by submitting thesequences to the Probe Match program provided by RibosomalDatabase Project II.21

Real-time quantitative PCRMembers of the genus Butyricicoccus were quantified using theApplied Biosystems 7500 Fast Real-Time PCR System (AppliedBiosystems, Foster City, California, USA). Amplification anddetection were carried out in 96-well plates using SYBR-greenlow ROX 2x master mix (Applied Biosystems). Each reactionwas done in triplicate in a 12 ml total reaction mixture using2 ml of appropriate dilutions of the DNA sample and 0.3 mMfinal quantitative PCR primer concentration (table 1). The amp-lification cycle used was one cycle of 95°C for 10 min, followedby 40 cycles of 95°C for 30 s, 60°C for 1 min. A stepwiseincrease of the temperature from 50°C to 95°C (at 10 s/0.5°C)was added and melting curve data were analysed to confirm thespecificity of the reaction. For construction of the standardcurve, the 895 bp long PCR product was generated using thestandard PCR primers listed in table 1 and DNA fromB pullicaecorum. After purification and determination of theDNA concentration, the volume of the linear double-strandedDNA standard was adjusted to 6.04×109 copies ml−1 assumingan average molecular weight of 660 per nucleotide pair. Thisstock solution was 10-fold serially diluted to obtain a standardseries from 6.04×107 to 6.04×101 copies ml−1. The copynumbers of samples were determined by reading off the stand-ard series with the Ct values of the samples. Gene copynumbers were expressed as log10 values per gram wet weight offaeces. To exclude a dilution effect in diarrhoea samples, a pre-cisely weighed portion of 0.5 g of each sample was taken andlyophilised. The weight difference before and after lyophilisa-tion represented the water content and was used to express thepercentage of dry faeces. Using this percentage, the gene copynumbers as log10 values per gram dry weight of faeces wascalculated.

In vivo trial with B pullicaecorumStrains, culture conditions and inoculum preparationB pullicaecorum (CCUG 55265) and F prausnitzii (M21/2)were grown overnight at 37°C in an anaerobic (84% N2, 8%CO2 and 8% H2) workstation (Ruskinn Technology, Bridgend,UK) in M2GSC broth medium22 at pH 6. The bacterial cellswere collected by centrifugation (10 min, 5000 g, 37°C) andwashed in Hank’s balanced salt solution (HBSS) withoutCa2+/Mg2+ pH 6 (Life Technologies, Bleiswijk, TheNetherlands), supplemented with 1 mg/ml cysteine-HCl(Sigma-Aldrich, St Louis, Missouri, USA). The resulting pelletwas suspended in the above-mentioned HBSS to reach a finalconcentration of 109 colony forming units (CFU)/ml. Rats were

2 Eeckhaut V, et al. Gut 2012;0:1–8. doi:10.1136/gutjnl-2012-303611

Inflammatory bowel disease

group.bmj.com on June 11, 2013 - Published by gut.bmj.comDownloaded from

daily administered 109 CFU of freshly cultivated bacteria viaintragastric gavage, under anaesthesia by inhalation of isoflurane(IsoFlo, EcuPhar Animal Health, Oostkamp, Belgium).

Rats and induction of TNBS colitisMale Wistar rats (450–500 g) were supplied by Janvier(St Berthevin, France), housed five per polycarbonate cage andmaintained on a 12 h light–dark cycle. The animals were fedstandard laboratory chow (Ssniff R/M-H, Bioservices, Uden,The Netherlands) and allowed access to water ad libitum. Allrats were acclimatised to the study conditions before enteringexperiments, at 12–14 weeks of age.

Experimental colitis was induced by a single intrarectal instil-lation of TNBS (Sigma-Aldrich) in 50% ethanol (vol/vol) follow-ing a 24 h fasting period. Enemas were gently instilled througha soft endotracheal tube (Vygon Corporation, Montgomeryville,Pennsylvania, USA) inserted 8 cm into the anus under inhalationanaesthesia with 3% isoflurane. The same procedure was usedwith rats from the non-colitic group but they were administeredphosphate-buffered saline (PBS). After instillation, the rats werekept upside down for 1 min.

All procedures involving animals were approved by theethical committee of the Faculty of Veterinary Medicine ofGhent University.

Experimental designRats were randomly allocated to four groups of 10 animals. Nobacterial strains were administered to the animals of twogroups, that is, the colitis and non-colitis control groups.Instead, for 8 consecutive days, they were inoculated intragastri-cally once a day with the vehicle (HBSS+1 mg/ml cysteine-HClpH 6). The other groups were administered 109 CFU B pullicae-corum or F prausnitzii once a day from day 7 preceding to day1 following induction of colitis. Forty-eight hours after instilla-tion of 400 ml of 25 mg/ml TNBS in 50% ethanol, all rats weresacrificed.

Necropsy and colonic damageThe body weight was recorded daily. After euthanasia usingintracardial embutramid (T61, MSD, Brussels, Belgium) injec-tion under deep isoflurane anaesthesia, the colon was removedand opened longitudinally. After gently rinsing with cold sterilesaline, the weight and length of the colon and the length of thelesion was recorded. The colon weight/colon length (g/cm) andcolon weight/body weight (mg/g) ratios were calculated as para-meters to assess the degree of colon oedema. Macroscopicassessment of the disease grade was scored using the criteriadescribed by Wallace et al23 (table 2). Segments of the colonwere taken, fixed in 10% buffered formalin and embedded inparaffin for histological examination. Other colon segmentswere frozen in liquid nitrogen and stored at −80 °C for quanti-tative analysis of MPO activity, TNFα and IL-12 concentration.

Histological scoringParaffin-embedded samples were sliced into 5 mm sections andstained with hematoxylin eosin for light microscopic examin-ation. Samples were blindly analysed for evidence of inflamma-tion by an experienced pathologist. Intestinal injury was scoredon a scale of 1–20 as described by Lahat et al24 (table 3). Foreach parameter a score was given as indicated in table 3 andthen added together with a maximum value of 20, providing aglobal assessment of colitis.

MPO activityFrozen colonic segments were assayed for MPO activity (unitsper mg of protein), as described previously.25

Cytokine measurementsCytokine levels were determined after homogenisation of colontissue in cold PBS containing a protease-inhibitor cocktail(Sigma-Aldrich). After 20 min centrifugation at 10 000 g, the

Table 2 Macroscopic scoring of colitis23

Macroscopic injury Score

Normal appearance 0Focal hyperaemia, no ulcers 1Linear ulcers without hyperaemia and bowel wall thickening 2Linear ulcers with inflammation at one site 3Two or more sites of ulceration and inflammation 4

Major sites of damage extending >1 cm along the length of the colon 5Major sites of damage extending >2 cm along the length of the colon 6–10The score was increased by 1 for each additional cm of involvement

Table 3 Histological scoring of colitis24

Parameter Scoring (0–20)

Percentage of area involved 0=normal1=<10%

Crypt loss 2=10%3=10–15%4=15–50%

Erosions 0=intact epithelium1=involvement of the lamina propria2=involvement of the submucosa3=transmural ulceration

Number of follicle aggregates 0=absentOedema 1=weakInfiltration of mononuclear andpolymorphonuclear cells

2=moderate3=severe

Table 1 Butyricicoccus-specific 16S rRNA-targeted primers

Target Forward primer Reverse primer Analysis

16S rRNA gene from Butyricicoccus species ACCTGAAGAATAAGCTCC GATAACGCTTGCTCCCTACGT qPCRnt* 473–490 nt 541–520TCGGGATGGAATCTTCCAACT TTGGTAAGGTTCTTGCGCGTT Standard PCRnt 81–101 nt 975–955

*Sequences are presented from 50 to 30 and their position in the 16S rRNA gene is given.nt, nucleotide; qPCR, quantitative PCR.

Eeckhaut V, et al. Gut 2012;0:1–8. doi:10.1136/gutjnl-2012-303611 3

Inflammatory bowel disease

group.bmj.com on June 11, 2013 - Published by gut.bmj.comDownloaded from

supernatants were used at various dilutions for quantitative ana-lysis of IL-12 and TNFα concentrations using commerciallyavailable ELISA kits (eBioscience, San Diego, California, USA).Results were expressed as picograms of cytokine per milligramof protein.

Evaluation of B pullicaecorum’s supernatant on theintestinal permeabilityTER measurementsCaco-2 cells were grown on Costar Transwell polycarbonatefilters of 65 mm diameter, and 0.4 μm pore size (CorningIncorporated, Corning, New York, USA) for 2 weeks until TERreached at least 1000 Ω*cm2. Cells were then exposed to a fil-tered supernatant of B pullicaecorum or medium complementedwith 10 and 20 mM butyrate in the apical compartment.Simultaneously cells were stimulated with or without 100 ng/mlTNFα (R&D Systems, Minneapolis, Massachusetts, USA) and100 ng/ml interferon γ (IFNγ) in the basolateral compartmentto mimic inflammation. Supernatants were diluted in Caco-2medium in a ratio of 4–6. TER was measured in duplicatebefore and 24 h after stimulation and each condition was per-formed at least in triplicate. At the end of the experiment, thebasolateral medium was harvested and stored at −20°C. IL-8was measured in that medium using an ELISA (BD Pharmingen,San Diego, California, USA).

Statistical analysisA non-parametric Mann–Whitney U test was performed tocompare the mean number of Butyricicoccus bacteria in the dif-ferent groups. All other values in the figures and tables are pre-sented as least-square means±SEM. Means of all variables,except scores, were compared using a Fisher’s protected t test.The non-parametric Kruskal–Wallis test was used to comparedifferences among groups for Wallace score and histologicalmeasurements. Differences were considered statistically signifi-cant at p<0.05.

RESULTSQuantification of Butyricicoccus bacteria in human stoolsThe average number of bacteria belonging to the genusButyricicoccus was 8.69 log10/g wet faeces and 8.38 log10/g wetfaeces respectively in patients with UC and CD in remission, 8.61log10/g wet faeces and 6.58 log10/g wet faeces respectively inpatients with UC and CD in the active disease phase and 9.32log10/g wet faeces in healthy subjects. The average number ofButyricicoccus bacteria was significantly (p<0.0001) lower in thestools of IBD patient groups compared with the healthy controls.In addition, a significantly (p<0.0188) lower level ofButyricicoccus species was observed in the faecal microbiota ofpatients with active CD compared with CD in remission (figure 1).Lyophilisation of the stool samples showed a significantly higherwater content in stools of patients with IBD compared with stoolsof the healthy subjects. Nevertheless the same significant differ-ences were observed when comparing the average number ofButyricicoccus bacteria expressed as log10 per g dry weight offaeces in stools of patients with IBD and healthy individuals (seeonline supplementary table S1).

Preventive effect of B pullicaecorum in TNBS-induced colitisAdministration of B pullicaecorum and F prausnitzii did notinduce any symptoms of diarrhoea and did not affect weightgain (data not shown). Once colitis was induced using TNBS,the B pullicaecorum-treated rats showed an overall lower impactof the TNBS treatment compared with the F prausnitzii-treatedand the colitis control group. Administration of B pullicaecorumprevented loss of body weight (figure 2). At necropsy, the non-colitis control group and the group treated with B pullicae-corum and F prausnitzii had an average body weight that wassignificantly (p<0.001) higher than the colitis control group.The anti-inflammatory effect of B pullicaecorum was evidencedmacroscopically by a significantly (p<0.001) lower macroscopicscore and a significant (p<0.001) reduction in the colon/bodyweight ratio and the colon weight/length ratio compared withthe colitis control rats (table 4). The surface area with mucosalulceration was significantly smaller in the colon of rats in theB pullicaecorum-treated group compared with the F prausnitzii-treated and colitis control group (data not shown). Histological

Figure 1 Quantification of Butyricicoccus bacteria in stool samplesfrom 142 patients with inflammatory bowel disease and 88 healthysubjects. Bacterial density is expressed as log10 copy number of 16SrRNA genes for Butyricicoccus per g of stool. ***p<0.0001;*p<0.0188. C, Crohn’s disease; UC, ulcerative colitis.

Figure 2 Effect of administration of Faecalibacterium prausnitzii andButyricicoccus pullicaecorum on body weight loss in rats withtrinitrobenzenesulfonic (TNBS)-induced colitis. Percent body weight gainor loss was calculated based on the body weight recorded on the dayof TNBS instillation (day 7). At day 9, average body weights (g) foreach group were 511b, 508b, 489b and 463ª for the non-colitis control,B pullicaecorum, F prausnitzii and colitis control groups, respectively.The body weight loss was significantly lower in the B pullicaecorumand F prausnitzii treated groups compared with the colitis controlgroup 48 h after TNBS administration. A different superscript indicatessignificant differences between the groups (p<0.05).

4 Eeckhaut V, et al. Gut 2012;0:1–8. doi:10.1136/gutjnl-2012-303611

Inflammatory bowel disease

group.bmj.com on June 11, 2013 - Published by gut.bmj.comDownloaded from

assessment of the colonic samples from rats treated with theprobiotics revealed a more pronounced recovery in the intestinalarchitecture compared with the colitis control group (table 4).The improvement in microscopic colonic damage was accom-panied by a significant (p<0.001) reduction in colonic MPOactivity (figure 3A). The colonic inflammation induced by TNBSwas characterised by significantly (p<0.001) increased levels ofcolonic TNFα and IL-12. Treatment with B pullicaecorum orF prausnitzii resulted in a significant (p<0.001) reduction ofcolonic TNFα and IL-12 levels, to a level comparable with non-colitis normal rats (figure 3B, C).

Supernatant of B pullicaecorum protects epithelial cellsfrom increase of intestinal permeability mediatedby inflammationSupernatant of B pullicaecorum culture was able to protectCaco-2 cells from the increase of intestinal permeabilitymediated by inflammatory stimulus, as TER was preserved 24 hafter stimulation with TNFα and IFNγ (figure 4A). In non-inflamed conditions, supernatant of B pullicaecorum slightly(p=0.0282) increased the TER. Interestingly, Caco-2 cellsexposed to B pullicaecorum as lyophilised bacteria diluted inCaco-2 medium were not protected. Note that the bacteria didnot grow in aerobic conditions in Caco-2 medium, suggesting

that the bacteria must be metabolically active to exert theirbeneficial effect. Since butyrate is found in supernatants ofB pullicaecorum (10 mM), we hypothesised that butyrate mightbe the protective compound. Medium complemented withincreasing concentrations of butyrate was able to confer similarprotective effect, suggesting that butyrate produced byB pullicaecorum confers the beneficial effect. Under non-inflamed conditions, IL-8 was produced in low amounts andwas slightly decreased by the supernatant or medium comple-mented with increasing concentrations of butyrate (figure 4B).When Caco-2 cells were stimulated with TNFα and IFNγ, cellsproduced large amounts of IL-8. This production was reduced(p=0.0106) when cells were coincubated with the supernatantof B pullicaecorum. Medium complemented with butyrateinduced similar protection, though less efficiently. Bacteria aloneinduced a non-significant production of IL-8 in both conditions.

DISCUSSIONIt is generally accepted that changes in the intestinal bacterialmicrobiota are associated with IBD. Evidence from severalstudies has highlighted alterations in abundance26 27 and diver-sity28 29 of the intestinal microbiota in patients with IBD com-pared with healthy individuals. Theoretically, introduction ofprobiotic bacteria, modulating the dysbiosis and aberrantimmune response observed in patients with IBD, could result inclinical improvement. Therefore, the gut microbiota hasemerged as a potential therapeutic target and a repository fornovel drug discovery.30 Commercially available probiotics usedto attenuate inflammatory activity and prevent relapses in UCare mostly Lactobacillus and Bifidobacterium species,31 selectedfor their low faecal levels in IBD and their ease of culture,storage, transport and stability within food products. In con-trast, the probiotic potential of anaerobes which constitute themass of the indigenous flora of the large intestine has been lessexplored.

Changes in the proportions of intestinal anaerobes belongingto clostridial clusters IV and XIVa have been suggested to play arole in the development of IBD.32 The relative loss of bacteriabelonging to the clostridial clusters IV and XIVa is suggested todeplete gut fluids of key anti-inflammatory metabolites andother cell-associated immunomodulatory ligands.33 Manymembers of the microbiota metabolise fibre and resistant starchto butyrate which is the key energy source for the colonocytes,34

and possesses potent anti-inflammatory properties.35 A reduc-tion in the number of these butyrate-producing bacteria can

Figure 3 Bar graph showing the effect of Butyricicoccus pullicaecorum and Faecalibacterium prausnitzii on trinitrobenzenesulfonic (TNBS)-inducedcolitis, as reflected by (A) myeloperoxidase (MPO) activity, (B) tumour necrosis factor α (TNFα) and (C) interleukin (IL)-12 concentrations.Administration of TNBS increased the levels of MPO, TNFα and IL-12 significantly compared with the non-colitis control. Treatment with eitherB pullicaecorum or F prausnitzii had a significant inhibitory effect on the upregulation of cytokine production and the MPO activity in the colonicmucosa of colitic rats. Results are the mean±SEM from 10 rats per group. Means with no common superscript differ significantly (p<0.05).

Table 4 The effect of oral administration of Faecalibacteriumprausnitzii and Butyricicoccus pullicaecorum on macroscopic andmicroscopic manifestations of TNBS-induced colitis in rats

Group

Colon/bodyweight(mg/g)

Colonweight/length(mg/cm)

Macroscopiclesion score

Microscopiclesion score

Colitis control 8.73a±0.68 173a±12.71 6.4a±0.96 15.2a±0.57F prausnitzii 8.03a±0.70 175a±16.43 4.7a±0.88 12.0b±1.05B pullicaecorum 6.25b±0.34 129b±8.73 1.8b±0.47 8.2c±1.70Non-colitis control 5.37b±0.14 104b±2.04 0b 0.8d±0.13

The non-colitis control and Butyricicoccus pullicaecorum treated group demonstratedfewer changes in colon morphology as reflected by a significantly lower colon/bodyweight and colon weight/length ratio in comparison to the Faecalibacteriumprausnitzii treated group and the colitis control group. Both treated groups showedsignificant improvement in microscopic lesion score, while the macroscopic lesionscore was only significantly lower for the B pullicaecorum treated group comparedwith the colitis control group. Different superscripts indicate significant differencesbetween the groups (p<0.05).TNBS, trinitrobenzenesulfonic.

Eeckhaut V, et al. Gut 2012;0:1–8. doi:10.1136/gutjnl-2012-303611 5

Inflammatory bowel disease

group.bmj.com on June 11, 2013 - Published by gut.bmj.comDownloaded from

thus result in a degree of focal metabolic stress and vulnerabilityto inflammatory disease.36 The most abundant butyrate produ-cers appear to be F prausnitzii, belonging to clostridial clusterIV, and Eubacterium rectale/Roseburia spp, which belong to clos-tridial cluster XIVa.37 F prausnitzii has been shown to be signifi-cantly underrepresented in stool samples15 and in surgicallyresected intestinal tissue7 from patients with IBD. The IBDphenotype could also be correlated with a lower level of theclostridial cluster IV genus Butyricicoccus.7 In the present studywe showed that Butyricicoccus species were significantly lessrepresented in the faecal microbiota from patients with UC andCD compared with healthy subjects. Moreover the Butyricicoccusgenus was shown to be significantly decreased in patients with CDwith clinically active disease compared with patients with CD withinactive disease. This finding is in agreement with the recently pub-lished study by Papa et al38 who generated a list of taxa specificallyassociated with each disease state (active IBD, remission samples,CD and UC) and showed Butyricicoccus as one of the taxa asso-ciated with remission. Butyricicoccus species belong to the samephylogenetic family (Ruminococcaceae) as F prausnitzii and areconsidered autochthonous microbes predominantly colonising themucosa-associated mucus layer of the colon of mice andhumans.39

Based on the correlation between the decreased intestinalabundance of the genus Butyricicoccus and the IBD phenotype,

we suggest that a targeted increase of these potentially beneficialbacteria could reduce the incidence and severity of inflamma-tion. We tested this hypothesis in a TNBS rat model using astrain from the Butyricicoccus genus B pullicaecorum, whichhad demonstrated desirable properties in vitro such as goodadhesion capacity and tolerance to low pH (2) and bile(3.7 mM).40 Oral administration of B pullicaecorum had a pre-ventive efficacy in controlling colitis in a TNBS model and wasat least equivalent to the effect of F prausnitzii. Treatment withB pullicaecorum was shown ineffective in protecting againstdextran sulphate sodium (DSS)-induced acute colitis (see onlinesupplementary figure S1 and table S2). The reason for the lackof protection against DSS-induced inflammation is unclear.However, the mechanism by which B pullicaecorum exerts itsprotection in TNBS-induced colitis may reside in the effect ofthe bacterium on immune regulation. Indeed, dosing withB pullicaecorum decreased the production of pro-inflammatorycytokines in the TNBS model. B pullicaecorum is able toproduce high concentrations of butyrate.41 Butyrate exerts awide array of effects on intestinal function that can potentiallycontribute to disease therapy in IBD. Butyrate is known tomodulate the transcription of numerous genes through its abilityto inhibit histone deacetylase activity, resulting in hyperacetyla-tion of histones and as a consequence suppression of nuclearfactor (NF)-κB.10 NF-κB is a key transcription factor that con-trols the expression of genes encoding pro-inflammatory cyto-kines, chemokines, acute phase proteins, adhesion moleculesand immune receptors.42 The increased mucosal levels of acti-vated NF-κB in patients with UC are reduced by butyrate, an effectwhich correlates well with disease activity.11 Recently butyrate hasbeen shown to antagonise the effect of metabolic stress in the colo-nocytes and to significantly reduce bacterial translocation.43 Thisinhibition of bacterial transcytosis across metabolically stressed epi-thelia is associated with reduced I-κB phosphorylation and henceNF-κB activation.43 In addition, NF-κB is inhibited by butyrate inmononuclear cells isolated from biopsies, and in vivo in the TNBScolitis models of IBD, resulting in decreased expression of TNFα.44

In IBD an initial upregulation of TNFα expression is observedduring flair-ups, which increases the release of reactive oxygenspecies, resulting in DNA damage and as a consequence more acti-vation of NF-κB and further TNFα, creating a perpetuating cycle.The decrease in TNFα expression in the colon of animals to whichB pullicaecorum was administered could thus be a consequence ofincreased colonic butyrate levels. In addition to the effects onNF-κB, butyrate has been demonstrated to upregulate the anti-inflammatory peroxisome proliferator-activated receptorγ (PPARγ).45 In the colonic mucosa of healthy controls PPARγprotein expression is much higher compared with the non-inflamedmucosa of patients with UC.46 Butyrate thus inhibits inflammatorypathways and stimulates anti-inflammatory pathways.

Besides anti-inflammatory effects, butyrate has also been pro-posed to reinforce the colonic defence barrier, by increasingproduction of mucins and antimicrobial peptides.47 Indeed, theotherwise repressed expression of these goblet cell-secreted pro-teins was increased by butyric acid in a TNBS-induced ratmodel of colitis.48 More so, transglutaminase activity, involvedin intestinal mucosal healing, correlates well with the severity ofinflammation in colitis and was restored to normal levels in a ratmodel of colitis using butyrate.49 Butyric acid also decreasesintestinal epithelial permeability, by increasing the expression oftight junction proteins50 and enhances proliferation of normalintestinal epithelial cells, thus leading to longer villi and anincreased absorption capacity. Altered tight junction structures51

and abnormalities in mucus barrier functions leading to

Figure 4 Caco-2 cells were grown on transwell filters andsubsequently exposed on the apical side to Butyricicoccuspullicaecorum supernatant, B pullicaecorum cells and mediumcomplemented with various butyrate concentrations. Simultaneously, inthe basolateral side, cells were either left untreated (no stimulation) orstimulated with 100 ng/ml tumour necrosis factor α (TNFα) and 100 ng/mlinterferon γ (IFNγ) to mimic colonic inflammation. (A) Changes intransepithelial resistance (TER) are expressed as percentage of original TERmeasured before stimulation. (B) Interleukin (IL)-8 production by Caco-2cells expressed in pg/ml. ***p<0.0004; *p<0.02. NS, non-significant.

6 Eeckhaut V, et al. Gut 2012;0:1–8. doi:10.1136/gutjnl-2012-303611

Inflammatory bowel disease

group.bmj.com on June 11, 2013 - Published by gut.bmj.comDownloaded from

excessive bacterial translocation52 are characteristics of IBD thatcan thus be reverted by butyric acid. We showed that the super-natant including secreted metabolic components and butyratefrom B pullicaecorum increased the TER, suggesting that meta-bolically active B pullicaecorum influence the epithelial barrierfunction. Although actions of butyrate are the most logical wayto explain the effects observed in our study, there are multipleother possibilities, such as the production of other metabolitesand the induction of a global shift in the microbiotacomposition.

Reconditioning of the gut microbiota through direct supple-mentation with beneficial bacteria or by indirect stimulation ofcolonisation and proliferation of beneficial bacteria could play aprotective role in the inflammatory process. This is particularlythe case for diseases in which the indigenous microbiota isaltered due to the pathological condition, such as is the case inIBD. Although probiotic bacteria do not seem to be able to cureactive disease, butyrate producers may be given to patients withIBD in times of remission to prevent disease relapse.

In conclusion, B pullicaecorum is a clostridial cluster IVspecies which seems to be a good candidate for use as a pro-biotic with anti-inflammatory potential. If a probiotic effect wasconfirmed in humans, future studies would be essential tounravel its mechanism of action and targets.

Acknowledgements The authors would like to thank Professor H. Flint whokindly provided Faecalibacterium prausnitzii M21/2. We also thank Karolien Claes forrunning quantitative PCRs and Christian Puttevils for paraffin embedding andhistological staining. Professor R Titball is acknowledged for critical review of themanuscript and improvement of language style.

Contributors VE initiated the study. VE, SM, BF and MS were responsible for theanimal study. KM and VE carried out quantitative PCR analysis. CP performed invitro cell culture assays. CR performed the statistical analyses. BS, FH, RD, SV andFVI participated in the study design. Overall supervision of the research project wasdone by RD, SV and FVI. All authors were involved in the interpretation of resultsand the critical revision of the manuscript. All authors approved the finalmanuscript.

Funding This work was supported by the Institute of Science and Technology,Flanders (IWT), under contract no SBO-100016.

Competing interests V Eeckhaut, B Sas, R Ducatelle, F Haesebrouck and F VanImmerseel are listed as coinventors on a patent application for use ofbutyrate-producing bacterial strains related to Butyricicoccus pullicaecorum in theprevention and/or treatment of intestinal health problems (International ApplicationNumber PCT/EP2010/052184 and International Publication Number WO2010/094789 A1).

Ethics approval The Ethics Committee of the University of Leuven.

Patient consent Obtained.

Provenance and peer review Not commissioned; externally peer reviewed.

REFERENCES1 Spor A, Koren O, Ley R. Unravelling the effects of the environment and host

genotype on the gut microbiome. Nat Rev Microbiol 2011;9:279–90.2 Cho JH. The genetics and immunopathogenesis of inflammatory bowel disease. Nat

Rev 2008;8:458–66.3 Hendrickson BA, Gokhale R, Cho JH. Clinical aspects and pathophysiology of

inflammatory bowel disease. Clin Microbiol Rev 2002;15:79–94.4 Mowat C, Cole A, Windsor A, et al. Guidelines for the management of

inflammatory bowel disease in adults. Gut 2011;60:571–607.5 Toruner M, Loftus EV Jr, Harmsen WS, et al. Risk factors for opportunistic infections

in patients with inflammatory bowel disease. Gastroenterology 2008;134:929–36.6 Sun L, Nava GM, Stappenbeck TS. Host genetic susceptibility, dysbiosis, and viral

triggers in inflammatory bowel disease. Curr Opin Gastroenterol 2011;27:321–7.7 Frank DN, Robertson CE, Hamm CM, et al. Disease phenotype and genotype are

associated with shifts in intestinal-associated microbiota in inflammatory boweldiseases. Inflamm Bowel Dis 2011;17:179–84.

8 Iebba V, Aloi M, Civitelli F, et al. Gut microbiota and pediatric disease. Dig Dis2011;29:531–9.

9 Huda-Faujan N, Abdulamir AS, Fatimah AB, et al. The impact of the level of theintestinal short chain fatty acids in inflammatory bowel disease patients versushealthy subjects. Open Biochem J 2010;4:53–8.

10 Place RF, Noonan EJ, Giardina C. HDAC inhibition prevents NF-kappa B activationby suppressing proteasome activity: down-regulation of proteasome subunitexpression stabilizes I kappa B alpha. Biochem Pharmacol 2005;70:394–406.

11 Luhrs H, Gerke T, Muller JG, et al. Butyrate inhibits NF-kappaB activation in laminapropria macrophages of patients with ulcerative colitis. Scand J Gastroenterol2002;37:458–66.

12 Vernia P, Annese V, Bresci G, et al. Topical butyrate improves efficacy of 5-ASA inrefractory distal ulcerative colitis: results of a multicentre trial. Eur J Clin Investig2003;33:244–8.

13 Scheppach W, Sommer H, Kirchner T, et al. Effect of butyrate enemas on the colonicmucosa in distal ulcerative colitis. Gastroenterology 1992;103:51–6.

14 Steinhart AH, Hiruki T, Brzezinski A, et al. Treatment of left-sided ulcerative colitiswith butyrate enemas: a controlled trial. Aliment Pharmacol Ther 1996;10:729–36.

15 Joossens M, Huys G, Cnockaert M, et al. Dysbiosis of the faecal microbiota inpatients with Crohn’s disease and their unaffected relatives. Gut 2011;60:631–7.

16 Sokol H, Pigneur B, Watterlot L, et al. Faecalibacterium prausnitzii is ananti-inflammatory commensal bacterium identified by gut microbiota analysis ofCrohn disease patients. Proc Natl Acad Sci U S A 2008;105:16731–6.

17 Eeckhaut V, Van Immerseel F, Teirlynck E, et al. Butyricicoccus pullicaecorum gen.nov., sp. nov., an anaerobic, butyrate-producing bacterium isolated from the caecalcontent of a broiler chicken. Int J Syst Evol Microbiol 2008;58:2799–802.

18 Harvey RF, Bradshaw JM. A simple index of Crohn’s-disease activity. Lancet1980;1:514.

19 Schroeder KW, Tremaine WJ, Ilstrup DM. Coated oral 5-aminosalicylic acid therapyfor mildly to moderately active ulcerative colitis. A randomized study. N Engl J Med1987;317:1625–9.

20 Vanhoutte T, Huys G, Brandt E, et al. Temporal stability analysis of the microbiota inhuman feces by denaturing gradient gel electrophoresis using universal andgroup-specific 16S rRNA gene primers. FEMS Microbiol Ecol 2004;48:437–46.

21 Maidak BL, Cole JR, Lilburn TG, et al. The RDP-II (Ribosomal Database Project).Nucleic Acids Res 2001;29:173–4.

22 Miyazaki K, Martin JC, Marinsek-Logar R, et al. Degradation and utilization ofxylans by the rumen anaerobe Prevotella bryantii (formerly P. ruminicola subsp.brevis) B(1)4. Anaerobe 1997;3:373–81.

23 Wallace JL, MacNaughton WK, Morris GP, et al. Inhibition of leukotriene synthesismarkedly accelerates healing in a rat model of inflammatory bowel disease.Gastroenterology 1989;96:29–36.

24 Lahat G, Halperin D, Barazovsky E, et al. Immunomodulatory effects of ciprofloxacinin TNBS-induced colitis in mice. Inflamm Bowel Dis 2007;13:557–65.

25 Yang J, Wu R, Qiang X, et al. Human adrenomedullin and its binding proteinattenuate organ injury and reduce mortality after hepatic ischemia-reperfusion. AnnSurg 2009;249:310–17.

26 Frank DN, St Amand AL, Feldman RA, et al. Molecular-phylogenetic characterizationof microbial community imbalances in human inflammatory bowel diseases. ProcNatl Acad Sci U S A 2007;104:13780–5.

27 Walker AW, Sanderson JD, Churcher C, et al. High-throughput clone library analysisof the mucosa-associated microbiota reveals dysbiosis and differences betweeninflamed and non-inflamed regions of the intestine in inflammatory bowel disease.BMC Microbiol 2011;11:7–19.

28 Ott SJ, Musfeldt M, Wenderoth DF, et al. Reduction in diversity of the colonicmucosa associated bacterial microflora in patients with active inflammatory boweldisease. Gut 2004;53:685–93.

29 Lepage P, Hasler R, Spehlmann ME, et al. Twin study indicates loss of interactionbetween microbiota and mucosa of patients with ulcerative colitis. Gastroenterology2011;141:227–36.

30 Shanahan F. Therapeutic implications of manipulating and mining the microbiota.J Physiol 2009;587:4175–9.

31 Meijer BJ, Dieleman LA. Probiotics in the treatment of human inflammatory boweldiseases: update 2011. J Clin Gastroenterol 2011;45:S139–44.

32 Maslowski KM, Vieira AT, Ng A, et al. Regulation of inflammatory responses by gutmicrobiota and chemoattractant receptor GPR43. Nature 2009;461:1282–6.

33 Nagalingam NA, Lynch SV. Role of the microbiota in inflammatory bowel diseases.Inflamm Bowel Dis 2011;18:968–84.

34 Mai V, Draganov PV. Recent advances and remaining gaps in our knowledge ofassociations between gut microbiota and human health. World J Gastroenterol2009;15:81–5.

35 Hamer HM, Jonkers D, Venema K, et al. Review article: the role of butyrate oncolonic function. Aliment Pharmacol Ther 2008;27:104–19.

36 Schoultz I, Soderholm JD, McKay DM. Is metabolic stress a common denominator ininflammatory bowel disease? Inflamm Bowel Dis 2011;17:2008–18.

37 Louis P, Flint HJ. Diversity, metabolism and microbial ecology of butyrate-producingbacteria from the human large intestine. FEMS Microbiol Lett 2009;294:1–8.

38 Papa E, Docktor M, Smillie C, et al. Non-invasive mapping of the gastrointestinalmicrobiota identifies children with inflammatory bowel disease. PloS One 2012;7:e39242.

Eeckhaut V, et al. Gut 2012;0:1–8. doi:10.1136/gutjnl-2012-303611 7

Inflammatory bowel disease

group.bmj.com on June 11, 2013 - Published by gut.bmj.comDownloaded from

39 Nava GM, Stappenbeck TS. Diversity of the autochthonous colonic microbiota. GutMicrobes 2011;2:99–104.

40 Geirnaert A, Debruyne B, Eeckhaut V, et al. In vitro evaluation of the uppergastrointestinal passage of a novel butyrate producing isolate to counterbalancedysbiosis in inflammatory bowel disease. Commun Agric Appl Biol Sci2012;77:195–9.

41 Eeckhaut V, Van Immerseel F, Croubels S, et al. Butyrate production inphylogenetically diverse Firmicutes isolated from the chicken caecum. MicrobBiotechnol 2011;4:503–12.

42 Jobin C, Sartor RB. NF-kappaB signaling proteins as therapeutic targets forinflammatory bowel diseases. Inflamm Bowel Dis 2000;6:206–13.

43 Lewis K, Lutgendorff F, Phan V, et al. Enhanced translocation of bacteria acrossmetabolically stressed epithelia is reduced by butyrate. Inflamm Bowel Dis2010;16:1138–48.

44 Segain JP, Raingeard de la Bletiere D, Bourreille A, et al. Butyrate inhibitsinflammatory responses through NFkappaB inhibition: implications for Crohn’sdisease. Gut 2000;47:397–403.

45 Kinoshita M, Suzuki Y, Saito Y. Butyrate reduces colonic paracellular permeability byenhancing PPARgamma activation. Biochem Biophys Res Commun2002;293:827–31.

46 Dubuquoy L, Jansson EA, Deeb S, et al. Impaired expression of peroxisomeproliferator-activated receptor gamma in ulcerative colitis. Gastroenterology2003;124:1265–76.

47 Barcelo A, Claustre J, Moro F, et al. Mucin secretion is modulated by luminal factorsin the isolated vascularly perfused rat colon. Gut 2000;46:218–24.

48 Song M, Xia B, Li J. Effects of topical treatment of sodium butyrate and5-aminosalicylic acid on expression of trefoil factor 3, interleukin 1beta, and nuclearfactor kappaB in trinitrobenzene sulphonic acid induced colitis in rats. Postgrad MedJ 2006;82:130–5.

49 D’Argenio G, Calvani M, Della Valle N, et al. Differential expression of multipletransglutaminases in human colon: impaired keratinocyte transglutaminaseexpression in ulcerative colitis. Gut 2005;54:496–502.

50 Peng L, Li ZR, Green RS, et al. Butyrate enhances the intestinal barrier by facilitatingtight junction assembly via activation of AMP-activated protein kinase in Caco-2 cellmonolayers. J Nutr 2009;139:1619–25.

51 Zeissig S, Burgel N, Gunzel D, et al. Changes in expression and distribution ofclaudin 2, 5 and 8 lead to discontinuous tight junctions and barrier dysfunction inactive Crohn’s disease. Gut 2007;56:61–72.

52 Marks DJ. Defective innate immunity in inflammatory bowel disease: a Crohn’sdisease exclusivity? Curr Opin Gastroenterol 2011;27:328–34.

8 Eeckhaut V, et al. Gut 2012;0:1–8. doi:10.1136/gutjnl-2012-303611

Inflammatory bowel disease

group.bmj.com on June 11, 2013 - Published by gut.bmj.comDownloaded from

doi: 10.1136/gutjnl-2012-303611 published online December 22, 2012Gut

 Venessa Eeckhaut, Kathleen Machiels, Clémentine Perrier, et al. inflammatory bowel diseaseButyricicoccus pullicaecorum in

http://gut.bmj.com/content/early/2012/12/21/gutjnl-2012-303611.full.htmlUpdated information and services can be found at:

These include:

Data Supplement http://gut.bmj.com/content/suppl/2012/12/21/gutjnl-2012-303611.DC1.html

"Supplementary Data"

References http://gut.bmj.com/content/early/2012/12/21/gutjnl-2012-303611.full.html#ref-list-1

This article cites 52 articles, 15 of which can be accessed free at:

P<P Published online December 22, 2012 in advance of the print journal.

serviceEmail alerting

the box at the top right corner of the online article.Receive free email alerts when new articles cite this article. Sign up in

CollectionsTopic

(848 articles)Crohn's disease   � (1040 articles)Ulcerative colitis   �

 Articles on similar topics can be found in the following collections

(DOIs) and date of initial publication. publication. Citations to Advance online articles must include the digital object identifier citable and establish publication priority; they are indexed by PubMed from initialtypeset, but have not not yet appeared in the paper journal. Advance online articles are Advance online articles have been peer reviewed, accepted for publication, edited and

http://group.bmj.com/group/rights-licensing/permissionsTo request permissions go to:

http://journals.bmj.com/cgi/reprintformTo order reprints go to:

http://group.bmj.com/subscribe/To subscribe to BMJ go to:

group.bmj.com on June 11, 2013 - Published by gut.bmj.comDownloaded from

Notes

(DOIs) and date of initial publication. publication. Citations to Advance online articles must include the digital object identifier citable and establish publication priority; they are indexed by PubMed from initialtypeset, but have not not yet appeared in the paper journal. Advance online articles are Advance online articles have been peer reviewed, accepted for publication, edited and

http://group.bmj.com/group/rights-licensing/permissionsTo request permissions go to:

http://journals.bmj.com/cgi/reprintformTo order reprints go to:

http://group.bmj.com/subscribe/To subscribe to BMJ go to:

group.bmj.com on June 11, 2013 - Published by gut.bmj.comDownloaded from