A

imSatBdosOrt©

Km

trlTf

R

0d

Available online at www.sciencedirect.com

Molecular Immunology 45 (2008) 1385–1397

Bovine TLR2 and TLR4 properly transduce signals from Staphylococcusaureus and E. coli, but S. aureus fails to both activate NF-�B in

mammary epithelial cells and to quickly induce TNF� andinterleukin-8 (CXCL8) expression in the udder

Wei Yang a,1, Holm Zerbe b, Wolfram Petzl b, Ronald Marco Brunner a, Juliane Gunther a,Christian Draing c, Sonja von Aulock c, Hans-Joachim Schuberth d, Hans-Martin Seyfert a,∗

a Research Institute for the Biology of Farm Animals (FBN), Wilhelm-Stahl-Allee 2, 18196 Dummerstorf, Germanyb Clinic for Ruminants, Ludwig-Maximilians-University, Sonnenstr. 16, 85764 Oberschleißheim, Germany

c Biochemical Pharmacology, POB M655, University of Konstanz, 78457 Konstanz, Germanyd Institute for Immunology, Veterinary School, University of Hannover, Bischofsholer Damm, 30173 Hannover, Germany

Received 31 July 2007; received in revised form 5 September 2007; accepted 5 September 2007Available online 22 October 2007

bstract

Staphylococcus aureus, but not E. coli pathogens frequently cause subclinical, chronic infections of the mammary gland. We examined here, ifnadequate activation of the bovine TLR2 and TLR4 pathogen receptors by ligands derived from S. aureus pathogens might contribute to molecular

echanisms underpinning the escape strategies from mammary immune defence of this pathogen. We show that infections with live E. coli, but not. aureus pathogens induce strongly IL-8 and TNF� gene expression in the udders. Yet, preparations of heat-killed bacteria from both pathogensctivate equally well bovine TLR2 and TLR4 receptors to induce NF-�B activation, as shown in the HEK293 reconstitution system of TLR-signalransduction. LTA prepared from the S. aureus strain used to infect the cows activates the bovine TLR2 as strongly as the entire, heat-killed pathogen.oth pathogens induce in primary bovine mammary epithelial cells (pbMEC) IL-8 and TNF� gene expression, but S. aureus to less than 5% of theegree caused by E. coli. This impaired proinflammatory activation is paralleled by a complete lack of NF-�B activation in pbMEC by S. aureusr LTA. In contrast, E. coli and LPS activate strongly NF-�B in these cells. A large proportion of this activation is attributable to TLR-mediatedignalling, since a dual transdominant negative DN-MyD88-DN-TRIF factor blocks >80% of the pathogen-related NF-�B activation in pbMEC.

ur results prove that impaired binding of TLR-ligands from the pathogenic S. aureus strain are not the cause for the inadequate mammary immune

esponse elicited by this pathogen. Rather, the pathogen causing subclinical mastitis impairs NF-�B activation in MEC thereby severely weakeninghe immune response in the udder.

2007 Elsevier Ltd. All rights reserved.

; LTA

eywords: Bovine; Chemokines; Cow; Cytokines; HEK293; Inflammation; LPS astitis; TLR

Abbreviations: CFU, colony forming unit; DN, transdominant nega-ive; GFP, green fluorescent protein; MyD88, myeloid differentiation primaryesponse gene 88; PAMPs, pathogen associated molecular patterns; LPS,ipopolysaccharide; LTA, lipoteichionic acid; S.E.M., standard error of the mean;LR, toll-like-receptor; TRIF, TIR-domain-containing adaptor inducing inter-

eron beta (also known as TICAM1).∗ Corresponding author. Tel.: +49 3808 768 713; fax: +49 3808 768 702.

E-mail address: seyfert@fbn-dummerstorf.de (H.-M. Seyfert).1 Now at: Department of Anesthesiology, Duke University Medical Center,esearch Drive, Durham, NC 27710, USA.

1

tfqCirad

161-5890/$ – see front matter © 2007 Elsevier Ltd. All rights reserved.oi:10.1016/j.molimm.2007.09.004

; Mastitis; Primary mammary epithelial cells; Signal transduction; Subclinical

. Introduction

Infections and inflammations of the mammary gland (masti-is) are a severe threat to the host. They pose not only a problemor women (Fetherston, 2001), but represent also the most fre-uent and costly disease in dairy cows (Seegers et al., 2003).hronic, subclinical infections are of particular relevance. They

mpair the well-being of the host and cause ∼80% of all mastitiselated costs in dairy industries, due to both reduced milk yieldnd product quality (Shim et al., 2004). The rate of mastitis inci-ence has been quite stable for decades. Approximately 30% of

1 mun

ts

ea2hoSsHgpsuait(

ttto(tJOclawvHtt2

fniYtoibdDN2

ttp(t2

c(nemps(Twa2

TwHSrtcii

soosbeiertcaTqfiniWoa

2

2

dtae

386 W. Yang et al. / Molecular Im

he cows carry mastitis pathogens and about one third of all cowsuffer from mastitis once a year (Tenhagen et al., 2006).

The outcome of an infection of the mammary gland is influ-nced by the species of the infecting bacterial pathogen (Rainardnd Riollet, 2006; Bannerman et al., 2004c; Riollet et al.,000a,b). Gram negative Coliform bacteria very often causeeavy, acute inflammations with clinical symptoms. In contrast,ther pathogens, like the gram positive Streptococcus uberis ortaphylococcus aureus tend to cause less severe clinical, oftenubclinical inflammations (Sutra and Poutrel, 1994; Smith andogan, 1993). Such pathogens may persist in the mammaryland for long periods, sometimes life long. Consequently, theseathogens represent also the most prevalent mastitis causingpecies (Tenhagen et al., 2006). The molecular mechanismsnderpinning escape strategies from the host’s immune defencere entirely unclear (Sordillo and Streicher, 2002). However,t was noted that S. aureus pathogens causing subclinical infec-ions elicit only a very weak proinflammatory cytokine responseBannerman et al., 2004c; Riollet et al., 2000a).

Perceiving the presence of a pathogen is the first and manda-ory step to setting in motion the immune defence againsthe invading pathogen. Mammals are equipped with a bat-ery of receptors sensing the presence molecular componentsf pathogens. The 13 different mammalian toll-like-receptorsTLRs) represent the best-described family of such ‘pat-ern recognition receptors’ (PPRs) (Akira and Takeda, 2004;aneway and Medzhitov, 2002; Aderem and Ulevitch, 2000;zinsky et al., 2000). Some of these receptors span across the

ell membrane and bind bacterial ligands with their extracellu-ar domain. TLR2, for example, is known to bind lipoteichioniccid (LTA) from gram positive bacteria (Schroder et al., 2003),hile the protein A moiety of lipopolysaccharide is the rele-ant ligand for TLR4 (Palsson-McDermott and O’Neill, 2004;irschfeld et al., 2000). Upon ligand binding, the intracellular

oll-interleukin-receptor domain of the TLR becomes compe-ent to bind other, auxiliary factors (O’Neill, 2006; West et al.,006).

Successful TLR signalling mostly involves inclusion of theactor MyD88 (Takeuchi and Akira, 2001). However, TLR3 sig-alling appears to be MyD88 independent, rather requiring thenclusion of TRIF as an auxiliary factor (Oshiumi et al., 2003;amamoto et al., 2003). One can evaluate the contribution of

he TLR-dependent pathways to the pathogen-specific inductionf proinflammatory gene expression by simultaneously block-ng the function of both factors, MyD88 and TRIF. This cane achieved by overexpressing together in the same cells trans-ominant negative MyD88 factors, lacking the N-terminal Deathomain and transdominant negative TRIF-factors, lacking their- and C-termini (Kawai and Akira, 2005; Yamamoto et al.,002).

All TLR signal transduction pathways are known to even-ually activate NF-�B factors (Hatada et al., 2000). Thisranscription factor complex consists of a family of five different

roteins, the p50, p52, p65 (or RelA), c-Rel and RelB proteinsHayden et al., 2006). They are stored in the cytoplasm in an inac-ive form, bound to the inhibitor of NF-�B (I�B) (Scheidereit,006). The pathogenic signal ultimately leads to the proteolytic

2tos

ology 45 (2008) 1385–1397

leavage of the I�B complex, liberating active NF-�B factorsHacker and Karin, 2006). They may subsequently enter theucleus and bind to their cognate sequences on target promoters,ither as hetero- or as homo-dimers. A wealth of proinflam-atory regulated genes feature NF-�B attachment sites in their

roximal promoter region and this factor complex acts as a mainwitch to orchestrate a whole battery of immune defence genesTian et al., 2005a,b; Karin and Lin, 2002; Saccani et al., 2001).hese include also the bactericidal �-defensin-encoding geneshose expression is strongly induced in the udder of the cow

s a consequence of mastitis (Yang et al., 2006; Swanson et al.,004; Diamond et al., 2000).

We observed recently in a field study increased levels ofLR2 and TLR4 mRNA molecules in udders acutely infectedith either E. coli or with S. aureus (Goldammer et al., 2004).ence, the cow may eventually respond to an infection with. aureus pathogens by increasing the abundance of this TLReceptor which is particularly relevant to perceive gram posi-ive S. aureus pathogens. However, this previous observationould not be correlated with any information as to whether thencreased TLR2 and 4 repertoires of the glands would result inmproved pathogen perception.

We recently established a mastitis model allowing a moreystematic investigation of the host response towards acuter subclinical mastitis causing pathogens. The model is basedn the infection of healthy lactating cows with asseveratedtrains of E. coli and S. aureus pathogens, which had previouslyeen isolated from infected udders. We anticipate that earlyvents in the udder may crucially determine the outcome of themmune reaction. It may either result in a strong inflammation,licited by pathogens causing acute mastitis, or the immuneeaction may be weak, tolerating to some extent survival ofhe subclinical mastitis causing pathogens. We report here onhanges in the expression of several diagnostic cytokines earlyfter infection or inoculation of the pathogens into the udder.hese cytokines serve as paradigms for the qualitative anduantitative activation of the immune response in the udder. Wend that our subclinical mastitis causing S. aureus strain doesot elicit any induced cytokine synthesis early after infection,n stark contrast to the acute mastitis causing E. coli strain.

e examine in model cells if impaired signalling downstreamf TLR2 is the reason why the S. aureus pathogens do notdequately alert the immune defence in the udder.

. Materials and methods

.1. Experimentally induced mastitis

We have previously established an animal model to study theifferential alert and activation of the immune mechanisms inhe udder following infections with pathogen models for acutend subclinical mastitis, respectively. A short description of thexperimental model has already been given (Vanselow et al.,

006). Briefly, healthy cows in the 4th month of their first lacta-ion were with 500 CFU of live E. coli strain 1303 or 10,000 CFUf live S. aureus strain 1027 pathogens, each made up in 2 ml ofaline. These strains of pathogenic bacteria had previously been

muno

au1rtmmtwgs

2

tcatPkmriwcaqctst

2

pg

2

JEpbp

∼ap8cco

2

Asctcbrsrpd(

2

TTeNpF

2

fMo(fbc

TP

G

TIIIT

◦

W. Yang et al. / Molecular Im

sseverated from true cases of bovine mastitis. From any cow,dder quarters were infected sequentially at times 0 h, 12 h and8 h into the experiment. One quarter was kept as a control andeceived an infusion of 2 ml of sterile saline only. All udder quar-ers were sampled at time 24 h into the experiment. The experi-

ent had been conducted in two sessions, consisting of four ani-als each. In each session two animals were arbitrarily assigned

o become infected with E. coli, while the other two were infectedith S. aureus. Tissue samples were snap frozen in liquid nitro-en, immediately after culling the animals. Details regardingample collection have been described (Vanselow et al., 2006).

.2. RNA extraction and mRNA titration with real time PCR

RNA extraction with TRIZOL (Invitrogen), cDNA prepara-ion with Superscript plus (Invitrogen) and subsequent purifi-ation with columns (Roche) was as described (Goldammer etl., 2004). This reference describes also the general procedureso determine the mRNA copy numbers with quantitative RT-CR using the LightCycler device and the Sybr Green Fast Startit (both from Roche). All parameters from each sample wereeasured from a single cDNA, primed with a mix of specific

everse primers for each mRNA species. Primers used are listedn Table 1. cDNA aliquots equivalent to 75 ng of total RNA inputere distributed to individual vials and the respective amplifi-

ation primers added. All samples were run out on agarose gelsfter the LightCycler run to verify in ethidium stained gels theuality of the amplification products. Copy numbers were cal-ulated from standard curves established with serial dilutions ofhe subcloned and sequenced reference plasmid. The dilutionspanned the range of concentrations from 1 × 106 copies downo 10 copies per assay.

.3. Preparation of pathogen-related stimuli

We used as pathogen-related stimuli heat-killed bacteria andreparations of purified LPS or LTA, representing PAMPs ofram negative and gram positive bacteria, respectively.

.3.1. Heat-killed bacteriaThe laboratory safety strain E. coli XL-1 blue (Stratagen, La

olla, CA, USA) was grown in LB broth, while the pathogenic

. coli strain 1303 was grown in Brain Heart Infusion. Theathogenic S. aureus strain 1027 was cultivated in tryptic soyroth. All bacteria were harvested in the early logarithmichase of culture grow (OD600, 0.5), representing approximately

bwafi

able 1rimers used for real time PCR determination of mRNA copy numbers

ene Forward primer Reverse primer

NF� CTTCTGCCTGCTGCACTTCG GAGTTGATGTCGGCTL-8 CCTCTTGTTCAATATGACTTCCA GGCCCACTCTCAATAL-12p40 TGGTCGTTTCCTGGTTTTC GTTTTGCCAGAGCCCL-10 GTGGAGAAGGTGAAGAGAGTC CATTGGCATCGAAGTGF-� TTTCCGCTTCAACGTGTCCT TGCTTGGCTATGTGC

C, measuring temperature of fluorescent intensity; bp, length of amplificates; directi

logy 45 (2008) 1385–1397 1387

5 × 107 cells/ml. Cultures of E. coli XL1-blue were incubatedt 60 ◦C for 30 min, to kill all bacteria. Killing was verified bylating. E. coli 1303 and S. aureus 1027 required incubation at0 ◦C for 60 min to heat-kill all bacteria. Cells were subsequentlyollected (3000 rpm, 15 min), washed twice in RPMI1640 tissueulture growth medium and stored at −20 ◦C at a concentrationf 5 × 108 bacteria/ml.

.3.2. PAMPsLPS from E. coli 0127:B8 was purchased from Sigma–

ldrich (St. Louis, MO, USA). LTA was prepared from S. aureustrain 1027, which was also used for in vivo infections of liveows in this study. These bacteria were cultured aerobically in aryptic soy broth (25 g/l) containing beef extract (5 g/l) and glu-ose (8 g/l) and harvested after 18 h (stirring at 37 ◦C, 150 rpm)y centrifugation at 4225 × g for 20 min. Integrity of bacte-ia and potential contaminations with gram negative bacterialpecies were checked by Gram staining and microscopy. Bacte-ia were stored frozen at −20 ◦C before LTA extraction. LTA wasrepared from the bacteria using the butanol extraction proce-ure and hydrophobic interaction chromatography, as describedMorath et al., 2001).

.4. Plasmid constructions

The establishment of CMV driven expression constructs forLR2 and TLR4 has already been described (Yang et al., 2006).his paper reports also the construction of the SV40 drivenxpression constructs of the factors MD2 and CD14 and of theF-�B measuring plasmid, which was based on the ELAMromoter of the pNiFty-SEAP plasmid (InvivoGen, Toulouse,rance).

.4.1. Transdominant negative MyD88Construction of a transdominant negative bovine MyD88

actor required the isolation and sequencing of the bovineyD88 factor. To this end we exploited a 3′-terminal sequence

f the bovine MyD88 factor from the GenBank data baseaccession number AY634627) to retrieve in BLAST searchesrom the cow genome shotgun database at http://www.hgsc.cm.tmc.edu/blast/?organims=Btraus) a sequence file (IDont388923) containing most the coding sequence of the

ovine MyD88 factor. The missing 5′-terminus of the factoras identified by BLAST searches of the human factor

gainst the bovine genome sequence file draft and wasnally identified on file ID Contig389562. To amplify in

cDNA primer ◦C bp

ACAACG CTGTGAGTAGATGAGGTAAAGC 84 156ACTCTC CATGGAACAATGTACATGCGAC 81 170AAGAC TGGACCAAATTCCATCTTCC 81 205TCTGTAC CATGGAACAATGTACATGCGAC 79 176TCACC CAAGAGCCATTCACGCACAG 83 156

on of all sequences is 5′ to 3′.

1 mun

RRGr(t(ssm(a

tDpaaeaqr(iSGtcpfNptCGmawlc

2n

TussTRa(Ts(aw

l(mtAGufscpftetcntf�s

2

cHf

womDLfpiatifwbbtfrwlatk

388 W. Yang et al. / Molecular Im

T-PCR the entire bovine factor from bovine mammary glandNA we used the primers 5′-CGCCATGGCTGAA-GGA-TAC and 5′-AGGCATGTCCAGCGATCGAG (forward and

everse, respectively). The amplification product was subclonedour clone 1093) into pGEMTeasy (Promega), sequenced andhe cDNA sequence was deposited in the EMBL databaseAcc. No. AJ853453). The conceptual translation of the cDNAequence revealed that the encoded protein has a high degree ofequence similarity to the orthologous factors from human andouse (86% and 76%, respectively). The encoded TIR domain

from aa residues 163 to 292) is 95% and 91% similar to humannd mouse counterparts.

To establish a transdominant negative deletion mutant ofhis factor we used PCR techniques to delete the N-terminaleath Domain of the bovine MyD88 factor. We used therimers ATC AACTAGTATGGGCATCACCATTCGCGACGAnd GTAGAATTCGGGCATGGACAGGGCCTTGG (forwardnd reverse) to amplify from the cDNA clone a TIR domain-ncoding segment (from aa residues 146 to 296) and to introducet the same time SpeI and EcoRI sites (underlined) for subse-uent cloning steps. These restriction enzymes were used toetrieve the DN-MyD88-encoding fragment from the subclonedpGEMTeasy, Madison, WI, USA) amplificates and to insert itnto a modified pGL3 control vector (Promega) harbouring atreptactin binding domain from the pASK-IBA43plus (IBA,ottingen, Germany). The resulting DN-MyD88factor was thus

agged at the carboxy-terminus with the eight aa residuesomprising Strep-Tag. Hence, the application of an alkalinehosphatase (AP)-conjugated Streptactin (IBA) allowed veri-ying the expression of the DN-MyD88 factor in Western blots.ext we changed the expression vector to exploit our CMVromoter driven vector 280. To reamplify the insert, we usedhe oligonucleotide primers 5′-GTACTAACATACGCTCTC-ATC (forward) and 5′-ATAGGATCCTTATTTTTCGAACT-CGGGTGG (reverse) binding immediately in front of the pro-oter and on the Streptactin binding domain, respectively. This

mplificat was digested with HindIII and BamHI (introducedith the reverse primer, underlined) and cloned into the simi-

arly digested clone 280. Expression of the construct in HEK293ells was verified in Western blots (not shown).

.4.2. Dual transdominant negative MyD88-transdominantegative TRIF factor (dual DN-MyD88-TRIF)

The previously unknown cDNA sequence of the bovineRIF factor was established with a strategy similar to the onesed for MyD88 characterization. We used the human TRIFequence to identify in BLAST searches a bovine genomicequence (Sequence ID Contig233699) harbouring the bovineRIF-encoding gene. The TRIF cDNA was established byT-PCR, using mammary gland total RNA as a templatend the primers TAACTAGTACCTGAGCCCATGGCCTGCCforward) and CAAAGTCGAGGTCATCAGGTCC (reverse).he resulting amplificates were subcloned into pGEMTeasy,

equenced and the sequence deposited in the EMBL databaseAcc. No. AJ879588). The bovine TRIF factor comprises 760 aa,nd the TIR domain of the bovine factor shares 80% similarityith the human factor.

idsr

ology 45 (2008) 1385–1397

To establish a transdominant negative TRIF factor, we fol-owed the scheme as previously established for the human factorYamamoto et al., 2002). We deleted the N- and C-termini andaintained the middle part of the factor, from aa position 424

o 578, encoding the TIR domain of this factor. The primersTAGAATTCCTGGAGTCGTCCGAGCAGAA (forward) andTAGAATTCCCTCCACTTGGCCTTGCGG (reverse) weresed to amplify the respective fragment of the bovine TRIFactor and clone it via the inserted EcoRI sites into the EcoRIite of the DN-MyD88 factor. The properly oriented clone (ourlone 1158) was identified via sequencing. It contains on oneolypeptide chain N-terminally the truncated bovine MyD88actor, followed by the central part of the bovine TRIF-factor anderminated by the Streptactin tag. The fusion protein is properlyxpressed, as verified at hand of protein extracts from transientlyransfected HEK293 cells probed in Western blots with the AP-onjugated Streptactin (WY, unpublished). The transdominantegative TRIF function had been verified by demonstrating thathis dual DN-MyD88-DN-TRIF factor, but not the DN-MyD88actor could completely abrogate the induction of the human-IFN promoter by LPS in the TLR4-dependent HEK293 recon-titution model of TLR signalling (WY, thesis, unpublished).

.5. Cells, transfection and luciferase assay

Establishment of the primary bovine mammary epithelia cellultures, the reconstitution of the TLR-signalling cascade inEK293 cells and the assay of luciferase activity were per-

ormed virtually as described (Yang et al., 2006).All plasmid DNAs used for transfection of mammalian cells

ere prepared free of endotoxins. To this end we used the Nucle-Bond Plasmid Maxi EF Purification Kit, as prescribed by theanufacturer (BD Biosciences, San Jose, CA, USA). PlasmidNAs were transiently transfected into tissue culture cells usingipofectamin 2000 (Invitrogen, Karlsruhe, Germany). To trans-

ect a single well of a six well plate, we prepared two differentremixes. Premix one consisted of up to 3 �g of DNA dissolvedn 100 �l of the salt base from the DMEM medium, withoutny additives. The second premix consisted of 6 �l of Lipofec-amin 2000, suspended in the same medium. Each premix wasncubated for 5 min, before both were combined and incubatedor another 20 min. Meanwhile, the cells (80% confluent) wereashed twice with PBS and covered with 800 �l of DMEM saltase medium. The 200 �l of the premix were added and incu-ated. After 3 h, 1 ml of DMEM medium, supplemented withwice the complement of all usual additives (including 20%oetal calf serum) were added and the cells were allowed toecover over night. Next they were split and distributed to a 24ell plate for stimulation experiments. To this end, the stimu-

ating agents (either inactivated bacteria or LPS or LTA) weredded immediately and left together with the cells for the dura-ion of the experiment. This transfection protocol was previouslynown as a standard transfection protocol. We describe it here

n detail, since a recently suggested simplification of this proce-ure does not perform well in our laboratory. The modificationuggests adding the DNA into complete growth medium. Thiseduces in our hands the transfection efficacy down to 10–20%

muno

otc

3

3

Eespefiisls(

ccc

F(utioi

hRuiiccqms

ff1t(piif

3

W. Yang et al. / Molecular Im

f that as achieved with the original protocol. More importantly,he extent of bacterial TLR2 or TLR 4 activation in HEK293ells became quite variable and not well reproducible.

. Results

.1. Different degrees of mastitis elicited by both pathogens

Details of the clinical evaluation of the infection trial with. coli strain 1303 and S. aureus strain 1027 will be presentedlsewhere (Petzl et al., submitted for publication). The E. colitrain 1303 established a strong acute mastitis infection 24ost-infection in all four cows. Clear signs of the successfullystablished infections were, for example, the development ofever within 12 h after infection, swelling and hardening of thenfected udder quarters and a strong recruitment of somatic cellsnto the first infected udder quarter (Fig. 1A). Also, the caseinynthesis was virtually blunted 24 h after infection and histo-ogical examinations of the 24 h infected quarters showed clearigns of mastitis related alterations of the tissue morphologyVanselow et al., 2006).

Inoculation of S. aureus strain 1207 into the udder also causedonsistently and quickly (within 12 h) a recruitment of somaticells into the gland, as shown by increased numbers of somaticells into the milk (Fig. 1B). This response indicates that the

ig. 1. Somatic cell scores in the milk of various udder quarters. Mean valueserror bars, S.E.M.) of the number of somatic cells/ml of milk from the fourdder quarters. The different symbols represent individual quarters infected atimes after beginning of the experiment, as indicated in the legend. (A) Quartersnfected with 500 CFU E. coli, strain 1303 and (B) infected with 10,000 CFUf S. aureus, strain 1027. Cows were milked immediately prior to pathogennfusion as well as 12 h and 24 h later.

i

stdertTa

Imfv2sqe(n(atrmtotntbii

logy 45 (2008) 1385–1397 1389

ost recognized the presence of the pathogen inside the udder.egarding the recruitment of somatic cells into the udder, it isnclear in the moment why E. coli inoculations caused a strongncrease in cell number in the first infected quarter only, block-ng a similar increase in subsequently infected quarters, whileonversely the S. aureus inoculations caused a steep rise in theell numbers of all quarters, including the not infected controluarter. The phenomenon as such shows, however, that all ani-als analysed perceived the pathogen presence and responded

ystemically to it.The infection potential of S. aureus strain 1027 is different

rom the E. coli strain used, resembling what is known as typicalor pathogens causing subclinical mastitis. The S. aureus strain027 did not cause any clinical signs of inflammation duringhe first 24 h of infection. It took a longer period of observation48–74 h post-infection) in other experiments to verify that thisathogenic strain does indeed have the potential to cause clinicalnfections. The manifestation of infections caused by this strains variable, influenced by host and even udder quarter specificactors.

.2. Live E. coli pathogens, but not S. aureus, elicit a strongnduction of IL-8 and TNFα gene expression in the udder

We profiled infection related changes in the expression ofelected cytokines in experimentally infected udders as parame-ers for the extent of proinflammatory stimulation of the immuneefence. We chose to measure TNF� and IL-12 as known mark-rs for the induction of a TH1 response, and IL-10 as a TH1esponse antagonist. IL-8 was included, since it is involved inhe recruitment of polymorph nuclear granulocytes (PMNs) andGF-� expression was measured as a factor necessary for PMNctivation.

The pathogenic E. coli strain caused a strong induction ofL-8 and TNF� gene expression in the infected quarters. TheRNA concentrations of IL-8 and TNF� increased >50 or 100-

old already 12 h post-infection (Fig. 2A) and reached maximalalues (180- and 300-fold, for IL-8 and TNF�, respectively) after4 h of pathogen presence. IL-10 and IL-12 expression were alsotrongly induced after 24 h of pathogen presence in the udderuarter (40- and 60-fold, IL-10 and IL-12, respectively). Thexpression of TGF-�, on the other hand, remained unchanged1.6-fold, 24 h quarters). In contrast, the S. aureus infections didot change significantly the expression of any of these genesFig. 2B). However, the animals perceived the presence of the S.ureus pathogens, since they responded systemically to infec-ion. The uninfected control quarters of S. aureus infected cowsevealed significantly (p, 0.0036, t-test) higher levels of TGF-�RNA abundance than measured in the respective controls of

he E. coli infected animals (Table 2). IL-8 expression, on thether hand, was found greatly enhanced in the control quarters ofhe E. coli infected cows. However, this elevated mean value wasot statistically different from that of the S. aureus control quar-

ers, due to the large variance. These results show that E. coli,ut not S. aureus infection provokes a strong proinflammatorynduction of TNF� and IL-8 synthesis. The failure of cytokinenduction following the S. aureus infection is not caused by an

1390 W. Yang et al. / Molecular Immun

Fig. 2. Cytokine mRNA concentrations in udder quarters, infected for differenttimes with E. coli or S. aureus pathogens. (A) Udder quarters from four cowshad sequentially been infected with either 500 CFU of E. coli pathogens, at time0 h, 12 h and 18 h into the experiment. RNA was extracted after 24 h and therelative mRNA copy numbers of TNF�, IL-8, IL-12, IL-10 and TGF-� (opensquares) was determined. Means (ordinate; error bars, S.E.M.) are expressed asmultiples from the uninfected control quarters. All mean values from the 24 hpost-infection samples are significantly different from the control values (t-test orMhb

eop

3c

pebb

3

rmtatm

vNimosoTtHDTmDbtTiDwcmOmt

3s

srbao

TC

pMM

N

ann–Whitney test, p < 0.05), except for TGF-�. (B) Same as (A) but quartersad been infected with 10,000 CFU of S. aureus pathogens. All differencesetween the means of different time groups are statistically insignificant.

xcessive induction of the IL-10-encoding gene, an antagonistf proinflammatory induction, since IL-10 is not induced by thisathogen, but quite strongly by the E. coli strain.

.3. Isolated bovine TLR2 or TLR4 receptors areomparably activated by both pathogens

We used the HEK293 reconstitution system of TLR-mediatedathogen-dependent signal transduction to examine, if the inad-quate proinflammatory activation by S. aureus pathogens mighte due to a failure of the relevant bovine TLRs to recognize andind ligands from the S. aureus pathogens.

lot

t

able 2omparison of cytokine mRNA abundance in control quarters and cultures of pbME

TNF� IL-8

bMEC 112 ± 14 376 ± 12G, E. coli 301 ± 117 4617 ± 2509G, S. aureus 568 ± 106 333 ± 141

is 4, for any value; statistical significance vs. E. coli (t-test): **p < 0.01.

ology 45 (2008) 1385–1397

.3.1. Validation of the systemWe verified first, that the TLR-expression vector chosen

esults in proper localization of the encoded factor in the cellembrane of the HEK293 cells. To this end, we had tagged

he bovine TLR2-encoding cDNA carboxy-terminally with GFPnd resolved the cytoplasmic localization of the protein withhe Laser-Scanner microscope. The protein decorates the cell

embrane, as expected (insert, Fig. 3A).Pilot experiments revealed quickly that heat-killed bacteria of

arious strains and different PAMPs (LPS and LTA) resulted inF-�B activation in the HEK293 reconstitution system. These

nductions could be entirely blocked by co-transfecting a 10-foldolar excess of transdominant negative mutants (DN-mutant)

f either TLR receptor, serving as another control of this modelystem (WY thesis, unpublished). Also, co-transfecting 2 �gf the DN-mutants of MyD88 or the dual DN-MyD88-DN-RIF together with 100 ng of either TLR completely blocked

he TLR2- and TLR4-dependent signal transduction in theEK293 cell system (Fig. 3A). The DN-MyD88 and the dualN-MyD88-DN-TRIF mutants had been established to blockLR-dependent signal transduction in primary bovine mam-ary epithelial cells (pbMEC; see below). Aside from theN-MyD88 factor we established a dual factor, harbouringoth, the DN-MyD88 and the DN-TRIF domain on one pro-ein to ensure that both DN-domains reside in the same cell.his molecule should allow complete abrogation of any TLR-

nvolving pathway of pathogen-related signal transduction. TheN-TRIF function of this dual DN-MyD88-DN-TRIF factoras verified in a separate set of experiments by showing that our

onstruct blocks completely induction of the human IFN-� pro-oter in TLR4 expressing HEK293 cells (WY, unpublished).ur finding that both DN-constructs block TLR2- or TLR4-ediated signal transduction in the HEK293 cells proves that

his cell system works as expected in our experiments.

.3.2. E. coli and S. aureus activate TLR2 and TLR4 toimilar extents

We applied this system to titrate the capacity of both pathogenpecies and their PAMPs to activate the bovine TLR2 and TLR4eceptors (Fig. 3B). We found that preparations of heat-killedacteria from the pathogenic S. aureus strain activate both, TLR2nd TLR4 to the same extent as similar preparations of the lab-ratory safety strain XL-1 blue from E. coli. Interestingly, theaboratory safety strain E. coli XL-1 blue is a stronger inducer

f TLR2 than the E. coli strain 1303, which is highly virulent inhe udder of the cow.

However, in contrast to the stimulation data obtained by usinghe complete pathogens, we found that LTA prepared from our

C [copies/100 ng RNA equivalent]

TGF-� IL-10 IL-12

348 ± 23 4 ± 3 48 ± 1755 ± 75 393 ± 200 11 ± 11

2145 ± 291** 150 ± 110 166 ± 85

W. Yang et al. / Molecular Immuno

Fig. 3. Reconstitution of TLR-dependent signal transduction in HEK293 cellsand titration of TLR-mediated NF-�B induction. (A) Transdominant negativeMyD88 or dual DN-MyD88-DN-TRIF block the TLR2- or TLR4-mediatedpathogen-dependent NF-�B induction in HEK293 cells. The cells were co-transfected with the NF-�B reporter plasmid and expression constructs ofthe respective TLR-factor (indicated), either without (hatched columns) or amolar excess of the DN-MyD88 or dual-DN-MyD88-DN-TRIF (black and opencolumns, respectively) expression constructs. We co-transfected for the TLR2system 50 ng pELAM-Renilla and 100 ng TLR2 vector with 2 �g empty vec-tor, 2 �g DN-MyD88 or 2 �g DN-MyD88-TRIF. For TLR4, we co-transfected50 ng pELAM-Renilla, 200 ng CD14, 200 ng MD2 and 400 ng TLR4 vector with2 �g empty vector and 2 �g DN-MyD88 or 2 �g DN-MyD88-TRIF. The cellswere stimulated with heat-killed 107/ml E. coli-XL1 blue for 18 h. The Renilla-luciferase activity of the NF-�B reporter plasmid was expressed as multiple fromthe unstimulated control culture. Means (ordinate, ±S.E.M.) from two exper-iments are indicated, each assayed in triplicate. Both DN-constructs entirelyblock the induction. Insert: Laser-scanning microscope image of HEK293 cellsafter transient transfection with a GFP-tagged version of the bovine TLR2expression construct reveals proper localization of the TLR2 protein in the cellmembrane (arrow). Construction of the DN-MyD88 and dual DN-MyD88-DN-TRIF factors is based on our deposits of the bovine sequence Acc. No. AJ853453and Acc. No. AJ879588 for MyD88 and TRIF, respectively. (B) Titration ofthe NF-�B induction capacity of various pathogens and PAMPs in HEK293cells. Expression constructs for TLR2 or TLR4 (black and empty columns,respectively) were co-transfected with the NF-�B reporter plasmid and the cul-tures either left unstimulated, or stimulated for 18 h with heat-killed (107 ml−1)pathogens or PAMPs (LPS, 1 �g/ml, LTA, 10 �g/ml), as indicated. Mean valuesof the Renilla luciferase activities from stimulated cultures (ordinate, ±S.E.M.)from three to five independent experiments are expressed as multiples fromthe unstimulated control cultures. LPS stimulates barely (1.5-fold) the TLR2reT

pecT

aT1swptatgtte

3r(

tuTcbthi(g

cacub(s

tba3tpItccd

iefabundance of both, IL-8 and TNF� mRNA peaked 3 h after

eceptor, while LTA virtually fails to activate TLR4, as expected. Note, how-ver, that both gram negative as well as gram positive bacteria stimulate bothLR-receptors.

athogenic S. aureus strain activates TLR2, but not TLR4, as

xpected. Likewise, TLR4 is strongly activated by the commer-ially available LPS preparation. This LPS preparation activatesLR2 only to a small extent (1.5 ± 0.04-fold) and only if applied

sai

logy 45 (2008) 1385–1397 1391

t the relatively high concentration of 1 �g/ml. The LPS relatedLR2 induction is absent (1.04-fold), if this PAMP is applied at00 ng/ml (data not shown). Given this proven ligand-specificignalling in our HEK293 reconstitution system, it was some-hat unexpected to find that heat-inactivated bacteria of bothathogen species activate both, TLR2 and TLR4. This indicateshat the complete, unfractionated bacteria contain relevant lig-nds for TLR2 and TLR4 in addition to, and different fromhe well-known PAMPs LPS and LTA of gram negative andram positive bacteria, respectively. The data together show thathe bovine TLR2 and TLR4 receptors are strongly activated byhe pathogenic S. aureus strain as used in the in vivo infectionxperiments.

.4. Both pathogens elicit a proinflammatory cytokineesponse in primary bovine mammary epithelial cellspbMEC), but E. coli much stronger than S. aureus

Mammary epithelial cells (MEC) are the principle and by farhe most abundant cell type in the mammary alveoli of healthydders (compare Vanselow et al., 2006 for histological images).hey are highly immune competent, as demonstrated by theirapacity to strongly induce the expression of the bactericidaleta-defensin peptides after stimulation with pathogenic bac-eria (Yang et al., 2006). Hence, we compared the potential ofeat-killed bacteria from both pathogenic strains, as used for then vivo infections, to induce in cultures of primary bovine MECpbMEC) the expression of the same set of cytokine-encodingenes, as characterized from the infected udders.

Heat-killed E. coli and S. aureus pathogens both activateytokine expression in pbMEC. The mRNA concentrations forll the respective cytokine-encoding genes found in the untreatedontrol MEC cultures is comparable to those measured in theninfected udder quarters, except for IL-10 (Table 2). The MECarely express IL-10 as has already been previously recognizedStrandberg et al., 2005). Cells other than MEC must be theource for this cytokine in the udder.

E. coli induces very rapidly and massively the expression ofhe IL-8- and TNF�-encoding genes (Fig. 4A). The abundance ofoth mRNAs rose as quickly as 30 min after induction (4.4 ± 1.0nd 2.6 ± 1.4-fold), and increased on average 75 ± 28-fold and3± fold (mean values ± S.E.M. of IL-8 and TNF�, respec-ively) within an hour after stimulation. The mRNA levelseaked 3 h after stimulation (630 ± 61 and 183 ± 15-fold forL-8 and TNF�, respectively) and dropped subsequently, downo ∼200- or ∼80-fold (IL-8 and TNF�, respectively) over theontrol values 6 h after stimulation. Expression of the otherytokine-encoding genes, however, did not change significantlyuring induction.

Stimulations with heat-killed S. aureus preparations resultedn a similar time course and pattern of induced cytokinexpression (Fig. 4B). Levels of IL-8 mRNA were already five-old increased, as quickly as 30 min after stimulation. The

timulation (13- and 10-fold, for IL-8 and TNF�, respectively)nd dropped subsequently. However, the absolute extent ofnduction was much lower (�5%) than that caused by E.

1392 W. Yang et al. / Molecular Immunology 45 (2008) 1385–1397

Fig. 4. E. coli and S. aureus pathogens both induce IL-8 and TNF� expressionin pbMEC, albeit S. aureus to a lesser extent. pbMEC cultures were stimu-lated for various times (abscissa) with 107 ml−1 of the heat-killed pathogens(E. coli strain 1303, S. aureus strain 1027), as indicated and the relative mRNAcopy numbers of the various cytokine-encoding genes measured (same set ofcytokines and symbols as in Fig. 2). Mean values from two stimulations areexpressed as multiple of the unstimulated controls (ordinate, ±S.E.M.). E. coliinduces very quickly (within 1 h already) the IL-8 and TNF� mRNA concentra-tae

ci(Har

3N

NacwmpbaoN

Fig. 5. Extent and pathogen-dependent proportion of activated NF-�B inpbMEC. (A) Pathogen- or PAMP-dependent NF-�B induction in pbMEC isquenched by DN-MyD88 or the dual DN-MyD88-DN-TRIF factor. pbMECcultures were transfected with 100 ng of the NF-�B reporter plasmid, eitheralone (open columns), or together with increasing amounts of DN-MyD88 orDN-MyD88-DN-TRIF constructs. The concentrations were 0.2 �g, 1 �g, 4 �gper assay (columns with different textures, from left to right) of the respec-tive DN-factors, as indicated. Cultures were stimulated for 17 h with either100 ng/ml LPS, or 107/ml of the heat-killed pathogens (E. coli strain 1303, S.aureus strain 1027), as indicated. Mean activities of the NF-�B reporter plasmids(ordinate, ±S.E.M.) from two independent experiments are indicated. The dualDN-MyD88-DN-TRIF factor quenches the NF-�B activation more efficientlythan the DN-MyD88 factor alone. S. aureus does not cause any activation ofNF-�B factors. (B) Differential activation of NF-�B in pbMEC by E. coli, S.afL

it

ibloDDqDt

ions significantly (75- and 33-fold, respectively). Both pathogens induce IL-8nd TNF� expression with similar kinetics, but S. aureus to only <5% of thextent as caused by E. coli.

oli. Nevertheless, the expression of both genes was stronglynduced and the induction was statistically highly significantp < 0.001, t-test, comparing the mean values of 3 h vs. control).ence, the MEC recognize the presence of S. aureus pathogens

nd mount a weak, yet clearly recognizable proinflammatoryesponse.

.5. S. aureus and LTA do not increase levels of activeF-κB in pbMEC, unlike E. coli and LPS

Activation of TLRs is known to result in the activation ofF-�B. Given our results that in principal the bovine TLR2

nd TLR4 receptors are capable to activate NF-�B factors withomparable efficacies in the HEK293 reconstitution system,e wanted to measure the quantitative contribution of TLR-ediated signalling to the proinflammatory NF-�B activation in

bMEC. We also wanted to know if this parameter is modulated

y the pathogen species. To this end we co-transfected increasingmounts of transdominant negative (DN) expression constructsf MyD88 and the dual DN-factor, DN-MyD88-DN-TRIF with aF-�B reporter plasmid to monitor pathogen-related alterations

hboa

ureus and LTA. Same as (A), but without adding DN-constructs, applying dif-erent concentrations of S. aureus pathogens or LTA, as indicated. S. aureus andTA fail to increase levels of active NF-�B.

n NF-�B activity as a relevant parameter for the stimulation ofhe immune response in these cells.

E. coli or LPS increased the concentration of active NF-�Bnside the pbMEC. While the extent of increase varied somewhatetween experiments (4–11-fold) significantly increased NF-�Bevels were always observed using these stimuli. This activationf NF-�B could be quenched by higher concentrations of bothN-factors, DN-MyD88 and DN-MyD88-DN-TRIF (Fig. 5A).N-MyD88 and the dual factor DN-MyD88-DN-TRIF bothuenched more than 80% of the NF-�B activation, the dualN-MyD88-DN-TRIF factor somewhat more effectively

han DN-MyD88 alone. Similar results were obtained using

eat-killed E. coli pathogens as a stimulus. However, it maye noted that we were unable to completely block the E. coli-r LPS-dependent induction of NF-�B activity in pbMEC,lthough this is easily achieved in HEK293 cells (Fig. 3A). The

muno

dfcioaiowa

oMNuwrhpcria

svHibacTua

rpttimc

4

tkiEimtoTwc

aopNoi

4p

ihtouuiBCs

spfttBTnaiitSc2tii

io8aaMsHidai

W. Yang et al. / Molecular Im

osage-dependent blockage by the dual DN-MyD88-DN-TRIFactor revealed that transfecting 1 �g DNA of the cDNAonstruct expressing this factor was as effective as 4 �g. Thisndicates that we titrated out completely the blocking potentialf this factor. While the residual 1.5-fold induction of NF-�Bctivation might be considered as small compared to the 11-foldnduction measured without the DN-factor in this particular setf experiments, it nevertheless means that the cells respondedith a 50% increase in active NF-�B factors upon the stimuli

lbeit an entirely inactivated TLR-dependent signalling cascade.S. aureus, on the other hand, did not elicit any activation

f NF-�B factors in pbMEC (Fig. 5A), nor did the dual DN-yD88-DN-TRIF factor have any influence on the level ofF-�B activity. The lacking effect of S. aureus application wasnexpected, given that the cells did respond to the pathogenith weak proinflammatory activation (Fig. 4B). However, we

epeated the experiment applying different concentrations ofeat-killed pathogens as well as different concentrations of LTA,urified from this particular S. aureus strain. The comparisononfirmed entirely our previous results (Fig. 5B). We could notecord any altered or increased levels of NF-�B activity result-ng from these stimulations. Thus, neither S. aureus nor LTActivate NF-�B in MEC.

The data based on the dual DN-MyD88-DN-TRIF factorhow that a large proportion of pathogen-associated NF-�B acti-ation in MEC may be attributed to TLR-mediated signalling.ence, the complete lack of NF-�B activation in different exper-

mental settings involving S. aureus or LTA as challenges muste triggered by a mechanism different from TLR. This block-ge of NF-�B activation is related to MEC rather than HEK293ells, given the proven capability of S. aureus to activate theLR2 and TLR4 receptors in the latter cell system, using stim-lated NF-�B activity as a parameter for ligand-specific TLRctivation.

Our data altogether prove that the bovine TLR2 and TLR4eceptors are in principal competent to recognize both strains ofathogenic bacteria, which have been used for the in vivo infec-ions. However, only E. coli alerts the host’s immune defence inhe udder, while the S. aureus strain fails to do so. Both pathogensnduce the expression of some cytokine-encoding genes in MEC

odel cells in vitro, unlike live bacteria in the udder of theow.

. Discussion

We analyse in this study whether lesions in the TLR-mediatedransduction of pathogen signals are responsible for the well-nown fact that S. aureus pathogens elicit a much weakermmune defence in the udder of the cow than, for example,. coli. The failure to strongly activate the immune system, as

ndicated by a diminished cytokine response following infection,ight be causative for those sustained subclinical udder infec-

ions, which are quite characteristic for S. aureus caused cases

f mastitis. We show, as first key observation that the bovineLR2 and TLR4 receptors recognize killed S. aureus pathogensith signal intensities of similar magnitude as elicited by E.

oli, using the NF-�B activation capacity of the TLR receptors

doig

logy 45 (2008) 1385–1397 1393

s a parameter. However, we show as second, very novel keybservation, that the TLR-mediated signal from S. aureus or itsurified PAMP LTA does not activate the transcription factorF-�B in MEC cells. The failure to activate this key regulatorf immune processes presents a likely cause for the diminishedmmune response elicited by this pathogen.

.1. Weak TNFα induction during mastitis caused by gramositive bacteria

The S. aureus strain 1027 caused only a moderate increasen somatic cells in the milk. Weak, delayed and even transientost reactions are typical for infections with gram positive bac-eria (see Rainard and Riollet, 2006 for a review). The virulencef our pathogenic S. aureus 1027 strain appears to be atten-ated if compared, for instance, to that of the more widelysed S. aureus strain N305, which established clinical infectionsn all cows after application of only very few CFU (74 CFU,annerman et al., 2004c). We found the application of 10,000FU necessary to reliably establish udder infections with our

train.We used mastitis related increased intramammary cytokine

ynthesis of a spectrum of cytokines to quantify the extent ofroinflammatory alert of the mammary immune defence. Weound in keeping with other studies, that the E. coli, but nothe S. aureus strain caused a strong proinflammatoric activa-ion of TNF� and IL-8 expression in vivo (Schmitz et al., 2004;annerman et al., 2004c; Riollet et al., 2000a). DiminishedNF� induction following udder infection with S. aureus, butot with E. coli was also measured in milk cells, which arelways recruited into the mammary gland as a consequence ofnfection (Lee et al., 2006). A survey of other studies regardingnduced TNF� synthesis as a consequence of mastitis revealshat the gram negative bacteria Klebsiella pneumoniae anderratia marcescens were both found to increase the TNF� con-entration in the milk quickly and strongly (Bannerman et al.,004a, 2004b). The same authors observed that the gram posi-ive pathogen Streptococcus uberis caused only a weak increasen the TNF� concentration in milk, occurring at later times afternfection.

The immunological consequences of a diminished TNF�nduction may be quite severe. TNF� functions not only torchestrate the induction of cytokine synthesis, including IL-(Standiford et al., 1990) and recruitment of leukocytes early

fter infection, but may also induce the formation of granulomas,ssisting efficient pathogen elimination (Roach et al., 2002).oreover, it controls the activation of two different downstream

ignalling pathways, of AP1 and of NF-�B (Tian et al., 2005b).ence, a deficiency in TNF� induction may impair NF-�B

nduction which, in turn cuts off an important arm of the immuneefence (Hacker and Karin, 2006; Karin and Lin, 2002). Onlyvery limited number of studies compared the TNF� induc-

ng potential between gram negative and gram positive bacteria

uring mastitis. Given the severe immunological consequencesf an altered TNF� induction, it might be worth systematicallynvestigating possible differences between gram positive andram negative bacteria in this regard.

1 mun

4N

TpLTpiUi

kttjgeorNtvsHcn

rasrpapiius

4

poastfsbaMieb

cbwajkpaaIuLairvtwirsrsvw2

tNsfCaiaptciili

apLtpaNpa

394 W. Yang et al. / Molecular Im

.2. S. aureus and LTA induce TLR2- and TLR4-mediatedF-κB activation in HEK293 cells

We have used the well-established reconstitution system ofLR signalling in HEK293 cells (Bauer et al., 2001) to com-are heat-killed E. coli and LPS with heat-killed S. aureus andTA regarding their strength to activate the bovine TLR2 orLR4. We compare in this setting the passive TLR-activationotential of the respective bacteria, free of potentially confound-ng effects from virulence factors produced by the live bacteria.sing UV-inactivated bacteria yields similar results, as verified

n respective control experiments (not shown).It was somewhat unexpected to find that the entire, heat-

illed pathogens of either species activate both receptors inhe HEK293. This indicates that the entire pathogens con-ain more PAMPs as activators for the respective TLR thanust LTA from the gram positive S. aureus or LPS from theram negative E. coli. TLR independent side effects can bexcluded, since we did not observe any NF-�B induction with-ut co-transfecting the respective TLR together with the NF-�Beporter plasmid. Moreover, the pathogen- or PAMP-inducedF-�B activation can completely be inhibited either by co-

ransfecting a molar excess of a transdominant negative mutatedersion of the respective TLR receptor (data not shown, the-is WY), or of the dual transdominant MyD88-TRIF factor.ence, the NF-�B induction as measured in HEK293 cells can

learly and exclusively be attributed to the respective TLR sig-alling.

Importantly, the data show that the bovine TLR2 and TLR4eadily bind PAMPs from the particular S. aureus strain 1027nd respond with activation of NF-�B transcription factors in aimilar strength as elicited by E. coli. Hence, the relevant bovineeceptors are competent to recognize gram negative and gramositive pathogens and to relay this signal on to the appropri-te key mediator, the NF-�B factor complex. This excludes theossibility that the failure of the S. aureus pathogen to alert themmune defence in the udder would be due to ‘escape’ mutationsn the PAMPs, rendering the cattle pathogenic S. aureus strainsndetectable by the pathogen receptors of the innate immuneystem.

.3. S. aureus and LTA do not activate NF-κB in MEC

The isolated MEC in culture perceive the presence of the gramositive pathogens, since heat-inactivated S. aureus pathogensr their LTA provoke a clear but very weak induction of TNF�nd IL-8 synthesis in these cells. Pathogen presence was indeedignalized into the cells, but their response was much weakerhan elicited by heat-killed E. coli. LPS has previously beenound to induce a much stronger and more sustained expres-ion of the TNF�- and IL-8-encoding genes in isolated primaryovine MEC than LTA, very similar to our results (Strandberg etl., 2005). However, two studies analysing infections of bovine

EC with live S. aureus pathogens reported a fairly strong

nduction TNF� and IL-8 synthesis (Wellnitz and Kerr, 2004),ventually faster and stronger early after infection than elicitedy E. coli (Lahouassa et al., 2007).

iAss

ology 45 (2008) 1385–1397

These differences regarding time course and extent of inducedytokine synthesis as reported in the various studies cannot reallye reconciled at the moment. Understanding these differencesould require a direct experimental comparison. Obviously, it isdifferent system to infect MEC with live pathogens rather that

ust challenging them with PAMPs, either in the form of heat-illed bacteria or with purified LPS or LTA preparations. Liveathogens will express their repertoire of virulence factors, withll their confounding effects on the host. Moreover, the studiesre difficult to compare for experimental and technical reasons.n one of the studies, the levels of the TNF� mRNA in the unstim-lated control cultures differed vastly (�100-fold) between thePS and S. aureus control cultures (ct values of 10 vs. 16 for LPSnd S. aureus, respectively). Hence, stimulations expressed asnduction folds over the levels measured in the control culturesesulted in extremely different absolute mRNA copy numbers,ery much higher in the LPS stimulated cultures than found inhe S. aureus infected cultures. The reported respective ct valuesere ct 6 for the LPS treated culture and 10 for the S. aureus

nfected culture. The E. coli infections, as used in the other study,esulted in an unusually delayed induction of TNF� and IL-8ynthesis, with peak values 24 h post-infection. We observe aapid increase reaching peak values 3 h post-stimulation and aubsequent decline. Our time course resembles that from a pre-ious report in bovine MEC (Strandberg et al., 2005) and whatas observed after LPS infusion into udders (Schmitz et al.,004).

We used the dual transdominant negative MyD88-TRIF fac-or to show that the largest proportion of E. coli- or LPS-relatedF-�B activation in MEC may be attributed to the TLR driven

ignalling cascade. This excludes the possibility, that PPRs dif-erent from TLRs, like the CATERPILLER-NOD family or theARD-containing class of proteins (see Hayden et al., 2006 forreview) rather than TLRs might quantitatively be of prime

mportance to mount pathogen-specific immune defence mech-nisms in MEC. The failure, however, to block entirely theathogen-induced and TLR-mediated signal transduction withhe dual transdominant negative MyD88-TRIF factor might indi-ate the operation of a TLR independent surveillance mechanismn MEC. It has recently been postulated that such a mechanisms activated in macrophages, when the gram positive intracellu-ar living pathogens Listeria monocytogens and Bacillus subtilisnvaded the cytoplasm (McCaffrey et al., 2004).

The failure of our S. aureus strain to increase the levels ofctive NF-�B in the MEC from the udder of the cow presents aaradox. The dead but complete bacteria, as well as the isolatedTA activate the TIR domain of the bovine TLR2 to increasehe level of active NF-�B in HEK293 cells. Thus, the failure torovoke the same effect in MEC might indicate the activation ofcell type dependent blocking mechanism of TLR-dependentF-�B activation, mediated by the heat-inactivated S. aureusathogens or even just the LTA isolated from this strain. This S.ureus related blocking of NF-�B activation in MEC is elicited

n the absence of secreted virulence factors of the pathogen.ssuming the operation of a MEC-specific, hence cell type-

pecific blocking of LTA-dependent NF-�B activation is alsoupported by the observation that LTA prepared according to

muno

twaItn2

bfimsMt(auadtet2uaM

5

(

(

(

(

(

A

aADgEo

R

A

A

B

B

B

B

B

D

F

G

H

H

H

H

H

W. Yang et al. / Molecular Im

he same procedure and in the same laboratory, indeed, as itas used in this study, was found to very strongly induce TNF�

nd IL-8 synthesis in human neutrophiles (Hattar et al., 2006).rrespective of the causative mechanism, it is clear that the failureo activate NF-�B represents a major lesion in the train of eventsecessary for mounting a full immune response (Liang et al.,004; Karin and Lin, 2002).

Several mechanisms are known to down regulate or evenlock TLR-dependent signal transduction (see Liew et al., 2005or a survey). Regarding the recognition of gram positive bacteriat was shown, for instance, that extracellular soluble decoy TLR2

olecules secreted into breast milk may down regulate TLR2ignalling (LeBouder et al., 2003). TGF-� was found to block the

yD88-dependent pathways of TLR signalling through ubiqui-inylation and subsequent proteasomal degradation of this factorNaiki et al., 2005). Our observation that mastitis elicited by S.ureus systemically causes increased TGF-� expression in thedder (Table 2) might be indicative of the activation of suchmechanism. Multiple other mechanisms are known to either

irectly block NF-�B activation, for example by interfering withhe breakdown of the I�B complex (Baxter et al., 2006; Maengt al., 2006) or to interfere with the nuclear translocation ofhe activated p65 component of the NF-�B factor (Shi et al.,006; Pathak et al., 2005). Further experiments are needed tonravel the molecular mechanisms of how inactivated S. aureusnd isolated LTA prevent TLR-mediated NF-�B activation inEC.

. Conclusions

1) We show that our S. aureus model pathogen for subclini-cal mastitis fails to activate expression of proinflammatorycytokines in the udder early after inoculation, unlike ourpathogenic E. coli strain which quickly causes acute masti-tis and concomitantly strongly induces the proinflammatorycytokines IL-8, TNF� and IL-12. S. aureus infections leadsystemically to an upregulation of TGF-� expression.

2) Using expression constructs of the bovine TLR2 and TLR4receptors we prove in the HEK293 reconstitution system ofTLR-mediated signal transduction that these bovine recep-tors recognize this S. aureus strain as well as its LTAresulting in enhanced activation of NF-�B factors in thesecells, similar in strength to that in response to E. coli andLPS.

3) In primary bovine mammary epithelial cells (MEC), how-ever, S. aureus and LTA elicit only a much weaker (�5%)proinflammatory cytokine response, than E. coli and LPS,conceivably indicating a MEC-dependent quenching of thepathogen signal.

4) We present the novel observation that S. aureus and LTA failto activate NF-�B in MEC. This is conceivably the molec-ular reason for the diminished activation of TNF� and IL-8synthesis in MEC by these stimuli and represents also a sig-

nificant lesion in the molecular interplay necessary to mounta full immune response.

5) Our data suggest comparing the NF-�B activation potentialof a broader variety of pathogens causing subclinical masti-

J

K

logy 45 (2008) 1385–1397 1395

tis to see, if impaired NF-�B activation in MEC and/or otherimmune relevant cells from the udder is a general moleculardefect associated with subclinical mastitis.

cknowledgments

Part of this work contributed to the thesis of WY. Were grateful for the dedicated assistance by Angelika Deike,nne Bernd and Barbel Pletz. Sponsored by grants from theeutsche Forschungsgemeinschaft (Se 326/12-1 and Forscher-ruppe FOR585, grants Se-326/14-2 and AU 274/2-2). Theuropean Union through the EADGENE network of excellencen host pathogen interaction contributed also to this work.

eferences

derem, A., Ulevitch, R.J., 2000. Toll-like receptors in the induction of theinnate immune response. Nature 406, 782–787.

kira, S., Takeda, K., 2004. Toll-like receptor signalling. Nat. Rev. Immunol. 4,499–511.

annerman, D.D., Paape, M.J., Goff, J.P., Kimura, K., Lippolis, J.D., Hope, J.C.,2004a. Innate immune response to intramammary infection with Serratiamarcescens and Streptococcus uberis. Vet. Res. 35, 681–700.

annerman, D.D., Paape, M.J., Hare, W.R., Hope, J.C., 2004b. Characteriza-tion of the bovine innate immune response to intramammary infection withKlebsiella pneumoniae. J. Dairy Sci. 87, 2420–2432.

annerman, D.D., Paape, M.J., Lee, J.W., Zhao, X., Hope, J.C., Rainard, P.,2004c. Escherichia coli and Staphylococcus aureus elicit differential innateimmune responses following intramammary infection. Clin. Diagn. Lab.Immunol. 11, 463–472.

auer, S., Kirschning, C.J., Hacker, H., Redecke, V., Hausmann, S., Akira, S.,Wagner, H., Lipford, G.B., 2001. Human TLR9 confers responsiveness tobacterial DNA via species-specific CpG motif recognition. Proc. Natl. Acad.Sci. U.S.A. 98, 9237–9242.

axter, F.O., Came, P.J., Abell, K., Kedjouar, B., Huth, M., Rajewsky, K., Pas-parakis, M., Watson, C.J., 2006. IKK-�/2 induces TWEAK and apoptosisin mammary epithelial cells. Development 133, 3485–3494.

iamond, G., Kaiser, V., Rhodes, J., Russell, J.P., Bevins, C.L., 2000. Tran-scriptional regulation of beta-defensin gene expression in tracheal epithelialcells. Infect. Immun. 68, 113–119.

etherston, C., 2001. Mastitis in lactating women: physiology or pathology?Breastfeed. Rev. 9, 5–12.

oldammer, T., Zerbe, H., Molenaar, A., Schuberth, H.J., Brunner, R.M., Kata,S.R., Seyfert, H.M., 2004. Mastitis increases mammary mRNA abundanceof {beta}-defensin 5, toll-like-receptor 2 (TLR2), and TLR4 but not TLR9in cattle. Clin. Diagn. Lab. Immunol. 11, 174–185.

acker, H., Karin, M., 2006. Regulation and function of IKK and IKK-relatedkinases. Sci. STKE, re13.

atada, E.N., Krappmann, D., Scheidereit, C., 2000. NF-kappaB and the innateimmune response. Curr. Opin. Immunol. 12, 52–58.

attar, K., Grandel, U., Moeller, A., Fink, L., Iglhaut, J., Hartung, T., Morath,S., Seeger, W., Grimminger, F., Sibelius, U., 2006. Lipoteichoic acid (LTA)from Staphylococcus aureus stimulates human neutrophil cytokine releaseby a CD14-dependent, toll-like-receptor-independent mechanism: autocrinerole of tumor necrosis factor-[alpha] in mediating LTA-induced interleukin-8generation. Crit. Care Med. 34, 835–841.

ayden, M.S., West, A.P., Ghosh, S., 2006. NF-kappaB and the immuneresponse. Oncogene 25, 6758–6780.

irschfeld, M., Ma, Y., Weis, J.H., Vogel, S.N., Weis, J.J., 2000. Cuttingedge: repurification of lipopolysaccharide eliminates signaling through both

human and murine toll-like receptor 2. J. Immunol. 165, 618–622.

aneway Jr., C.A., Medzhitov, R., 2002. Innate immune recognition. Annu. Rev.Immunol. 20, 197–216.

arin, M., Lin, A., 2002. NF-kappaB at the crossroads of life and death. Nat.Immunol. 3, 221–227.

1 mun

K

L

L

L

L

L

M

M

M

N

O

O

O

P

P

R

R

R

R

S

S

S

S

S

S

S

S

S

S

S

S

S

T

T

T

T

V

W

W

396 W. Yang et al. / Molecular Im

awai, T., Akira, S., 2005. Toll-like receptor downstream signaling. ArthritisRes. Ther. 7, 12–19.

ahouassa, H., Moussay, E., Rainard, P., Riollet, C., 2007. Differential cytokineand chemokine responses of bovine mammary epithelial cells to Staphylo-coccus aureus and Escherichia coli. Cytokine 38, 12–21.

eBouder, E., Rey-Nores, J.E., Rushmere, N.K., Grigorov, M., Lawn, S.D.,Affolter, M., Griffin, G.E., Ferrara, P., Schiffrin, E.J., Morgan, B.P., Labeta,M.O., 2003. Soluble forms of toll-like receptor (TLR)2 capable of mod-ulating TLR2 signaling are present in human plasma and breast milk. J.Immunol. 171, 6680–6689.

ee, J.W., Bannerman, D.D., Paape, M.J., Huang, M.K., Zhao, X., 2006. Charac-terization of cytokine expression in milk somatic cells during intramammaryinfections with Escherichia coli or Staphylococcus aureus by real-time PCR.Vet. Res. 37, 219–229.

iang, Y., Zhou, Y., Shen, P., 2004. NF-kappaB and its regulation on the immunesystem. Cell. Mol. Immunol. 1, 343–350.

iew, F.Y., Xu, D., Brint, E.K., O’Neill, L.A., 2005. Negative regulation oftoll-like receptor-mediated immune responses. Nat. Rev. Immunol. 5, 446–458.

aeng, Y.S., Min, J.K., Kim, J.H., Yamagishi, A., Mochizuki, N., Kwon, J.Y.,Park, Y.W., Kim, Y.M., Kwon, Y.G., 2006. ERK is an anti-inflammatorysignal that suppresses expression of NF-kappaB-dependent inflammatorygenes by inhibiting IKK activity in endothelial cells. Cell Signal. 18, 994–1005.

cCaffrey, R.L., Fawcett, P., O’Riordan, M., Lee, K.D., Havell, E.A., Brown,P.O., Portnoy, D.A., 2004. From the cover: a specific gene expression pro-gram triggered by Gram-positive bacteria in the cytosol. Proc. Natl. Acad.Sci. U.S.A. 101, 11386–11391.

orath, S., Geyer, A., Hartung, T., 2001. Structure-function relationship ofcytokine induction by lipoteichoic acid from Staphylococcus aureus. J. Exp.Med. 193, 393–398.

aiki, Y., Michelsen, K.S., Zhang, W., Chen, S., Doherty, T.M., Arditi, M.,2005. Transforming growth factor-{beta} differentially inhibits MyD88-dependent, but not TRAM- and TRIF-dependent, lipopolysaccharide-induced TLR4 signaling. J. Biol. Chem. 280, 5491–5495.

’Neill, L.A., 2006. How toll-like receptors signal: what we know and what wedon’t know. Curr. Opin. Immunol. 18, 3–9.

shiumi, H., Matsumoto, M., Funami, K., Akazawa, T., Seya, T., 2003. TICAM-1, an adaptor molecule that participates in toll-like receptor 3-mediatedinterferon-beta induction. Nat. Immunol. 4, 161–167.

zinsky, A., Underhill, D.M., Fontenot, J.D., Hajjar, A.M., Smith, K.D., Wil-son, C.B., Schroeder, L., Aderem, A., 2000. The repertoire for patternrecognition of pathogens by the innate immune system is defined by cooper-ation between toll-like receptors. Proc. Natl. Acad. Sci. U.S.A. 97, 13766–13771.

alsson-McDermott, E.M., O’Neill, L.A., 2004. Signal transduction bythe lipopolysaccharide receptor, toll-like receptor-4. Immunology 113,153–162.

athak, S.K., Basu, S., Bhattacharyya, A., Pathak, S., Kundu, M., Basu, J.,2005. Mycobacterium tuberculosis lipoarabinomannan-mediated IRAK-Minduction negatively regulates toll-like Receptor-dependent interleukin-12p40 production in macrophages. J. Biol. Chem. 280, 42794–42800.

ainard, P., Riollet, C., 2006. Innate immunity of the bovine mammary gland.Vet. Res. 37, 369–400.

iollet, C., Rainard, P., Poutrel, B., 2000a. Differential induction of com-plement fragment C5a and inflammatory cytokines during intramammaryinfections with Escherichia coli and Staphylococcus aureus. Clin. Diagn.Lab. Immunol. 7, 161–167.

iollet, C., Rainard, P., Poutrel, B., 2000b. Kinetics of cells and cytokines duringimmune-mediated inflammation in the mammary gland of cows systemi-cally immunized with Staphylococcus aureus alpha-toxin. Inflamm. Res.49, 486–496.

oach, D.R., Bean, A.G.D., Demangel, C., France, M.P., Briscoe, H., Britton,

W.J., 2002. TNF regulates chemokine induction essential for cell recruit-ment, granuloma formation, and clearance of mycobacterial infection. J.Immunol. 168, 4620–4627.

accani, S., Pantano, S., Natoli, G., 2001. Two waves of nuclear factor {kappa}Brecruitment to target promoters. J. Exp. Med. 193, 1351–1360.

Y

ology 45 (2008) 1385–1397

cheidereit, C., 2006. IkappaB kinase complexes: gateways to NF-kappaB acti-vation and transcription. Oncogene 25, 6685–6705.

chmitz, S., Pfaffl, M.W., Meyer, H.H., Bruckmaier, R.M., 2004. Short-termchanges of mRNA expression of various inflammatory factors and milkproteins in mammary tissue during LPS-induced mastitis. Domest. Anim.Endocrinol. 26, 111–126.

chroder, N.W., Morath, S., Alexander, C., Hamann, L., Hartung, T., Zahringer,U., Gobel, U.B., Weber, J.R., Schumann, R.R., 2003. Lipoteichoic acid(LTA) of Streptococcus pneumoniae and Staphylococcus aureus activatesimmune cells via toll-like receptor (TLR)-2, lipopolysaccharide-binding pro-tein (LBP), and CD14, whereas TLR-4 and MD-2 are not involved. J. Biol.Chem. 278, 15587–15594.

eegers, H., Fourichon, C., Beaudeau, F., 2003. Production effects related tomastitis and mastitis economics in dairy cattle herds. Vet. Res. 34, 475–491.

hi, Y., Tu, Z., Tang, D., Zhang, H., Liu, M., Wang, K., Calderwood, S.K.,Xiao, X., 2006. The inhibition of LPS-induced production of inflammatorycytokines by HSP70 involves inactivation of the NF-kappaB pathway butnot the MAPK pathways. Shock 26, 277–284.

him, E.H., Shanks, R.D., Morin, D.E., 2004. Milk loss and treatment costsassociated with two treatment protocols for clinical mastitis in dairy cows.J. Dairy Sci. 87, 2702–2708.

mith, K.L., Hogan, J.S., 1993. Environmental mastitis. Vet. Clin. North Am.Food Anim. Pract. 9, 489–498.

ordillo, L.M., Streicher, K.L., 2002. Mammary gland immunity and mastitissusceptibility. J. Mammary Gland Neoplasia 7, 135–146.

tandiford, T.J., Kunkel, S.L., Basha, M.A., Chensue, S.W., Lynch III, J.P.,Toews, G.B., Westwick, J., Strieter, R.M., 1990. Interleukin-8 gene expres-sion by a pulmonary epithelial cell line. A model for cytokine networks inthe lung. J. Clin. Investig. 86, 1953.

trandberg, Y., Gray, C., Vuocolo, T., Donaldson, L., Broadway, M., Tellam,R., 2005. Lipopolysaccharide and lipoteichoic acid induce different innateimmune responses in bovine mammary epithelial cells. Cytokine 31, 72–86.

utra, L., Poutrel, B., 1994. Virulence factors involved in the pathogenesis ofbovine intramammary infections due to Staphylococcus aureus. J. Med.Microbiol. 40, 79–89.

wanson, K., Gorodetsky, S., Good, L., Davis, S., Musgrave, D., Stelwagen, K.,Farr, V., Molenaar, A., 2004. Expression of a beta-defensin mRNA, lingualantimicrobial peptide, in bovine mammary epithelial tissue is induced bymastitis. Infect. Immun. 72, 7311–7314.

akeuchi, O., Akira, S., 2001. Toll-like receptors; their physiologicalrole and signal transduction system. Int. Immunopharmacol. 1, 625–635.

enhagen, B.A., Koster, G., Wallmann, J., Heuwieser, W., 2006. Prevalence ofmastitis pathogens and their resistance against antimicrobial agents in dairycows in Brandenburg, Germany. J. Dairy Sci. 89, 2542–2551.

ian, B., Nowak, D.E., Brasier, A.R., 2005a. A TNF-induced gene expres-sion program under oscillatory NF-kappaB control. BMC Genomics 6,137.

ian, B., Nowak, D.E., Jamaluddin, M., Wang, S., Brasier, A.R., 2005b. Identifi-cation of direct genomic targets downstream of the nuclear factor-{kappa}Btranscription factor mediating tumor necrosis factor signaling. J. Biol. Chem.280, 17435–17448.

anselow, J., Yang, W., Herrmann, J., Zerbe, H., Schuberth, H.J., Petzl, W.,Tomek, W., Seyfert, H.-M., 2006. DNA-remethylation around a STAT5-binding enhancer in the �S1-casein promoter is associated with abrupt shut-down of �S1-casein synthesis during acute mastitis. J. Mol. Endocrinol. 37,463–477.

ellnitz, O., Kerr, D.E., 2004. Cryopreserved bovine mammary cells tomodel epithelial response to infection. Vet. Immunol. Immunopathol. 101,191–202.

est, A.P., Koblansky, A.A., Ghosh, S., 2006. Recognition and signaling by

toll-like receptors. Annu. Rev. Cell Dev. Biol. 22, 409–437.

amamoto, M., Sato, S., Mori, K., Hoshino, K., Takeuchi, O., Takeda, K., Akira,S., 2002. Cutting edge: a novel toll/IL-1 receptor domain-containing adapterthat preferentially activates the IFN-{beta} promoter in the toll-like receptorsignaling. J. Immunol. 169, 6668–6672.

muno

Y

W. Yang et al. / Molecular Im

amamoto, M., Sato, S., Hemmi, H., Hoshino, K., Kaisho, T., Sanjo, H.,Takeuchi, O., Sugiyama, M., Okabe, M., Takeda, K., Akira, S., 2003. Role ofadaptor TRIF in the MyD88-independent toll-like receptor signaling path-way. Science 301, 640–643.

Y

logy 45 (2008) 1385–1397 1397

ang, W., Molenaar, A.J., Kurts-Ebert, B., Seyfert, H.M., 2006. NF-�B factorsare essential, but not the switch, for pathogen-related induction of the bovine�-defensin 5-encoding gene in mammary epithelial cells. Mol. Immunol. 43,210–225.