This content has been downloaded from IOPscience. Please scroll down to see the full text.

Download details:

This content was downloaded by: giannic82

IP Address: 87.17.171.8

This content was downloaded on 22/10/2013 at 22:09

Please note that terms and conditions apply.

Boron nitride nanotubes and primary human osteoblasts: in vitro compatibility and biological

interactions under low frequency ultrasound stimulation

View the table of contents for this issue, or go to the journal homepage for more

2013 Nanotechnology 24 465102

(http://iopscience.iop.org/0957-4484/24/46/465102)

Home Search Collections Journals About Contact us My IOPscience

IOP PUBLISHING NANOTECHNOLOGY

Nanotechnology 24 (2013) 465102 (13pp) doi:10.1088/0957-4484/24/46/465102

Boron nitride nanotubes and primaryhuman osteoblasts: in vitro compatibilityand biological interactions under lowfrequency ultrasound stimulation

Serena Danti1,2, Gianni Ciofani3, Stefania Moscato4, Delfo D’Alessandro1,2,Elena Ciabatti4, Claudia Nesti2, Rosaria Brescia5, Giovanni Bertoni5,Andrea Pietrabissa6, Michele Lisanti7, Mario Petrini4, Virgilio Mattoli3

and Stefano Berrettini1

1 Department of Surgical, Medical, Molecular Pathology and Emergency Medicine, University of Pisa,via Paradisa 2, I-56124 Pisa, Italy2 Center for the Clinical Use of Stem Cells—Regional Network of Regenerative Medicine‘CUCCS-RRMR’, University of Pisa, via Roma 55, I-56126 Pisa, Italy3 Center for Micro-BioRobotics @SSSA, Istituto Italiano di Tecnologia, viale Rinaldo Piaggio 34,I-56025 Pontedera (Pisa), Italy4 Department of Clinical and Experimental Medicine, University of Pisa, via Roma 67, I-56126 Pisa,Italy5 Department of Nanochemistry, Istituto Italiano di Tecnologia, via Morego 30, I-16163 Genova, Italy6 Department of Surgical Sciences, IRCCS Policlinics San Matteo, University of Pavia, via Aselli 45,I-27100 Pavia, Italy7 Department of Translational Research and New Technology in Medicine and Surgery,University of Pisa, Via Paradisa 2, I-56124 Pisa, Italy

E-mail: s.danti@med.unipi.it and gianni.ciofani@iit.it

Received 3 July 2013, in final form 3 September 2013Published 22 October 2013Online at stacks.iop.org/Nano/24/465102

AbstractIn this paper we investigated a novel and non-invasive approach for an endogenous osteoblaststimulation mediated by boron nitride nanotubes (BNNTs). Specifically, following the cellularuptake of the piezoelectric nanotubes, cultures of primary human osteoblasts (hOBs) wereirradiated with low frequency ultrasound (US), as a simple method to apply a mechanicalinput to the cells loaded with BNNTs. This in vitro study was aimed at investigating the maininteractions between hOBs and BNNTs and to study the effects of the ‘BNNTs+ US’stimulatory method on the osteoblastic function and maturation.

A non-cytotoxic BNNT concentration to be used in vitro with hOB cultures wasestablished. Moreover, investigation with transmission electron microscopy/electron energyloss spectroscopy (TEM/EELS) confirmed that BNNTs were internalized in membranalvesicles. The panel of investigated osteoblastic markers disclosed that BNNTs were capable offostering the expression of late-stage bone proteins in vitro, without using any mineralizingculture supplements. In our samples, the maximal osteopontin expression, with the highestosteocalcin and Ca2+ production, in the presence of mineral matrix with nodular morphology,was observed in the samples treated with BNNTs+ US. In this group was also shown asignificantly enhanced synthesis of TGF-β1, a molecule sensitive to electric stimulation in

10957-4484/13/465102+13$33.00 c© 2013 IOP Publishing Ltd Printed in the UK & the USA

Nanotechnology 24 (2013) 465102 S Danti et al

bone. Finally, gene deregulations of the analyzed osteoblastic genes leading to depletivecellular effects were not detected. Due to their piezoelectricity, BNNT-based therapies mightdisclose advancements in the treatment of bone diseases.

(Some figures may appear in colour only in the online journal)

1. Introduction

Boron nitride nanotubes (BNNTs) are ceramic nanomaterialsthat have catalyzed in recent years an increasing scientificand technological interest further to the fashionable trendexerted by carbon nanotubes (CNTs) on nanoscience [1].BNNTs and CNTs share a structurally analogous arrangementof their constitutive atoms; however, the polar natureof the B–N bond imparts BNNTs with other chemicaland physical properties [2–5]. In particular, BNNTs showpiezoelectricity, namely, the ability to convert mechanicalinto electrical energy and vice versa, so they could beenvisioned as nanoscale transducers [6–8]. The piezoelectricbehavior of BNNTs has been found to originate from thedeformation of the hexagonal BN plane upon rolling, andto depend on their aspect ratio [9, 10]. First calculationsof the spontaneous polarization and piezoelectric proper-ties of BNNTs have demonstrated that they work betterthan piezoelectric polymers and comparably to wurtzitesemiconductors [7]. Recent researches have experimentallyverified a deformation-driven polarization and a first evidenceof piezoelectric behavior also in multi-walled BNNTs[8, 11]. Additionally, studies on cyclic mechanical de-formations of BNNTs have confirmed their outstandingflexibility [6]. Finally, the piezoelectric coefficients of BNNTshave been investigated and predicted by a new continuummechanics approach based on electrostructural elements [12].

In the latest decade, exploitation of CNTs in thenanomedical domain has been largely proposed in applica-tions ranging from biosensors, DNA chips, and nanovectorsto nanocomposites and others, showing their intriguingopportunities but also some significant limitations, such asimportant cytotoxicity hurdles [13, 14]. As a consequenceof the novelty of BNNT bio-applications, cytocompatibilitystudies are very recent and rely on the set-up of properdispersion procedures [15]. For these reasons, in vivocompatibility is still an object of investigation [16, 17].Our group was among the first to study the biologicalinteractions of BNNTs, highlighting negligible cytotoxiceffects after administering BNNT-loaded culture medium(CM) to different cell lines for several days [18]. In the pasttwo years a growing amount of research on BNNTs has beenreported, which mostly agrees on the encouraging resultsabout BNNT cytocompatibility, although surfactant type andaspect ratio often remain underestimated key factors ofcytotoxicity [18]. However, BNNTs are not to be consideredas mere nanovectors: their piezoelectric properties togetherwith their good cytocompatibility entitles their use also asmechanoelectrical nanotransducers. Indeed, in our vision, thepossibility to convey mechanically activated (i.e. wireless)‘electric-like’ (i.e. due to the material polarization) signals to

the cells and tissues can open intriguing opportunities for celltherapy and regeneration [18].

Bone is a recognized piezoelectric tissue with piezoelec-tric constants of the dry matter close to those of quartz [19].Apatite crystals being centrosymmetric, piezoelectricity inbone has been found to rely on collagen fibers and fibrils,which can polarize under load conditions [20]. Since the1960s, such intrinsic piezoelectric features have been invokedin activating osteoblast function towards highly stressedareas via mechanoelectrical transduction signaling [21]. Theelectric sensitivity of osteoblasts has ever provoked bonestudies in multiple facets, using both direct and indirectelectric stimulation to enhance ossification and healing.For example, conducting composite substrates have beentested to deliver exogenous electric currents to osteoblastsand increase their function [22–24], while evidence ofindirect electric stimulation on ossification has been observedin living bone following application of electromagneticfields [25]. Obviously, any indirect method resulting inelectric stimulation is widely preferable to the direct andinvasive application of electrodes to the target site.

In this paper, we investigated a novel and non-invasiveapproach for an endogenous osteoblast stimulation mediatedby BNNTs. More precisely, following the cellular uptakeof the piezoelectric nanotubes, osteoblast cultures wereirradiated with low frequency ultrasound (US).

In medical practice, low frequency (range 20–100 kHz) US is applied for a number of therapeutic purposes,such as sonophoresis, sonothrombolysis and dentistry. Incontrast to US used for image diagnostics and due to theirrelatively long wavelength, low frequency ultrasonic wavesare most influenced by obstacles during their irradiationpathway and can efficiently transfer their energy to them [26].We thus selected low frequency US as a simple and easilyup-scalable method for conveying mechanic pressure wavesto the BNNT-loaded cells and, in the future, to BNNT-loadedtissue/organs of therapeutic interest (figure 1).

The effectiveness of US-activated BNNT-mediatedstimulation has been recently demonstrated by our groupusing neuronal cell lines, resulting in their enhanceddifferentiation [27]. Here we applied this stimulation systemto primary human osteoblasts (hOBs). To this purpose,osteoblasts represent a cellular model of higher complexitythan neuronal cells, as they are sensitive to both mechanic andelectric stimuli.

The aim of this in vitro study was: (i) investigatingthe main interactions between hOBs and BNNTs, includingthe identification of an effective non-cytotoxic dose and theascertainment of BNNT uptake by hOBs, and (ii) studyingthe effects of the ‘BNNTs + US’ stimulatory method onthe osteoblastic function and maturation. This objective was

2

Nanotechnology 24 (2013) 465102 S Danti et al

Figure 1. Schematic diagram of cell stimulation mediated byBNNTs. This figure depicts a novel method for cell stimulationbased on piezoelectric nanotransducers, such as BNNTs.Piezoelectric nanomaterials, activated by a mechanical-stress source(i.e. ultrasound waves, US), are able to convert mechanical intoelectric energy (i.e. material polarization). The proposed methodmay represent a wireless system for inner electric stimulation ofcells and tissues. Additionally, BNNTs can be used asfunctionalized nanotransducers, exploiting both the chemical andthe physical properties of the nanosystem. Possible methods forBNNT functionalization are listed in the figure legend. In this study,BNNTs were functionalized with a biocompatible coating and, forspecific tests, a fluorescent molecule was also added.

achieved throughout assaying a panel of osteogenic markers,including production of several bone proteins (alkalinephosphatase, osteopontin, osteocalcin, transforming growthfactor beta 1), and evaluating the quantity and morphologyof the mineral matrix. Moreover, the expression of someosteoblastic genes (collagen I, runt-related transcriptionfactor 2, osteopontin and osteocalcin) was investigated inorder to eliminate any important gene deregulation affectingbone protein translation induced by BNNTs.

2. Experimental section

2.1. Preparation and characterization of BNNT dispersions

BNNTs, supplied by the Australian National University,Canberra, Australia, were produced by a ball-milling andannealing method [28]. Details of sample purity andcomposition, as provided by the supplier, comprise thefollowing: yield >80%, boron nitride >97 wt%, residualmetal catalysts (Fe and Cr) ∼1.5 w%, absorbed O2 ∼1.5 w%.

Stable dispersions of BNNTs in water were obtainedusing 0.1% poly-L-lysine (PLL; Mw 70 000–150 000, Fluka,Buchs, Switzerland) as described in previous studies [29, 30].Briefly, dispersions (0.5 mg ml−1) were prepared mixingBNNTs with 0.1% PLL solution in phosphate-bufferedsaline (PBS; Sigma-Aldrich, St Louis, MO, USA). Thesamples were sonicated and centrifuged to remove clusteredimpurities. Excess PLL was removed by repeated ultracen-trifugation (Allegra 64R, Beckman Coulter, Fullerton, CA,USA). Stable PLL-BNNT dispersions were thus obtainedthrough non-covalent coating of the nanotube walls with PLL.

The concentration of BNNTs was quantified by spectropho-tometric analysis, using a UV/vis/NIR spectrophotometer(LIBRA S12, Biochrom, Cambridge, UK), while the residualconcentration of PLL in the dispersions was assessed using thebicinchoninic acid (BCA) assay, as previously reported [30].

Measurement of Z-potential distribution was carried outwith a Nano Z-Sizer (Malvern Instruments, Westborough,MA, USA). Each acquisition was performed in triplicateon aqueous nanotube suspensions at a concentration of1 µg ml−1.

Micrographs of PLL-BNNTs were obtained via transmis-sion electron microscopy (TEM; Zeiss 902 microscope, Zeiss,Oberkochen, Germany). Single droplets of the BNNT aqueousdispersions were dripped on copper grids and dried in a 37 ◦Coven before TEM observation.

2.2. Isolation and culture of hOBs

hOBs were isolated in our laboratories from discarded bonematerial of orthopedic surgery, otherwise destined to bedisposed of. Samples were treated anonymously and inconformity to the principles expressed by the Declaration ofHelsinki. As such, approval from the ethics review board ofour hospital was not necessary.

Trabecular bone fragments, removed from femoralheads discharged after total hip joint replacement, wereused. Isolation was performed according to an establishedmethod [31]. Briefly, dissected bone fragments were placed insterile saline supplemented with antibiotics and antimycoticand washed several times to remove fat, marrow, tissuedebris and blood cells. Within 1–2 weeks, cell migration wasobserved from the native tissues, leading to the formation ofosteoid seams around the explants. Cells were detached usingtrypsin (Sigma-Aldrich) and replated, thus obtaining purifiedprimary hOB populations. hOBs were cultured in expansion(i.e. not differentiating) CM containing low-glucose DMEM(Sigma-Aldrich), 10% heat-inactivated fetal calf serum (FCS;Invitrogen, Carlsbad, CA, USA), L-glutamine, HEPES, non-essential aminoacids, ascorbic acid, penicillin–streptomycinand Fungizone (all from Sigma-Aldrich) without mineralizingsupplements [31]. For the following studies, hOBs were usedat passage 2 and seeded at a density of 10 000 cells cm−2.

2.3. Cytocompatibility of PLL-BNNTs

2.3.1. MTT viability assay. For viability testing, MTT(3-(4,5-dimethylthiazole-2-yl)-2,5-diphenyl tetrazolium bro-mide; Sigma-Aldrich) cell proliferation assay was carriedout 24, 48 and 72 h after hOB incubation with PLL-BNNTmodified media having final concentrations of 5, 10 and15 µg ml−1 of BNNTs. At the time-points, samples wereincubated with MTT 0.5 mg ml−1 for 2 h. Finally, CM wasremoved and dimethylsulfoxide (DMSO; Sigma-Aldrich) wasadded at 100µl per well. Absorbance was measured at 550 nmwith a microplate reader (VERSAMax, Molecular Devices,Sunnyvale, CA, USA). Reference tests (blanks) were alsocarried out. This assay was performed on six sample sets(n = 6).

3

Nanotechnology 24 (2013) 465102 S Danti et al

2.3.2. Annexin V-FITC/propidium iodide assay. Toinvestigate apoptotic phenomena, annexin V-FITC/propidiumiodide assay (ApoAlert kit, from Clonetech Laboratories,Mountain View, CA, USA) was performed on one set ofsamples at 24 and 72 h time-points, using a flow cytometryanalyzer (FACScan, BD Bioscience, Franklin Lakes, NJ,USA) according to the manufacturer’s instructions. This assayallows viable, apoptotic and necrotic cells (gated percentages)to be discriminated within a cell population. Here wecompared PLL-BNNT-treated samples to controls.

2.4. Intracellular uptake of PLL-BNNTs

2.4.1. Lysosome-tracking assay. For cellular trackingstudies, PLL-BNNTs were covalently labeled with carboxylderivatized quantum dots (QDs; Qdot R© 605 ITKTM,Invitrogen) as described elsewhere [29, 30]. QD-PLL-BNNTswere diluted in the CM with a ratio of 1:10 leadingto a final concentration of 5 µg ml−1 of PLL-BNNTs.The lysosome-tracking assay was carried out on one setof hOB samples with LysoTracker dye (Invitrogen). After6 h exposure to QD-PLL-BNNTs in the CM, specimenswere incubated for 2 h in the CM containing LysoTrackerdiluted 1:2500. Live micrographs were captured with aninverted fluorescent microscope (Eclipse TI, Nikon, Tokyo,Japan) equipped with a cooled CCD camera (DS-5MCUSB2, Nikon), Perfect Focus System and NIS Elements ARimaging software. Colocalization was measured on acquiredimages using a 3D image analyzer software (Volocity 5.3,PerkinElmer, Waltham, MA, USA).

2.4.2. TEM analysis. To assess internalization phenomena,TEM analysis was performed on hOB cultures in 75 cm2

flasks after overnight incubation in CM containing PLL-BNNTs at 10 µg ml−1. Samples were trypsinized andcentrifuged to obtain cell pellets, which were fixed in a0.5% (w/v) glutaraldehyde–4% (w/v) formaldehyde solutionfor 2 h at 4 ◦C, washed and post-fixed in 1% (w/v) OsO4for 1 h, rinsed and dehydrated with acidified acetone-dimethylacetal (Fluka). Finally, the samples were embeddedin Epon/Durcupan resin in BEEM capsules No 00 (StructureProbe, West Chester, PA, USA) at 56 ◦C for 48 h. Ultra-thinsections (20–30 nm) were obtained with an ultramicrotome(Ultratome Nova, LKB, Bromma, Sweden) equipped witha diamond knife (Diatome, Biel/Bienne, Switzerland). Thesections were placed on 200 square mesh nickel grids,counterstained with saturated aqueous uranyl acetate and leadcitrate solutions and observed with a JEM-2200FS TEM(JEOL, Tokyo, Japan), equipped with a field emission gunoperated at 200 kV and an Omega filter. Elemental maps of Band N were acquired in energy filtered TEM (EFTEM) modeusing the three-window method. Moreover, electron energyloss spectra (EELS) were acquired by pointing a 1 nm electronbeam at selected features in scanning TEM (STEM) mode.

2.5. Investigation of BNNT-treated hOB cultures under USirradiation

2.5.1. Experimental design. Cultures of hOBs, plainand internalizing PLL-BNNTs, were irradiated with US for

comparison to their respective non-irradiated controls. PlainhOB samples were incubated with 2 µg ml−1 of pristine PLL,corresponding to the residual PLL concentration detectedin the dispersion of 10 µg ml−1 PLL-BNNTs [30]. USstimulation of samples was performed at 40 kHz frequencyfor 5 s three times a day for one week using a sonicatorbath (Bransonic 2510, Bransonic, Danbury, CT, USA), settingan output power of 20 W. Culture media were replacedevery three days. After seven days (endpoint), specimens intriplicate of all the groups were treated for quantification ofgene expression and bone molecule production, as well as forsome cytochemical and immunocytochemical stainings.

2.5.2. Gene expression analysis. Total RNA wasisolated from cell cultures using a High Pure RNAIsolation Kit (Roche, Mannheim, Germany) according to themanufacturer’s protocol. The synthesis reaction of cDNAwas performed using 1 µg of RNA in a total volume of20 µl containing 200 units of M-MLV reverse transcriptase(Invitrogen), 5× First-Strand Buffer (50 mM Tris-HCl,75 mM KCl, 3 mM MgCl2), 1 mM dNTPs, 32 units of RNaseRiboLock ribonuclease inhibitor (Fermentas, Burlington,Canada), 10 mM of dithiothreitol (DTT) and 5 µM randomprimers. The synthesis program included an initial incubationat 25 ◦C for 10 min, followed by incubation at 42 ◦C for45 min. Reaction was inactivated heating at 99 ◦C for 3 min.

Quantitative RT-PCR (qPCR) was performed on an iQ5Multicolor cycler apparatus (Bio-Rad, Hercules, CA, USA) todetermine the expression of the selected genes, normalizingthe results to glyceraldehyde 3-phosphate dehydrogenase(GAPDH), which was selected as a housekeeping gene. In20 µl final volumes, 2× iQ SsoFast EvaGreen Supermix(Bio-Rad, Hercules, CA, USA), 500 nM primer and 50 ngtotal cDNA were used. The thermal protocol was applied withone cycle at 95 ◦C for 30 s for enzyme activation, followedby 40 cycles at 95 ◦C for 10 s and 60 ◦C for 30 s. Eachassay included a ‘no template’ sample and all tests werecarried out in duplicate. Following the Livak method [32], thecycle threshold (Ct) value relative to the control sample wasadopted as a reference for the calculation of11Ct (differencebetween 1Ct values deriving from difference between Ctof target and housekeeping genes) for the following genes:Runt-related transcription factor 2 (Runx2), collagen Iα1(Coll I), osteopontin (OPN) and osteocalcin (OCN). Theprimer sequences of the investigated genes are reported intable 1.

2.5.3. Quantitative biochemical assays. For each sample,double stranded (ds) DNA, ALP activity, OCN, transforminggrowth factor beta 1 (TGF-β1) and calcium (Ca) contentswere assayed in cascade. Three independent experimentswere evaluated for each treatment (n = 3). Additionally,individual samples were run in triplicate to take the operator’serror into account. To obtain cell lysates, cellular samplesunderwent two freeze–thaw cycles in double distilled (dd)H2O. Final tests (samples versus standards) prepared on96-well microplates were measured on a plate reader (Victor3;PerkinElmer, Waltham, MA, USA).

4

Nanotechnology 24 (2013) 465102 S Danti et al

Table 1. Primer sequences used for gene expression analysis via qRT-PCR.

Gene Primer sequence Forward/reverse

GAPDH 5′ CCCTTCATTGACCTCAACTACATG 3′ F5′ TGGGATTTCCATTGATGACAAGC 3′ R

Runx2 5′ GCCAAAAGGGTCATCATCTCTG 3′ F5′ CATGCCAGTGAGCTTCCCGT 3′ R

Coll I 5′ AAGGTCATGCTGGTCTTGCT 3′ F5′ GACCCTGTTCACCTTTTCCA 3′ R

OPN 5′ GCCGAGGTGATAGTGTGGTT 3′ F5′ TGAGGTGATGTCCTCGTCTG 3′ R

OCN 5′ CTGTATCAATGGCTGGGAGCCCC 3′ F

Ds-DNA content in cell lysates was measured usingthe PicoGreen kit (Molecular Probes, Eugene, OR, USA),as previously reported [29]. Briefly, working buffer andPicoGreen dye solution were prepared according to themanufacturer’s instructions using reagents provided in the kit.After 10 min incubation in the dark at room temperature (RT),the fluorescence intensity was measured using an excitationwavelength of 485 nm and an emission wavelength of 535 nm.

The intracellular ALP activity was quantified witha colorimetric endpoint assay, according to a standardmethod [33]. The principle of the method is based on atemperature-dependent hydrolysis reaction, catalyzed by theenzyme ALP in alkaline conditions, which transforms acolorless substrate (p-nitrophenol phosphate) into a yellow-colored product (p-nitrophenol). The increasing absorbanceat 405 nm (rate of product formation) is directly related tothe enzyme activity in the sample. Intracellular ALP activitywas thus determined by assaying aliquots of the same samples(cell lysates) as used for ds-DNA quantification using reagentsprovided by Sigma-Aldrich. The microplate was incubated at37 ◦C and the reaction was stopped after 1 h using 0.3 MNaOH [33].

On the same samples, in cascade, OCN and TGF-β1 wereevaluated using clinical-grade immunoenzymatic ELISAassays: N-MID osteocalcin kit (Cobas, Roche, Indianapolis,IN, USA) and anti-human TGF-β1 (eBioscience BenderMedSystems, Vienna, Austria) following the manufacturer’sinstructions.

Ca content was evaluated using the Arsenazo III assay(Diagnostic Chemicals, Oxford, CT, USA), as described inprevious work [33]. Briefly, this colorimetric assay measuresthe amount of blue–purple-colored Ca-Arsenazo2+ complexformed when Arsenazo III binds to free Ca in an acid solution.Residual samples from cascade assays were incubated with1 N acetic acid overnight under shaking in order toallow calcium deposits to get efficiently into solution. Themicroplate was incubated for 10 min at RT and the absorbancewas measured at 650 nm.

2.5.4. Histologic analyses. Samples were fixed with 1%neutral buffered formalin for 10 min at 4 ◦C to revealcalcium via cytochemical and OPN via immunocytochemicalmethods.

For Ca detection, samples were processed according tostandard protocols for von Kossa staining [32]. For OPN

detection, specimens were permeabilized with 0.2% TritonX-100 (Sigma-Aldrich) in 1× PBS for 10 min at RT.Then, endogenous peroxidases were quenched by incubationwith 0.6% H2O2 in methanol in the dark for 15 min atRT. To block the aspecific binding sites, the samples weretreated with goat serum (Vektor Lab, Burlingame, CA, USA)for 20 min at 37 ◦C. After washing, cells were incubatedovernight with mouse monoclonal anti-OPN (sc-21742, SantaCruz Biotechnology, Santa Cruz, CA, USA) diluted in 0.1%bovine serum albumin (BSA) in a moistened chamber at 4 ◦C.Negative controls were performed by incubating sampleswith 0.1% BSA only. The following day, the specimenswere incubated with a goat anti-mouse biotinylated secondaryantibody (Vektor Lab) in 1.5% goat serum solution for60 min and then with streptavidin (Vectastain Elite ABC KitStandard, Vektor Lab) for 30 min at RT. To reveal the reaction,the samples were exposed to the substrate–chromogensolution (DakoCytomation, Glostrup, Denmark) for 5 minat RT in the dark, counterstained with hematoxylin andwashed in tap water. Finally, the specimens were dehydratedand mounted with DPX medium (Sigma-Aldrich). Sixteenmicrographs at 20× optical magnification (total magnification200×) were captured for each treatment to evaluate thenumber of OPN-positive cells and to compare among thegroups the antigen intensity, which was scored by threeindependent observers according to the following criteria: −,negative; +, weak positivity; ++, good positivity; + + +,strong positivity. Averages of about 1800 cells were countedand analyzed for each group.

Histologic analyses were carried out using an integratedsystem for microscopy digital imaging (Leica Microsystem,Milan, Italy).

2.6. Statistical analysis

Statistical significance in quantitative analyses was evaluatedusing the two-tailed t test for unpaired data, followed byBonferroni’s correction. Data underwent both descriptive,i.e. mean ± standard deviation (SD), and inferential statistics(p-values).

3. Results and discussion

3.1. Preparation and characterization of BNNT dispersions

In this paper, we report on the in vitro effects of BNNT-mediated stimulation on the function and differentiation

5

Nanotechnology 24 (2013) 465102 S Danti et al

patterns of primary hOBs. Due to BNNT hydrophobicity,stable water dispersions of individual nanotubes have to bereached for an effective administration in vitro [15]. Indeed,since the object size is known to affect the cellular uptakeefficiency, nanoparticle clustering must be avoided [18].To this purpose, surfactants or other dispersion agents aresuccessfully used; however, the surfactant biocompatibilitycan represent the actual factor limiting the dose ofnanoparticles to be administered to a biological system [18].From among the biocompatible agents used for colloiddispersions of BNNTs, some biomolecules able to wrap thenanotubes have been reported to foster cell internalizationprocesses [18]. This is possibly due to biomimetic interactionsoccurring between the coating molecule and the cellularmembrane, allowing efficient BNNT trafficking. In this study,a biodegradable and positively charged biopolymer, PLL, wasselected to obtain biomimetically coated and finely dispersedBNNTs. Indeed, from our previous experience, due to theelectrostatic interactions between PLL and the negativelycharged cell membrane, PLL-wrapped BNNTs could be easilyendocytosed by muscle cells [29]. In this study, measurementof Z potential confirmed the high stability of PLL-BNNTdispersions (43.4 ± 3.3 mV) (figure 2(a)). Moreover, TEManalysis was able to image single nanotubes, indicating goodefficacy of the BNNT dispersion with PLL (figure 2(b)).Reported data on CNT interactions with biological systemshave identified a direct correlation between their cytotoxicityand other parameters, namely dispersion agents, purity,aspect ratio (length/diameter = L/D) and concentration ofthe nanotubes [34]. The nanotubes used in this studywere multi-walled BNNTs with and BN >97%. Hollownanotubes with diameters in the range 40–70 nm and lengths<500 nm were detected by TEM analysis. The thicknessof the tube walls was about 10 nm (figure 2(b)), leadingto an aspect ratio L/D ≈ 9. Based on comparisons withthe current scientific literature on BNNTs, such parametersshould not be bio-hazardous [18]. Instead, cytotoxic effectsdue to PLL-BNNT concentration have to be experimentallyestablished and this is the object of the following paragraph.

3.2. BNNT cytocompatibility

BNNT cytotoxicity has also been reported to show somecell-type dependency [35]. Moreover, studies investigatingBNNT cytotoxicity have been performed so far only oncell lines [18]. Instead, disclosure of specific cytotoxicityof PLL-BNNTs towards primary hOBs was investigated inthis study. After incubation with PLL-BNNTs, hOB viabilitywas assayed using metabolic and apoptosis tests [29]. Themetabolic assay MTT was carried out after 24, 48, and72 h of cell incubation with a PLL-BNNT modified CM atdifferent BNNT concentrations. No statistically significantdecrease (p > 0.05) in metabolic activity could be observedafter 72 h following the administration of PLL-BNNTsin the CM up to the highest concentration tested in thisstudy (15 µg ml−1) (figure 3(a)). Based on these results,a working concentration of 10 µg ml−1 was chosen forthe further experiments. Moreover, similarly to the findings

Figure 2. Characterization of PLL-BNNT dispersions. (a) Zpotential graph of PLL-BNNT aqueous dispersions. (b) TEM imageshowing a single (i.e. well dispersed) PLL-BNNT. Tubular shapeand dimensions were: diameter = 60 nm; length = 450 nm; wallthickness = 10 nm. Scale bar = 100 nm.

reported administrating PLL-BNNTs to an animal myoblastline, any relevant cytotoxic effect was not detected with sucha dose [29, 30]. Early apoptotic and necrotic phenomenapossibly induced by PLL-BNNTs in hOBs were investigatedusing annexin V-FITC combined with propidium iodide underflow cytofluorometry at 24 and 72 h after cell exposure toPLL-BNNT-loaded CM. Both events turned out to be ofphysiological order of magnitude (<10%), with no detectabledifferences within BNNT-treated and untreated groups, nornecrotic cell increase over time (figure 3(b)). Specifically,in both controls and PLL-BNNT-treated samples, apoptoticcells increased over time, from 3.11% and 4.28% at 24 h, to7.51% and 7.04% at 72 h; while necrotic cells showed a slightreduction, from 9.97% and 9.01% at 24 h to 8.51% and 8.85%at 72 h.

Summarizing, our outcomes allowed the definition of anon-cytotoxic concentration (i.e. 10µg ml−1) of PLL-BNNTsthat can be also adequate for potential pharmaceuticaluses [36].

6

Nanotechnology 24 (2013) 465102 S Danti et al

Figure 3. Cytocompatibility of PLL-BNNTs and determination ofthe working concentration. (a) Results of MTT assay after 24, 48and 72 h of incubation of hOBs with 0 (control), 5, 10 and15 µg ml−1 of PLL-BNNTs (n = 6). In all cases p > 0.05.(b) Results of annexin V assay on hOBs treated with 10 µg ml−1 ofBNNTs after 24 and 72 h performed via flow cytometry againstcontrols.

3.3. BNNT localization

The second objective of this study was to demonstratethat the BNNTs were internalized by hOBs and todefine their main location in the primary osteoblast.Our previous studies with fluorescence tracking haveshown that PLL-BNNT internalization followed an energy-dependent mechanism; moreover, TEM observations havehighlighted electron-dense nano-objects, putatively BNNTs,

accumulated inside cytoplasm vesicles [30]. In this report,BNNT localization following incubation with hOB cultureswas investigated with the lysosome-tracking assay underfluorescence microscopy to reveal any lysosomal involvementin PLL-BNNT trafficking, and with TEM/EELS to giveevidence that the abovementioned electron-dense nano-objects were actually BNNTs. Results obtained showed thatonly a small fraction of QD-labeled PLL-BNNTs colocalizedwith hOB lysosomes (Pearson coefficient = 0.130) (figure 4).As a confirm, TEM analysis, conducted using unlabeledPLL-BNNTs, indicated massive presence of tube-shapednano-objects inside cytoplasm vesicles, which were notvisible in the control group (i.e. plain hOBs). Additionally,we performed EFTEM elemental maps of B and EEL spectraon such aggregates, which unequivocally demonstrated thespecific presence of both B and N elements (figure 5). Theseresults are in line with other findings obtained by our groupusing other BNNT types and biopolymeric coatings [27].

3.4. Effects of PLL-BNNTs and US irradiation on hOBcultures

The stimulation experiments consisted of four groups ofcellular samples, each one performed in triplicate, retracingthe scheme used in the first study on neuronal cells [27]. Here,plain hOBs and hOBs internalizing BNNTs were irradiatedwith low frequency US, comparatively to their respectiveun-irradiated controls. The four sample groups will be furtherreported as: ‘hOBs’, ‘hOBs + US’, ‘hOBs + BNNTs’, and‘hOBs + BNNTs + US’. A schematic of BNNT-mediatedstimulation of cell cultures obtained via US irradiationis shown in figure 1. Osteoblasts are cells in which thedifferentiation pathway is well documented through an arrayof markers which enable the precise assessment of theirdifferentiative stage [37]. In this report, we investigated theexpression of a set of osteoblastic markers, including someosteoblast-specific genes (Runx2, Coll I, OPN and OCN),as well as selected biomolecules secreted by hOBs: TGF-β1(i.e. a growth factor), ALP (i.e. a glycoprotein), OPN (i.e. asialoprotein), OCN (i.e. a non-collagenic protein), and Ca(i.e. a mineral matrix component).

Figure 4. Colocalization of BNNTs and lysosomes in hOBs studied via fluorescence microscopy. (a) All channels: Q-dot labeled BNNTs(red channel) and hOB lysosomes (green channel) after 6 h incubation. (b) Colocalized objects (yellow channel). Scale bar = 50 µm.

7

Nanotechnology 24 (2013) 465102 S Danti et al

Figure 5. BNNT internalization assessment via electron microscopy. Intracellular location of BNNTs in hOBs, as obtained viaTEM/EELS. (a) TEM micrograph of a region including several hOB intracellular vesicles. (b) Elemental map of boron (B K edge at 188,20 eV slit) on the same cell area. (c) An EEL spectrum collected in STEM mode from the point indicated with a cross in (a), showing thecore-loss K edges of boron and nitrogen.

3.4.1. Effects on gene expression. In the developmentof the osteoblast phenotype, Runx2 and Coll I genes areconstitutive of the osteoblastic lineage [38]. In contrast,regulation of other genes, such as OPN and OCN, is involvedin osteoblast maturation with a diverse timeline. Indeed, OPNexpression rises early during proliferation and differentiation,while OCN expression occurs later in mature bone cells[37, 38]. qRT-PCR showed gene expression effects dependingon the type of treatment (single, i.e. US and BNNTs; orcombined, i.e. BNNTs + US) applied to the hOB cultures.The gene expression chart is reported in figure 6(a). TheOPN expression level in treated samples (hOBs + US,hOBs + BNNTs and hOBs + BNNTs + US) showed a2.09 ± 0.06-, 1.83 ± 0.05- and 3.46 ± 0.3-fold differencewith respect to that of hOBs (1.00± 0.21), being significantlyupregulated by both single treatments (about 1.8- and 2.0-folddifferences, with statistical significance: p = 0.01 and p =0.001) and further enhanced by the combined treatment (about3.5-fold difference, with statistical significance: p = 0.0001).Moreover, the latter group (hOBs + BNNTs + US) wasstatistically different from both single treatments (hOBs+US

and hOBs + BNNTs, both with p = 0.001), while nostatistically significant difference was detected between OPNexpression in single-treatment groups (hOBs + US versushOBs + BNNTs: p n.s.). Summarizing, OPN expression levelwas markedly upregulated with a wide excursion in all treatedspecimens, displaying its lowest expression in plain hOBs andits highest expression in the hOBs + BNNTs + US group.

In our findings, a moderate and BNNT-unspecificdownregulation of other osteoblastic genes was revealed. Withrespect to those of control hOBs (1.00 ± 0.18, 1.00 ± 0.21and 1.00 ± 0.17), in the treated samples (hOBs + US,hOBs + BNNTs and hOBs + BNNTs + US), the expressionof Coll I was 0.23 ± 0.03 (p = 0.01), 0.21 ± 0.01(p = 0.001) and 0.31 ± 0.008 (p = 0.01); expression ofRunx2 was 0.77 ± 0.25 (p = 0.01), 0.65 ± 0.034 (p =n.s) and 0.59 ± 0.17 (p = n.s); and expression of OCNwas 0.42 ± 0.06 (p = 0.01), 0.76 ± 0.008 (p = n.s.) and0.60 ± 0.11 (p = 0.01) fold difference. Summarizing theseresults, it can be pointed out that a significantly downregulatedexpression, with respect to hOBs, of the osteoblastic mastergene Runx2 was detected only in the hOBs + BNNTs group,

8

Nanotechnology 24 (2013) 465102 S Danti et al

Figure 6. Results of the stimulation method: quantification of geneexpression and bone molecule synthesis in the investigated groups(n = 3). Data are reported as mean ± SD. Asterisks indicate thefollowing p values: ∗0.01; ∗∗0.001; ∗∗∗0.0001 and ∗∗∗∗0.000 01.(a) The gene expression chart shows the relative fold expression ofbone related genes. (b) Bone specific proteins (TGF-β1, ALPactivity and OCN) and calcium assayed and normalized by theds-DNA content of each sample.

while, in this comparison only, the late-stage differentiativemarker, OCN, was not statistically different from controls.

So far, the effect of the interactions between BNNTsand osteoblasts at gene level has been poorly documentedin the literature, apart from a report on cells cultured onnanocomposites, highlighting a high upregulation of Runx2gene in a human osteoblast cell line [39]. However, it has to beconsidered that immortalized cell lines (i.e. not primary cells)may have altered machinery resulting in modified timelineand expression of specific gene markers [40]. Conversely,models of CNT cytotoxicity after endocytosis have pointedout important gene deregulation together with the concomitantdepletion of protein synthesis [41]. From an overview of thegene expression chart, the gene expression profiles in thedifferent treatments look very similar. In our study, the lightColl I downregulation occurred in all comparisons againstcontrols, including merely US-treated samples. Differently,statistically significant downregulation of Runx2 expressionoccurred only in the hOBs + BNNTs group, while that ofOCN only in hOBs + US and hOBs + BNNTs + US.

Better than genes, protein marker expression can givean elucidative picture of hOB viability and differentiation.Indeed, gene downregulation may occur as a consequence ofan increased protein production and vice versa, as an examplefor a feedback regulatory mechanism. For this reason, wefocused upon the synthesis of important proteins involved in

the osteogenic process, since protein expression is decisive toassess the differentiative stage of hOBs as well as their vitalityand function. Indeed, the produced mRNAs may not always betranslated into proteins due to degradation, and proteins maybe still steadily expressed along with a low gene expression.Anyhow, OPN upregulation at gene level following the set oftreatments confirmed that neither BNNTs, nor US, nor thecombination of the two, had exerted a depleting role in theOPN regulatory pathway itself.

3.4.2. Effects on protein expression. To assess the stage ofhOB maturation, three main proteins of the non-collagenousbone matrix were analyzed as they are involved in osteoblastdifferentiation with different timelines: ALP activity (early),OPN (bimodal: early and late) and OCN (late) [37, 38].TGF-β1 was also investigated as a cytokine known to beinvolved in bone mechanoelectrical transduction [42]. ALPactivity, OCN and TGF-β1 were quantitatively evaluated andnormalized by respective ds-DNA contents; OPN, instead,was investigated immunocytochemically. Normalized dosagesof ALP, TGF-β1 and OCN are reported in figure 6(b).The TGF-β1 amount per microgram of ds-DNA was0.52 ± 0.24 ng in hOBs, 0.73 ± 0.25 ng in hOBs + US,3.54 ± 1.92 ng in hOBs + BNNTs, and 3.36 ± 0.61 ng inhOBs + BNNTs + US. In the latter group, highly enhancedlevels of TGF-β1 were detected with statistical significancewith respect to those of hOBs (>6 times; p = 0.001).

Relatively low levels of ALP activity per microgramds-DNA, measured at the endpoint, were similarly detectedin all groups (averages in the range 0.17–0.53 mmol h−1).A statistically significant difference in ALP activity could beonly detected between hOBs+US and hOBs+BNNTs+USgroups, 0.17± 0.04 and 0.53± 0.13, respectively (p = 0.01).

Quantitative values of OCN per microgram of ds-DNAwere 0.90 ± 0.16 ng in hOBs, 1.67 ± 0.21 ng inhOBs + US, 3.17 ± 0.73 ng in hOBs + BNNTs and4.62 ± 0.79 ng in hOBs + BNNTs + US. Synthesisof OCN followed an increasing trend, reaching in thehOBs + BNNTs + US samples the highest value againsthOBs (p = 0.0001) and hOBs + US (p = 0.001). As aconsequence, the previously reported downregulation in OCNgene expression did not prevent its protein from beingsynthesized. Quantitative evaluation of OCN protein provedthat the slight downregulation of OCN at gene level wasat the same time associated with its enhanced synthesis atprotein level. Indeed, OCN turned out to be increased alongtreatments (plain → US → BNNTs → BNNTs + US),reaching its peak in the BNNTs + US group. In bothBNNT-treated groups, and in particular in the BNNTs + USone, reduction of proliferation (as from ds-DNA contents atthe endpoint; data not explicitly represented since used fornormalization) and ALP activity, associated with the enhancedexpression of the later stage marker OCN, indicate osteoblaststo be in a postproliferative phase about to initiate their mineraldeposition process [43]. These data suggested that the bothapplied stimuli (i.e. BNNTs and US) were non-cytotoxic, withhOBs being viable, responsive to stimuli and syntheticallyactive in US-irradiated BNNT-treated samples.

9

Nanotechnology 24 (2013) 465102 S Danti et al

Figure 7. Histologic results of the stimulation method. Micrographs of hOBs under different treatments (1–4). (a) OPN expression, asobtained via immunocytochemistry (in orange–brown). (b) Calcium deposits revealed via cytochemistry (in black). Scale bar = 50 µm.

OPN was investigated via immunocytochemistry (fig-ure 7(a) (1–4)). In this case, a semiquantification ofOPN expression was obtained by positive cell countson immunostained micrographs. In particular, hOBs andhOBs + BNNTs + US samples displayed a closely highpercentage of positive cells (39.6% and 41.0%, respectively)and the same intensity of positivity (++), which wasthe highest one scored in all the groups. In contrast, insingle treatment-groups (hOBs + US and hOBs + BNNTs,respectively), OPN-positive cells were 5.5% and 5.4% andshowed a decreased antigen intensity, (+/++) and (+),

respectively. OPN protein was found then reduced in thesamples that underwent single treatments (hOBs + USand hOBs + BNNTs), while in hOBs + BNNTs + USsamples it was still well expressed and comparable to thatof hOBs, in both the number and the antigenic intensity ofpositive cells. In contrast to OCN behavior, OPN expression,which was significantly upregulated at gene level, turnedout at the same time to be reduced at protein level in thesamples that underwent single treatments (hOBs + US andhOBs + BNNTs), as detected via immunocytochemistry.However, OPN protein was found to be highly expressed

10

Nanotechnology 24 (2013) 465102 S Danti et al

in hOBs + BNNTs + US samples and comparable to thatof plain hOBs. During osteoblastogenesis, OPN is knownto show up with a typical bimodal expression, rising earlierin the active proliferation phase and later at the onsetof mineralization [37, 38]. The contemporaneous maximalexpression of OPN and OCN in the BNNTs + US groupcorroborated the hypothesis of initiation of a mineralizingphase [38].

3.4.3. Effects on mineralization. The mineral matrix isformed by mature osteoblasts with typical nodular formationslying on the secreted organic extracellular matrix. In ourexperiments, no mineralizing supplement was added tothe CM. The obtained Ca2+ amount per microgram ofds-DNA detected in the specimens was 10.20 ± 2.98 µgin hOBs, 25.95 ± 6.43 µg in hOBs + US, 41.00 ±7.97 µg in hOBs + BNNTs, and 78.92 ± 7.32 µg inhOBs + BNNTs + US. A statistically significant Ca2+

production in hOBs + BNNTs + US samples (p =0.000 01 against hOBs, p = 0.001 against hOBs + US andhOBs + BNNTs) was demonstrated quantitatively by Ca2+

dosages (figure 6(b)) and morphologically by apatite noduleformations, specifically located within the extracellular spacesof the most densely populated areas of the cultures, asrevealed by von Kossa staining (figure 7(b) (1–4)).

On the whole, these findings are compatible with thehOB differentiative pattern and indicate a clear increase intheir maturation process driven by BNNTs. Indeed, althoughcell interactions with plain BNNTs seemed to exert an initialosteogenic effect, specifically on OCN protein, osteoblastmaturation (i.e. the highest OCN protein and Ca2+ amounts)became relevant only if US treatment was added. Thispanel of outcomes, although still preliminary, shows thepossibility of influencing and driving the osteoblast fatein vitro using piezoelectric nanotubes and low frequencyUS. This appears somehow to involve the regulatorypathways of some osteoblastic markers enrolled in thedifferentiation cascade, such as OPN and OCN. Moreover,the maximal expression of TGF-β1 protein in this groupsuggests mechanoelectrical signaling to be involved in theosteoblast maturation, thus indicating a piezoelectric behaviorof BNNTs. The reported findings, which are in sharp contrastwith those obtained after administration of CNTs to osteoblastcultures, highlighting a strong decline in their viability anddifferentiative capacity [44], thus confirm once again thesuperior cytocompatibility of BNNTs and their appealingpotential in bone regeneration [45].

Further studies should be aimed at demonstrating whetherand to what extent the reported effects are a direct result ofBNNT polarization induced by US or of the two separatestimuli (BNNTs and US), independently. Indeed, sinceosteoblasts are responsive to both electric and mechanicalsignals, a concomitant influence of such stimuli at somedegree cannot be excluded. Moreover, due to the complexorchestrating of signal transduction pathways involved in theosteoblast differentiation, dedicated studies will be necessaryto understand the underlying molecular mechanisms. Owingto osteoblasts’ sensitivity to electric stimuli and to the

possibility of safely applying US in vivo, BNNTs might beexploited in bone diseases as nanotransducers for regenerativecellular therapies as well as composite scaffold materials fortissue engineering applications [39, 46].

4. Conclusion

In this paper we have reported on the possibility ofusing BNNTs and low frequency US to promote osteoblastmaturation in vitro. We applied an indirect methodfor a putative ‘electric-like’ stimulation of osteoblastsusing US-activated BNNTs. Stable water dispersions ofBNNTs were obtained via PLL-wrapping. Our preliminarycytocompatibility assessment allowed the establishment of anon-cytotoxic PLL-BNNT concentration to be used in vitrowith hOB cultures. Moreover, investigation with TEM/EELSconfirmed that PLL-BNNTs were internalized at cytoplasmlevel, being mainly detected in membranal vesicles. Atthis point, a minimal US irradiation (15 s day−1) wasapplied for one week to the cellular samples. Due to thecomplexity of the experimental system, at such an early stageof investigation, this study faces a ‘black box’, in whichthe two stimuli are added to osteoblast cultures and theeffects are mainly measured in terms of bone ECM synthesisand composition with respect to control groups. Indeed, themolecular mechanism underlying the reported events is stillan object of investigation. As a straightforward result, apanel of findings compatible with an increased osteoblasticmaturation was observed in BNNT-treated samples, in whichOCN protein turned out to be increased with respect totheir controls. However, mineralization and TGF-β1 synthesisbecame significant only in BNNTs + US-treated specimens.As an encouraging remark, this stimulatory method wasfound not to exert important deregulations of the analyzedosteoblastic markers. As an example, the OPN gene turnedout to be markedly upregulated in BNNT-treated samples,and some light gene downregulation could not be related todepletive effects so far.

On the whole, our outcomes show the appealing propertyof BNNTs, jointly with low frequency US, to triggerthe differentiation processes of human primary osteoblasts,and to foster their function. This may disclose intriguingimplications for the development of new minimally invasivetherapies for the regeneration of bone as well as othermechanoelectrically responsive tissues.

Acknowledgments

The Tuscany Region is gratefully acknowledged for fundingthis study (Pisa CUCCS/RRMR grant). Many thanks aredue to Professor Ying Chen and Dr Jun Yu (Departmentof Electronic Materials and Engineering, Australian NationalUniversity of Canberra, Australia) for supplying the BNNTsample, as well as to Dr Andrea Falqui (IIT, Genoa, Italy),Dr M Rita Metelli (AUOP, Pisa, Italy) and Dr Simone Pacini(Department of Internal Medicine, University of Pisa, Italy)for the technical support given to this study.

11

Nanotechnology 24 (2013) 465102 S Danti et al

References

[1] Dai H 2002 Carbon nanotubes: synthesis, integration, andproperties Acc. Chem. Res. 35 1035–44

[2] Wang J, Lee C H and Yap Y K 2010 Recent advancements inboron nitride nanotubes Nanoscale 2 2028–34

[3] Terrones M, Romo-Herrera J M, Cruz-Silva E, Lopez-Urıas F,Munoz-Sandoval E, Velazquez-Salazar J J, Terrones H,Bando Y and Golberg D 2007 Pure and doped boron nitridenanotubes Mater. Today 10 30–8

[4] Zhi C, Bando Y, Terao T, Tang C, Kuwahara H andGoldberg D 2009 Chemically activated boron nitridenanotubes Chem. Asian J. 4 1536–40

[5] Zhi C, Bando Y, Tang C C, Honda S, Sato K, Kuwahara H andGoldberg D 2005 Covalent functionalization: towardssoluble multiwalled boron nitride nanotubes Angew. Chem.Int. Edn 44 7932–5

[6] Golberg D, Bai X, Mitome M, Tang C, Zhi C and Bando Y2007 Structural peculiarities of in situ deformation of amulti-walled BN nanotube inside a high-resolutionanalytical transmission electron microscope Acta Mater.55 1293–8

[7] Nakhmanson S M, Calzolari A, Meunier V, Bernholc J andBuongiorno Nardelli M 2003 Spontaneous polarization andpiezoelectricity in boron nitride nanotubes Phys. Rev. B67 235406

[8] Wang J, Lee C H, Bando Y, Golberg D and Yap Y K 2009B-C-N Nanotubes and Related Nanostructureed Y K Yap (Heidelberg: Springer) pp 23–44

[9] Michalski P J, Sai N and Mele E J 2005 Continuum theory fornanotube piezoelectricity Phys. Rev. Lett. 95 116803–6

[10] Mele E J and Kral P 2002 Electric polarization of heteropolarnanotubes as a geometric phase Phys. Rev. Lett. 88 056803

[11] Bai X, Golberg D, Bando Y, Zhi C, Tang C, Mitome M andKurashima K 2007 Deformation-driven electrical transportof individual boron nitride nanotubes Nano Lett. 7 632–7

[12] Jafari A, Afaghi Khatibi A and Mashhadi M M 2012Evaluation of mechanical and piezoelectric properties ofboron nitride nanotube: a novel electro structural analogyapproach J. Comput. Theor. Nanosci. 9 461–8

[13] Kostarelos K et al 2007 Cellular uptake of functionalizedcarbon nanotubes is independent of functional group andcell type Nature Nanotechnol. 2 108–13

[14] Dvir T, Timko B P, Kohane D S and Langer R 2011Nanotechnological strategies for engineering complextissues Nature Nanotechnol. 6 13–22

[15] Zhi C, Bando Y, Tang C, Xie R, Sekiguchi T and Golberg D2005 Perfectly dissolved boron nitride nanotubes due topolymer wrapping J. Am. Chem. Soc. 127 15996–7

[16] Ciofani G, Danti S, Genchi G G, D’Alessandro D,Pellequer J L, Odorico M, Mattoli V and Giorgi M 2012Pilot in vivo toxicological investigation of boron nitridenanotubes Int. J. Nanomed. 7 19–24

[17] Ciofani G, Danti S, Nitti S, Mazzolai B, Mattoli V andGiorgi M 2013 Biocompatibility of boron nitridenanotubes: an up-date of in vivo toxicological investigationInt. J. Pharm. 444 85–8

[18] Ciofani G, Danti S, Genchi G G, Mazzolai B and Mattoli V2013 Boron nitride nanotubes: biocompatibility andpotential spill-over in nanomedicine Small 9 1672–85

[19] Wojnar R 2012 Piezoelectric Nanomaterials for BiomedicalApplications ed G Ciofani and A Menciassi (Berlin:Springer) p 181

[20] Minary-Jolandan M and Yu M F 2011 Nanoscalecharacterization of isolated individual type I collagenfibrils: polarization and piezoelectricity Nanotechnology20 085706

[21] Stroe M C, Crolet J M and Racila M 2013Mechanotransduction in cortical bone and the role of

piezoelectricity: a numerical approach Comput. MethodsBiomech. Biomed. Eng. 16 119–29

[22] Meng S, Zhang Z and Rouabhia M 2011 Acceleratedosteoblast mineralization on a conductive substrate bymultiple electrical stimulation J. Bone Miner. Metab.29 535–44

[23] Bodhak S, Bose S, Kinsel W C and Bandyopadhyay A 2012An investigation of in vitro bone cell adhesion andproliferation on Ti using direct current stimulation Mater.Sci. Eng. C 32 2163–8

[24] Ercan B and Webster T J 2010 The effect of biphasic electricalstimulation on osteoblast function at anodized nanotubulartitanium surfaces Biomaterials 31 3684–93

[25] Spadaro J A 1997 Mechanical and electrical interactions inbone remodeling Bioelectromagnetics 18 193–202

[26] Ahmadi F, McLoughlin I V, Chauhan S and ter-Haar G 2012Bio-effects and safety of low-intensity, low-frequencyultrasonic exposure Prog. Biophys. Mol. Biol. 108 119–38

[27] Ciofani G et al 2010 Enhancement of neurite outgrowth inneuronal-like cells following boron nitride nanotube-mediated stimulation ACS Nano 4 6267–77

[28] Yu J, Chen Y, Wuhrer R, Liu Z and Ringe S P 2005 In situformation of BN nanotubes during nitriding reactionsChem. Mater. 17 5172–6

[29] Ciofani G and Danti S 2012 Evaluation of cytocompatibilityand cell response to boron nitride nanotubes Methods Mol.Biol. 811 193–206

[30] Ciofani G et al 2010 Investigation of interactions betweenpoly-L-lysine-coated boron nitride nanotubes and C2C12cells: up-take, cytocompatibility, and differentiation Int. J.Nanomed. 5 285–98

[31] Tsiridis E, Gurav N, Bailey G, Sambrook R and Di Silvio L2006 A novel ex vivo culture system for studying bonerepair Injury 37 S10–7

[32] Livak K J and Schmittgen T D 2001 Analysis of relative geneexpression data using real-time quantitative PCR and the2(-Delta Delta C(T)) method Methods 25 402–8

[33] Danti S, D’Alessandro D, Pietrabissa A, Petrini M andBerrettini S 2010 Development of tissue-engineeredsubstitutes of the ear ossicles: PORP-shapedpoly(propylene fumarate)-based scaffolds cultured withhuman mesenchymal stromal cells J. Biomed. Mater. Res. A92A 1343–56

[34] Zhang Y, Ali S F, Dervishi E, Xu Y, Li Z, Casciano D andBiris A S 2010 Cytotoxicity effects of graphene andsingle-wall carbon nanotubes in neuralphaeochromocytoma-derived PC12 cells ACS Nano4 3181–6

[35] Horvath L, Magrez A, Golberg D, Zhi C, Bando Y, Smajda R,Horvath E, Forro L and Schwaller B 2011 In vitroinvestigation of the cellular toxicity of boron nitridenanotubes ACS Nano 5 3800–10

[36] Ferreira T H, Silva P R O, Santos R G and Sousa E M B 2011A novel synthesis route to produce boron nitride nanotubesfor bioapplications J. Biomater. Nanobiotechnol. 2 426–34

[37] Javed A, Chen H and Ghori F Y 2010 Genetic andtranscriptional control of bone formation Oral Maxillofac.Surg. Clin. North Am. 22 283–93

[38] Aubin J E 1998 Advances in the osteoblast lineage Biochem.Cell Biol. 76 899–910

[39] Lahiri D, Rouzaud F, Richard T, Keshri A K, Bakshi S R,Kos L and Agarwal A 2010 Boron nitride nanotubereinforced polylactide-polycaprolactone copolymercomposite: mechanical properties and cytocompatibilitywith osteoblasts and macrophages in vitro Acta Biomater.6 3524–33

12

Nanotechnology 24 (2013) 465102 S Danti et al

[40] Pan C, Kumar C, Bohl S, Klingmueller S and Mann M 2009Comparative proteomic phenotyping of cell lines andprimary cells to assess preservation of cell type-specificfunctions Mol. Cell. Proteomics 8 443–50

[41] Alazzam A, Mfoumou E, Stiharu I, Kassab A, Darnel A,Yasmeen A, Sivakumar N, Bhat R and Al Moustafa A E2010 Identification of deregulated genes by single wallcarbon-nanotubes in human normal bronchial epithelialcells Nanomedicine 6 563–9

[42] Zhuang H, Wang W, Seldes R M, Tahernia A D, Fan H andBrighton C T 1997 Electrical stimulation induces the levelof TGF-beta1 mRNA in osteoblastic cells by a mechanisminvolving calcium/calmodulin pathway Biochem. Biophys.Res. Commun. 237 225–9

[43] Hoemann C D, El-Gabalawy H and McKee M D 2009 In vitroosteogenesis assays: influence of the primary cell source onalkaline phosphatase activity and mineralization Pathol.Biol. 57 318–23

[44] Zhang D, Yi C, Qi S, Yao X and Yang M 2010 Effects ofcarbon nanotubes on the proliferation and differentiation ofprimary osteoblasts Methods Mol. Biol. 625 41–53

[45] Ciofani G, Danti S, Ricotti L, D’Alessandro D, Moscato S andMattoli V 2012 Piezoelectric Nanomaterials for BiomedicalApplications ed G Ciofani and A Menciassi (Berlin:Springer) pp 213–38

[46] Salehi-Khojin A and Jalili N 2008 Buckling of boron nitridenanotube reinforced piezoelectric polymeric compositessubject to combined electro-thermo-mechanical loadingsCompos. Sci. Technol. 68 1489–501

13