based sirna delivery system for the treatment of triple-negative ...

DEVELOPMENT OF A MULTIFUNCTIONAL CATIONIC LIPID-

BASED SIRNA DELIVERY SYSTEM FOR THE TREATMENT OF

TRIPLE-NEGATIVE BREAST CANCER

Thesis by

MANEESH GUJRATI

In Partial Fulfillment of the Requirements

for the degree of Doctor of Philosophy

Dissertation Advisor: Zheng-Rong Lu

Department of Biomedical Engineering

Case Western Reserve University

August, 2015

CASE WESTERN RESERVE UNIVERSITY

SCHOOL OF GRADUATE STUDIES

We hereby approve the thesis/dissertation of

Maneesh Gujrati

candidate for the degree of Doctorate of Philosophy *.

(signed)

(date)

Zheng-Rong Lu

Efsthatios Karathanasis

Nicole Steinmetz

Julian Kim

May 6, 2015

* We also certify that written approval has been obtained for any proprietary

material contained therein.

© 2015

Maneesh Gujrati

All Rights Reserved

i

Table of Contents

Table of contents ................................................................................................. i

List of Tables ................................................................................................... viii

List of Figures .................................................................................................... ix

Acknowledgments .......................................................................................... xiv

List of Abbreviations ....................................................................................... xvi

Abstract ............................................................................................................ xix

Chapter 1: Introduction ...................................................................................... 1

1.1 The promise of gene therapy ...................................................................... 2

1.2 The RNA interference mechanism ............................................................. 3

1.3 The RNAi advantage .................................................................................. 5

1.3.1 A natural pathway ................................................................................ 5

1.3.2 A catalytic mechanism ......................................................................... 6

1.3.3 Target ‘undruggable’ targets ................................................................ 6

1.3.4 Upstream mechanism .......................................................................... 7

1.3.5 Enable drug discovery process ............................................................ 7

1.4 Opportunity for RNAi in cancer ................................................................... 8

1.4.1 Opportunity of RNAi-mediated gene therapy in triple-negative breast

cancer ........................................................................................................... 9

1.5 Considerations for systemic siRNA delivery ............................................. 11

1.6 Current approaches for siRNA delivery .................................................... 14

1.6.1 Targeted siRNA delivery .................................................................... 17

1.6.2 Chemically modified siRNA ................................................................ 20

1.6.3 Lipid-based siRNA delivery systems .................................................. 22

ii

1.6.4 Cationic liposomes ............................................................................. 23

1.6.5 Neutral liposomes .............................................................................. 24

1.6.6 Lipid-like siRNA nanoparticles……………………………….. ................ 26

1.67 Polymer-mediated siRNA delivery........................................................ 27

1.6.8 Theranostics ....................................................................................... 32

1.6.9 siRNA in clinical trials .......................................................................... 35

1.7 Objectives ................................................................................................. 39

Chapter 2: pH-Sensitive Cationic Lipid-Based siRNA Delivery Systems .... 42

2.1 Introduction ................................................................................................ 43

2.2 Endosomal escape: The rate-limiting step................................................. 45

2.3 pH-sensitive amphiphilicity ........................................................................ 46

2.4 Mechanism of endolysosomal escape ....................................................... 47

2.5 pH-sensitive lipids for siRNA delivery ........................................................ 49

2.6 Concluding remarks .................................................................................. 71

Chapter 3: Multifunctional Cationic Lipid-Based Nanoparticles Facilitate

Endosomal Escape and Reduction-Triggered Cytosolic siRNA Release ... 72

3.1 Introduction ................................................................................................ 73

3.2 Materials and Methods .............................................................................. 78

3.2.1 Synthesis of (1-aminoethyl)iminobis[N-(oleicylcysteinyl-1-amino-

ethyl)propionamide] ..................................................................................... 78

3.2.2. Preparation of ECO/siRNA Nanoparticles ......................................... 78

3.2.3 Nanoparticle Characterization ............................................................ 78

3.2.4. Entrapment Efficiency ....................................................................... 79

3.2.5 Heparin Displacement Assay ............................................................. 79

3.2.6 Gel Electrophoresis for siRNA Loading, Serum Protection, and

Glutathione-Mediated Nanoparticle Reduction ………………………………. 79

iii

3.2.7 Cell Culture ........................................................................................ 80

3.2.8 In Vitro Transfection Efficiency ........................................................... 81

3.2.9 Cytotoxicity ......................................................................................... 81

3.2.10 Flow Cytometry for Nanoparticle Cellular Uptake and Uptake Kinetics

Measurements ............................................................................................ 82

3.2.11 Protein Adsorption ............................................................................ 83

3.2.12 pH-Dependent Membrane Disruption Hemolysis Measurement ...... 84

3.2.13 Inhibition of Glutathione-Dependent Reduction with BSO ................ 84

3.2.14 Confocal Microscopy of Cellular Uptake of ECO/siRNA Nanoparticles

and Intracellular Release of siRNA ............................................................. 85

3.2.15 Immunofluorescence of Intracellular Trafficking of ECO/siRNA

Nanoparticles……………………………….. .................................................. 85

3.2.16 Statistical Analysis ........................................................................... 86

3.3 Results and Discussion ............................................................................. 86

3.3.1. Effect of N/P ratio on the physicochemical properties of ECO/siRNA

nanoparticles ............................................................................................... 86

3.3.2. Effect of N/P ratio on the biological properties of ECO/siRNA

nanoparticles ............................................................................................... 89

3.3.3. ECO/siRNA nanoparticles protect siRNA and promote cellular uptake

in the presence of serum proteins ............................................................... 93

3.3.4. ECO/siRNA nanoparticles are pH-sensitive and promote endosomal

escape ........................................................................................................ 96

3.3.5. Cytosolic reduction of ECO/siRNA nanoparticles is crucial for siRNA

release and RNAi activity ............................................................................ 99

3.4 Conclusions ............................................................................................. 102

3.3 Acknowledgments ................................................................................... 103

iv

Chapter 4: Silencing β3 Integrin by Targeted siRNA Nanoparticles Inhibits

EMT and Metastasis of Triple Negative Breast Cancer .............................. 104

4.1 Introduction .............................................................................................. 105

4.2 Materials and Methods ............................................................................ 107

4.2.1 Cell lines and reagents ..................................................................... 107

4.2.2 Preparation of ECO/siRNA nanoparticles ........................................ 107

4.2.3 Western blot analyses ...................................................................... 109

4.2.4 Flow cytometry for nanoparticle cellular uptake ............................... 109

4.2.5 Semi-quantitative real-time PCR analyses ....................................... 110

4.2.6 Invasion and proliferation assays ……………………………….. ........ 110

4.2.7 3-Dimensional (3D)-organotypic cultures ......................................... 111

4.2.8 Tumor growth and bioluminescent imaging (BLI) .............................. 111

4.2.9 In vivo therapeutic treatment ……………………………….. ............... 112

4.2.10 Immunofluorescence and immunohistochemical staining .............. 112

4.2.11 Statistical analyses ......................................................................... 114

4.3 Results .................................................................................................... 114

4.3.1 ECO/siβ3 nanoparticles induce sustained silencing of a3 integrin ... 114

4.3.2 ECO/siβ3 nanoparticles attenuate TGF-β-mediated EMT, invasion, and

proliferation ............................................................................................... 117

4.3.3 ECO/siβ3 nanoparticles attenuate outgrowth of murine and human

MECs in 3D-organotypic culture ............................................................... 119

4.3.4 Surface modification of ECO/siRNA nanoparticles with RGD peptide

promotes cellular uptake and sustains gene silencing .............................. 122

4.3.5 RGD-ECO/siβ3 nanoparticles inhibit pulmonary outgrowth of mouse

MECs in vivo ............................................................................................. 124

v

4.3.6 RGD-ECO/sia3 nanoparticles effectively inhibit primary tumor growth

and metastasis of malignant human MECs ……………………………….. .. 125

4.4 Discussion ............................................................................................... 132

4.5 Conclusions ............................................................................................. 135


Chapter 5: Development of a pH-Cleavable PEG Surface Modification

Strategy to Overcome the PEG Dilemma in ECO/siRNA Nanoparticles .... 137

5.1 Introduction .............................................................................................. 138


5.2.1 Cell Culture ...................................................................................... 142

5.2.2 Synthesis of mPEG(HZ)-mal and RGD-PEG(HZ)-mal ...................... 142

5.2.3 Preparation of PEG-modified ECO/siRNA nanoparticles ................. 144

5.2.4 Nanoparticle Characterization ........................................................... 145

5.2.5 pH-Dependent Membrane Disruption Hemolysis Measurement ....... 145

5.2.6 Flow Cytometry for Nanoparticle Cellular Uptake Measurements

……………………………….. ...................................................................... 146

5.2.7 Confocal Microscopy of Nanoparticle Uptake and Intracellular Release

of siRNA .................................................................................................... 147

5.2.8 In Vitro Luciferase Silencing Efficiency ............................................. 148

5.2.9 In Vivo Luciferase Silencing Efficiency ……………………………….. 149

5.2.10 Fluorescence Molecular Tomography ............................................. 149

5.2.11 Ex vivo flow cytometry and confocal microscopy ........................... 150

5.2.12 Statistical analyses .................................................................... 150

5.3 Results and Discussion ........................................................................... 150

vi

5.3.1 Surface modification of ECO/siRNA nanoparticles with pH-cleavable

PEG layer restores intrinsic pH-sensitive activity ...................................... 151

5.3.2 pH-cleavable RGD-PEG modification induces potent in vitro silencing

efficiency ................................................................................................... 155

5.3.3 Inclusion of hydrazone linkage enhances endosomal escape ......... 158

5.3.4 Targeted pH-sensitive nanoparticles exhibit potent and sustained in

vivo gene silencing .................................................................................... 162

5.3.5 Targeting ligand enhances tumor retention of nanoparticles by

promoting internalization within tumor cells ............................................... 163

5.4 Conclusions ............................................................................................. 168


Chapter 6: Targeting eIF4E with a Dual pH-responsive siRNA Delivery

System to Overcome Drug Resistance in Triple-Negative

Breast Cancer ................................................................................................ 170

6.1 Introduction .............................................................................................. 171


6.2.1 Cell Culture ....................................................................................... 174

6.2.2 Preparation of PEG-modified ECO/siRNA nanoparticles .................. 174

6.2.3 Semi-quantitative real-time PCR analyses ........................................ 175

6.2.4 Western blot analyses ...................................................................... 176

6.2.5 Cytotoxicity Assay ............................................................................ 177

6.2.6 In vivo tumor growth inhibition study ……………………………….. ... 177

6.2.7 Bioluminescent imaging ................................................................... 178

6.2.8 Toxicity, immune response, and pathology studies ........................... 178

6.3 Results and Discussion ........................................................................... 179

vii

6.3.1. Silencing eIF4E by RGD-targeted pH-cleavable PEG-modified

ECO/siRNA nanoparticles enhances sensitivity to paclitaxel in a drug-

resistance triple-negative breast cancer cell line ........................................ 179

6.3.2. Combination of siRNA targeting eIF4E and paclitaxel inhibits primary

tumor growth of drug-resistant MDA-MB-231 cells .................................... 182

6.3.3. Long-term systemic administration of RGD-PEG(HZ)-ECO/siRNA

nanoparticles elicits no chronic immune response or organ damage ......... 190

6.4 Conclusions ............................................................................................. 192


Chapter 7: Future Work .................................................................................. 194

7.1 Summary of Work ................................................................................... 195

7.2 Long-term stability of ECO/siRNA nanoparticle formulations .................. 195

7.3 Treatment of late-stage, metastatic disease ............................................ 197

7.4 Alternative surface-modification strategies .............................................. 200

7.5 Synergy in co-delivery of siRNA and PTX ............................................... 202

Appendix ......................................................................................................... 205

A.1. Synthesis of ECO ................................................................................... 206

A.2. Synthesis of cRGD-PEG-maleimide ...................................................... 214

A.3. Synthesis of mPEG(HZ)-maleimide ....................................................... 216

A.4. Synthesis of cRGD-PEG(HZ)-maleimide ............................................... 217

References ...................................................................................................... 220

viii

List of Tables

Table 1.1. Examples of siRNA-based therapies against breast cancer .............. 11

Table 1.2. Examples of siRNA delivery systems for the treatment of cancers ... 15

Table 1.3. Select examples of siRNA therapies in clinical trials ......................... 38

Table 7.1. Considerations for nanoparticle delivery to specific sites ................ 199

ix

List of Figures

Figure 1.1. Synthetic siRNA-induced RNA interference ....................................... 5

Figure 1.2. Subtypes of breast cancer ............................................................... 10

Figure 1.3. Physiological barriers to the systemic delivery of siRNA

nanoparticles ...................................................................................................... 13

Figure 2.1. Structure and activity of DLinDMA-based cationic lipids .................. 51

Scheme 2.1. General structure of pH-sensitive cationic lipids for siRNA delivery

........................................................................................................................... 52

Figure 2.2. Structure and pH-sensitive activity of polydisulfide .......................... 54

Figure 2.3. Library of polymerizable surfactants exhibiting pH-sensitive

amphiphilicity for siRNA delivery ........................................................................ 58

Figure 2.4. Chemical structures and transfection efficiency of the spermine-

based library of nucleic acid carriers .................................................................. 61

Figure 2.5. Surface functionalization and self-assembly of EHCO to form

targeted siRNA nanoparticles ............................................................................. 63

Figure 2.6. In vivo efficacy of systemically administered RGD-targeted

EHCO/siRNA nanoparticles ................................................................................ 65

Figure 2.7. In vivo efficacy of intracranially-administered PEGylated

EHCO/siRNA nanoparticles ................................................................................ 66

Figure 2.8. Chemical structure and function of EKHCO and EHHKCO ............. 67

Figure 2.9. Chemical structures, hemolytic activity and silencing efficiency of

newly synthesized cationic lipid-based siRNA carriers ....................................... 70

Scheme 3.1. Formation of ECO/siRNA nanoparticles ........................................ 75

x

Scheme 3.2. Cellular trafficking of ECO/siRNA nanoparticles ........................... 76

Figure 3.1. Physicochemical evaluation of ECO/siRNA nanoparticles ............... 87

Figure 3.2. Biological activity of ECO/siRNA nanoparticles in U87 Glioblastoma

cells .................................................................................................................... 90

Figure 3.3. Activity of ECO/siRNA nanoparticles in serum-containing

conditions ........................................................................................................... 95

Figure 3.4. Evaluation of pH-sensitive hemolysis and endolysosomal escape of

ECO/siRNA nanoparticles .................................................................................. 98

Figure 3.5. Sensitivity of ECO/siRNA nanoparticles to reduction by endogenous

levels of glutathione .......................................................................................... 101

Figure 4.1. ECO/siβ3 nanoparticles induced sustained gene silencing of β3

integrin .............................................................................................................. 116

Figure 4.2. ECO/siβ3 nanoparticles attenuated TGF-β-mediated EMT, invasion

and proliferation ................................................................................................ 118

Figure 4.3. ECO/siβ3 nanoparticles attenuated 3D organoid outgrowth .......... 121

Figure 4.4. RGD modification of ECO/siRNA nanoparticles enhances uptake in

post-EMT breast cancer cells ........................................................................... 123

Figure 4.5. Pulmonary outgrowth of NME cells treated with the ECO/siRNA

treatment regimen ............................................................................................ 125

Figure 4.6. RGD-targeted ECO/siβ3 nanoparticles inhibited primary tumor

growth and EMT in mice after systemic administration ..................................... 128

Figure 4.7. RGD-ECO/siβ3 nanoparticles inhibited breast cancer metastasis and

primary tumor recurrence ................................................................................. 130

Schematic 5.1. pH-sensitive surface modification of ECO/siRNA nanoparticles

with RGD-PEG(HZ)-maleimide ......................................................................... 141

xi

Figure 5.1. pH-sensitivity of ECO/siRNA, PEG-ECO/siRNA, and PEG(HZ)-

ECO/siRNA nanoparticles ................................................................................ 153

Figure 5.2. Comparison of hemolytic activity of ECO, PEG-ECO, and PEG(HZ)-

ECO siRNA nanoparticles at pH levels corresponding to stages of intracellular

trafficking .......................................................................................................... 155

Figure 5.3. Cellular uptake and luciferase silencing efficiency of unmodified,

PEG-, PEG(HZ)-, RGD-PEG-, and RGD-PEG(HZ)-modified ECO/siRNA

nanoparticles .................................................................................................... 159

Figure 5.4. Confocal microscopy images of MDA-MB-231 cells incubated with

RGD-PEG-, and RGD-PEG(HZ)-modified ECO/siRNA nanoparticles .............. 160

Figure 5.5. Luciferase silencing efficiency after 48 hours in MDA-MB-231-luc

cells transfected with or without the endosomolytic agent chloroquine ............. 161

Figure 5.6. In vivo luciferase silencing efficiency following a single i.v. treatment

with various surface-modified ECO/siRNA nanoparticles ................................. 163

Figure 5.7. Tumor accumulation and retention of surface-modified ECO/siRNA

nanoparticles following i.v. administration ........................................................ 164

Figure 5.8. Flow cytometry and confocal microscopy analysis of single cell

suspensions obtained from primary MDA-MB-231 mammary fat pad tumors

following i.v. administration of various surface modified ECO/siRNA

nanoparticles .................................................................................................... 166

Figure 6.1. Evaluation of eIF4E mRNA and protein expression analysis in MDA-

MB-231 and MDA-MB-231.DR cells 5 days following treatment with RGD-

PEG(HZ)-ECO/siRNA nanoparticles ................................................................ 180

Figure 6.2. Dose-response curves as determined by MTT assay of MDA-MB-231

and MDA-MB-231.DR cells treated with varying concentrations of PTX following

prior treatment with RGD-PEG(HZ)-ECO/siRNA nanoparticles delivering sieIF4E

or siNS .............................................................................................................. 182

xii

Figure 6.3. In vivo efficacy of combination therapy involving PTX and RGD-

PEG(HZ)-ECO/sieIF4E nanoparticles quantified with bioluminescent

imaging ............................................................................................................. 185

Figure 6.4. Growth, size and final weight of tumors following combination therapy

involving PTX and RGD-PEG(HZ)-ECO/sieIF4E nanoparticles........................ 186

Figure 6.5. Quantification of mRNA expression of eIF4E, Survivin, Cyclin D1,

and VEGF following combination therapy involving PTX and RGD-PEG(HZ)-

ECO/sieIF4E nanoparticles .............................................................................. 189

Figure 6.6. Histological evaluation of liver, kidney, and primary tumor ............ 190

Figure 6.7. Immunogenicity of ECO and RGD-PEG(HZ)-ECO/siRNA

nanoparticles .................................................................................................... 191

Figure A1. Synthetic Procedure of ECO .......................................................... 206

Figure A2. Reaction scheme and 1H NMR of Intermediate (1)........................ 207






Figure A8. Reaction scheme and 1H NMR of ECO ......................................... 213

Figure A9. Maldi-Tof Spectra of ECO .............................................................. 214

Figure A10. Synthetic procedure of cRGD-PEG3400-maleimide .................... 214

Figure A11. Maldi-tof and H1-NMR spectrum of cRGD-PEG3400-

maleimide .................................................................................................. 215/216

xiii

Figure A12. Synthetic procedure of mPEG5000(HZ)-Maleimide ..................... 216

Figure A13. H1 NMR spectrum of mPEG5000(HZ)-maleimide ....................... 217

Figure A14. Synthetic procedure of cRGD-PEG3400(HZ)-maleimide ............. 218

Figure A15. H1 NMR spectrum (Solvent: DMSO of cRGD-PEG3400(HZ)-

maleimide ......................................................................................................... 218

Figure A16. H1 NMR spectrum (Solvent: D2O) of cRGD-PEG3400(HZ)-

maleimide ......................................................................................................... 219

xiv

Acknowledgments

I would first like to acknowledge and thank my advisor, Dr. Zheng-Rong

Lu. Over the last four years, ZR consistently encouraged me to think both

critically and creatively about my research. I am grateful for the opportunity to

pursue my research interests with freedom and support. The guidance I received

from ZR during my Ph.D. was the main driver for my success and I could not

imagine having the same experience in another lab.

I would also like to thank each member of my Ph.D. committee for their

guidance and support: Efstathios Karathanasis, Nicole Steinmetz, and Julian

Kim. Each member played an integral role in shaping my research project, often

asking critical questions and encouraging me to approach my work from different

perspectives. I am grateful for the time and effort each put in to my personal and

professional development during my Ph.D.

I am extremely grateful for my fellow labmates, both past and present, for

their help along the way. I would especially like to thank Anthony Malamas who

took me under his wing when I first joined the lab. Additionally, I would like to

thank our collaborators Dr. Scott Welford and Dr. William P. Schiemann.

Lastly I would like to thank my funding support through the National

Science Foundation Graduate Research Fellowship (DGE-0951783).

xv

List of Abbreviations

ASO: antisense oligonucleotide

Bax: Bcl-2-associated X protein

BCA: bicinchorninic acid assay

Bcl-2: B-cell lymphoma 2

Bcl-xl: B-cell lymphoma-extra large

BLI: bioluminescent imaging

BN: bombesin

BSA: bovine serum albumin

BSO: buthionine-sulfoximine

ECO: (1-aminoethyl)iminobis[N-(oleicylcysteinyl-1-amino-ethyl)propionamide]

CA-IX: carbonic anhydrase-IX

CHO: Chinese hamster ovary cell line

CK-19: cytokeratin 19

CPP: cell-penetrating peptide

DLS: dynamic light scattering

DMEM: Dulbecco’s Modified Eagle Medium

DMSO: dimethyl sulfoxide

DNP: 2,4-dinitrophenol

DOGS: dioctadecylamidoglycylspermidine

DOPC: 1,2-dioleoyl-sn-glycero-3-phosphatidylcholine

DOPE: 1,2-Dioleoyl-sn-Glycero-3-Phosphoethanolamine

DOTAP: 1,2-dioleoyl-3-trimethylammonium-propane

xvi

DOTMA: N-[1-(2,3 Dioleoyloxy)propyl]-N,N,N-trimethyl-ammonium methyl

sulphate

dsRNA: double-stranded RNA

E-cad: E-cadherin

eIF4E: eukaryotic translation initiation factor 4E

EMT: epithelial-mesenchymal transition

EpCAM: Epithelial cellular adhesion molecule

EPR: enhanced permeability and retention

ER: estrogen receptor

FACS: fluorescence-activated cell sorting

FBS: fetal bovine serum

FITC: Fluorescein isothiocyanate

FMT: fluorescence molecular tomography

GAPDH: Glyceraldehyde 3-phosphate dehydrogenase

GFP: green fluorescent protein

GLUT-1: glucose transporter

GPCR: G protein-coupled receptor

GSH: glutathione

H&E: hematoxylin and eosin

HER2: human epidermal growth factor receptor 2

HIF-1α: Hypoxia-inducible factor 1α

HZ: hydrazone

IR: ionizing radiation

LAMP1: lysosomal-associated membrane protein 1

mRNA: messenger RNA

xvii

Maldi-TOF: matrix-assisted laser desorption/ionization time of flight

MMP: metalloproteinase

MTT: 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide

MW: molecular weight

MWCO: molecular weight cutoff

N-cad: N-cadherin

NME: normal murine mammary gland cells

NMR: nuclear magnetic resonance

PAI-1: plasminogen activator inhibitor

PBS: phosphate buffered saline

pDNA: plasmid DNA

PEG: polyethylene glycol

PEI: polyethyleneimine

PET: positron emission tomography

pKa: acid dissociation constant

PLL: poly-L-lysine

PR: progesterone receptor

PS: phosphothionate

PTX: paclitaxel

RBC: red blood cells

RES: reticuloendothelial system

RGD: Arg-Gly-Asp peptide

RISC: RNA-induced silencing complex

RNAi: RNA Interference

RNase: ribonuclease

xviii

ROI: region of interest

siRNA: small interfering RNA

SFM: serum-free media

SLN: solid lipid nanoparticle

SNALP: stable nucleic acid-lipid particle

ssRNA: single-stranded RNA

TBE: Tris/Borate/EDTA

Tf: transferrin

TGF-β: transforming growth factor β

TNBC: triple-negative breast cancer

VEGF: vascular endothelial growth factor

xix

Development of a Multifunctional Cationic Lipid-Based siRNA Delivery System

for the Treatment of Triple-Negative Breast Cancer

Abstract

by

MANEESH GUJRATI

Triple-negative breast cancer (TNBC) is a subtype of breast cancer

associated with a poor prognosis and an aggressive clinical course. Due to the

lack of well-defined biomarkers, TNBCs are not amenable to currently available

targeted therapies, leaving systemic chemotherapy as the sole therapeutic

strategy. Unfortunately, disease relapse, metastasis, and drug resistance often

render standard small-molecule chemotherapy ineffective. Small interfering RNA

(siRNA) has garnered much attention as a promising avenue for cancer gene

therapy due to its ability to silence disease-related genes through the RNA

interference (RNAi) mechanism. Deeper insights into the molecular profile of

TNBCs have identified a number of novel gene targets well-suited for RNAi

therapy. We therefore aim to employ siRNA-mediated gene therapy to address

two critical risks associated with TNBCs: metastasis and drug resistance.

Effective gene silencing is contingent upon the delivery of siRNA

molecules into the cytosol of target cells and requires carefully designed

multifunctional delivery systems to overcome systemic delivery barriers. The

present work reports the development of a novel pH-sensitive cationic lipid

carrier (ECO) for targeted siRNA delivery. Optimization of the chemical structure

was performed to engender ECO/siRNA nanoparticles with two key features

necessary for efficient cytosolic siRNA delivery: i) pH-sensitive membrane

disruption and ii) glutathione-mediated siRNA release.

xx

As TNBCs are associated with an elevated risk of distant recurrence, our

first application was to exploit 3 integrin as a therapeutic target against

metastatic TNBC. Recently, 3 integrin has been coupled to epithelial-

mesenchymal transition (EMT) and metastasis. We therefore hypothesized that

functional disruption of 3 integrin may inhibit metastasis. Treatment of

metastatic TNBC cells with ECO/si3 nanoparticles in vitro effectively silenced 3

integrin expression, attenuated EMT and cell invasion, restored cytostasis, and

inhibited organoid outgrowth within a 3D cellular culture system. Systemic

administration of RGD-PEG-modified ECO/si3 nanoparticles in vivo alleviated

primary tumor burden, and more importantly, significantly inhibited metastasis

and disease relapse, thereby validating 3 integrin as a viable therapeutic target

and the in vivo delivery capacities of ECO/siRNA nanoparticles.

The major cause of metastatic treatment failure is multidrug resistance to

standard chemotherapies. Therefore, we next investigated siRNA targeting of the

eukaryotic translation initiation factor 4E (eiF4E) to improve the susceptibility of

drug-resistant TNBC cells to paclitaxel. In parallel, an RGD-targeted pH-

cleavable PEG surface modification strategy (RGD-PEG(HZ)) was designed.

Multimodal imaging was used to demonstrate the pH-cleavable strategy exhibited

superior in vivo gene silencing compared to the non-cleavable formulations.

Silencing of eiF4E in a drug-resistant TNBC cell line was sufficient to re-sensitize

cells to paclitaxel. Importantly, treatment with RGD-PEG(HZ)-ECO/sieIF4E

nanoparticles in combination with paclitaxel resulted in significant regression of

the primary tumor when compared to either therapy alone. These results

substantiate the advantage of combining nanoparticle-mediated eIF4E silencing

with small-molecule chemotherapy to provide a promising therapeutic solution to

drug-resistant TNBCs.

1

Chapter 1

Introduction

Adapted in part from Gene Therapy of Cancer 2013, 3rd Edition, p. 47-65

Maneesh Gujrati and Zheng-Rong Lu

2

1.1 The promise of gene therapy

Today, breast cancer remains a significant health risk worldwide. Within

the United States, breast cancer is the second leading cause of cancer-related

deaths amongst women, accounting for 14% of all cancer-related deaths (1). The

lifetime risk for developing breast cancer is 1 in 8 for women in the U.S.

Significant improvements have been achieved in reducing the morbidity

associated with certain classes of breast cancers, with the overall breast cancer

death rate falling steadily over the past several decades. According to National

Cancer Institute, death rates associated with breast cancer have been falling on

average 1.9% each year from 31.4 per 100,000 women in 1975 to 21.5 per

100,000 per women in 2011 (2). Furthermore, the overall 5-year relative survival

rate for breast cancers has improved from 75.2% in 1975 to 90.6% in 2011 (2).

While the overall trends are indeed promising, stark differences exist between

the various breast cancer subtypes and even more so between localized and

metastatic disease. In fact, the 5-year relative survival for women with localized

disease is 98.5% but falls dramatically to 25% for those suffering from

metastases due to a lack of therapeutics that can specifically address this

segment of the disease (3).

Breast cancer also imposes a significant socioeconomic burden within the

healthcare system where it accounts for 20% of all cancer-related expenditure

(4,5). In 2014, the United States spent over 17 billion dollars alone towards the

treatment of breast cancer (5). Importantly, the treatment of late-stage,

metastatic and terminal disease is significantly higher than the original treatment

3

phase. The reasons for this are twofold: i) costs for terminal disease are on

average eight-times most costly than the original treatment phase; and ii) many

of the costly targeted therapies are used with little to no therapeutic benefit.

Breast cancers are now understood to be segmented across a spectrum

of various subtypes, each with their own molecular profiles and susceptibilities to

therapy. Conventional small-molecule chemotherapies, such as anthracyclines

and taxanes, are commonly used as the first line of defense against breast

cancer. These drugs utilize various mechanisms to impede cell division, thereby

killing rapidly proliferating cells. However, these agents lack the ability promote

accumulation within the tumor to enhance bioavailability and target only

malignant cells. As a consequence, this class of therapy harbors an array of

severe side effects, including peripheral neuropathy, amongst others. A deeper

understanding of the molecular mechanisms and profiles of breast cancer has

allowed the development of a novel generation of gene therapies able to

delineate benign from malignant cells and exert selective targeting of cancer cells

to substantially reduce systemic toxicity by direct targeting of disease-related

genes. The advent of gene therapies against novel molecular targets has the

potential to substantially improve the overall disease outcome for highly

aggressive breast cancers.

1.2 The RNA interference mechanism

RNA interference (RNAi) is a relatively new and highly promising

technology for gene therapy that represents an entirely novel approach to the

4

treatment paradigms of many diseases. Widely considered one of the most

promising and rapidly advancing frontiers in medicine, the discovery of RNAi was

awarded the 2006 Nobel Prize for Physiology or Medicine, being heralded as “a

major scientific breakthrough that happens once every decade or so”. RNAi is a

gene silencing process in which double-stranded RNA (dsRNA) interferes with

the expression of a gene through a homologous sequence shared with the

dsRNA (6,7). RNA silencing occurs when the RNase III enzyme Dicer initiates

the cytoplasmic breakdown of dsRNA into small interfering RNA (siRNA) (8).

These siRNA fragments, generally 20-25 nucleotides in length, incorporate into

the RNA-induced silencing complex (RISC) (9,10). Once incorporated into the

RISC, the siRNA molecule is unwound into a single-stranded RNA (ssRNA)

where the sense strand ssRNA is then degraded (11). The RISC containing

sequence specific antisense strand of ssRNA is then able to seek out and target

mRNA that is complementary to the antisense strand (12). Cleavage of mRNA

occurs at nucleotide position 10 and 11 on the complementary antisense strand,

relative to the 5’-end (13). To further amplify gene silencing, the RISC complex

can continue on to destroy additional mRNA targets, allowing the therapeutic

effect to last for up to 7 days in rapidly proliferation cells and for several weeks in

non-diving cells (14).

5

Figure 1.1. Synthetic siRNA-induced RNA interference. RNAi can be induced by

introducing synthetic double-stranded siRNA. The siRNA associates with the

multiprotein complex RISC and the sense strand is degraded by the protein Argo-2 in

the RISC. The remaining antisense strand, serves as a guide to recognize the

corresponding mRNA, after which Argo-2 cuts and degrades the target mRNA

1.3 The RNAi Advantage

1.3.1 A natural pathway

The fact that RNAi is a highly conserved, natural biological pathway

involved in the regulation of gene expression in all mammalian cells has

propelled the notion of it being used as a safe and effective therapeutic platform.

While naturally occurring, a key advantage of RNAi-based therapy is that siRNA

6

molecules can be chemically synthesized and delivered into cells to elicit the

desired silencing effect. The direct introduction of synthetic siRNA into cells can

bypass the Dicer mechanisms to trigger gene silencing (14). Synthetic siRNA

molecules have already been shown to block specific expression of endogenous

and heterologous genes in several mammalian cell lines. Further, long-term gene

silencing can be achieved without interrupting endogenous microRNA pathways

through multiple administrations of synthetic siRNAs (15). With an mRNA

sequence in hand these synthetic siRNA molecules can be readily designed to

be both potent and highly selective.

1.3.2 A catalytic mechanism

A single molecule of siRNA is needed to active the RISC to initiate RNAi-

mediated silencing of the target mRNA. Specifically, once the siRNA molecule

degrades one mRNA, it can go on and continue to silencing a large number of

mRNA molecules, unlike other oligonucleotide-based technologies, such as

antisense therapy, which directly bind to their mRNA targets via Watson-Crick

base pairing at a stoichiometric one-to-one ratio of silencing molecule to target

mRNA (16). Therefore, siRNA-mediated RNAi requires a significantly lower

cytosolic dose than other antisense drugs.

1.3.3 Target ‘undruggable’ targets

Clinically available small-molecule medicines are limited in their

therapeutic scope to certain classes of drug targets: GPCRs, ion channels,

enzymes, nuclear hormone receptors (17,18). Similarly, protein-based drugs,

7

such as monoclonal antibodies, are currently restricted to cell surface receptors

and circulating proteins. In contrast, siRNA molecules can be synthetically

constructed to target any gene so long its mRNA transcript is known, thus

enabling the targeting of proteins that have until now been considered

“undruggable” by current therapies (19,20). The power of RNAi can also be

harnessed in diseases caused by mutations in a single allele. In such a case, the

siRNA molecule can be designed to target the specific disease-causing allele to

spare the normal allele from silencing. Accordingly, RNAi-based therapies can

regulate the expression of any disease-implicated gene.

1.3.4 Upstream mechanism

Currently available small molecules and antibody-based therapies

inactivate their protein targets via direct binding, but are not able to actively

eliminate the protein. The RNAi mechanism operates upstream of protein

synthesis to allow for the prevention of disease-causing proteins from being

translated in the first place. Unlike other antisense technologies, the RNAi

mechanism interferes only with translation and not with DNA transcription. As

siRNA does not interact with chromosomal DNA, the lack of DNA interaction

reduces the possibility of adverse gene alterations found in DNA-based gene

therapy (16).

1.3.5 Enable drug discovery process

As siRNA sequences can be synthetically designed based of the

knowledge of the mRNA target transcript, the identification of candidate siRNA

8

molecules can be more straightforward. The emergence of high-throughput gene

expression profiling of cancer cells has enabled the facile identification of genes

implicated with cancers. The application of RNAi towards these genes creates a

systematic approach to discover new drug targets by allowing loss of function

studies to elucidate their exact role. For drug discovery, RNAi has the greatest

impact on target validation and identification, a process by which the roles of

specific genes are functionally linked to a disease. Using RNAi to knockdown a

gene, it can be determined if the gene is involved in a certain pathway or

mechanism and whether it would serve as a viable target for small molecule

therapy.

1.4 Opportunity for RNAi in cancer

The discovery of RNAi and subsequent use of siRNA to exploit this

mechanism has revealed new opportunities for the development of novel

therapeutic systems to treat previously incurable diseases. It has been reported

that synthetic siRNAs are able to knock down targets in various diseases in vivo,

including hepatitis B virus, human papillomavirus, ovarian cancer, bone cancer,

hypercholesterolaemia, and liver cirrhosis, amongst others (21–25). The ability of

siRNA to target any gene with a complementary sequence, makes it a potentially

potent therapeutic, especially for cancer (20). Over the past several decades

many important genes associated with different cancers have been identified

along with their mutations and pathways through which they can be

characterized (26). As a genetic disease, cancer is a well suited candidate for

siRNA-mediated gene therapy. Already, a number of siRNAs have been

9

developed against dominant oncogenes, malfunctionally regulated oncogenes,

and viral oncogenes involved in carcinogenesis. In addition, siRNAs have been

studied as a therapeutic means of silencing target molecules crucial for tumor-

host interactions and tumor resistance to chemo- or radiotherapy. The resulting

silencing of these critical cancer-associated target proteins by siRNAs has led to

significant apoptotic and/or antiproliferative effects (27).

1.4.1 Opportunity for RNAi-mediate gene therapy in triple-negative breast

cancer

Breast cancer is a heterogeneous disease comprised of multiple subtypes

with different molecular profiles that govern cellular morphologies, clinical

aggressiveness, and response to therapy (Figure 1.2) (28). Triple-negative

breast cancer (TNBC), which contribute to 15% of diagnosed breast cancer

cases, is immunohistochemically negative for estrogen receptors (ER),

progesterone receptors (PR), and lacks the overexpression of the human

epidermal growth factor receptor 2 (HER2). Clinically, TNBCs exhibit a poor

prognosis with a devastatingly aggressive clinical course. For other breast cancer

subtypes, the positive expression of these biomarkers have allowed for the

development of molecularly targeted therapies: tamoxifen is effective against

ER+ breast cancers and Herceptin is targeted against HER2+ breast cancers. As

TNBCs lack such hormone makers and are not amenable to targeted therapies,

small-molecule chemotherapy, although limited in safety and efficacy, has

emerged as the standard of care.

10

Deeper insights into the molecular makeup of TNBCs have identified a

number of novel targets which, while not appropriate for targeting via a small-

molecular inhibitor or protein-based antibody, are well-suited for RNAi-based

therapy. A summary of genes being explored within breast cancers for siRNA-

based therapies and their current status is summarized in Table 1.1 (29).

Common approaches include targeting pathways involved in oncogenesis, tumor

cell survival and proliferation, induction of apoptosis, angiogenesis,

invasion/metastasis, and chemoresistance.

Figure 1.2. Subtypes of breast cancer

11

Table 1.1. Examples of siRNA-based therapies against breast cancer

1.5 Considerations for systemic siRNA delivery

While RNAi holds great potential for cancer therapy, many issues remain

to be resolved in order to develop this technology into a viable bedside treatment

option. The main challenge for clinical translation of RNAi is the efficient delivery

of siRNA therapeutics into target cells. Safe and efficient delivery systems are

needed to protect siRNA from enzymatic degradation during the process of in

vivo delivery and to effectively transfect target cells. Significant progress has

been made recently on the design and development of safe and effective siRNA

delivery systems. Recently reported siRNA delivery systems aimed at various

cancers are summarized in Table 1.2 (30).

Function Target gene BC subtype Cell system Tumor model Therapeutic effects

Cell cycle and proliferation Plk1 TNBC MDA-MB-435s s.c. Induction of apoptosis and inhibition of proliferation

TNBC MDA-MB-435s Orthotopic -

Erα Luminal A MCF-7 Orthotopic -

E2F3 TNBC BT20, LY-2 - -

Akt2 TNBC MDA-MB-231 - Increased mitochondrial volume

AAT TNBC MDA-MB-231 - -

DNMTs Luminal B BT474 Orthotopic Restored tumor suppressor gene expression

RhoA/RhoC TNBC MDA-MB-231 s.c. Reduction of cell metastasis

Orai3 Luminal A MCF-7 - Regulate cell survival and Ca2+ entry

ATM TNBC MDA-MB-231 Orthotopic Regulate DNA repair and cell cycle checkpoints

OPN TNBC MDA-MB-231 s.c. Inhibit angiogenesis

HER2/neu Luminal A and B SK-BR-3, BT-474, MCF-7, - -

TNBC MDA-MB-468

hPRLR Luminal A MCF-7 - Down regulation of cyclin D1

Cell death and survival Mcl-1 TNBC MDA-MB-435WT s.c. Reduced tumor volume when co-delivered with RPS6KA5

TNBC MDA-MB-435R s.c.

Bcl-2 NER2/neu+ N202.1A -

Survivin TNBC MDA-MB-231 - Block angiogenesis

BORIS TNBC MDA-MB-231 - -

Angiogenesis VEGF Luminal B SK-BR-3 - -

ARNT2 Luminal A MCF-7 - Affect HIF-1-regulated metabolism

53BP1 Luminal A, TNBC MCF-7, MDA-MB-231 - Inhibit invasion and metastasis

Chemosensitization P-gp Luminal A MCF-7/A s.c. Efflux transporter

Clusterin Luminal A MCF-7 -

RPN2 Luminal A MCF-7-ADR - Inhibit glycosylation of P-gp to decrease membrane localization

KIF14 TNBC MDA-MB-231, HCC1937 Orthotopic Enhance chemosensitivity to docetaxel

TLN1 TNBC MDA-MB-231, HCC38 Orthotopic Enhance chemosensitivity to docetaxel

EMT, tumor invasion and metastasis PAI-1 TNBC MDA-MB-231 - Inhibit ECM remodeling and angiogenesis

Stat3 TNBC (mouse) 4T1 - Inhibit cell proliferation, survival and tumor angiogenesis

AnxA1 Basal-like BLBC - Inhibit EMT

Smad2 Luminal A and B SK-BR-3 and MCF-7 - Inhibit EMT

COX-2 TNBC MDA-MB-231 - In vivo imaging

MLF2 TNBC Orthotopic Reduced primary tumor growth and lung metastasis

RPL39 TNBC Orthotopic Reduced primary tumor growth and lung metastasis

12

In order to harness the potent therapeutic effects of RNAi, siRNA must

first be efficiently delivered to target tissue and cells. Systemic siRNA delivery

from the bloodstream to the cytoplasm of the target cells has to overcome

numerous challenges in the delivery process (Figure 1.3). In the body, naked

siRNA is susceptible to degradation by endogenous enzymes. Its large size (~13

kDa) and negative charge prevent siRNA molecules from crossing cellular

membranes (31). To address these issues, siRNA is commonly complexed into

nanoparticles to protect against degradation and to facilitate cellular uptake.

Once administered into the bloodstream, the siRNA nanoparticles must traverse

the circulatory system while avoiding kidney filtration, phagocytosis, aggregation

with serum proteins, and enzymatic degradation (32). Phagocytic cells, such as

macrophages and monocytes, pose a significant immunological barrier in both

the bloodstream and the extracellular matrix of tissues. Responsible for

removing foreign materials as protection against viral infection, phagocytes are

also efficient at removing therapeutic agents from the body (31). Another barrier

to systemic siRNA delivery in vivo is the transport of the delivery vehicle from the

bloodstream across the vascular endothelial barrier. Generally, only molecules

less than 5 nm in diameter will cross the capillary endothelium, and those larger

ones will remain in circulation until they are taken up by tissues or organs and

cleared from the body. Some tissues, such as the liver, spleen, and in certain

cases, tumors, allow larger molecules up to 200 nm in diameter, the size of

typical drug delivery nanocarriers, to pass (33).

13

Figure 1.3. Physiological barriers to the systemic delivery of siRNA nanoparticles.

A systemically injected siRNA nanoparticle must avoid filtration, phagocytosis, and

degradation in the bloodstream, be transported across the vascular endothelial barrier,

diffuse through the extracellular matrix, be taken up by the cell, escape the endosome,

and unpackage and release the siRNA to the RNA interference machinery.

Once the complexed siRNA exits the bloodstream, is must diffuse through

the extracellular matrix creating further opportunity for uptake and clearance by

phagocytic cells. The extracellular matrix is a dense network of polysaccharides

and fibrous proteins that creates a resistance against the transport of delivery

vehicles and may interrupt the drug delivery process (34). Entry into the target

cells involves endocytosis wherein the siRNA will be trafficked through various

14

endocytic pathways. Once the siRNA delivery systems have been taken up into

the target cells, the next step in the delivery process is endosomal release,

where siRNA escapes from the endosomal compartments (35). If the siRNA

complexes do not escape from the endosome, they will be trafficked through an

endocytic pathway into lysosomes where the acidic environment will degrade the

siRNA cargo (36,37). To avoid this complication, delivery systems have been

designed to disrupt the endolysosomal membranes and release the siRNA

payload into the cytosol, a concept to be further explored in Chapter 2. Finally,

the siRNA must be released from the carrier so that it can be incorporated into

the RNAi silencing complex.

An ideal delivery system for siRNA should exhibit the following

characteristics: i) biocompatible (non-cytotoxic and non-immunogenic); ii)

biodegradable; iii) protect siRNA cargo from enzymatic degradation; iv) minimal

non-specific tissue uptake; v) tissue and target cell specificity; and vi) efficient

cytosolic siRNA release.

1.6 Current approaches for siRNA delivery

Various delivery vehicles have been developed providing the desired

properties listed above for the in vivo delivery of siRNA. Delivery vehicles

generally consist of cationic polymers or lipid-like materials and take advantage

of the anionic nature of siRNA to form complexes through ionic interactions.

These complexes provide protection against nuclease attack and facilitate

cellular uptake of siRNA via endocytosis. Although the overall positive charge of

15

the carrier-siRNA complexes improve cellular uptake due to favorable interaction

with the negatively charged cellular membrane, many of the cationic agents used

are cytotoxic, thus limiting their clinical potential (38–41). Many design strategies

of delivery vehicles have been developed to improve properties such as stability,

cellular delivery, and biocompatibility. Strategies ranging from the direct chemical

modification of siRNA to different non-viral vehicles have been designed and

evaluated. Numerous physicochemical and biological functions have been

introduced to the delivery systems to protect siRNA from degradation, enhance

cellular uptake, facilitate cytosolic siRNA release and allow site-specific delivery

(42). The development of biocompatible, efficient and specific siRNA delivery

systems to the target cancer cells is the key to translate siRNA into a bedside

therapeutics.

Table 1.2. Examples of siRNA delivery systems for the treatment of cancers

16

Systemic siRNA delivery is a convenient approach for cancer treatment.

However, systemic delivery of naked siRNA experiences rapid renal clearance

due to its small size (17,43). It has been shown that intravenous injection of

naked siRNA results in its accumulation in the kidney and urinary bladder within

the first 5 minutes of administration (44). Pharmacokinetics of siRNA can be

altered by complexing it with carriers to form nanoparticles to prevent rapid

clearance from circulation. Prolonged circulation of the siRNA delivery systems

would allow preferential accumulation of the delivery system in solid tumor due to

the enhanced permeability and retention (EPR) effect. The EPR effect is caused

by the improper formation of the rapidly growing tumor vasculature, which causes

it to be more permeable to large molecules and nanoparticles (45).

Systemic administration of nanoparticles often results in increased

accumulation in the liver, spleen, kidneys and lungs, the organs of the

reticuloendothelial system (RES) (46,47). The surface property of a delivery

system is a critical parameter for minimizing non-specific tissue uptake and

achieving target-specific siRNA delivery because it affects the interaction of the

delivery system with the surrounding environment. A positively charged surface

can readily associate with the negatively charged cellular membrane to facilitate

uptake, including non-specific uptake (48). However, negatively charged serum

proteins in the blood plasma will complex with the positively charged surfaces

rendering the delivery systems ineffective. Hydrophilic biocompatible

polyethylene glycol chains (PEG) are often used to modify the surface of the

delivery systems to mask their positive surface and, consequently, to avoid

17

aggregation in serum and to minimize non-specific tissue and cellular uptake

(49). PEGylation also plays an important role in protecting the delivery systems

against the immune system and accompanying phagocytes. PEG forms a barrier

around nanoparticles creating steric stabilization and protection from the

physiological surroundings (50). By altering the length and structure of the PEG

chain, the stabilization, protective properties and particle size can be optimized

for each delivery system (51). Targeting agents, mainly peptides and proteins,

can be readily conjugated to the modified surface with a PEG spacer to achieve

target-specific siRNA delivery.

Finally, the safety of siRNA delivery systems is the most important

parameter to consider as even the most efficient delivery systems will be deemed

useless if they elicit significant local or systemic toxicity. Early delivery vehicles

studied, namely viral vectors, induced an immune response and thus were found

to be toxic (52). To avoid stimulating an immune response, synthetic lipid and

polymer systems have been developed. Although non-viral delivery systems can

avoid induction of a significant immune reaction from the body, cationic carriers,

especially cationic polymers, can cause serious toxic side effects after systemic

administration. Biodegradable polycations containing environmentally sensitive

linkages have been prepared to reduce the toxicity of the carriers (53). Surface

modification of siRNA nanoparticles can also reduce the toxicity of the cationic

carriers.

1.6.1 Targeted siRNA delivery

18

Targeted siRNA delivery systems for cancer are a promising new class of

experimental therapeutics with the potential to revolutionize medicine with their

increase efficiency and relative low toxicity compared to conventional drugs. The

EPR effect allows siRNA nanoparticles to passively accumulate within tumors

following system administration. However, as siRNA needs to be internalized by

the cancer cells, the EPR effect alone may not provide the necessary means to

ensure a therapeutic effect. Therefore, a strategy of active targeting to cancer

cells is commonly used to enhance specific uptake in cancer cells. Active

targeting involves the direct interaction of a targeting agent with a specific

biomarker or receptor expressed on the surface of the target cells (54–56).

Various cell- and tissue-specific targeting agents, including various

antibodies, peptides or aptamers, have been identified and used for siRNA

delivery (57). When selecting a targeting agent, it is important that the cellular

receptor can be readily internalized after ligand binding and then re-expressed on

the cell surface to allow repeated targeting along with preventing prolonged

ligand-binding disruption. The selected targeting agent should also bind to its

respective receptor with high specificity and affinity. Delivery vehicles equipped

with targeting ligands are able to target and interact with specific cells to enhance

cellular uptake via receptor-mediated endocytosis. Further, since the majority of

the chemical conjugations of these ligands occur on the carrier and not the

nucleic acids of siRNA, the ability of siRNA for gene silencing will not be affected.

Many surface modification techniques allow multiple ligands to be attached to the

delivery vehicle. These multi-functional modification strategies combine ligands

19

as a means of potentially overcoming sequential delivery barriers. The

combination of targeting ligands and endosomal escape ligands can be used to

elicit cell surface binding and receptor mediated endocytosis and to promote

delivery to the cytosol and avoid endosomal-lysosomal degradation, respectively

(58,59). Cell-penetrating peptides (CPPs) are sometime employed to enhance

uptake and can increase cell membrane translocation of high molecular weight

cargo, including siRNA (60).

Recent studies have shown that some targeted siRNA delivery systems

may not produce more favorable biodistribution or enhanced tumor uptake that

non-targeted siRNA nanoparticles, but the former still result in more efficient

gene silencing efficiency in cancer cells (61). For example, luciferase-specific

DOTA-conjugated siRNA molecules were labeled for positron emission

tomography (PET) imaging with 64Cu. The labeled siRNA was then complexed

with cyclodextrin-containing polycation nanoparticles both with and without

transferrin (Tf) as a targeting ligand. The siRNA-nanoparticle complexes were

administered to mice bearing tumors expressing luciferase. PET imaging

revealed that the attachment of the Tf targeting ligand to the surface of the

nanoparticles had a negligible impact on the biodistribution compared to the non-

targeted nanoparticles. Both Tf-targeted and non-targeted nanoparticles were

found to have similar tumor localization kinetics and similar tumor accumulation 1

day after injection, thus accumulation was not correlated to the Tf receptor status

of the tumor cell. However, bioluminescent imaging (BLI) revealed that while

tissue distribution for the targeted and non-targeted nanoparticles was similar,

20

the targeted nanoparticles more effectively suppressed tumor luciferase

expression 1 day after injection. The results revealed that a higher portion of the

siRNA was able to localize in the target cells and thus actively function within the

tumor cells when delivered using the Tf-targeted nanoparticles. Thus, the

greatest advantage of using targeted delivery systems for siRNA comes from

targeted delivery systems being able to deliver more functional siRNA into tumor

cells than non-targeted systems due to receptor-mediated endocytosis (62).

1.6.2 Chemically modified siRNA

siRNA can be chemically modified to alter the physicochemical properties

and to increase the in vivo stability for improved circulation time. Chemical

modifications at various positions along the siRNA duplex have been made to

confer both nuclease resistance in addition to reducing nonspecific activation of

the immune system (63). A common modification is the replacement of the

phosphodiester group with a phosphothionate (PS) at the 3’-end (64). The

introduction of phosphorothioate backbone linkages at the 3’-end of the RNA

strands can inhibit enzymatic degradation by reducing siRNA’s susceptibility to

exonucleases (17). The conversion of 2’-OH into either an O-methyl group (2’-O-

Me), a fluoro (2’-F) group, or a 2-methoxyethyl (2’-O-MOE) group leads to the

decrease of hydrolysis associated with 2’-OH and an increase in half-life and

RNAi activity in cells cultured with plasma (65). The modification of siRNA with

2,4-dinitrophenol (DNP) lead to a heightened nuclease resistance along with an

increase in membrane permeability of the modified siRNA (66).

21

There may be concerns that direct siRNA modification will compromise

gene knockdown efficiency because RNAi evolved using native siRNA, and

altered siRNA may impair its recognition by the RNAi machinery. While it has

been shown that siRNA modified with boranophosphate improved resistance to

degradation, modification at the center position of the antisense strand reduced

RNAi activity (67). The degradation of modified siRNA into molecules not found

naturally in vivo may also raise concerns of introducing harmful byproducts

during this method of siRNA delivery. Furthermore, the requirement of siRNAs to

use cellular machinery for their mechanism of action limits the extent of chemical

modification. As a result, focus has been placed on creating delivery systems in

which unmodified siRNA will be loaded as a cargo for targeted systemic delivery.

1.6.3 Lipid-based siRNA delivery systems

Lipid-based transfection reagents are the most commonly used approach

for the in vitro delivery of nucleic acids to cells. Liposomes have been developed

for effective drug delivery for systemic siRNA delivery. Liposomes form

spontaneously in aqueous environments when a lipid bilayer forms a sphere with

an aqueous core. For example, a set of polar head-groups can form the outer

layer of the nanocomplex, while another set of polar head-groups faces the

interior hydrophilic core where the siRNA payload is held (68). Liposomes can

also form an amorphous structure in which the lipids and nucleic acids of the

siRNA are interspersed throughout. The liposome design can be easily tailored

as multiple lipid types can be incorporated creating flexibility in the physical and

chemical properties (69,70).

22

Several cationic lipid-based delivery systems have been developed for the

in vivo delivery of siRNA for cancer therapy. Lipid composition, siRNA-to-lipid

ratio, particle size and assembly process are the key parameters to optimize

when developing these delivery systems. Although cationic lipids are one of the

most popular and effective nucleic acid delivery vehicles, concerns regarding

their safety profile for therapeutic use exist for some (71). Both in vitro and in vivo

toxicity has been reported for certain cationic lipid siRNA nanoparticles, and

certain synthetic agents have been shown to increase off-target effects of siRNA

(71,72). Consequently, recent interest has focused on developing nontoxic lipid

delivery vehicles. Nevertheless, cationic lipids offer adequate protection against

siRNA degradation by nucleases, improve cell membrane penetration and

reduce siRNA renal clearance, making them a promising siRNA delivery vehicle.

1.6.4 Cationic liposomes

Liposomes have traditionally been popular and widely used delivery

systems because of their good safety profiles and a superior payload compared

to other delivery materials (73). Cationic liposomes have been developed for

delivering nucleic acids, including DNA and RNA. Cationic lipids, such as 1,2-

dioleoyl-3-trimethylammonium-propane (DOTAP) and N-[1-(2,3

Dioleoyloxy)propyl]-N,N,N-trimethyl-ammonium methyl sulphate (DOTMA), along

with helper lipids, such as 1,2-Dioleoyl-sn-Glycero-3-Phosphoethanolamine

(DOPE), are often used to form cationic liposomes and complex with negatively

charged DNA and siRNA, resulting in high in vitro transfection efficiency (74).

While efficient for in vitro nucleic acid delivery, cationic liposomes have had

23

limited success for in vivo gene downregulation due to non-specific tissue uptake

and siRNA release. Cationic liposomes may also interact with serum proteins,

lipoproteins and the extracellular matrix, which cause premature release of the

siRNA cargo. Further, cationic liposomes can activate the complement system of

the innate immune system, which causes the rapid clearance by activated

macrophages of the RES. The surface of cationic liposomes can be modified

with molecules such as PEG to minimize non-specific tissue uptake and to

enhance circulation half-life by eliminating aggregation and clearance by the

RES. An extended circulation half-life allows for sustained availability to take

advantage of the EPR effect, resulting in increased delivery to target sites. To

promote cellular uptake, targeting agents can be incorporated to enable targeted

delivery into a specific cell type. The combination of surface modification along

with active targeting has been demonstrated with a PEGylated liposome modified

with antibodies against receptors for transferrin or insulin for targeted siRNA

delivery to the brain in both mouse and monkey models (71,75).

Cationic immunoliposomal siRNA delivery nanoparticles modified with

anti-transferrin receptor single-chain antibody fragment have been developed to

silence human epidermal growth factor receptor-2 (HER-2) on human breast

carcinoma cells. In a mouse xenograft model, repeat intravenous administrations

of the immunoliposomes lead to inhibition of HER-2 expression. The results of

the in vivo delivery also demonstrated its ability to re-sensitize breast cancer cells

to chemotherapeutic drugs (76,77). Another cationic liposome composed of

dioctadecylamidoglycylspermidine (DOGS) has been used for gene silencing in

24

breast cancer cells (78,79). The lipoplexes composed of the cationic liposomes

complexed with the siRNA payload exhibited low cytotoxicity and mediated high

uptake of cyclin D1-specific siRNA by MCF-7 breast cancer cells in the presence

of serum proteins. They accumulated within specific cytoplasmic compartments

in the periphery of the nucleus. The cationic liposomes were also found to be

effective delivery vehicles of siRNA specific for plasminogen activator inhibitor

type 1 (PAI1) to triple-negative breast carcinoma MDA-MB-231 cells (80).

1.6.5 Neutral liposomes

Neutral liposomes have also been used for systemic siRNA delivery. The

neutral lipid 1,2-dioleoyl-sn-glycero-3-phosphatidylcholine (DOPC) forms

liposomes with a size around 65 nm and a 65% siRNA encapsulation efficiency

in (DOPC)-based neutral liposomes (81). The neutral liposomes containing anti-

EphA2 siRNA have been tested for the treatment of ovarian cancer in animal

models. The liposomes were administered intravenously in mice bearing human

ovarian tumor xenografts. The liposomal EphA2-targeting siRNA inhibited

ovarian tumor growth following treatment. When delivered in concert with

paclitaxel, a significant reduction in the growth of ovarian cancers was observed

in the mouse tumor model (82). The intraperitoneal administration of the

liposomal EphA2-targeting siRNA was also evaluated and found to inhibit ovarian

cancer growth by a similar degree compared to intravenous administration in the

mouse tumor model. The DOPC-based neutral liposomes have additionally been

used for the delivery of other anti-cancer siRNAs, including those targeting focal-

adhesion-kinase, interleukin-8, and β-2 adrenergic receptor, in ovarian cancer

25

mouse models (83–85). The liposomes can deliver siRNA in vivo into tumors 10-

and 30-times more effectively than cationic liposomes (DOTAP) and naked

siRNA, respectively. Twice weekly intravenous injections of DOPC-liposomes at

a dose of 150 μg/kg/day resulted in substantial reduction in the expression of the

target genes (e.g., EphA2, FAK, neuropilin-2, IL-8 or Bcl-2) and tumor size in

mice with different human cancers, including subcutaneous xenografts and

orthotopic tumor models (82). A single injection of DOPC-liposomes (150 μg/kg,

iv. or i.p) leads to inhibition of target protein expression for over 4 days in tumors

in mice. DOPC-based liposomes did not cause any detectable distress or toxicity

and were found to be safe in mice and in nonhuman primates. These liposomes

do not exhibit any toxicity to normal cells including fibroblasts, bone marrow and

hematopoietic cells, making them highly attractive for further development.

1.6.6 Lipid-like siRNA nanoparticles

In addition to liposomal formulations, lipid siRNA nanoparticles have been

used in the systemic delivery of siRNA. Examples include stable nucleic acid-

lipid particles (SNALPs) and cationic solid lipid nanoparticles (SLN). SNAPLs are

constructed from a bilayer composed of a mixture of cationic and fusogenic lipids

to enable cellular uptake and endosomal release of the siRNA cargo. They have

been used to carry chemically modified siRNA targeting to HBV RNA as liver

cancer therapeutics in mouse tumor models as well as successfully deliver

intravenously administered siRNA (2.5 mg/kg) into monkeys with marked

inhibition of apolipoprotein B protein up to 11 days. siRNA delivered by SNALPs

exhibited extended half-life in the liver and resulted in a 95% reduction in HBV

26

serum titers. Delivery by SNALPs did not illicit an immune response and the

reduction in HBV DNA was sustained for up to 7 days following the last dose

administration (86). Solid lipid nanoparticles (SLNs) reconstituted from natural

components of protein-free low-density lipoproteins have also been used to

deliver siRNA. SLNs were prepared using a modified solvent-emulsification

method and composed of cholesteryl ester, triglyceride, cholesterol, dioleoyl

phosphatidylethanolamine (DOPE), and 3-beta-[N-(N’,N’-dimethylamino

ethane)carbamoyl]-cholesterol (DC–cholesterol). These carriers provide efficient

target gene silencing and serum stability, with a minimal level of cytotoxicity.

1.6.7 Polymer-mediated siRNA delivery

Polymer-based delivery systems have been investigated for delivering

plasmid DNA for some time, and more recently polymers have also been

developed for siRNA delivery. Similar to lipid-based systems, polymeric siRNA

delivery systems typically involves a cationic moiety as the core of the carrier.

Since 1990, a wide array of cationic polymers has been developed, initially for

the delivery of plasmid DNA, and some of them have been adapted for siRNA

delivery. While siRNA differs from plasmid DNA in terms of molecular weight,

charge ratio, stability and mechanism of action, they are both nucleic acids and

share similar characteristics applicable to their delivery in vivo. Therefore, much

of what has been learned while developing polymeric-based delivery systems for

DNA can be used in the development of these systems for siRNA (84).

27

Cationic polymers can be classified as synthetic or natural polymers.

Examples of synthetic cationic polymers include linear or branched

polyethyleneimine (PEI), poly-L-lysine (PLL), and cyclodextrin-based polycations.

Examples of natural cationic polymers include chitosan, atelocollagen, and

cationic polypeptides. The advantage of cationic polymers comes from the

simplicity and ease in which complexes can be formed between the polymer and

siRNA. Unlike cationic liposomes, which require a lengthy, multiple step process

for assembly, cationic polymers can complex with anionic siRNA by merely

mixing the two together.

Natural cationic polymers are often employed as they are considered both

biocompatible and biodegradable. Chitosan is the most commonly used natural

cationic polymer for nucleic acid delivery. Chitosan/siRNA nanoparticles have

been administered intranasally to endogenously enhanced green fluorescent

protein (GFP)-transgenic mice. The chitosan/(anti-GFP siRNA) nanoparticles

mediated knockdown of endogenously enhanced green fluorescent protein in

bronchiole epithelial cells (85). Chitosan-coated polyisohexylcyanoacrylate

(PIHCA) nanoparticles have also been used for the delivery of RhoA-specific

siRNA in a mouse model (87).

For siRNA, stable complexation with cationic polymers is an essential part

of successful delivery and transfection. Parameters such as

hydrophobicity/hydrophilicity, polymer molecular weight, and charge density can

be adjusted to achieve optimal complexation with siRNA. The N/P ratio, defined

as the ratio of protonatable polymer amine groups to nucleic acid phosphate

28

groups, is another important parameter that affects the electrostatic binding

between siRNA and cationic polymers (88). When designing nanoparticles as

delivery vehicles for siRNA delivery, an optimal stability condition should be met

such that the nanoparticles will remain chemically stable as to protect against

enzymatic degradation during the process of delivery yet vulnerable to polymer

coating rupture in the endosomal compartment. Minimizing the propensity for

nanoparticle aggregation through either electrostatic or steric stabilization can

achieve physical stability (88). Polymers hold major promise because their unit-

by-unit construct allows optimization and fine-tuning of the properties needed for

efficient transfection and release of siRNA (89). Although typically encapsulation

occurs through electrostatic interactions, some polymers can encapsulate siRNA

using hydrophobic interactions (90). Cationic nanoparticles are believed to

facilitate cellular uptake through associating with the negatively charged

membrane of the target cells. However, in vivo, negatively charged serum

proteins, such as albumin, lead to nanoparticle aggregation. Generally, 150 nm is

the considered size limit for cellular uptake by non-specific endocytosis (91).

Therefore, aggregates of nanoparticles exceeding this size will disrupt cellular

uptake and will not be internalized (92).

The most extensively used cationic polymers, PEI, come in a wide range

of molecular weights and have many protonable amino groups, giving a high

cationic charge density at physiological pH. siRNA forms complexes with PEI

through electrostatic interactions between the phosphate groups of siRNA and

the amino groups of PEI (88). PEI has been shown to have a superior

29

transfection efficiency compared to other polymers and has buffering capability

and proton sponge effect in the acidic endosome, thus releasing the siRNA load

into the cytoplasm (93). Despite these advantages, PEI had been found to be

cytotoxic and induce cell death through mechanisms such as necrosis and

apoptosis in a variety of cell lines (94,95). The cytotoxicity of PEI depends on

both molecular weight and degree of branching, higher molecular weight and

increased branching increase cytotoxicity (96,97). By removing uncomplexed PEI

remaining after the complexation reaction with siRNA, the toxicity can be

reduced. While these purified complexes improved the toxicity profile of the

delivery system, the complexes had to be administered at higher concentrations

to achieve the same level of transfection as their unpurified, cytotoxic counter

partners (94).

Introducing PEG chains to form block copolymers is one strategy used to

reduce the cytotoxicity of high molecular weight PEI. Biodegradable systems

synthesized from PEI and PEG increase the overall charge densities of the

system which in turn reduces the cytotoxicity (95). Further, PEG chains can form

a layer of protection against interactions with degradation enzymes and other

serum proteins and increase the circulation time of siRNA in vivo (96). A PEG

and PLL copolymer was developed and found that a higher molecular weight PLL

will produce prolonged siRNA circulation. Cyclodextrin-containing polycations

can self-assemble with siRNA to form nanoparticles approximately 50 nm in

diameter. These polymer-based nanoparticles form a delivery system where the

terminal imidazole groups of the cyclodextrin-containing polycation assist in the

30

intracellular trafficking and subsequent release of nucleic acids. This system can

be conjugated with PEG chains containing targeting ligands to interact

specifically with cell-surface receptors to create a targeted in vivo delivery system

(96).

Polymeric siRNA delivery systems have been tested as therapeutics for

treating many types of cancer. The complexes of a linear low-molecular weight

PEI with siRNA targeting the HER-2 receptor were administered in a mouse

model with SKOV-3 ovarian carcinoma xenograft. PEI/siRNA complexes

resulted in substantial downregulation of HER-2 and, consequently, significant

inhibition of tumor growth in the animal model (97). A nontoxic copolymer blend

of PEI and PEG, PEI-g-PEG, have been used to deliver siRNA specific for the

signaling peptide of the secretory clusterin, a prosurvival factor that protects cells

from ionizing radiation (IR) injury as well as chemotherapeutic agents for

sensitizing breast cancer cells (98). The siRNA nanoparticles have shown in vitro

suppression of both basal and IR-induced secretory clusterin expression, and

increased susceptibility to IR exposure in human MCF-7 breast cancer cells. This

study demonstrated the ability of the siRNA nanoparticles to mediate the

knockdown of specific cytoprotective factors for DNA repair, antiapoptotosis and

free radical scavenging and to enhance the sensitivity of cancer cells to radiation

therapy, and potentially to chemotherapy (51).

Low molecular weight PEI has been used to prepare biodegradable

cationic polymers for siRNA delivery for cancer treatment. PEI was reacted with

PEG diacrylate (PEI-alt-PEG) to synthesize a degradable poly(ester amine)

31

copolymer. An siRNA targeting against Akt1 complexed with the PEI-alt-PEG

copolymers was delivered through a nose-only inhalation system for the

treatment of lung cancer in a mouse model with urethane-induced lung cancer.

Akt plays a key role in cancer by stimulating cell proliferation, inhibiting

apoptosis, and modulating the protein translation (99,100). Amplification of genes

encoding Akt isoforms has been found in many tumors and dominant negative

alleles of Akt have been reported to block cell survival and to induce an apoptotic

response (101). After a delivery regimen for 4 weeks, the Akt1 siRNA-poly(ester

amine) complexes were successful in downregulating Akt-related signals.

Aerosol-delivered Akt1 siRNA nanoparticles decreased about 80% of the Akt1

protein expression specifically in the lungs and significantly inhibited the

progression of lung cancer in different mouse models. Recent findings also

suggest that aerosol delivery of Akt1 siRNA may be useful for the treatment of

chemotherapy- or radiotherapy-resistant lung cancer. Combination therapy with

other classical chemotherapeutic treatments may enhance the therapeutic

efficacy(102,103).

Polymeric siRNA delivery systems have been used in conjunction with

anticancer drugs for cancer treatment in animal models. For example, cationic

core-shell nanoparticles have been self-assembled from a biodegradable

amphiphilic copolymer poly{(N-methyldietheneamine sebacate)-co-

[(cholesteryloxocarbonylamidoethyl)methylbis(ethylene) ammonium bromide]

sebacate} (P(MDS-co-CES)). Enhanced siRNA transfection with the co-delivery

of paclitaxel was demonstrated in vivo in a 4T1 mouse breast cancer model. The

32

co-delivery of paclitaxel with Bcl-2-targeted siRNA increased cytotoxicity in MDA-

MB-231 human breast cancer cells (104).

1.6.8 Theranostics

Theranostics combines diagnostic and therapeutic strategies to diagnose,

treat and monitor the response to the therapy (105). Cancer is a heterogeneous

disease and current treatments are effective only at select stages and for only a

limited subpopulation of the patient pool (106). Traditionally, imaging and therapy

systems have been developed and investigated independently. Theranostics

allows the improved understanding of how each system works and provides a

comprehensive and coordinated platform for the diagnosis, treatment and

efficacy monitoring of cancer (107). In this way, imaging of the disease can be

done before, during and after treatment to track the delivery of therapeutics and

the response of the disease to the delivered therapeutics.

Recent advances in cancer biology have revealed the extent of the

molecular heterogeneity in cancers of the same type, among the cells of the

same tumor and between primary tumors and their metastatic foci. This

molecular diversity, coupled with the ability of cancer cells to develop multidrug

resistance, emphasizes the insufficiencies of monotherapy. The integration of

biomedical imaging with therapeutics, such as siRNA, has a potential to address

the challenges of cancer heterogeneity and adaption. Molecular imaging can be

used as a means of assessing the cellular phenotypes present in the tumor of

interest to guide the selection of an appropriate target-specific therapy. Repeated

33

molecular imaging can then be used to tailor targeting strategies and treatments

as the tumor evolves in response to the initial therapy (108).

In addition to providing information regarding the molecular makeup of

tumors, biomedical imaging can be used to study many facets of systemic siRNA

delivery to study and determine pharmacokinetics, delivery efficiency and

pharmacodynamics of siRNA delivery systems. siRNA delivery systems can be

labeled with imaging agents to provide real-time tracking of the delivery vehicles,

validating targeting efficacy, monitoring the expression pattern of molecular

targets and early feedback of the therapeutic efficacy before detection of any

anatomic changes (109).

siRNA has been incorporated into dextran coated superparamagnetic

nanoparticles for the simultaneous noninvasive imaging and delivery of siRNAs

to tumors. The coated nanoparticles were also modified with Cy5.5 near-infrared

fluorescence dye and MPAP membrane translocation peptides. A GFP targeting

siRNA was used to target a reporter gene GFP. Cellular uptake and silencing

efficiency of the complexes were investigated in vitro in 9L-GFP glioma tumor

cells. Fluorescence results indicated that these nanoparticle complexes were

able to localize within the cells, predominantly in perinuclear regions. Further, the

theranostic nanoparticles resulted in significant suppression of GFP fluorescence

in the 9L-GFP cells, while in control 9L-RFP cells, RFP fluorescence remained

unchanged. The feasibility of the superparamagnetic nanoparticle-complexes to

act as both imaging and delivery platform was then tested in mice implanted with

9L-GFP and 9L-RFP tumors with in vivo contrast enhanced MRI after

34

intravenous injection. The superparamagnetic nanoparticles were characterized

by their strong T2 magnetic susceptibility effects. The accumulation in tissue

was reflected by a decrease in T2 relaxation time, which results in a loss of

signal on MR images. It was found that the tumors appeared bright on T2 images

taken before injection of the complexes. After administration, images showed a

significant drop in signal decrease in the tumors as a result of MN-NIRF-siGFP

accumulation, indicating strong accumulation of the theranostic nanoparticles in

tumor (110). The therapeutic efficacy of theranostic nanoparticles was tested

with an anti-survivin siRNA in an animal tumor model. Survivin, a member of the

inhibitor of apoptosis protein (IAP) family, is expressed solely in most human

neoplasms making it an ideal therapeutic target (111). The theranostic

nanoparticles with siSurvivin were administered systemically to nude mice

bearing human colorectal carcinoma tumors. Silencing efficiency was confirmed

by RT-PCR. Transcript level of survivin in tumors treated with the nanoparticles

was 97% lower than control tumors. Additionally, levels of tumor-associated

apoptosis and necrosis were higher compared to controls (111).

The effectiveness of theranostic nanosized siRNA complexes can be

improved by conjugating tumor-specific ligands. Paramagnetic nanoparticles

were coupled with a fluorescent Cy5 dye component, siRNA and a PEGylated

cyclic Arg-Gly-Asp (RGD) peptide. RDG conjugated nanoparticles bound strongly

to αvβ3 integrin, which is overexpressed on endothelial cancer cells and were

readily internalized into cells by receptor-mediated endocytosis. MRI and

fluorescence imaging non-invasively revealed that the targeted nanoparticles

35

reached the cytoplasm of the target cells, possibly through the endolysosomal

pathway. Once in the cytosol, the disulfide bond was cleaved by a glutathione to

release the siRNA from the nanoparticle. The free siRNA then went on to

incorporate into the RISC to initiate posttranscriptional gene-silencing (112).

1.6.9 siRNA in clinical trials

Since 2004, a handful of siRNA therapies have undergone various

degrees of clinical evaluation (113–115). Table 1.3 summarizes select examples

of clinical trials involving siRNA. siRNA has been investigated for the treatment

of ocular, retinal, and respiratory diseases. Many of the trials employ local

administration of siRNA or delivery of naked siRNA, due to the target tissue

being easily accessible by localized delivery methods. For example, intravitreal

injection was used to delivery PF-655 (Quark Pharmaceuticals) as a means to

target RPT801 for the treatment of age-related macular degeneration and

diabetic macular edema. SYL040012 targeting β2 adrenergic receptor was

formulated into an eye drop for treatment against glaucoma.

Exploration into the application of siRNA towards cancer involving active

delivery strategies have begun to enter into the clinical phase of development.

Most notably, the siRNA therapeutic CALAA-01 (Calando Pharmaceuticals) was

the first targeted systemic siRNA delivery system in clinical trial for cancer

treatment to be terminated. The delivery system was comprised of four

components: (1) a cyclodextrin-based cationic linear polymer, (2) an siRNA that

silences the expression of the M2 subunit of ribonucleotide reductase (RRM2),

36

(3) PEG chains to increase the in vivo stability of the siRNA nanoparticles, (4) a

human transferrin protein (Tf) targeting ligand conjugated to the surface of the

nanoparticles to engage transferrin receptors overexpressed on the surface of

cancer cells. The four components formed a stable targeted siRNA delivery

system through complexation and self-assembly. The transferrin-tagged CALAA-

01 nanoparticles mediated efficient cancer cell targeting and intracellular uptake.

Initially, three patients with metastatic melanoma received doses of 18, 24, and

30 mg m-2 intravenously. One patient received an additional dose 1 month after

the final dose of the first cycle. Immunohistochemistry and staining was

conducted on biopsied tissue samples and compared with archived tissue

samples. The study showed that nanoparticles localized intracellularly in tumor

tissue and not in the surrounding epidermis. Tumor RRM2 mRNA levels were

measured by quantitative real time reverse-transcriptase polymerase chain

reaction (qRT–PCR) and a reduction in RRM2 mRNA was observed in post-

treatment samples (116). While not explicitly stated, the reasons for terminating

the clinical development may have stemmed from an observed rapid clearance

and activation of an acute inflammatory cytokine response (117).

ALN-VSP01 (Alnylam Pharmaceuticals’), a SNALP-based delivery system,

targets both VEGF and kinesin spindle proteins for the treatment of liver and

other solid tumor cancers (ALN-VSP02). Following delivery, 50% of patients with

hepatocellular carcinoma demonstrated an anti-VEGF effect. Another SNALP

based therapy, ALN-TTR01, was able to significantly knockdown levels of serum

transthyretin in patients with transthyretin-related amyloidosis. Many

37

pharmaceutical and biotechnology companies also have a number of siRNA

candidates in development, inevitably lending to an increase in the number of

siRNA-based therapies reaching clinical trials (118).

38

Table 1.3. Select examples of siRNA therapies in clinical trials

Clin

ical

ap

plic

atio

nN

ame

Ind

icat

ion

(s)

Gen

e ta

rget

(s)

Spo

nso

rSt

atu

s

Occ

ula

r an

d r

etin

alQ

PI-

10

07

Op

tic

atro

ph

yC

asp

ase

2Q

uar

k P

har

mac

euti

cals

Ph

ase

I

TD1

01

Pac

hyo

nyc

hia

co

nge

nit

a

Ke

rati

n K

6a,

K6

b, K

16

, K1

7

mu

tati

on

sP

ach

yon

ych

ia C

on

gen

ita

Pro

ject

Ph

ase

I co

mp

lete

d

AG

N2

11

74

5

Age

-rel

ated

mac

ula

r d

egen

erat

ion

ch

oro

idal

neo

vasc

ula

riza

tio

nV

EGFR

1A

llerg

an, S

irn

a Th

erap

euti

cs In

c.P

has

e I/

II co

mp

lete

d

SYL0

40

01

2G

lau

com

aβ

2 a

dre

ner

gic

rece

pto

rSy

len

tis

Ph

ase

I, II

Bev

asir

anib

Mac

ula

r d

egen

erat

ion

VEG

FO

pko

Hea

lth

, In

cP

has

e II,

co

mp

lete

d

Can

cer

NC

T00

67

25

42

Met

asta

tic

mel

ano

ma

LMP

2, L

MP

7, M

ECL1

, MA

RT-

1,

tyro

sin

ase,

gp

10

0, M

AG

E-3

Du

ke U

niv

ersi

ty M

edic

al C

ente

rP

has

e I

AP

N4

01

Solid

tu

mo

rs (

Mel

ano

ma,

Kid

ney

, Pan

crea

tic,

oth

er)

E3 u

biq

uit

in li

gase

Cb

l-b

Wak

e F

ore

st U

nvi

vers

ity,

Ap

erio

n

Bio

logi

csP

has

e I

ATU

02

7A

dva

nce

d s

olid

tu

mo

rsP

KN

3Si

len

ce T

her

apet

uic

s G

mb

HP

has

e I

CA

LAA

-01

Solid

tu

mo

rs

M2

su

bu

nit

of

R2

Cal

and

o P

har

mac

euti

cals

Ph

ase

I, t

erm

inat

ed

siG

12

D L

OD

ERP

ancr

eati

c C

ance

rM

uta

nt

KR

AS

Sile

nse

ed

Ltd

.P

has

e I

siR

NA

-Ep

hA

2-D

OP

CA

dva

nce

d, r

ecu

rren

t ca

nce

rEp

hA

2M

D A

nd

erso

n C

ance

r C

ente

rC

urr

entl

y e

nro

llin

g

TKM

-08

03

01

Pri

mar

y an

d s

eco

nd

ary

liver

can

cer

Po

lo-l

ike

kin

ase

1

NC

IP

has

e I

DC

R-M

YCH

epat

oce

llula

r C

arci

no

ma

MYC

Dic

ern

a P

har

mac

euti

cals

Inc

Ph

ase

I/II

Kid

ney

QP

I-1

00

2/I

5N

PA

cute

kid

ney

inju

ryp

53

Qu

ark

Ph

arm

., In

c.Te

rmin

ated

, Ph

ase

I

QP

I-1

00

2/I

5N

PD

elay

ed g

raft

fu

nct

ion

kid

ney

tra

nsp

lan

tp

53

Qu

ark

Ph

arm

., In

c.A

ctiv

e, P

has

e I,

II

QP

I-1

00

2/I

5N

PK

idn

ey in

jury

acu

te r

enal

fai

lure

p5

3Q

uar

k P

har

m.,

Inc.

Co

mp

lete

d, P

has

e I

SPC

36

49

Hep

atit

is C

vir

us

miR

-12

2Sa

nta

ris

Ph

arm

Act

ive

, Ph

ase

II

pH

IV7

-sh

I-TA

R-C

CR

5R

ZH

IV

HIV

Tat

pro

tein

, HIV

TA

R R

NA

,

hu

man

CC

R5

Cit

y o

f H

op

e M

edic

al

Cen

ter/

Ben

ite

cA

ctiv

e, P

has

e 0

ALN

-RSV

01

RSV

in v

olu

nte

ers

RSV

nu

cleo

cap

sid

Aln

ylam

Ph

arm

.C

om

ple

ted

, Ph

ase

II

ALN

-RSV

01

RSV

in lu

ng

tran

spla

nt

pat

ien

tsR

SV n

ucl

eoca

psi

dA

lnyl

am P

har

m.

Co

mp

lete

d, P

has

e I

ALN

-RSV

01

RSV

in lu

ng

tran

spla

nt

pat

ien

tsR

SV n

ucl

eoca

psi

dA

lnyl

am P

har

m.

Act

ive

, Ph

ase

IIA

nti

vira

l

39

1.7 Objectives

Objective 1: Evaluation of the effect of N/P ratio on physicochemical and

biological properties ECO/siRNA nanoparticle system

The physicochemical properties of a nanoparticle can directly influence the

biological efficacy of such systems both in vitro and in vivo. Chapter 3 focuses

on understanding the factors that govern how ECO and siRNA assemble into

nanoparticles with a specific interest in how the N/P ratio can directly influence a

wide array of parameters. Extensive physicochemical and biological

characterization of the ECO/siRNA nanoparticles reveals how the N/P ratio can

be easily altered to create a tunable system. Further, the intrinsic properties of

the ECO lipid structure are explored to fully characterize the multifunctional

properties exhibited by the ECO/siRNA nanoparticles. The results demonstrate at

the optimal N/P ratio, properties such as siRNA binding efficiency, nanoparticle

stability, silencing efficiency and cytotoxicity are balanced and the nanoparticles

exhibit pH-dependent membrane disruption and glutathione-mediated siRNA

decomplexation to promote endolysosomal escape and cytosolic siRNA release,

respectively.

Objective 2: Assess the therapeutic efficacy of peptide-targeted ECO/siRNA

nanoparticles delivering Integrin β3-specific siRNA on metastatic triple-

negative breast cancer

Functional disruption of integrin β3 has shown potential in vitro as a means to

inhibit TGF-β-mediated epithelial-mesenchymal transition, the seminal event in

the metastasis of breast cancer cells. In chapter 4, ECO/siRNA nanoparticles

40

delivering integrin β3-specific siRNA were used to evaluate the potential of RNAi-

based therapy against metastatic triple-negative breast cancer. The effect of

nanoparticle-mediated integrin β3 silencing was evaluated in vitro within the

context of the events that comprise the metastatic cascade. The ECO/siRNA

nanoparticles were modified with an RGD-targeting ligand anchored with a PEG

spacer to allow for the systemic administration of the nanoparticles in vivo. These

targeted nanoparticles were shown to enhance cellular uptake within post-EMT

breast cancer cells. Two animal models were used to determine the effect of

integrin β3 silencing on i) outgrowth within the pulmonary environment and ii)

primary tumor growth and development of metastases. RGD-targeted ECO/siβ3

nanoparticles were found to reduce primary tumor burden and pulmonary

outgrowth while also inhibiting metastasis.

Objective 3: Design a pH-cleavable PEG-moiety to overcome the PEG

dilemma

PEGylation of non-viral gene delivery systems often leads to an increase in

lysosomal degradation of the nucleic acid cargo and a decrease in functional

efficacy. To improve the efficacy of the targeted and PEGylated ECO/siRNA

nanoparticles, a pH-cleavable PEG system was created in Chapter 5 using the

acid-labile hydrazone linkage. In vitro characterization revealed the hydrazone

linkage restored the important pH-sensitive endolysosomal escape ability and

improved gene silencing. In vivo, noninvasive bioluminescent imaging (BLI) and

fluorescence molecular tomography (FMT) is used to monitor the in vivo tumor

targeting and functional activity of the siRNA nanoparticles and provide crucial

41

insights into the in vivo behavior of the targeted and pH-cleavable siRNA

nanoparticles.

Objective 4: Determine therapeutic efficacy of eIF4E silencing in

combination with paclitaxel using dual pH-responsive ECO/siRNA

nanoparticles in drug-resistant triple-negative breast cancer

Chapter 6 explores the combination of RNAi-based therapy against eIF4E with

the small-molecule chemotherapeutic paclitaxel in drug-resistance triple-negative

breast cancer. Using the RGD-targeted pH-cleavable PEGylated ECO/siRNA

nanoparticles, siRNA directed against eIF4E was used to sensitize drug-resistant

breast cancer cells to paclitaxel therapy in vitro. In vivo, a combination of

nanoparticle-delivered siRNA and paclitaxel was more effective in reducing tumor

growth than either therapy alone in a primary mammary fat pad tumor model.

The results highlight the potential of such combination RNAi- and small-

molecule-based therapeutic regimens to combat highly aggressive triple-negative

breast cancers.

42

Chapter 2

pH-Sensitive Cationic Lipid-Based siRNA Delivery Systems

43

2.1 Introduction

To date, a large number of nanoparticles systems have been explored to

overcome the obstacles and improve the silencing efficiency of siRNA delivery.

The early development of delivery vehicles for siRNA-based applications relied

heavily upon systems originally created for the intracellular delivery of DNA

(67,114,119–121). Initially, those materials developed for DNA delivery were

used for RNA delivery; however, siRNA delivery and DNA delivery differ in

regards to several important aspects (122). The molecular weight of siRNA is

approximately 13 kDa while the molecular weight of DNA molecules used in gene

therapy is typically several hundred times larger (123). As the size of a nucleic

acid/nanoparticle complex is in part dictated by the size of the nucleic acid cargo

in relation to the nanoparticle carrier, those materials optimized for DNA delivery

may not necessarily be ideal for siRNA delivery (124–126). Additional differences

include the site of action within the cell and the stability of the respective

molecules. To initiate RNAi-mediated gene silencing, siRNA molecules must be

delivered into the cytosol, unlike DNA which must localize within the nucleus.

Further, RNA molecules have an increased susceptibility to hydrolysis and

therefore, extra care must be taken to ensure sufficient packing and protection of

the RNA cargo from the harsh and dynamic physiological environments (40,127).

The field of lipid-based synthetic transfection began with the development

of N-[1-(2,3-dioleyloxy) propyl]-N,N,N-trimethylammonium chloride (DOTMA) as

the first cationic lipid-based gene delivery system (128–130). DOTMA contains a

trimethylammonium polar head (quaternary amino group), a glycerol-like

44

backbone with two linkage bonds, and two oleyl lipid hydrocarbon tails. An early

study based off the success of DOTMA aimed to identify the structural

characteristics of lipid-based systems critical for a high transfection efficiency

(131). The lipid-based analogues synthesized varied in backbone structure,

aliphatic chain composition, and linkage bonds. In vivo luciferase silencing data

following intravenous administration of the accompanying derivative structures

was used to propose a framework to classify the features common to those lipids

found most effective for in vivo DNA delivery (131). These features included: i) a

cationic head group and its neighboring aliphatic chain being in a 1,2-relationship

on the backbone; ii) an ether bond for bridging the aliphatic chains to the

backbone, and iii) paired oleyl chains as the hydrophobic anchor into the lipid

assembly.

Recent work has focused on optimizing materials to create delivery

systems specifically for the application of siRNA delivery (84,132–134). To do so,

an expanded library of 1200 lipid-based materials has been developed and

characterized specifically for siRNA delivery applications (135). Within the library

of structures, the following parameters were systematically adjusted to enable

the study of structure-function relations: i) hydrophobic tail chain length and

saturation; ii) linkage group between hydrophobic tail and amino group; iii)

primary R group on amine; and iv) post-synthetic quaternization of the amino

group. A similar framework was created and identified the following properties as

ideal: i) greater than two amines per head group; ii) amide bonds between the

45

amine ‘core’ and acyl tails; iii) greater than two acyl chains; iv) acyl chains

between 8 and 12 carbon atoms; and v) a least one secondary amine.

Regardless of DNA or siRNA as the cargo, nucleic acid delivery systems

must be designed to: i) protect the nucleic acid cargo from degradation during

systemic circulation; ii) ensure accumulation within the target site to avoid non-

specific uptake in healthy, non-target tissue; iii) promote cellular uptake and

endolysosomal escape; iv) release nucleic acids intracellularly. As such, cationic

lipid systems developed for siRNA delivery should invariably consist of three

main structural domains: 1) a cationic head group; 2) backbone and linker

groups; 3) hydrophobic tail groups. Careful design and characterization of

cationic lipid structures will allow for the fine-tuning of physicochemical properties

and biological activity to achieve maximum intracellular siRNA delivery and RNAi

activity.

2.2 Endosomal escape: The rate-limiting step

Following internalization, siRNA delivery vehicles encounter a unique set

of intracellular obstacles unlike those experienced during systemic circulation

and extracellular transport. SiRNA-based nanoparticles are typically internalized

via endocytosis, whereupon they will be trafficked through a series of maturing

acidic vesicles leading to the lysosomes (136,137). SiRNA systems must

therefore be designed to escape these compartments and avoid exposure to the

degradative enzymes contained within the harsh acidic environment of late-

endosomes and lysosomes. Non-targeted siRNA nanoparticles with a net

cationic surface charge can non-specifically interact with the negatively-charged

46

lipids of the cell membrane to promote internalization, hypothesized to be

through a combination of adsorptive pinocytosis and direct lipid membrane fusion

(138). Nanoparticles decorated with targeting ligands will mediate specific

interactions with receptors expressed on the cell-surface to facilitate receptor-

mediated endocytosis (139,140). While the exact mechanism of internalization

may vary depending on the physicochemical properties of the siRNA delivery

system, targeted or non-targeted nanoparticles will become localized within

endocytic vesicles (141).

The first vesicle in the trafficking pathway, the endosome, can fuse with

other sorting vesicles to transport the internalized content back to the cellular

membrane and induce exocytosis (142,143). In fact, recent work using a cationic

lipid-based siRNA nanoparticle system revealed that up to 70% of the

internalized siRNA underwent exocytosis (144). Endosomal vesicles not involved

in recycling will continue to be trafficked through the endocytic pathway to late-

endosomes (145). Late-endosomes engage ATPase proton-pump enzymes to

rapidly acidify the vesicle environment to a pH of 5-6 before maturing into

lysosomes with a pH of 4.5 and containing degradative enzymes (146). If trapped

inside these acidic vesicles, any siRNA or nucleic acid load will be degraded. As

such, an emphasis on designing siRNA delivery systems capable of escaping the

fate of exocytosis and/or lysosomal degradation is the key to achieving efficient

target gene knockdown.

2.3 pH-sensitive Amphiphilicity

47

A desirable feature of siRNA delivery systems is tunable pH-sensitive

amphiphilicity. Amphiphilicity is described as the characteristic of chemical

structures to contain both hydrophilic and lipophilic domains (147). Amphiphiles

can self-assemble in an aqueous environment, either alone or with the help of

co-lipid helpers, and can associate with nucleic acids (ie., siRNA, DNA,

microRNA) to form cationic-lipid/siRNA complexes (148). Such complexes

enhance the protection and the structural integrity of the siRNA cargo against

RNases.

As the siRNA carrier system progresses through the cellular trafficking

pathway, it will encounter an increasingly acidic environment as mentioned

above. Therefore, specific pH-sensitive amphiphilicity within an acidic

environment resulting in structural changes to enhance interactions with the lipid

walls of vesicles to initiate membrane disruption should be achieved to trigger

endolysosomal membrane destabilization and subsequent escape. Minimal

amphiphilicity should be observed at physiological pH to minimize non-specific

membrane disruption and cytotoxic effects as the siRNA carrier travels through

systemic circulation.

2.4 Mechanism of endolysosomal escape

While the precise mechanism by which cationic lipid-based siRNA delivery

systems mediate endolysosomal escape has yet to be entirely elucidated, two

main hypotheses exist to explain the observed event: i) the proton sponge effect

and ii) lamellar phase transition.

48

The proton sponge effect is a proposed mechanism for delivery materials

that contain amines with pKa values that range between 7 and 5, thus matching

the pH range encountered during endolysosomal trafficking (39,149). According

to the proton sponge effect, following internalization, the amine groups become

protonated as the endosome acidifies. These amines possess a buffering

capability that results in an influx of protons and chloride ions to create an

osmotic imbalance. As water enters the endosomes to counter this effect, the

endosomal vesicle inflates causing it to rupture and ultimately release its

contents into the cytosol. As such, primary, secondary and tertiary and imidazole

amines of various pKa’s are often incorporated into nucleic acid delivery systems

for their buffering capabilities (150).

Initially, it was argued that complexes arranged in the inverted hexagonal

phase had a greater transfection efficiency compared to those in the lamellar

phase (151,152). However, conflicting data has disputed that a direct correlation

exists between the complex structure and transfection efficiency (153,154). More

recently it has been suggested that the dynamic evolution of a complex’s

structure upon interactions with anionic cellular lipids is the critical factor that

determines the extent of transfection efficiency (151). The lamellar phase

transition occurs with a class of fusogenic cationic-based lipids that form into

non-bilayer formations under aqueous environments (155–157). These lipids can

adopt the inverted hexagonal phase characterized by a long, cylindrical, and

inverted micelle structure. Complexes comprised from such lipids that undergo a

transition from lamellar to an inverted hexagonal phase (lamellar-to-hexagonal

49

inverted phase transition) can fuse with the anionic lipid membranes of

intracellular vesicles to release their nucleic acid cargo into the cytosol. To

achieve the transition, the lipid must contain unsaturated hydrocarbon chains.

Studies have demonstrated that cationic-lipid based systems containing

unsaturated lipids have superior gene silencing efficiency compared to systems

containing saturated lipids. The unsaturation of the hydrophobic lipid tail directly

influences the fusogenic potential of the delivery system.

Dioleoylphosphatidylethanolamine (DOPE) is a lipid with fusogenic capabilities

and is commonly incorporated into delivery systems as a helper lipid to mediate

lamellar-to-hexagonal transition and improve the transfection efficiency

(158,159).

2.5 pH-Sensitive Lipids for siRNA Delivery

Lipids containing fusogenic capabilities and pH-sensitive, or ionizable,

domains are commonly used to improve the transfection efficiency of siRNA

delivery systems. The first developed systems for siRNA using pH-sensitive lipids

demonstrated that the pKa of the amino group governs the endosomal buffering

capability and facilitates endosomal escape. Ionizable lipids, capable of

protonation in an acidic environment, with a pKa of 6.7, were found to be highly

efficient in RNAi-mediate gene knockdown (156). A series of novel pH-sensitive

cationic lipids with varying degrees of saturation were developed: zero (1,2-

distearyloxy-N,N-dimethyl-3-aminopropane (DSDMA)), one 1,2-dioleyloxy-N,N-

dimethyl-3-aminopropane (DODMA)), two (1,2-dilinoleyloxy-N,N-dimethyl-3-

aminopropane (DLinDMA)), or three (1,2-dilinolenyloxy-N,Ndimethyl-3

50

aminopropane (DLenDMA)) double bonds per alkyl chain. Each lipid was then

incorporated into stable nucleic acid lipid particles to assess the impact of lipid

tail saturation on gene silencing efficiency, as more unsaturation within the acyl

chains may enhance the cone shape of the lipids to improve membrane

destabilization induced by the cationic lipids. It was reported that increasing the

saturation within the hydrocarbon chains from 0 to 2 resulted in greater

transfection efficiency, however, 3 double bonds led to no significant

improvement.

Accordingly, DLinDMA was used for further development as a pH-

sensitive cationic lipid siRNA delivery system by optimizing the linker region

connecting the hydrophobic and hydrophilic domains through the introduction of

groups exhibiting different rates of chemical or enzymatic stability. Introduction of

a ketal ring linker domain into DLinDMA (DLin-K-DMA) resulted in the best in vivo

silencing efficiency when compared to analogue lipids containing ester, alkoxy,

carbamate or thioether linkages. Next, the composition of the amine-based head

group was reevaluated using DLin-K-DMA by varying the number of ionizable

groups to study the downstream effect on overall pKa and functionality. Further

structural refinements in the head group design included addition of the following

groups: piperazino, morpholino, trimethylamine and bis-dimethylamino. The

dimethylamino group of the original DLin-K-DMA lipid was found to be superior to

any explored structural modification. As a final point of optimization, the distance

between the amino-based head group and the dioxolane linker domain was

varied through the introduction of methylene groups (Figure 2.1A). The distance

51

between the cationic head group and the linker domain can influence the overall

pKa of the lipid and thus greatly impact the silencing efficiency (Figure 2.1B). It

was found than increasing the distance with a single additional methylene group

(DLin-KC2-DMA) produced a fourfold increase in efficiency compared to DLin-K-

DMA (Figure 2.1C). The additional of additional methylene groups increased the

overall pKa of the lipid and subsequently decreased the functional activity,

highlighting the need for careful optimization of the structural components of pH-

sensitive lipids.

Figure 2.1. A. Chemical structures of DLinDMA-derivative cationic lipids. B. Biophysical

parameters and in vivo silencing activity of DLinDMA-derivative cationic lipids. C. Effect

of distance between cationic head group and linker domain. DLin-K-DMA () had

52

additional methylene groups added between the DMA headgroup and the ketal ring

linker to generate DLin-KC2-DMA (), DLin-KC3-DMA () and DLin-KC4-DMA (). The

activity of PFV formulations of each lipid was assessed in the mouse Factor VII model.

D. Plot of in vivo hepatic gene silencing activity vs. pKa in mice. The library of cationic

lipids were formulated in LNPs and subjected to an ED50 analysis and plotted against

their pKa.

A follow-up study conducted a comprehensive evaluation of 53 ionizable

lipid derivatives of DLin-KC2-DMA to correlate the pKa of the head group with the

intracellular siRNA release profile (160). Indeed, a compelling correlation

between pKa of the polar head group and the siRNA silencing efficiency was

reported. Within the library of 53 structures, the pKa’s ranged from 4.17 to 7.16.

Only those lipids with pKa’s ranging from 6.2-6.5 were able to elicit in vivo gene

silencing (Figure 2.1D). Such findings serve as a value design guide for the

future development of pH-sensitive cationic lipids for siRNA delivery.

Scheme 2.1. General structure of pH-sensitive cationic lipids for siRNA delivery

53

Over the years, our group has synthesized a number of rationally

designed polymerizable surfactants with pH-sensitive amphiphilicity for DNA and

siRNA delivery applications. All carriers are designed to contain the following

three domains with each playing an integral role in the formation of stable and

effective siRNA nanoparticles: i) a protonatable amino head group, ii) a cysteine-

based linker residue, and iii) geminal lipid tail groups (Scheme 2.1). The

protonable amine groups are comprised of various combinations of primary,

secondary, tertiary and aromatic amino groups which can electrostatically

complex with siRNA. The lipid tail groups introduce lipophilicity to further stabilize

the siRNA nanoparticles through hydrophobic interactions in an aqueous

solution. The pH-sensitive amphiphilicity will allow the carrier to alter its

amphiphilic structure when exposed to the acidic environment of the

endolysosomal pathway, resulting in membrane disruption and subsequent

endolysosomal escape. It is crucial that siRNA delivery carriers have selective

amphiphilic behavior such that high membrane disruption is achieved at the

endolysosomal pH and low disruption activity is exhibited at the physiological pH.

Alteration of the amine composition of the head group and the structure of the

lipophilic tails tunes the pH-sensitive amphiphilicity to improve the selectivity of

endolysosomal membrane disruption and enhance the gene silencing efficiency.

The inclusion of cysteine-based residues serves to stabilize the nanoparticles

through autoxidation-mediated polymerization of free thiols into disulfide bonds

and allow for surface modification with PEG and/or targeting moieties via facile

thiol-maleimide chemistry. Further, while the disulfide bonds remain stable during

54

systemic delivery of the nanoparticles, they are degraded within the reductive

environment of the cytosol by endogenous glutathione to promote siRNA de-

complexion and release.

The first system designed and synthesized for nucleic acid delivery was a

polydisulfide with protonatable pendants possessing histidine, primary and

tertiary amino groups (Figure 2.2A) (161). The flexible cationic side chains were

hypothesized to facilitate stable complex formation with both DNA and siRNA

while the incorporated amino groups would enhance the pH buffering capacity of

the carrier system. Indeed, the polydisulfide exhibited high buffering capacity in

the endolysosomal pH range (5.0–7.4) similar to that of a branched, 25 KDa PEI,

34% and 32%, respectively (Figure 2.2B). Interestingly, the addition of

chloroquine diphosphate, an endosomolytic agent, did not enhance the

transfection efficiency of the polydisulfide carrier system unlike previously

reported systems that require the assistance of chloroquine to achieve

comparable transfection efficiency (Figure 2.2C). The findings suggest the

observed buffering capacity of the protonable amines of various pKa’s within

cationic side chains promote endolysosomal escape.

55

Figure 2.2. A) Structure of polydisulfide, B) Acid titration profiles of NaCl, PEI and

polydisulfide (PDS), C) transfection efficiency of PDS/DNA complexes in the absence or

presence of chloroquine (CQ) compared with PEI and naked DNA (161).

A small library of polymerizable surfactants exhibiting pH-sensitive

amphiphilicity for siRNA delivery was synthesized using combinatorial solid-

phase chemistry (162). The pH-sensitive amphiphilic cell membrane disruption

was evaluated in rat red blood cells at pH values corresponding to the

environment of the endolysosomal trafficking pathway. The siRNA delivery and

luciferase silencing efficiency was determined in a human U87-luc glioblastoma

cell line engineered to stably express firefly luciferase. Ten distinct structures

were designed and synthesized to create the library of polymerizable surfactants

each with a unique combination of a protonable amine-based head group, dual

peptide linker groups, and geminal, distal lipophilic tail groups to form

nanoparticles with siRNA through charge-charge complexation, lipophilic

condensation, and oxidative polymerization (Figure 2.3A). For the head group,

ethylenediamine (E), triethylenetetramine (T), pentataethylenehexamine (P), and

spermine (S) were selected. These polyamines differ in the number of amino

groups with various pKas to adjust the pH-sensitive amphiphilic behavior of the

carriers. Histidine (H), glycine (G) and cysteine (C) were selected for the peptide

linkage. Fatty acids of different chain lengths and degrees of saturation, including

lauric acid (L), oleic acid (O), and steric acid (St), were used as the hydrophobic

tail groups.

56

The pH-sensitive amphiphilic cell membrane disruption of the library was

evaluated using a hemolysis assay (Figure 2.3B). The results revealed varying

pH-dependent hemolytic activities governed by differences in their structural

composition. Generally, all surfactants exhibited lower hemolytic activity at pH

7.4 when compared with pHs 6.5 and 5.4. Histidine groups contain an imidazole

ring with a pKa of 6 and can become protonated when the environmental pH is

below 6. Additionally, when the imidazole ring is protonated, the histidine residue

can contribute towards the fusogenic properties of the lipid carrier (162). For

surfactants containing histidine residues with the same lipophilic tail groups, the

hemolytic activity increased with the number of protonable amino groups at pHs

7.4 and 6.5. This suggests that increasing the number of protonable amino

groups contributes to an increased head group charge and higher amphiphilicity

at neutral pH. The hemolytic activity was also dependent on the composition of

the lipophilic tail groups. Interestingly, carriers containing the same head group

but unsaturated oleoyl groups exhibited less hemolysis than those with saturated

lipophilic tails at pHs 7.4 and 6.5. By selecting a combination of head group and

lipophilic tail groups that exhibit low hemolysis at pH 7.4 and 6.5 and high

hemolytic activity at 5.4, the specific pH-sensitive amphiphilicity can be finely

tuned. Based on this criterion, EHCO, with its combination of primary, tertiary and

aromatic amine groups in tandem with the unsaturated oleic acid lipid tail groups,

demonstrated specific hemolytic activity only at pH 5.4 with negligible hemolysis

at other pH levels.

57

It has been well documented that the stoichiometric relationship between

cationic lipid charge and anionic RNA charge in the form of lipid-to-siRNA (N/P)

ratio can influence a number of parameters including carrier shape, size, cellular

trafficking, and silencing efficiency. One study using aminoglycoside-based lipids

found that when formulated with low N/P ratios the siRNA lipoplexes formed were

small, stable but anionic. Increasing the N/P ratio led to neutral lipoplexes that

were unstable and aggregated into large complexes [46]. By increasing the N/P

ratio even further, the lipoplexes formed were small, stable and carried a net

positive charge. However, such trends heavily depend on the chemical

composition of the lipid. Along these lines, EHCO was used to study the impact

of N/P ratio on the complexation and formation of siRNA/lipid nanoparticles

(Figure 2.3C). When mixed and incubated with siRNA for 30 minutes,

nanoparticle formation was observed with an N/P ratio as low as 0.5 with a

diameter of 200 nm. Increasing the N/P ratio to 4 increased the nanoparticle

diameter to 3 μm due to aggregation. When the N/P ratio was increased even

further to 10, the nanoparticle sized decreased to 151 nm. At an N/P of 10, the

other surfactants ranged in diameter between 160-210 nm.

The luciferase silencing efficiency and cytotoxicity was evaluated for all

surfactants at an N/P ratio of 10 in U87-luc cells (Figure 2.3D). EHCO resulted in

the highest luciferase silencing (88.4 ± 3.1%) of the surfactants (48% to 81%).

Importantly, all surfactants had high cell viability ranging from 78.6 ± 5.7% to 88.2

± 1.3%. Comparatively, the commercially available TransFast reagent induced

89.6 ± 5.6% luciferase silencing but had poor viability (57.6 ± 2.2%) and

58

DOTAP/siRNA complexes had poor luciferase silencing (56.7 ± 3.1%) but a

higher cell viability (85.8 ± 1.6%). The success of EHCO in achieving high gene

silencing efficiency and low cytotoxicity is speculated to result from the specific

pH-sensitive amphiphilicity and membrane disruption characteristic of the

ethylenediamine head group and unsaturated oleoyl tails.

59

Figure 2.3. A) Chemical structures and abbreviated names of library of polymerizable

surfactants exhibiting pH-sensitive amphiphilicity for siRNA delivery, B) Hemolytic

activity of polymerizable surfactants and DOTAP at pHs 7.4, 6.5, and 5.4 with 1%Triton

X-100 and PBS as controls, C) Particle size of EHCO/siRNA complexes at different N/P

ratios, D) Luciferase silencing efficiency and cell viability of polymerizable surfactants

complexed with siRNA (100 nM). Transfact and DOTAP were used as controls (162).

Among the carriers developed in the library, SHCO also demonstrated

high transfection efficiency with minimal cytotoxicity and was chosen as the

parent compound for a new library of spermine-based protonable surfactants as

pH-sensitive multifunctional non-viral based delivery systems for both plasmid

DNA and siRNA (163,164). Eight new chemical structures were designed for

gene carriers (Figure 2.4A). Each carrier included spermine (S) as the

protonable head group to assist in packing the nucleic acid load. Spermine

naturally complexes with DNA through stabilization of their α-helix structure and

has commonly been incorporated into non-viral gene carrier systems. As before,

histidine (H) and cysteine (C) residues were included to allow fine-tuning of the

pH-sensitive behavior of the carriers and provide a means to stabilize and

functionalize the nanoparticles, respectively. Oleic acid (O) was used again for

the hydrophobic lipid tail groups to introduce flexibility and facilitate the phase

transition involved with endolysosomal escape. The inclusion L-lysine (K)

residues introduced a “Y” joint giving the lipid tails of the carriers an overall

wedge-shaped structure. β-alanine (A) was incorporated on the α-amino group of

60

the lysine and/or histidine residues to alter the distance between the two lipid

tails in an effort to understand the impact on transfection efficiency.

All the spermine-based carriers effectively complexed with pDNA via

charge-charge interactions at N/P ratios ≥ 2 with particle diameters ranging

between 90-130 nm for DNA complexes and 85-120 nm for siRNA complexes

(Figure 2.4B). The hemolytic activity of the carriers at two concentrations was

evaluated at pH 7.4 and 5.5. All carriers exhibited greater hemolytic activity at pH

5.5 compared with 7.4 and also as the concentration was increased from 16 to

40 μM (Figure 2.4C). SKACO demonstrated the most selective pH-sensitive

behavior with the largest increase of hemolytic activity as the pH decreased from

7.4 to 5.5. The incorporation of histidine within the structure again did not

improve the pH-sensitive hemolytic activity. It was observed that carriers with

histidine had lower pH-sensitive hemolytic activity and pDNA transfection

efficiency compared with those corresponding carriers that did not include

histidine (Figure 2.4D). In fact, carriers that included two histidine residues

(SHHKCO and SHHKACO) had even lower pDNA transfection efficiency than

those carriers with only one histidine (SKHCO and SKAHCO). For siRNA

delivery, SKAHCO (N/P 12, 50 nM siRNA) exhibited the highest silencing of

luciferase in U87 cells (84.6 ± 5.5%) (Figure 2.4E). Similarly as with pDNA

delivery, the histidine-containing carriers offered no distinct advantage over

carriers without histidine. The location of the lipid tails also had no clear impact

on the gene silencing efficiency of the spermine-based carriers. Based on these

data, the structural design of effective carriers for nucleic acids were found to be

61

different for pDNA and siRNA, as SKACO demonstrated the highest pDNA

transfection efficiency while SKAHCO had the greatest siRNA-mediated gene

silencing efficiency.

62

Figure 2.4. A) Chemical structures of the spermine-based library of nucleic acid carriers,

B) Particle size of pDNA (top) and siRNA (bottom) complexes at N/P ratio of 12, C)

Hemolytic activity of pDNA complexes formed with spermine-based carriers at N/P ratio

of 12 at pH 7.4 and 5.5. In vitro transfection efficiency of D) pDNA and E) siRNA

complexes at N/P ratio of 12 in U87 cells (163,164).

EHCO was chosen for further development for in vivo delivery due to the

observed high transfection efficiency and low cytotoxicity. Surface modification of

the siRNA nanoparticle surface is necessary for systemic in vivo delivery

applications to impart biocompatibility and avoid non-specific uptake by the

reticuloendothelial system (RES) of the liver and spleen (165,166). Polyethylene

glycol is a polymer commonly incorporated onto the surface, a process called

“PEGylation”, of nanoparticle systems to prolong blood clearance and reduce

non-specific tissue uptake. However, in doing so, PEGylation can also disrupt the

cellular uptake into the target cells (167). To overcome the inhibition of cellular

uptake, targeting ligands can be chemically modified to the distal end of PEG

moieties to restore cell-specific binding and internalization (139). The presence of

thiol groups in EHCO allows for facile and in situ conjugation of cell-specific

ligands to form a targeted siRNA delivery system using simple thiol-maleimide

chemistry (Figure 2.5A).

Bombesin (BN) receptors are found overexpressed on the surface of

various types of cancers, including ovarian and glioblastomas. A bombesin

peptide with high affinity towards BN receptors was used as a targeting ligand.

63

The peptide with a spacer of two 6-aminohexanoic acids was synthesized using

solid-phase chemistry and conjugated to a heterobifunctional NHS-PEG3400-

Maleimide to obtain BN-PEG-Mal. The peptide moiety was then conjugated to

EHCO through reaction of the maleimide group of BN-PEG-Mal with the thiol

groups of EHCO for 30 minutes at 2.5 mol% (168). An mPEG5000-Mal moiety was

used as a non-targeted control. Next, the BN-targeted EHCO/siRNA

nanoparticles were formed by self-assembly of EHCO with siRNA for an

additional 30 minutes through charge-charge complexation, hydrophobic

condensation and autoxidative polymerization.

Figure 2.5. A) Surface functionalization and self-assembly of EHCO to form targeted

siRNA nanoparticles, B) Confocal images of various EHCO/siRNA formulations with

rhodamine-red labelled anti-GFP siRNA to demonstrate (top) GFP silencing efficiency

and (bottom) cellular uptake (168).

Peptide modification of the EHCO/siRNA nanoparticles did not

significantly alter the nanoparticle size but promoted receptor mediated cellular

uptake and gene silencing. The cellular uptake and gene silencing was evaluated

in the Chinese Hamster Ovary (CHO)-d1EGFP cell line engineered to stably

64

express GFP and over-express BN receptors using a rhodamine-red labelled

anti-GFP siRNA (Figure 2.5B). Unmodified EHCO/siRNA nanoparticles were

readily internalized through non-specific interactions between the cationic

nanoparticle and the anionic cell membrane resulting in a strong intracellular red

fluorescent signal and reduced green fluorescence. Modification of EHCO/siRNA

nanoparticles with non-targeted mPEG (2.5 mol%) significantly reduced the

internalization of the nanoparticles and inhibited the gene silencing efficiency due

to a decrease in non-specific interactions with the cellular membrane. Peptide

modification with BN-PEG-Mal (2.5 mol%) to the surface of EHCO/siRNA

nanoparticles promoted robust receptor-mediated endocytosis, cellular

internalization, and gene silencing, as evident by the strong intracellular

rhodamine signal and a significant reduction of GFP signal.

The modification of EHCO/siRNA nanoparticles with targeting peptides

enables systemic in vivo delivery for therapeutic applications. Bombesin- and

RGD-targeted EHCO/siRNA nanoparticles, prepared in a similar manner as

described above, were used to deliver anti-HIF-1α siRNA (2.5 mg/kg) to regulate

tumor hypoxia in nude mice bearing human U87 glioblastoma xenografts (169).

RGD is commonly exploited for use as a targeting peptide due to its high affinity

and specificity towards αvβ3 integrin overexpressed in angiogenic blood vessels

and endothelial cancer cells. Intravenous injection of both BN- and RGD-targeted

EHCO/siRNA nanoparticles (RGD and BN) significantly suppressed tumor

growth in mice when compared to free siRNA (siRNA only) and non-targeted

PEGylated (mPEG) control groups (Figure 2.5A and B). PEI/siRNA complexes

65

were also used as a control group but the treated mice died immediately

following intravenous injection due to the high systemic toxicity of PEI. The

results demonstrate the potential of the peptide targeted EHCO/siRNA delivery

system for systemic therapy against cancer.

Figure 2.6. A) Normalized tumor growth curve and B) normalized tumor volume of mice

treated intravenously with various formulations of targeted (RGD and BN) and non-

targeted (mPEG) EHCO/anti-HIF1α siRNA nanoparticles (169).

EHCO can also be used for direct, local delivery of siRNA. EHCO/siRNA

nanoparticles were injected intracranially using stereotactic injection in an

orthotopic U87-LucNeo xenograft mouse model (170). The ability of

EHCO/siRNA nanoparticles to diffuse into the tissue after injection was evaluated

with a Cy3.5-labeled siRNA. Fluorescent histology revealed that at 5 minutes

following injection the EHCO/siRNA nanoparticles readily permeated throughout

brain tissue. Intratumoral injection of EHCO/siRNA nanoparticles delivering anti-

HIF-1α siRNA (siHIF-1589 or siHIF-1124) showed significantly less tumor growth

66

than the non-specific control groups (siNeg or siGFP) (Figure 2.7A). PEGylated

EHCO/siRNA nanoparticles administered via an osmotic pump significantly

increased the survival of the HIF-1α knockdown group (PEG1589) compared to

the non-specific PEGylated EHCO control (PEGGFP) and non-PEGylated EHCO

(1589) (Figure 2.7B). Knockdown of HIF-1α resulted in robust downregulation of

HIF-1α transcriptional targets, including vascular endothelial growth factor

(VEGF), glucose transporter 1 (GLUT-1), c-MET, and carbonic anhydrase-IX

(CA-IX).

Figure 2.7. A) Normalized average radiance denoting tumor growth in mice injected

intracranially with EHCO formulated with various siRNAs, B) Survival curves of mice

treated with Alzet osmotic pumps delivering various formulations of EHCO/siRNA and

PEGylated EHCO/siRNA nanoparticles (170).

The structure of EHCO was modified further to create two new

multifunctional carriers for nucleic acid delivery with dual histidine residues:

EKHCO and EHHKCO (Figure 2.8A) (171). These two new carriers have the

67

same amino acid residues and lipid tail groups, and only differ in the number and

position of histidine residues and also the distance between the two lipid tails.

Both carriers had increased hemolytic activity at pH 5.5 suggesting that

protonation of the aromatic amines within the imidazole groups of the dual

histidine residues (pKa≈6) contributed to the elevated membrane disruption.

When complexed with siRNA, EKHCO demonstrated higher pH sensitivity

compared with EHHKCO. EHHKCO demonstrated concentration dependent

hemolytic activity at pH 7.4 whereas EKHCO had minimal hemolysis independent

of concentration (Figure 2.8B). EHHKCO mediated superior luciferase silencing

in U87-luc cells compared to EKHCO, presumably due to the higher activity of

membrane destabilization of EHHKCO leading to enhanced endosomal escape

and cytosolic release of siRNA (Figure 2.8C).

Figure 2.8. A) Chemical structure of EKHCO and EHHKCO, B) Concentration-

dependent hemolytic activity at pH 7.4 and 5.5 of EKHCO and EHHKCO at N/P ratio of

12, C) Luciferase silencing efficiency of EKHCO and EHHKCO in U87-luc cells at N/P

ratio of 12 and 20 nM siRNA concentration (171).

68

To further explore how chemical modifications to the EHCO core structure

affect the physicochemical properties and performance of the carrier to deliver

siRNA, a new library of pH-sensitive amphiphilic cationic lipid carriers was

developed (Figure 2.9A) (172). Including EHCO, eight total carriers were

synthesized based on the three domain design framework: 1) a protonable

amino-based head group (E, ethylenediamine; S, spermine); 2) an amino acid-

based linker (C, cysteine; HC, histidine-cysteine); 3) two mono- or di-alkene

unsaturated fatty acid tails (O, oleic acid; Ln, linoleic acid). Two different

chemical scaffolds were incorporated into each of the three domains of the

delivery system to investigate: 1) the effect of the number of amines of the head

group; 2) the degree of unsaturation of the hydrophobic tail domain; and 3) the

role of the protonatable histidine residue of the linker group on RNAi-mediated

silencing efficacy.

Particle diameter decreased as the N/P ratio was increased for each of the

carriers although no trend was observed between carriers with differing head

and/or tail groups. The zeta potential increased as the N/P ratio was increased

for each of the carriers with spermine-based carriers exhibiting a significantly

quicker rise in surface charge at lower N/P ratios. For example, at an N/P ratio of

5, all ethylenediamine-based carriers carried a net anionic surface charge (-14.09

± 1.88 mV to -18.50 ± 2.43 mV) whereas spermine-based carriers were cationic

(24.02 ± 1.07 mV to 27.40 ± 1.25 mV). Spermine-based carriers were also more

efficient at condensing siRNA into nanoparticles compared to carriers containing

ethylenediamine. At an N/P ratio of 10, all carriers exhibited pH-dependent

69

membrane disruption (Figure 2.9B). However, increasing the number of amino

groups in the head domain improved hemolytic activity, even at pH 7.4. These

observations suggest that the two additional amino groups within spermine

enable stronger electrostatic interactions with siRNA and possess enhanced

protonation in acidic environments to facilitate greater membrane disruption.

However, the presence of additional protonable amines of histidine did not

translate to better hemolytic activity for both ethylenediamine and spermine-

based carriers, as those carriers possessing histidine domains exhibited weaker

membrane disruption. For this library of carriers, the incorporation of histidine is

hypothesized to decrease the overall pKa of the cationic carrier thereby reducing

the membrane disrupting ability. A similar observation was made for the

spermine-based library, for which the introduction of histidine groups offered no

distinct advantage (163,164). Accordingly, by altering the number and

composition of amino groups, and thus the overall pKa of the cationic carrier, the

degree of protonation and pH-sensitive behavior can be tuned.

Interestingly, hemolytic activity did not necessarily correlate to gene

silencing efficiency for the newly developed cationic lipid carriers (Figure 2.9C).

In fact, ECO and ECLn were found to have the greatest gene silencing efficiency

in HT29 and CHO cells despite not achieving the highest level of pH-sensitive

hemolysis at all 3 tested pHs. It may be that while spermine-based carriers

exhibited greater hemolysis, the superior ability to condense siRNA may inhibit

the cytosolic release of the siRNA cargo to decrease the silencing efficiency.

Previous work found that for a cationic lipid system the incorporation of two cis

70

double bonds within the hydrocarbon chains was optimal (156), however in our

library, the degree of unsaturation of the lipid tail groups was not found to

significantly affect the gene silencing of the carriers. Also, unlike past studies

which utilize histidine residues to fine-tune the pH sensitivity of gene delivery

systems, the incorporation of these domains reduced hemolysis and gene

silencing efficiency.

Figure 2.9. A) Chemical structures of newly synthesized cationic lipid-based siRNA

carriers, B) pH-dependent hemolytic activities of siRNA carriers formulated at an N/P

ratio of 10 at pHs 7.4, 6.5, and 5.5, C) Luciferase silencing efficiency in HT29-luc cancer

71

cells at 100 nM siRNA concentration for all siRNA carriers formulated at an N/P ratio of

12 (172).

2.6 Concluding Remarks

From the newly designed library, ECO was chosen as the lead

multifunctional carrier for further development due to favorable luciferase

silencing in both cancerous and non-cancerous cell lines. A deeper

understanding and characterization of the relationship of how the

physicochemical properties of ECO/siRNA nanoparticles interplay with their

biological activity will be required. Additionally, exploration into surface

modification strategies to impart biocompatibility and tumor cell specificity will be

required before use in vivo. Reflecting upon the framework proposed by Akinc for

siRNA delivery systems (135), ECO met all the requirements except: i) greater

than two acyl chains and ii) acyl chains between 8 and 12 carbon atoms. Shorter

aliphatic chains ranging from 12 to 14 carbons in length have demonstrated

favorable transfection efficiencies compare to saturated chains greater than 14

carbons due to differences in fluidity. However, as discussed above, systems

with unsaturated chains exhibit superior silencing efficiency compared to

saturated analogues. Therefore, while the proposed framework may provide a

useful guide when developing new siRNA delivery, it should not be used

exclusively. From our experience, the most important parameters for

development of cationic lipid-based delivery systems are carefully tuning of the

pKa of the pH-sensitive, ionizable lipid structure and the ability of the lipid to

induce pH-sensitive membrane disruption.

72

Chapter 3

Multifunctional Cationic Lipid-Based Nanoparticles Facilitate Endosomal

Escape and Reduction-Triggered Cytosolic siRNA Release

Adapted from Molecular Pharmaceutics 2014, Vol. 11, p. 2734-2744

Maneesh Gujrati, Anthony Malamas, Tesia Shin, Erlei Jin, Yunlu Sun, Zheng-Rong Lu

73

3.1 Introduction

Over the past decade, small interfering RNA (siRNA) has been explored

intensely as a promising therapeutic candidate for gene therapy due to its ability

to regulate gene expression through RNA interference (RNAi). RNAi is an

endogenous regulatory mechanism reliant upon siRNA molecules to specifically

target and regulate the expression of a gene through the posttranscriptional

cleavage of the corresponding mRNA (173–175). As siRNA does not interact

with chromosomal DNA, the possibility of adverse gene alterations commonly

encountered with DNA-based gene therapies is greatly reduced. Further, through

the appropriate design of siRNA, it is possible to harness RNAi to silence nearly

any gene, offering a significantly broader therapeutic potential than conventional

small molecule-based therapies. The application of siRNA to exploit the RNAi

regulatory mechanism has revealed a host of new opportunities for the

development of novel therapeutics systems (20). Recently, numerous cancer-

associated genes have been identified, ranging from oncogenes to those genes

responsible for tumor-host interactions and tumor resistance against chemo- and

radiotherapy, positioning cancer as a well-suited candidate for siRNA-mediated

gene therapy (27).

While RNAi holds great potential as a promising therapeutic modality, a

number of extracellular and intracellular obstacles have restrained the

development and translation of RNAi-based technologies into the clinic

(176,177). These challenges include the degradation of naked siRNA within the

bloodstream by endogenous nucleases, low cellular uptake of siRNA due to its

74

anionic nature, immune response to naked siRNA, and rapid clearance by the

RES system, which occurs within minutes of intravenous administration (178).

Initial efforts to improve siRNA delivery relied upon viral delivery systems, as

viruses have been evolutionarily programmed to efficiently deliver their genetic

payload into host cells (179,180). Despite achieving high transfection efficiencies,

viral-based delivery systems often produce adverse immunogenic effects and are

associated with a high cost of production (181). To overcome such challenges,

various non-viral delivery vehicles, including liposomes, polycationic polymers,

conjugates, and cationic lipid-based nanoparticles have been developed (182–

185). These formulations, while achieving varying degrees of success in terms of

transfection efficiency, have encountered additional issues arising from

cytotoxicity, hemotoxicity, nanoparticle aggregation in serum, and poor

intracellular siRNA release from the delivery vehicles, thereby deeming them

unsatisfactory for clinical use (115,185).

As the barriers for siRNA delivery are many, it is important for a delivery

system to be multifunctional and address each of the major challenges. An ideal

siRNA delivery system will incorporate the siRNA payload and protect it from

degradation and clearance, allow for functionalization with targeting ligands to

improve delivery specificity, promote cellular uptake, provide a mechanism to

escape the fate of endosomal-lysosomal degradation and ultimately facilitate the

cytosolic release of the siRNA cargo into the target cells. To further improve the

siRNA delivery capability with these design requirements taken into

consideration, we recently developed a library of pH-sensitive amphiphilic lipid

75

carriers through solid-phase chemistry synthesis based off structural

modifications of a previously validated multifunctional carrier (168,169,172). Each

of the carrier designs was constructed to have three distinct regions of varying

composition: 1) a cationic head group; 2) cysteine-based functionalizable linkers;

and 3) a lipophilic region consisting of geminal lipid tails. We have shown that the

number of amino groups within the head group, the degree of unsaturation of the

lipid tail groups, and the structure and composition of the linker group have a

significant effect on various aspects of the delivery process, including cellular

uptake and gene silencing efficiency (162,172). Among these carriers, ECO ((1-

aminoethyl)iminobis[N-(oleicylcysteinyl-1-amino-ethyl)propionamide]) emerged

as a lead multifunctional carrier for further development because of its

effectiveness for mediating potent gene silencing in both cancerous and non-

cancerous cells (172).

Scheme 3.1. The formation of ECO/siRNA nanoparticles via electrostatic interactions

between the cationic head group and anionic siRNA, auto-oxidation of free thiol groups

76

within the cysteine residues to form disulfide crosslinks, and hydrophobic condensation

of lipid tail groups.

Scheme 3.2. ECO/siRNA nanoparticles facilitate cellular internalization resulting in

trafficking of the nanoparticles into the late endosomes. Within the late endosomes, the

pH-sensitive nature of ECO promotes endosomal escape. Once release into the cytosol,

endogenous glutathione (GSH) mediates reduction of disulfide bonds formed within

ECO/siRNA nanoparticles to release the siRNA cargo. Upon release, free siRNA is able

to initiate RNAi-induced gene silencing.

ECO is a cationic lipid containing three structural components

hypothesized to play a significant role and function: a protonable

ethylenediamine head group, two cysteine-based linker groups, and two oleic

acid lipid tails (Scheme 3.1). The ethylenediamine head group allows for the

electrostatic condensation of siRNA. The geminal oleic acid tails hydrophobically

aggregate in an aqueous environment to further condense the nanoparticles. The

77

free thiol groups of the cysteine residues can be autooxidized into reducible

disulfide linkages to further stabilize the nanoparticles. Additionally, the cysteine

residues can also provide a means to functionalize the carrier with targeting

moieties and/or biocompatible polymers, e.g. polyethylene glycol (PEG), to

improve biocompatibility and target–specific delivery (169). Finally, the structure

possesses pH-sensitive amphiphilicity, an essential ability for disrupting the

membrane of endosomal and lysosomal compartments to promote escape and

avoid degradation of the siRNA cargo within the acidic environment. Upon

successful escape, the disulfide bonds within the nanoparticle backbone are

designed to facilitate the release of siRNA in the reductive environment of the

cytosol (Scheme 3.2).

Herein, we report a comprehensive evaluation of the multifunctional

properties of ECO as a carrier for effective intracellular siRNA delivery.

ECO/siRNA nanoparticles were formed and characterized over a range of N/P

ratios. The physicochemical properties of the ECO/siRNA nanoparticles,

including serum stability, pH-sensitivity, and bio-reducibility, were determined in

correlation with intracellular siRNA delivery and gene silencing efficiency.

Further, the process of endosomal escape and mechanism of intracellular siRNA

release following cellular uptake of ECO/siRNA nanoparticles was investigated in

order to understand their gene silencing ability in U87 glioblastoma cancer cells.

The response to environmental stimulus, coupled with the superior gene

silencing and serum stability, is of particular interest and utility in overcoming the

delivery barriers against nanoparticle-mediated gene therapy.

78

3.2 Materials and Methods

3.2.1 Synthesis of (1-aminoethyl)iminobis[N-(oleicylcysteinyl-1-amino-

ethyl)propionamide]

The synthesis of (1-aminoethyl)imino-bis[N-(oleicyl-cysteinyl-1-

aminoethyl)propionamide] (ECO) was done by liquid-phase chemistry and is

described in full in the Appendix. The reaction scheme can be seen in Figure 1.

The ethylenediamine head group was synthesized first followed by the

cysteine/oleic acid tail groups. Once these two groups were synthesized they

were reacted together to arrive at the final ECO product. Each reaction

intermediate was confirmed through 1H NMR and Maldi-TOF (see Appendix).

3.2.2 Preparation of ECO/siRNA Nanoparticles

ECO/siRNA nanoparticles were prepared at N/P ratios between 6 and 20. ECO

and siRNA were diluted into equal volumes in nuclease-free water from stock

solutions of 2.5 mM in ethanol and 18.8 μM in nuclease-free water, respectively.

The equal volumes of ECO and siRNA were mixed followed by a 30-minute

incubation period at room temperature under gentle agitation.

3.2.3 Nanoparticle Characterization

The size and zeta potential of the ECO/siRNA nanoparticles at different N/P

ratios in PBS was determined by dynamic light scattering with a Brookhaven

ZetaPALS Particle Size and Zeta Potential Analyzer (Brookhaven Instruments).

Zeta potential measurements were repeated for nanoparticles incubated for 30

minutes in serum free, 10% and 50% serum media. To determine the pH-

sensitivity of ECO, ECO/siRNA nanoparticles were formulated and incubated in

79

PBS solutions at pH 7.4, 6.5, or 5.4 for 30 minutes prior to zeta potential

measurement.

3.2.4 Entrapment Efficiency

A Ribogreen assay (Molecular Probes) was used to quantify the entrapment

efficiency of siRNA within the ECO/siRNA nanoparticles (186). ECO/siRNA

nanoparticles were prepared at various N/P ratios at a final siRNA concentration

of 120 nM. Free siRNA following particle formation was detected using a

SpectraMax microplate reader (Molecular Devices) with an excitation of 500 nm

and emission of 525 nm. The entrapment efficiency of ECO/siRNA nanoparticles

was calculated in reference to a linear standard curve by dividing the complexed

siRNA concentration by the initial siRNA concentration and multiplying by 100%.

3.2.5 Heparin Displacement Assay

ECO/siRNA nanoparticles were prepared at an N/P ratio of 20 at a final siRNA

concentration of 120 nM and incubated for 30 minutes at 37⁰C with heparin

solutions of varying concentrations based on heparin/siRNA (w/w) ratio, ie. 0, 1,

2.5, 5. Following the incubation period, each sample, after the addition of loading

dye, was run on a 1% agarose gel containing ethidium bromide at 100 V for 25

minutes.

3.2.6 Gel Electrophoresis for siRNA Loading, Serum Protection, and

Glutathione-Mediated Nanoparticle Reduction

The ability of ECO to complex and condense siRNA was assessed by gel

electrophoresis. ECO/siRNA nanoparticles were prepared and 15 μL aliquots

mixed with 3 μL of loading dye (Promega) were loaded onto a 1% agarose gel

80

containing ethidium bromide. The gel was submerged in 0.5X Tris/Borate/EDTA

(TBE) buffer and run at 100 V for 25 minutes. Free siRNA was run as the control.

SiRNA bands were visualized using an AlphaImager ultraviolet imaging system

(Biosciences). For siRNA loading, ECO/siRNA complexes were prepared at N/P

ratios between 6 and 20 and run on the gel as described above. For the

assessment of glutathione-mediated nanoparticle reduction, ECO/siRNA

nanoparticles were incubated with 1 hour at 37°C in the presence of 5 mM

glutathione (GSH) (Sigma Aldrich). Following incubation, samples were loaded

onto a 1% agarose gel containing ethidium bromide and run in the same manner

as described. Serum protection of siRNA by the complexes was assessed by

incubation ECO/siRNA complexes in 50% serum at 37°C for 0.5, 1, 6, or 24

hours. At each intermittent time point, aliquots were taken and stored at -80°C.

After the final aliquot was taken at 24 hours, samples were incubated for 30

minutes with heparin at a heparin/siRNA (w/w) ratio of 5 to release the

complexed siRNA cargo and each sample was loaded on the 1% agarose gel

and run as described above. Free siRNA was also incubated in 50% serum for

0.5, 1, 6, or 24 hours and stored and run on the gel in a similar manner.

3.2.7 Cell Culture

Human glioblastoma U87 cells expressing a luciferase reporter enzyme (U87-

Luc) were obtained from ATCC (American Type Culture Collection) and cultured

in Dulbecco’s modified Eagle’s media (Invitrogen) and supplemented with 10%

fetal bovine serum (Invitrogen), 100 μg/mL streptomycin, and 100 unites/mL

penicillin (Invitrogen). The cells were maintained in a humidified incubator at

81

37⁰C and 5% CO2.

3.2.8 In Vitro Transfection Efficiency

U87-Luc cells were seeded in 24-well plates at a density of 2 x 104 cells and

allowed to grow for 24 hours. Transfections were carried out in serum-containing

(10% or 50% FBS) and serum free media with 40 nM anti-luciferase siRNA

concentration (Dharmacon: sense sequence: 5’-

CUUACGCUGAGUACUUCGAdTdT-3’, anti-sense sequence: 5’-

UCGAAGUACUCAGCGUAAGdTdT-3’). Following a 4 hour transfection period,

the media was replaced with fresh serum-containing media and the cells

continued to grow for an additional 72 hours. At 72 hours, the cells were rinsed

twice with PBS and lysed using the reporter lysis buffered provided in the

Promega Luciferase Assay kit. Following lysis, the cells were centrifuged at

10,000 g for 5 minutes and 20 μL cell lysate was transferred to a 96-well plate.

To quantify luciferase expression, 100 μL Luciferase Assay Reagent was added

to each well and the luminescence was read using a SpectraMax microplate

reader (Molecular Devices). Luciferase activity was normalized to the total

protein content measured from the cell lysate of each well using the BCA assay

(Thermo Scientific). Data was presented relative to the control, which received no

siRNA treatment. Lipofectamine RNAiMAX was used as a positive control and

was prepared per the manufacturer’s protocol (Life Technologies).

3.2.9 Cytotoxicity

U87 were transfected in 10% serum media with ECO/siRNA nanoparticles at an

siRNA concentration of 40 nM in a 96-well plate with a seeding density of 1 x 104

82

cells. After 48 hours, the MTT reagent (Invitrogen) was added to the cells for 4

hours followed by the addition of SDS-HCl and further incubation for 4 hours. The

absorbance of each well was measured at 570 nm using a SpectraMax

spectrophotometer (Molecular Devices). Cellular viability was calculated as the

average of the set of triplicates for each N/P ratio and was normalized relative to

the no treatment control.

3.2.10 Flow Cytometry for Nanoparticle Cellular Uptake and Uptake Kinetics

Measurements

Cellular uptake and intracellular delivery of ECO/siRNA nanoparticles was

evaluated quantitatively with flow cytometry. ECO/siRNA nanoparticles were

prepared with 40 nM AlexaFluor488-labelled siRNA (Qiagen). Approximately 2.5

x 104 U87 cells were seeded onto 12-well plates and grown for an additional 24

hours. The cells were transfected with ECO/siRNA nanoparticles in serum free,

10% or 50% serum media. After 4 hours, the transfection media was removed

and each well was washed twice with PBS. The cells were harvested by

treatment with 0.25% trypsin containing 0.26 mM EDTA, (Invitrogen) collected by

centrifugation at 1000 rpm for 5 min, resuspended in 500 μL of PBS containing

5% paraformaldehyde, and finally passed through a 35μm cell strainer (BD

Biosciences). Cellular internalization of ECO/siRNA nanoparticles was quantified

by the fluorescence intensity measurement of Alexa Fluor 488 fluorescence for a

total of 10,000 cells per each sample using a BD FACSCalibur flow cytometer.

Each N/P ratio was conducted in triplicate and the data presented represents the

mean fluorescence intensity and standard deviation.

83

Nanoparticle uptake kinetics was measured in a similar setup as

described above. ECO/siRNA nanoparticles were formulated with 40 nM Alexa

Fluor 488-labelled siRNA at an N/P ratio of 10. U87 cells were seeded in 24-well

plates at a density of 2 x 104 cells and allowed to grow for 24 hours.

Nanoparticles were administered in serum free, 10% or 50% serum media.

Nanoparticle uptake was measured at various time points up to 4 hours post-

transfection. At each time point, the cells were washed twice with PBS,

trypsinized, collected and fixed with 5% paraformaldehyde in PBS before

quantification of Alexa Fluor 488 fluorescence using a BD FACSCalibur flow

cytometer. The mean fluorescence of 10,000 cells was quantified for each

replica. Data presented represents the mean and standard deviation of three

replicas for each time point.

3.2.11 Protein Adsorption

ECO/siRNA nanoparticles were formulated at an N/P ratio of 10. To

quantify BSA protein adsorption, 500 μL of nanoparticle solution and 500 μL of

BSA solution at varying concentrations were added together, stirred and

incubated for 1 hour at 37⁰C. Nanoparticles were prepared such that the final

amine concentration for each condition was 150 μM. Serial dilutions of a stock

BSA solution (4 mg/mL) were carried out to achieve the various protein

concentrations: 2 mg/mL, 1 mg/mL, 0.5 mg/mL, 0.25 mg/mL, 0.125 mg/mL.

Following incubation, the ECO/siRNA nanoparticles were centrifuged at 10,000 g

for 20 minutes. The concentration of BSA was determined from the supernatant

using UV-vis spectroscopy on a SpectraMax spectrophotometer (Molecular

84

Devices) at 280 nm. A linear calibration curve from predetermined BSA

concentrations was used. Relative BSA adsorption was calculated by dividing the

amount of protein adsorbed for each BSA incubation concentration by the

amount of protein adsorbed for 0.125 mg/mL BSA.

3.2.12 pH-Dependent Membrane Disruption Hemolysis Measurement

The hemolytic activity was measured to determine the membrane-disruptive

ability of ECO/siRNA nanoparticles at pH levels corresponding to various stages

of intracellular trafficking. Red blood cells (RBCs) isolated from rats (Innovative

Research Inc.) were diluted 1:50 in PBS solutions at pH 7.4, 6.5, and 5.4.

ECO/siRNA nanoparticles were prepared at a volume of 100 μL and incubated

with an equal volume of the various RBC solutions in a 96-well plate at 37⁰C for 2

hours. Nanoparticles were prepared such that the final amine concentration for

each pH condition was 150 μM. Following incubation, samples were centrifuged

and the absorbance of the supernatants was determined at 540 nm. Hemolytic

activity was calculated relative to the hemolytic activity of 1% Triton X-100

(Sigma Aldrich), a non-ionic surfactant. Each pH was conducted in triplicate and

the data presented represents the mean and standard deviation.

3.2.13 Inhibition of Glutathione-Dependent Reduction with BSO

Intracellular glutathione (GSH) was depleted in order to establish the role of

cytosolic reduction of ECO/siRNA nanoparticles on gene silencing. U87 cells

were plated and prepared in the same manner as during transfection studies.

The cells were incubated overnight with 200 μM buthionine-sulfoximine (BSO)

obtained from Sigma Aldrich prior to transfection, which was carried out as

85

describe earlier with an N/P ratio of 10 and an anti-luciferase siRNA

concentration of 40 nM. Luciferase expression was quantified with a luciferase

assay and normalized with a BCA assay 48 hours post-transfection as described

above.

3.2.14 Confocal Microscopy of Cellular Uptake of ECO/siRNA Nanoparticles

and Intracellular Release of siRNA

Live cell confocal microscopy was used to assess the cellular uptake and

intracellular release of siRNA. Approximately 1 x 105 U87 cells were seeded onto

glass-bottom micro-well dishes. After 24 hours, the cells were stained with 5

µg/mL Hoechst 33342 (Invitrogen) and treated with ECO/siRNA nanoparticles in

10% serum media. Nanoparticles were formed at an N/P ratio of 10 and a 20 nM

siRNA concentration with an Alexa Fluor 488-labelled siRNA. Images were taken

using an Olympus FV1000 confocal microscope for up to 72 hours while the cells

were housed in a humidified weather station under 5% CO2.

3.2.15 Immunofluorescence of Intracellular Trafficking of ECO/siRNA

Nanoparticles

Following transfection with ECO/siRNA particles containing Alexa Fluor 647-

labelled siRNA (Qiagen), U87 cells were fixed at various time points with 4%

formaldehyde for 30 min at room temperature and permeabilized with 0.1%

Triton-X 100 (in PBS) for 5 minutes at room temperature. Cells were then

incubated in blocking buffer (2% BSA in PBS) for 1 hour. The primary antibody,

rabbit anti-Lysosomal-associated membrane protein 1 (LAMP1) (Abcam), was

added at 1μg/mL in blocking buffer and incubated at room temperature for 1

86

hour. The secondary antibody, Alexa Fluor 488 goat anti-rabbit IgG (Life

Technologies), was used at a 1:1000 dilution for 1 hour. Samples were

thoroughly washed with PBS and imaged using an Olympus FV1000 confocal

microscope.

3.2.16 Statistical Analysis

Experiments were performed in triplicate and presented as the mean and

standard deviation. Statistical analysis was conducted with ANOVA and two-

tailed Student’s t-tests using a 95% confidence interval. Statistical significance

was established only when p < 0.05.

3.3 Results and Discussion

3.3.1. Effect of N/P ratio on the physicochemical properties of ECO/siRNA

nanoparticles

The physicochemical properties of siRNA nanoparticles can have a direct

impact on the efficacy of intracellular siRNA delivery and gene silencing of the

delivery system (67,187,188). The understanding of these physicochemical

properties, including particle size, surface zeta potential, siRNA entrapment and

particle stability, in correlation with the intracellular siRNA delivery and gene

silencing efficiency is crucial for formulating a safe and effective siRNA delivery

system suitable for clinical development (189). The physicochemical properties

can be tailored based on the ratio of cationic and anionic charge (N/P ratio)

within the ECO/siRNA nanoparticles. The impact of N/P ratio on these

parameters was investigated for ECO/siRNA nanoparticles between an N/P ratio

of 6 and an N/P ratio of 20.

87

Figure 3.1. Physicochemical evaluation of ECO/siRNA nanoparticles. a) Effect of N/P

ratio on mean particle diameter and surface charge. b) siRNA entrapment within

nanoparticles determined by RiboGreen RNA quantitation assay over a range of N/P

ratios. c) Agarose gel retardation of ECO/siRNA nanoparticles compared to free siRNA

over a range of N/P ratios. d) Heparin displacement assay. ECO/siRNA nanoparticles

were prepared at N/P ratio of 20 and incubated for 30 minutes at 37⁰C with varying

amounts of heparin, based on heparin/siRNA (w/w) ratio.

The particle size of ECO/siRNA nanoparticles decreased while their zeta

potential increased as the N/P ratio increased (Figure 3.1a). The ability of ECO

to complex and entrap siRNA increased as a function of N/P ratio, from 82.1 ±

4.3 % at N/P=6 to 98.7 ± 5.0 % at N/P=20, as demonstrated by a RiboGreen

fluorescence-based assay (Figure 3.1b). The complexation of ECO with siRNA

88

was further validated through an agarose gel retardation assay (Figure 3.1c).

Compared to naked siRNA, a decrease in particle-bound siRNA migration as the

N/P ratio increased was observed. At an N/P ratio ≥ 14, the complexed siRNA

was completely prevented from migrating through the gel indicating that the

interactions between ECO and siRNA were strong enough to resist dissociation

during electrophoresis. Interestingly, at an N/P ratio ≥ 18, no siRNA signal was

observed in the loading well, suggesting that the negatively charged siRNA was

completely neutralized as ethidium bromide was not able to intercalate (190).

Some cationic polymers with high charge density, such as PEI, can form

inseparable complexes with siRNA such that the siRNA cargo cannot be

released once internalized into the cytosol (191). Therefore, it is important that

the interactions between the siRNA and carrier be stable during cellular uptake

but do not impede the cytosolic release of the siRNA. To study the electrostatic

interaction of the siRNA with ECO, ECO/siRNA nanoparticles were subject to

heparin displacement. Heparin is an anionic polysaccharide and a major

component of extracellular matrix that can compete with siRNA for binding to

disrupt ECO/siRNA complex stability (192). No decomplexation of siRNA from

the nanoparticles occurred at heparin/siRNA (w/w) ratio of 1. Partial

decomplexation of siRNA from the ECO/siRNA nanoparticles, as determined by

siRNA release on an agarose gel, occurred at heparin/siRNA (w/w) ratio of 2.5

while full decomplexation was observed at a ratio of 5 (Figure 3.1d).

These results suggest that the N/P ratio plays an essential role in

regulating size, charge, and ability of the ECO lipid carrier to complex siRNA into

89

stable nanoparticles. While particle size decreases, increasing the N/P ratio will

increase the zeta potential. Increased concentrations of amino groups enhance

the ability of ECO to condense the siRNA cargo by facilitating stronger ionic

interactions and compact particle formation.

3.3.2. Effect of N/P ratio on the biological properties of ECO/siRNA

nanoparticles

The N/P ratio significantly influences the physicochemical parameters of

ECO/siRNA nanoparticles, which can in turn influence the biological properties

and activity of the nanoparticles. The effect of the N/P ratio on the cellular

uptake, gene silencing and cytotoxicity of the siRNA nanoparticles was

investigated in vitro with U87 glioblastoma cells expressing a luciferase reporter

gene (U87-Luc). Cellular uptake of ECO/siRNA nanoparticles was determined

using an Alexa Fluor 488-labeled siRNA with flow cytometry in serum-free, 10%

serum, and 50% serum media (Figure 3.2a). Cellular uptake was found to

increase in an N/P ratio-dependent manner for all transfection conditions. Under

serum free conditions, Lipofectamine RNAiMAX (Lipofect.) mediated higher

cellular uptake than ECO for all N/P ratios. However, for 10% and 50% serum

conditions, ECO/siRNA nanoparticles at an N/P of 20 had enhanced cellular

uptake compared to Lipofectamine. A significant reduction in cellular uptake was

observed in 10% and 50% serum media for N/P ratios ≤ 12 when compared to

serum free media (p<0.05). At N/P ≥ 14, cellular uptake in all three transfection

conditions was not significantly different. As shown in the above study, high N/P

ratios resulted in an increase in both surface zeta potential and stability of the

90

nanoparticles (Figure 3.1). It is thought that the positive surface charge

facilitated stronger interaction with the cells, and consequently, higher cellular

uptake at these N/P ratios. Improved nanoparticle stability might also be

responsible for competent cellular uptake at high N/P ratios in serum media.

Figure 3.2. Biological activity of ECO/siRNA nanoparticles in U87 Glioblastoma cells. a)

Cellular uptake quantified by flow cytometry for ECO/siRNA nanoparticles containing an

Alexa Fluor 488-labelled siRNA in serum free (SFM), 10% serum media (10% SM), and

50% serum media (50% SM). Cellular uptake was found to be significantly higher in

SFM for N/P ratios ≤ 12 (p<0.05). b) Luciferase silencing efficiency of ECO/siRNA

nanoparticles after 72 hours in serum free media, 10% and 50% serum media at 40 nM

siRNA compared to Lipofectamine RNAiMAX (Lipofect.). Quantified using a luciferase

assay and normalized with a BCA assay. c) Cell viability assessed with an MTT assay in

10% serum media for ECO/siRNA nanoparticles.

The gene silencing efficiency of ECO/siRNA nanoparticles was

determined in U87-Luc cells using an anti-luciferase siRNA at 72 hours post-

transfection in serum free, 10% and 50% serum transfection conditions. At a 40

91

nM siRNA concentration, gene silencing was dependent upon the N/P ratio,

although this trend was more evident in the presence of serum (Figure 3.2b).

High gene silencing efficiency was observed for the nanoparticles throughout the

N/P ratio range in serum free media: luciferase expression was inhibited to 7.2 ±

3.4 % for N/P=6 and 3.7 ± 3.3 % for N/P=20 at 72 hours post-transfection. In the

presence of 10% serum, luciferase silencing increased in an N/P dependent

manner from 38.41 ± 8.19 % luciferase expression for N/P=6 to 1.91 ± 0.97 %

luciferase expression for N/P=20 at 72 hours. Similarly for 50% serum, luciferase

silencing was less efficient for N/P ratios between 6 and 12 but was comparable

to serum free and 10% serum for N/P > 12. At N/P ≥ 10, ECO/siRNA

nanoparticles matched or exceeded the performance of Lipofectamine RNAiMAX

in their respective transfection conditions. It is interesting to note that in serum

free media, ECO/siRNA nanoparticles were equally as efficient at silencing

luciferase for N/P=6 as they were for N/P=20 despite a 4-fold difference in

cellular uptake. One possible explanation may be that the RNAi machinery

becomes saturated beyond a certain intracellular siRNA concentration (193,194).

Alternatively, it has been suggested that the efficiency of siRNA delivery via lipid

nanoparticles is limited by endocytic recycling, in which the siRNA nanoparticles

within the endocytic vesicles are expelled from the cytosol back into the

extracellular environment (144). For transfection conditions containing serum,

gene silencing efficiency correlated with cellular uptake due to significantly lower

cellular uptake at low N/P ratios compared to the serum free transfection

condition.

92

While a higher N/P ratio led to improved cellular uptake and gene

silencing, unwanted cytotoxic effects may arise as a result and should therefore

be monitored closely to ensure complete safety of a delivery system. The

cytotoxicity of the ECO carrier was evaluated using an MTT assay (Figure 3.2c).

Cell viability was evaluated 48 hours post-transfection and was found to

gradually decrease as the N/P ratio increased. Cell viability was especially

compromised at N/P > 14, which may be a result of increased positive charge

densities at high N/P ratios (195). Importantly, the overall viability of those cells

treated with ECO/siRNA nanoparticles at all N/P ratios remained higher than

those treated with Lipofectamine RNAiMAX.

Increased cellular uptake may be a direct consequence of the zeta

potential promoting interactions with the negatively charged cell membrane at

high N/P ratios. However, increased zeta potential will negatively influence the

biocompatibility of the delivery system. Additionally, low N/P ratios are not as

efficient at inducing gene silencing in the presence of serum which may be in part

contributed to reduced cellular uptake when compared to higher N/P ratios, but

also due to their lower siRNA entrapment efficiency and lower stabilities. In an

effort to optimize transfection conditions to maximize gene silencing while

minimizing cytotoxic effects in U87 glioblastoma cells, an N/P ratio of 10

appeared to be the best formulation of the ECO/siRNA nanoparticles and was

chosen for further studies. At an N/P of 10, ECO/siRNA nanoparticles averaged

112 nm in diameter, had a zeta potential of +18.2 mV, and silenced luciferase to

6.6% at 72 hours in 10% serum media while maintaining good cell viability.

93

3.3.3. ECO/siRNA nanoparticles protect siRNA and promote cellular uptake

in the presence of serum proteins

Serum proteins may lead to dissociation of the siRNA nanoparticles, and

premature release and degradation of siRNA (196). To address the question of

nanoparticle stability and siRNA protection from nuclease degradation, free

siRNA and ECO/siRNA nanoparticles (N/P=10) were incubated in PBS

containing 50% fetal bovine serum at 37 ⁰C for up to 24 hours. The agarose gel

chromatogram of the siRNA in both formulations at various time points of the

incubation revealed that free siRNA was prone to degradation within the first 30

minutes, and completely degraded by 6 hours, while siRNA within the

ECO/siRNA nanoparticles was preserved for at least 24 hours (Figure 3.3a). The

result suggests that ECO is able to sufficiently complex and pack siRNA into

stable nanoparticles such to protect the siRNA from enzymatic degradation in

serum.

Non-specific interaction of serum proteins with the ECO/siRNA

nanoparticles may also hinder membrane adsorption, block cellular entry, and

diminish the transfection efficiency, as has been demonstrated previously with

lipid-based nanoparticles (197,198). The kinetics of cellular uptake of

nanoparticles complexed with an Alexa Fluor 488-labelled siRNA was monitored

over the course of 4 hours in serum free, 10% and 50% serum media. While the

nanoparticle uptake is clearly higher in serum free media than in 10% and 50%

serum media (p<0.05), the cellular uptake under all transfection conditions

exhibits a similar biphasic trend (Figure 3.3b). This biphasic behavior has been

94

speculated to originate from an initial period where nanoparticles adhere to the

outer cell membrane before undergoing cellular entry and internalization (199).

Initial membrane adhesion is associated with slow nanoparticle internalization

until a steady state is achieved with a balanced rate of nanoparticle membrane

adhesion and internalization (200). The lower siRNA-associated fluorescence

signal observed in serum media was not due to siRNA degradation as the ECO

nanoparticles were effective in protecting the cargo siRNA (Figure 3.3a). The

difference in cellular uptake may then be in part due to the non-specific

interaction of serum proteins with nanoparticles and the consequent reduction of

zeta potential, diminishing the ability of the nanoparticles to adhere to the outer

cellular membrane and to undergo cellular internalization. This was confirmed

(Figure 3.3c) by the observation that ECO/siRNA nanoparticles had a reduced

zeta potential in 10% and 50% serum media compared to serum free media

(p<0.05). Cellular uptake and zeta potential was not found to be significantly

different between 10% and 50% serum transfection conditions suggesting that

serum protein binding to the ECO nanoparticles may reach a point of saturation.

To determine this, the binding of bovine serum albumin (BSA), the major protein

constituent of fetal bovine serum, to ECO/siRNA nanoparticles was quantified

following incubation over a range of BSA concentrations (Figure 3.3d). Indeed a

saturation point of BSA adsorption was observed for BSA concentrations ≥ 0.25

mg/ml.

95

Figure 3.3. a) Susceptibility to serum-degradation of free or complexed siRNA within

ECO nanoparticles. Samples were incubated in 50% serum for 0.5, 1, 6 and 24 hours.

Glutathione (5mM) was used to release complexed siRNA from ECO and the integrity of

siRNA cargo was evaluated with an agarose gel electrophoresis assay. b) Kinetics of

nanoparticle uptake with Alexa Fluor 488-labelled ECO/siRNA nanoparticles in U87 cells

in serum free (SFM), 10% and 50% serum media (10% SM and 50% SM). Levels of

96

cellular uptake of nanoparticles in SFM were found to be significantly higher than in 10%

and 50% SM for all time points (p<0.05). c) ECO/siRNA nanoparticles were formulated

at an N/P of 10 and the zeta potential was evaluated following incubation in either serum

free, 10%, or 50% serum media. Zeta potential of nanoparticles was found to be

significantly diminished by the presence of serum (p<0.05). d) Relative adsorption of

bovine serum albumin (BSA) to the ECO/siRNA nanoparticles after 1 hour incubation at

37⁰C as a function of BSA incubation concentration. e) Live-cell confocal imaging of

cellular uptake of ECO/siRNA nanoparticles in U87 cells and cytosolic distribution of

Alexa Fluor 488-labelled siRNA in 10% serum media. A dispersed siRNA-based

fluorescent signal is present 4 hours post-transfection and remains upwards of 72 hours.

The cellular uptake of ECO/siRNA nanoparticles in the presence of serum

was further investigated with confocal microscopy using an Alexa Fluor 488-

labeled siRNA (Figure 3.3e). Intracellular internalization and dispersed cytosolic

siRNA distribution was observed as early as 4 hours post-transfection. In

accordance with the observed sustained luciferase silencing (Figure 2b), the

dispersed signal intensity increased over time and persisted at least 72 hours

post-transfection. From these images, it is clear that even with a reduced zeta

potential, ECO/siRNA nanoparticles were effectively taken up by the cells in

serum and siRNA was released into the cytosol.

3.3.4. ECO/siRNA nanoparticles are pH-sensitive and promote endosomal

escape

Following successful internalization, one of the most crucial events for

effective intracellular siRNA delivery is the escape from the endosomal-

97

lysosomal pathway (201). It is imperative for the carrier to promote the escape

from such pathways for the purpose that siRNA must be available within the

cytosol to initiate RNAi. If the siRNA nanoparticles remain in these transport

vesicles, they will be at risk to lysosomal degradation (142). It has been proposed

that the multifunctional nanoparticles are able to escape endosomal-lysosomal

pathways with their ability to disrupt the membrane of the acidic endosomes and

lysosomes in a pH-sensitive manner (172,202). To validate this hypothesis, the

zeta potential and membrane disruption ability of ECO/siRNA nanoparticles at pH

levels of the extracellular (7.4) and endosomal and lysosomal environments (6.5

and 5.4) was studied. As the pH level decreased and became more acidic, amine

groups within the cationic head group of ECO become protonated and

consequently the zeta potential increased from 18.1 mV at pH=7.4, to 32.4 mV at

pH=6.5, to 49.5 mV at pH=5.4 (Figure 3.4a). The relative hemolytic activity of

ECO/siRNA nanoparticles in rat blood cells (RBCs), normalized to the hemolytic

activity of 1% Triton-X-100, was found to increase with acidity in a similar manner

through which maturing endocytic vesicles are acidified (Figure 3.4a). Hemolysis

of 48.5 ± 6.2 % at pH of 6.5 and 89.2 ± 5.4 % at pH of 5.4 demonstrated the

ability of these nanoparticles to interact with the membrane of late endosomes

and/or lysosomes in response to the pH changes. The low hemolytic activity of

ECO/siRNA nanoparticles at pH of 7.4 (12.5 ± 3.5 %) is consistent with the

observation that ECO/siRNA nanoparticles elicit a low cytotoxic effect on cells, as

minimal membrane disruption was observed.

98

Figure 3.4. a) Zeta potential measurements following incubation in PBS at various pH

levels demonstrate the pH-sensitivity of the ECO/siRNA nanoparticle. The zeta potential

was found to increase with increasing acidity. Hemolytic assay determined the pH-

dependent membrane-disruptive ability of ECO/siRNA nanoparticles increased

significantly (p < 0.05) with increasing acidity (pH= 7.4, 6.5, 5.4). Relative hemolytic

activity calculated with respect to the hemolytic activity of 1% Triton-X-100. b)

Immunofluorescence using an LAMP1-antibody (Alexa Fluor 488-labelled secondary

antibody) to stain for late endosomes reveals co-localization of ECO/siRNA (Alexa Fluor

647-labelled siRNA) nanoparticles occurs 2 hours post-transfection. At 4 hours, a

dispersed siRNA signal is present within the cytosol indicating that ECO/siRNA

nanoparticles are able to escape from late endosomes and release the siRNA cargo.

Intracellular trafficking of ECO/siRNA nanoparticles was further

determined using fluorescence confocal microscopy based on the localization of

an Alexa Fluor 647-labeled siRNA in respect to a specific marker for late

99

endosomes and lysosomes (anti-LAMP1). As shown, the ECO/siRNA

nanoparticles began interacting with the cell membrane with no visible co-

localization with LAMP1-stained vesicles within the first 5 minutes of transfection

(Figure 3.4b). At 30 minutes, areas of co-localization of nanoparticles and late

endosomes arose and co-localization increased at 2 hours, where the majority of

the siRNA-based fluorescent signal is coalescent with the vesicles that are

characteristic for late endosomes. By 4 hours, a dispersed siRNA signal

distribution appeared and the co-localization of the siRNA with LAMP1 was

diminished. This data suggests that the ECO/siRNA nanoparticles were trafficked

through the endosomal-lysosomal pathway to the late endosomes, whereupon

they were able to escape from the vesicles to release their cargo in the cytosol.

Although the exact pathways responsible for internalization and trafficking of the

nanoparticles have yet to be explored and defined, it has recently been

suggested that most nano-sized particles are trafficked to the lysosomes

regardless of their method of endocytosis (203). The result here suggests that,

irrespective of the endocytic pathway, the multifunctional carrier ECO can

promote effective early escape in the endosomal-lysosomal pathway, a key

feature responsible for its success in inducing gene silencing.

3.3.5. Cytosolic reduction of ECO/siRNA nanoparticles is crucial for siRNA

release and RNAi activity

Once escaped from the endosomal-lysosomal pathway, the final step of

the multi-stage process of intracellular siRNA delivery is to ensure the cytosolic

release of the siRNA cargo whereupon it will be available to bind to the RNA

100

induced silencing complex (RISC) and initiate RNAi. During nanoparticle

formation, the ECO/siRNA nanoparticles are stabilized by disulfide bonds. The

cleavage of these linkages within the reductive cytosolic environment, via

disulfide-thiol exchange initiated by endogenous glutathione, can facilitate the

release of the complexed siRNA (204,205). This bio-reducible functionality of

ECO was demonstrated by incubating nanoparticles at the physiological

concentration of glutathione (5 mM) for 1 hour at 37⁰C. Agarose gel

electrophoresis was used to evaluate whether the siRNA cargo could be

released in the presence of the reducing agent. In the absence of glutathione,

ECO successfully condensed siRNA into nanoparticles while in the presence of

glutathione, the siRNA cargo disassociated from the nanoparticles, indicating that

disulfide reduction by glutathione was sufficient to unpack the ECO/siRNA

nanoparticles (Figure 3.5a).

101

Figure 3.5. a) Sensitivity of ECO/siRNA nanoparticles to reduction by endogenous

levels of glutathione (GSH). Nanoparticles were incubated in the presence of 5 mM GSH

for 1 hour at 37⁰C. Release of complexed siRNA was evaluated with an agarose gel

electrophoresis assay. b) The ability of ECO/siRNA nanoparticles to induce luciferase

silencing is inhibited by the pre-treatment of U87 cells with BSO for 24 hours prior to

transfection (p < 0.05). c) Confocal imaging of cytosolic distribution of Alexa Fluor 488-

labelled siRNA in U87 cells 4 hours post-transfection. Compared to no treatment (left),

pre-treatment with BSO for 24 hours (right) reduced cytosolic distribution of siRNA

through inhibition of glutathione-mediated nanoparticle reduction.

To further demonstrate the significance of glutathione-dependent

reduction of the nanoparticles for cytosolic release of siRNA and RNAi activity,

102

U87-Luc cells were treated with buthionine sulfoximine (BSO) prior to

transfection with ECO/siRNA nanoparticles. BSO was implemented to deplete

intracellular glutathione by inhibiting γ-glutamylcystein synthetase, the enzyme

required to initiate glutathione synthesis (206,207). The ability of ECO/siRNA

nanoparticles to silence luciferase expression was significantly inhibited by the

BSO treatment (Figure 3.5b). Confocal microscopy further revealed that pre-

treatment of U87-Luc cells with BSO prevented the dispersed cytosolic

distribution of siRNA 4 hours post-transfection (Figure 3.5c). Unlike the

dispersed siRNA-associated fluorescence observed in the cytosol of untreated

cells (left), the fluorescence signal of the labeled siRNA in BSO-treated cells

remained punctate, indicative of intact nanoparticles (right). The result

demonstrate that the intracellular reduction of the nanoparticle, the final step in

the arduous intracellular delivery process of siRNA, plays a vital role and is a

requisite for achieving effective intracellular siRNA delivery and high gene

silencing efficiency of ECO/siRNA nanoparticles. The inclusion of the cysteine

residues within the structure of ECO is a key feature to stabilize the siRNA

nanoparticles and for cytosol-specific controlled siRNA release.

3.4 Conclusions

We have developed a cationic lipid-based ECO/siRNA nanoparticle delivery

system that demonstrates the multifunctionality critical for efficient intracellular

siRNA delivery and RNAi activity. The N/P ratio had a significant impact on the

size, zeta potential and siRNA complexation of the of ECO/siRNA nanoparticles.

Higher N/P ratio produced more compacted nanoparticles with improved siRNA

103

entrapment and increased zeta potential within the N/P ratio range of 6 – 20. In

serum free media, ECO/siRNA nanoparticles mediated high luciferase silencing

in U87-Luc while the silencing efficiency decreased at N/P < 10 under serum

media transfection conditions. For the U87 cell line, an N/P ratio of 10 was the

optimal formulation for balancing robust gene silencing with minimal adverse

cytotoxic effects. ECO/siRNA nanoparticles were effective to protect siRNA from

degradation in serum, able to escape from the late endosomes via their pH-

sensitive ability to induce membrane disruption at endosomal pH levels, and

released the siRNA payload in the reductive cytosolic environment through

cleavage of disulfide bonds within the nanoparticle. These functionalities of the

ECO/siRNA nanoparticles are critical for their capability to mediate efficient

intracellular siRNA delivery and effective gene silencing. The multifunctional

ECO/siRNA nanoparticles provide a promising platform delivery system for

efficient delivery of therapeutic siRNA in vitro and certainly warrant further

development and evaluation of their potential for in vivo delivery.

3.5 Acknowledgments

This material is based upon work partially supported by the National Science

Foundation Graduate Research Fellowship under Grant Number DGE-0951783

and the National Institutes of Health under Grant Number EB00489.

104

Chapter 4

Silencing β3 Integrin by Targeted siRNA Nanoparticles Inhibits EMT and

Metastasis of Triple Negative Breast Cancer

Adapted from Cancer Research 2015,

Maneesh Gujrati, Jenny Parvani, Margaret Mack, William Schiemann and Zheng-Rong

Lu

105

4.1 Introduction

Breast cancer is the second leading cause of cancer-related deaths

amongst women in the United States (208). The 5-year relative survival rate for

women with localized disease is 98.6%; however, for those diagnosed with

distant metastases, survival rates fall below 25%. Triple-negative breast cancer

(TNBC) is a highly aggressive subcategory of breast cancer that lack the

expression of estrogen receptor (ER) and progesterone receptor (PR), as well as

HER2 amplification. Currently, there is a lack of targeted therapies for TNBCs,

which renders chemotherapy as the standard of care (29,209,210). Although

TNBC patients are initially responsive to chemotherapy, most patients relapse,

and the recurrent tumor is usually highly metastatic and resistant to traditional

chemotherapy, which leads to a disproportionately large number of deaths

(29,209–211). Importantly, metastasis is associated with the aberrant activation

of epithelial-mesenchymal transition [EMT; (212–214)], which endows cancer

cells with elevated capabilities to invade and disseminate to distant sites (215).

Various molecular and microenvironmental factors can induce EMT, including

transforming growth factor- (TGF-). TGF- is a pleiotropic cytokine that

regulates virtually all aspects of mammary gland biology. TGF- induces the

dramatic upregulation of 3 integrin, which is essential for EMT and breast

cancer metastasis (216–218). Previous work has demonstrated that functional

disruption of 3 integrin inhibits TGF--mediated cytostasis, EMT, and invasion in

vitro (216)and reduces primary tumor burden in vivo (219). Given the essential

roles that 3 integrin plays in mediating breast cancer tumor progression, we

106

hypothesize that silencing 3 integrin expression has the potential to effectively

treat TNBC.

RNA interference (RNAi) is a natural biological mechanism for modulating

gene expression and can be exploited to effectively regulate the expression of 3

integrin in treating TNBC. Clinical application of RNAi requires efficient delivery of

therapeutic siRNA into the cytoplasm of target cells (172,220). We have recently

developed a multifunctional cationic lipid-based carrier, (1-aminoethyl)iminobis[N-

oleicylsteinyl-1-aminoethyl)propionamide] (ECO), which can effectively mediate

cytosolic siRNA delivery and facilitate efficient gene silencing in cancer cells

[Figure 4.1A; (172,221)]. ECO self-assembly with therapeutic siRNA forms

stable nanoparticles that can be readily functionalized with targeting moieties to

achieve targeted siRNA delivery to cancer cells. Considering the critical roles of

3 integrin in regulating EMT, proliferation and metastasis (222–224) and the

unmet need for targeted therapies tailored to TNBC (225), we sought to evaluate

silencing 3 integrin by targeted ECO/siRNA nanoparticles to treat metastatic

breast cancer.

The present study demonstrates the efficacy of ECO/si3 nanoparticles in

silencing 3 integrin expression and the consequent inhibition of TGF--mediated

EMT and invasion in breast cancer cells in vitro. The nanoparticles were modified

with a cyclic RGD peptide via a PEG spacer to improve biocompatibility and

systemic target-specific delivery of the therapeutic si3 in vivo (169). The efficacy

of the targeted ECO/si3 nanoparticles in alleviating primary tumor burden and

107

inhibiting TNBC metastasis was determined in tumor-bearing mice following

multiple intravenous injections.


4.2.1 Cell lines and reagents

MDA-MB-231 cells were obtained from ATCC (Manassas, VA) and

cultured in Dulbecco’s Modified Eagle Medium (DMEM; Gibco, Grand Island, NY)

supplemented with 10% fetal bovine serum (FBS; Gibco, Grand Island, NY).

NME cells are Normal Murine Mammary Gland (NMuMG; obtained from ATCC)

cells that were engineered to overexpress EGFR by VSVG retroviral transduction

of particles encoded from a pBabe-EGFR construct as previously described

(226) and cultured in DMEM supplemented with 10% FBS and 10 μg/mL of

insulin. TGF-β stimulated NME cells are a model of TNBC, that display

aggressive, post-surgical primary tumor recurrence and metastatic phenotypes

(226,227). Both cell lines were engineered to stably express firefly luciferase by

transfection with pNifty-CMV-luciferase and selection with Zeocin (500 μg/ml;

Invitrogen, Carlsbad, CA). Cell lines were not independently authenticated. Early

passage cells were utilized for all cell and tumor work. The following siRNAs

were purchased from Integrated DNA Technologies (Coralville, IA): Mouse

integrin β3 sense: [GCUCAUCUGGAAGCUACUCAUCACT], Mouse integrin β3

antisense: [AGUGAUGAGUAGCUUCCAGAUGAGCUC], Human integrin β3

sense: [GCUCAUCUGGAAACUCCUCAUCACC], and Human integrin β3

antisense: [GGUGAUGAGGAGUUUCCAGAUGAGCUC].

4.2.2 Preparation of ECO/siRNA nanoparticles

108

The ECO lipid carrier was synthesized as described previously (172).

ECO (MW=1023) was dissolved in 100% ethanol at a stock concentration of 2.5

mM for in vitro experiments and 50 mM for in vivo experiments. The siRNA was

reconstituted in RNase-free water to a concentration of 18.8 μM for in vitro

experiments and 25 μM for in vivo experiments. For in vitro experiments, an

siRNA transfection concentration of 100 nM was used. ECO/siRNA nanoparticles

were prepared at an N/P ratio of 8 by mixing predetermined volumes of ECO and

siRNA for a period of 30 minutes in RNase-free water (pH 5.5) at room

temperature under gentle agitation to enable complexation between ECO and

siRNA. The total volume of water was determined such that the volume ratio of

ethanol:water remained fixed at 1:20. For RGD- and RAD-modified ECO/siRNA

nanoparticles, RGD-PEG3400-Mal or RAD-PEG3400-Mal (MW = 3,400 Da;

NANOCS, New York, NY) was first reacted with ECO in RNase-free water at 2.5

mol% for 30 minutes under gentle agitation and subsequently mixed with siRNA

in RNase-free water for an additional 30 min. RGD-PEG3400-Mal or RAD-

PEG3400-Mal were prepared at a stock solution concentration of 0.32 mM in

RNase-free water. Again, the total volume of water was determined such that the

volume ratio of ethanol:water remained fixed at 1:20. After the incubation, free

peptide derivative was removed from RGD- and RAD-modified ECO/siRNA

nanoparticles by ultrafiltration (Nanosep, MWCO = 100 K, 5000 × g, 5 min;

Sigma Aldrich, St. Louis, MO). Conjugation of RGD-PEG3400-Mal to ECO was

determined and confirmed through matrix assisted laser desorption ionization

time-of-flight (MALDI-TOF) mass spectrometry using a Bruker Autoflex III MALDI-

109

TOF instrument. The size of RGD-modified ECO/siRNA nanoparticles in PBS

was determined by dynamic light scattering with a Brookhaven ZetaPALS

Particle Size Analyzer.

4.2.3 Western blot analyses

Immunoblotting analyses were performed as previously described (228).

Briefly, NME and MDA-MB-231 cells were seeded into 6-well plates (1.5 × 105

cells/well) and allowed to adhere overnight. The cells were then incubated in the

absence or presence of TGF-β1 (5 ng/mL) for 3 d and then treated with

ECO/siRNA complexes for 4 h in complete growth medium. At each indicated

time point, detergent-solubilized whole cell extracts (WCE) were prepared by

lysing the cells in Buffer H (50 mM -glycerophosphate, 1.5 mM EGTA, 1 mM

DTT, 0.2 mM sodium orthovanadate, 1 mM benzamidine, 10 mg/mL leupeptin,

and 10 mg/mL aprotinin, pH 7.3). The clarified WCE (20 mg/lane) were

separated through 10% SDS-PAGE, transferred electrophoretically to

nitrocellulose membranes, and immunoblotted with the primary antibodies, anti-

3 integrin (1:1000; Cell Signaling) and anti--actin (1:1000; Santa Cruz

Biotechnology).

4.2.4 Flow cytometry for nanoparticle cellular uptake

Cellular uptake and intracellular delivery of ECO/siRNA and RGD-

ECO/siRNA nanoparticles was evaluated quantitatively using flow cytometry.

ECO/siRNA and RGD-ECO/siRNA nanoparticles were prepared with 40 nM

Alexa Fluor 488-labeled siRNA (Qiagen; Valencia, CA). Approximately 2.5 × 104

NME cells were seeded onto 12-well plates and grown for an additional 24 h. The

110

cells were transfected with ECO/siRNA nanoparticles in 10% serum media. After

4 h, the transfection media was removed and each well was washed twice with

PBS. The cells were harvested by treatment with 0.25% trypsin containing

0.26 mM EDTA (Invitrogen; Carlsbad, CA), collected by centrifugation at

1,000 rpm for 5 min, resuspended in 500 μL of PBS containing 5%

paraformaldehyde, and finally passed through a 35 μm cell strainer (BD

Biosciences; San Jose, CA). Cellular internalization of the nanoparticles was

quantified by the fluorescence intensity measurement of Alexa Fluor 488 for a

total of 1 × 104 cells per sample using a BD FACSCalibur flow cytometer. All the

experiments were performed in triplicate and the data represent mean

fluorescence intensity and standard deviation.

4.2.5 Semi-quantitative real-time PCR analyses

Real-time PCR studies were performed as described previously (228).

Briefly, NME or MDA-MB-231 cells (100,000 cells/well) were seeded overnight

onto 6-well plates and treated with TGF- (5 ng/mL) for 3 days upon delivery of

ECO nanoparticles with a non-specific siRNA or 3 integrin-specific siRNA. At

each indicated timepoint, total RNA was isolated using the RNeasy Plus Kit

(Qiagen, Valencia, CA) and reverse transcribed using the iScript cDNA Synthesis

System (Bio-Rad, Hercules, CA). Semi-quantitative real-time PCR was

conducted using iQ-SYBR Green (Bio-Rad) according to manufacturer’s

recommendations. In all cases, differences in RNA expression for each individual

gene were normalized to their corresponding GAPDH RNA signals.

4.2.6 Invasion and proliferation assays

111

Invasion assays were conducted as described previously (219). Briefly,

NME cells, unstimulated (Pre-) or stimulated with TGF- for 3 d (Post-EMT),

were treated with the ECO/siRNA complexes for an additional 2 d. The cells were

then trypsinized and their ability to invade reconstituted basement membranes (5

× 104 cells/well) was measured utilizing modified Boyden chambers, as

previously described (18). For the proliferation assay, the NME cells were

cultured (1 × 104 cells/well) in the presence (post-EMT) or absence (pre-EMT) of

TGF- (5 ng/mL) for 3 d and then treated with ECO/siRNA. Cell proliferation was

determined by 3H-thymidine incorporation as previously described (216).

4.2.7 3-Dimensional (3D)-organotypic cultures

3D-organotypic cultures utilizing the “on-top” method were performed as

described previously (228). NME or MDA-MB-231 cells, which were unstimulated

(Pre-EMT) or stimulated with TGF- (5 ng/mL) for 3 d (Post-EMT), were cultured

in 96-well, white-walled, clear bottom tissue culture plates (2,000 cells/well) with

50 L of Cultrex cushions (Trevigen, Gaithersburg, MD) in media supplemented

with 5% Cultrex. The cells were maintained in culture for 4 d with continuous

ECO/siRNA treatment every 2 d. Growth was monitored by bright-field

microscopy or bioluminescent growth assays (where indicated) using luciferin

substrate (229,230).

4.2.8 Tumor growth and bioluminescent imaging (BLI)

All the animal studies were performed in accordance with the Institutional

Animal Care and Use Committee for Case Western Reserve University. NME

cells (1 × 106 cells/mouse) were engineered to stably express firefly luciferase,

112

and were subsequently injected into the lateral tail vein of 4-6 week old, female

nude mice (nu/nu Balb/c background) after TGF-β stimulation (5 ng/mL) for 7 d.

Pulmonary outgrowth was monitored and determined as described previously

(28). MDA-MB-231 cells, also engineered to express firefly luciferase and

stimulated with TGF-β for 7 d, were engrafted into the mammary fat pad of

female nude mice. The primary tumor growth and metastatic burden were

monitored and determined as described above.

4.2.9 In vivo therapeutic treatment

The tumor bearing mice were intravenously injected with RGD or RAD modified

ECO/siRNA nanoparticles with a siRNA dose of 1.5 mg/kg every five days

starting at the day 17 after cancer cell inoculation. Surface modified ECO/siRNA

nanoparticles (N/P ratio of 8) were prepared directly before each treatment

according to the two-step formulation process described above based on the

siRNA dose (1.5 mg/kg siRNA, 18.6 mg/kg ECO, 2.5 mol% PEGylation of ECO

with either RGD- or RAD-functionalized PEG3400-maleimide). Each mouse (25 g

body weight) received on average the nanoparticles containing 37.5 μg siRNA,

464 μg ECO, and 47.7 μg of either RGD-PEG3400-mal or RAD-PEG3400-mal in

150 μL nuclease-free water at each injection.

4.2.10 Immunofluorescence and immunohistochemical staining

For visualization of the actin cytoskeleton, immunofluorescent analysis

was performed as previously described (14). NME cells (5 × 104 cells/well) were

plated onto glass-bottom confocal dishes and allowed to adhere overnight, after

which they were simultaneously stimulated with TGF-β (5 ng/mL) and treated

113

with ECO/siRNA nanoparticles, either siβ3 or siNS at 100 nM siRNA

concentration. After 48 and 72 h of simultaneous TGF-β stimulation and

nanoparticle treatment, the cells were washed with PBS, fixed with 4%

paraformaldehyde, permeabilized in 0.1% Triton-X 100, stained with Alexa Flour

488 phalloidin (25 μM; Invitrogen; Carlsbad, CA), and visualized under a

fluorescent confocal microscope.

For immunohistochemistry, primary tumor samples were embedded in

optimum cutting temperature (O.C.T.) compound (Tissue-TeK; Torrence, CA) in

preparation for cryostat sectioning and immediately frozen. The samples were

then sectioned, fixed in paraffin, and maintained at -80⁰C. The samples were

stained with H&E to evaluate the presence of tumor tissue. Briefly, the samples

were fixed in 10% formalin, rehydrated in 70% ethanol and rinsed in deionized

water prior to hematoxylin staining. Samples were then rinsed in tap water,

decolorized in acid alcohol, immersed in lithium carbonate and rinsed again in

tap water. Next, the eosin counterstain was applied and slides were dehydrated

in 100% ethanol, rinsed in Xylene and finally mounted on a coverslip with

Biomount. For immunofluorescence detection of fibronectin, the paraffin-

embedded slides were first deparaffinized using a series of washes in xylene and

decreasing concentrations of ethanol. Heat-induced antigen retrieval was

performed using a pressure cooker in sodium citrate buffer (10 mM Sodium

citrate, 0.05% Tween 20, pH 6.0) for 20 minutes. Following heat-induced antigen

retrieval, the samples were blocked in TBST solution containing donkey serum

and washed three times with TBST. The primary antibody (Abcam; Cambridge,

114

MA) was applied at dilution of 1:100 in blocking solution for 1 h followed by three

rinses with TBST. The Alexa Fluor 488 secondary antibody (Jackson; West

Grove, PA) was applied at a dilution of 1:5000 in blocking solution for 1 h

followed by three washes with TBST and counterstained with DAPI at a dilution

of 1:2500 in blocking solution. After washing with TBST and mounting in an anti-

fade mounting solution (Molecular Probes; Grand Island, NY), the samples were

imaged using a confocal microscope.

4.2.11 Statistical analyses

Statistical values were defined using unpaired Student’s t-test, with p < 0.05

considered to be statistically significant.


4.3.1 ECO/siβ3 nanoparticles induce sustained silencing of 3 integrin

We examined the ability of ECO/β3 integrin-specific siRNA nanoparticles

(ECO/siβ3) to silence β3 integrin expression in mouse NME breast cancer cells

(226,227) (see materials and methods), which are reminiscent of a basal-like

breast cancer cell line (227), and human MDA-MB-231 breast cancer cells, a

TNBC cell line (231). The expression of 3 integrin was elevated in both cell lines

after stimulation with TGF-β for 72 h (219). Subsequent treatment of the

stimulated cells with ECO/siβ3 nanoparticles resulted in the rapid loss of β3

integrin mRNA within the first 16 h following treatment (Figure 4.1B). 3 integrin

expression was reduced by ~75% and this downregulation was sustained for up

to 7 d in NME cells treated with TGF-β (Figure 4.1B and C). ECO/si3 treatment

115

of MDA-MB-231 cells reduced 3 integrin expression level to that of the

unstimulated cells (Figure 4.1B and D). Importantly, treatment with

ECO/nonspecific siRNA nanoparticles (ECO/siNS) failed to alter 3 integrin

expression in both cell lines (Figure 4.1B-D). Collectively, these results

demonstrate the ability of ECO/si3 nanoparticles to induce efficient and

prolonged silencing of 3 integrin expression in breast cancer cells.

116

Figure 4.1. ECO/siβ3 nanoparticles induced sustained gene silencing of β3 integrin. A,

ECO forms nanoparticles with siRNA through electrostatic interactions, disulfide cross-

linking and hydrophobic interactions. B, β3 integrin mRNA expression in quiescent or

TGF- stimulated (5 ng/mL, 72 hours) NME and MDA-MB-231 cells with the indicated

treatment groups at 100 nM siRNA by semi-quantitative real-time PCR (n=3, mean ± SE,

p0.01 for all time points beyond 8 hours). Western blot analysis of β3 integrin

expression in quiescent or TGF- stimulated (5 ng/mL, 72 hours) NME C, and MDA-MB-

117

231 d) cells at the indicated time points post-nanoparticle treatment with the indicated

treatment groups.

4.3.2 ECO/siβ3 nanoparticles attenuate TGF-β-mediated EMT, invasion, and

proliferation

Next, we investigated the effects of ECO/si3 nanoparticles on EMT, invasion,

and proliferation of breast cancer cells. Phalloidin staining of the actin

cytoskeletal architecture (222) revealed that quiescent NME cells displayed the

epithelial hallmark of densely packed and well-organized cortical actin network

(222), while those stimulated with TGF- exhibited dissolved junctional

complexes and acquired an elongated morphology consistent with stress fiber

formation that are characteristic of mesenchymal cells (Figure 4.2A). Treatment

of NME cells with ECO/siβ3 nanoparticles at the time of TGF-β stimulation

inhibited dissolution of the junctional complexes and stress fiber formation, while

treatment with ECO/siNS nanoparticles failed to impact TGF-β-induced

morphological changes (Figure 4.2A). Moreover, the phenotypic changes in

post-EMT cells were accompanied by alterations in the expression of EMT-

related genes (232). Silencing of β3 integrin with ECO/siβ3 nanoparticles

significantly reduced TGF--mediated upregulation of the mesenchymal markers,

N-cad and PAI-1, and inhibited TGF--mediated downregulation of the epithelial

markers, E-cad and CK-19 (Figure 4.2B and C). ECO/siNS nanoparticles did not

alter the effect of TGF- on the aforementioned EMT markers.

118

Figure 4.2. ECO/siβ3 nanoparticles attenuated TGF-β-mediated EMT, invasion and

proliferation. A, Immunofluorescent images of actin cytoskeleton visualized with

rhodamine-conjugated phalloidin in mouse NME cells with different treatments (scale

bar, 100 μm; inset scale bar, 50 μm). B, Semi-quantitative real-time PCR analysis (n=3)

of EMT markers in NME cells (**p0.01). C, Western blot analysis of E-cadherin and N-

cadherin in NME cells. D, Invasion assay of quiescent (white bars) or TGF- stimulated

(gray bars) NME cells (n=3, *p0.05, **p0.01). E, Proliferation as measured by

119

[3H]thymidine incorporation of either quiescent (white bars) or TGF- stimulated (gray

bars) NME cells (n=3, *p0.05, **p0.01). For all experimental groups, NME cells were

pre-treated with TGF- (5ng/mL; 72 hours) followed by ECO/siRNA nanoparticle

treatment using 100nM siRNA. For panels B, D-E, data represent mean SE. Results

for panels D-E are representative of three independent experiments.

TGF--mediated EMT is also associated with increased invasiveness

(232) and cell cycle arrest (233). TGF--stimulated NME cells treated with

ECO/siNS readily invaded reconstituted basement membrane, while ECO/siβ3

nanoparticles significantly inhibited invasion (Figure 4.2D). Conversely,

treatment of quiescent NME cells with ECO/siβ3 nanoparticles had no effect on

basal invasiveness, an event that is uncoupled from 3 integrin expression.

Previous studies demonstrate that parental NMuMG cells readily undergo

proliferative arrest when stimulated with TGF- (233). We found that the NME

cells override these cytostatic effects of TGF- (Figure 4.2E), while treatment

with ECO/si3 partially restores TGF--mediated cytostasis (Figure 4.2E).

Collectively, these findings indicate that ECO/si3 nanoparticle-mediated

silencing of β3 integrin attenuates TGF--induced EMT and invasion, and

partially restores TGF--mediated cytostasis.

4.3.3 ECO/siβ3 nanoparticles attenuate outgrowth of murine and human

MECs in 3D-organotypic culture

To study the effects of ECO/si3 nanoparticles in a physiologically relevant

system, we cultured NME and MDA-MB-231 cells in 3D-organotypic cultures to

120

recapitulate the elastic modulus of a distant metastatic site such as the

pulmonary microenvironment (234). This culture method presented additional

obstacles in the delivery and uptake of nanoparticles, since these organoids were

compact and surrounded by a dense matrix. Using confocal microscopy, we

confirmed that ECO/siRNA nanoparticles formulated with fluorescently-labeled

siRNA (AF-488) readily gained access to NME organoids by first penetrating into

the periphery within 30 min after treatment, and further dispersing throughout the

entirety of the organoid to reach a near-uniform distribution within 24 h (Figure

4.3A). The dispersion of ECO/siRNA nanoparticles into the inner cell layers of

the organoids suggests that ECO/siRNA uptake by these cells may result from

diffusion through intercellular spaces or through transcytosis (235). Fig. 3C and C

show that NME and MDA-MB-231 organoids stimulated with TGF-β exhibited

elevated growth as compared to their quiescent counterparts. Treatment with

ECO/si3 nanoparticles inhibited the growth of both quiescent and TGF--

stimulated NME and MDA-MB-231 organoids (Figure 4.3B and C) in comparison

to treatment with ECO/siNS nanoparticles. These results demonstrate the

effectiveness of ECO/si3 nanoparticles in attenuating the 3D outgrowth of post-

EMT breast cancer cells.

121

Figure 4.3. ECO/siβ3 nanoparticles attenuated 3D organoid outgrowth. NME and MDA-

MB-231 cells were grown in a compliant 3D-organotypic microenvironment and treated

with ECO nanoparticles containing Alexa Fluor 488-labeled siRNA. Cellular uptake of

ECO/siRNA nanoparticles monitored by fluorescence confocal microscopy (scale bar,

100 μm). A, Bright-field microscopic image of a single organoid and fluorescence

confocal microscopic images of ECO/siRNA nanoparticle uptake in the organoid over the

course of 24 hours. B, NME and C, MDA-MB-231 cells were grown in a compliant 3D-

organotypic microenvironment for up to 10 days with or without prior TGF-β stimulation

(5ng/mL) for 72 h. On day 4, 6 and 8, cells were treated with ECO/siNS or ECO/siβ3

nanoparticles at 100 nM siRNA. Organoid growth at day 10 was monitored via

longitudinal bioluminescence (n=4, *p0.05, **p0.01). For panels C-D, data represent

mean SE.

122

4.3.4 Surface modification of ECO/siRNA nanoparticles with RGD peptide

promotes cellular uptake and sustains gene silencing

An essential goal of in vivo siRNA delivery is to increase siRNA localization at the

disease site while minimizing its accumulation in non-target tissues (236). We

modified ECO/siRNA nanoparticles with a cyclic RGD peptide, which binds to

v3 integrin, or a non-targeting control cyclic RAD peptide via PEG spacers

(3,400 Da; (237) ) (Figure 4.4A and B). The size of RGD-modified ECO/siRNA

nanoparticles (RGD-ECO/siRNA) was 88.3 ± 5.2 nm, as determined by dynamic

light scattering (Figure 4.4C). Their cellular uptake was then examined in both

unstimulated and TGF-β-stimulated NME cells. TGF-β stimulation had no effect

on the cellular uptake of unmodified ECO/siRNA nanoparticles, while cellular

uptake of RGD-ECO/siRNA nanoparticles was robustly enhanced (Figure 4.4D

and E), leading to effective silencing of 3 integrin in TGF--treated cells (Figure

4.4F and G). Since v3 is a major receptor that recognizes the RGD targeting

peptide, we sought to determine whether β3 integrin silencing impacts cellular

uptake of RGD-ECO/siRNA nanoparticles. Although cellular uptake of RGD-

targeted nanoparticles was diminished upon β3 integrin silencing, uptake was

nonetheless elevated consistently, because of the presence of other receptors

for the peptide (Figure 4.4H;(238)). Taken together, these results show that

RGD-targeted ECO/siRNA nanoparticles efficiently promote cellular uptake and

robust gene silencing, particularly in post-EMT and metastatic breast cancer

123

cells.

Figure 4.4. RGD modification of ECO/siRNA nanoparticles enhances uptake in post-

EMT breast cancer cells. A, RGD-ECO/siRNA nanoparticles were prepared by modifying

the ECO/siRNA nanoparticles with RGD-targeted PEG ligand via thiol-maleimide

chemistry. B, Conjugation of RGD-PEG-maleimide to ECO was confirmed from MALDI-

TOF mass spectroscopy. The center of the bell was observed at m/z 5200 confirming

the conjugation of RGD-PEG-maleimide (m/z, 4100) to ECO (m/z, 1046). C, The size of

RGD-ECO/siRNA nanoparticles was determined by dynamic light scattering (DLS). NME

124

cells, with or without TGF-β stimulation (5ng/mL; 72 hours), were treated with ECO

nanoparticles with Alexa Fluor 488-labeled siRNA at 40 nM siRNA for 4 hours. NME

cells that were stimulated with TGF-β exhibited a higher cellular uptake of RGD-targeted

ECO/siRNA nanoparticles compared to the non-targeted ECO/siRNA nanoparticles as

confirmed by D, confocal microscopy (scale bar, 50 μm) and E, quantified by flow

cytometry (n=3, **p0.01). Quantitative analysis of β3 integrin mRNA levels following

treatment with siβ3 nanoparticles by real-time PCR (n=3, **p0.01) in F, NME and G,

MDA-MB-231 cells revealed RGD-targeted ECO/siRNA nanoparticles maintain gene

silencing. H, Cellular uptake in NME cells, both with and without TGF-β stimulation

(5ng/mL; 72 hours), was quantified by flow cytometry for RGD-ECO/siRNA nanoparticles

containing Alexa Fluor 488-labelled siRNA 4 hours after treatment. One group of TGF-β

stimulated NME cells (TGF-β + ECO/siβ3) was treated with ECO/siβ3 nanoparticles at

100 nM siRNA for 48 hours prior to cellular uptake with the RGD-targeted nanoparticles

to quantify the effect of β3 integrin silencing on targeted uptake (n=3, ±SE, *p0.05,

**p0.01). For panels C-F, data represent mean SE.

4.3.5 RGD-ECO/si3 nanoparticles inhibit pulmonary outgrowth of mouse

MECs in vivo

To evaluate the effect of 3 integrin silencing on pulmonary outgrowth, we

inoculated TGF--treated NME cells into the lateral tail vein of nude mice and

subsequently monitored pulmonary outgrowth. Systemic injections of RGD-

targeted ECO/si3 nanoparticles dramatically inhibited pulmonary outgrowth of

post-EMT NME cells (Figure 4.5), as compared to non-specific RAD-ECO/si3

and RGD-ECO/siNS treatment groups. These results demonstrate that RGD-

125

targeted ECO/si3 nanoparticles with PEG spacers can effectively inhibit

pulmonary outgrowth of TGF--stimulated NME cells, when targeted for in vivo

delivery applications.

Figure 4.5. Pulmonary outgrowth of NME cells treated with the ECO/siRNA treatment

regimen. TGF--pre-treated NME cells (1 × 106) were injected into the lateral tail vein of

nude mice. Tail vein administration of the ECO/siRNA treatment regimen (siRNA dose of

1.5 mg/kg) was conducted every 5 d, starting at day 18 after the cancer cell inoculation

(n = 4, mean ± SE, *p 0.05).

4.3.6 RGD-ECO/si3 nanoparticles effectively inhibit primary tumor growth

and metastasis of malignant human MECs

126

To further evaluate the in vivo effect of our targeted ECO/si3 nanoparticles,

MDA-MB-231 cells pretreated with TGF- were engrafted into the mammary fat

pad of nude mice. Mice were treated with RGD-ECO/si3 (1.5 mg/kg siRNA)

every 5 days, starting at day 17 (Figure 4.6A). Primary tumor burden was

monitored by bioluminescence imaging (BLI) and caliper measurements.

Compared to the untreated control, RGD-ECO/siNS or RAD-ECO/si3 treatment

groups, RGD-ECO/si3 treated mice exhibited significantly reduced primary

tumor burden (Figure 4.6B-D). The primary tumors were resected at week 9

(Figure 4.6A) and weighed. Figure 4.6E shows that RGD-ECO/si3 treatment

resulted in significantly reduced tumor weights as compared to the control

groups. Importantly, the therapeutic efficacy of RGD-ECO/si3 was reflected by

decreased mRNA expression of 3 integrin in the primary tumors, relative to that

in the control groups (Figure 4.6F). RAD-ECO/si3 treatment resulted in

marginally reduced 3 integrin expression (Figure 4.6F), which was consistent

with the marginally reduced primary tumor burden, which were not statistically

significant (Figure 4.6D and E). These data reflect partial uptake of the RAD-

ECO/si3 nanoparticles by primary tumors as a result of passive tumor

accumulation attributed to tumor vascular hyperpermeability. H&E staining of

tissue sections demonstrated similar histopathological patterns in RGD-

ECO/si3-treated and control groups, while untreated mice developed tumors

that were more vascularized than RGD-ECO/si3-treated tumors (Figure 4.6G).

Further immunostaining of tissue sections indicated that RGD-ECO/si3-treated

127

primary tumors exhibited decreased expression of a mesenchymal marker,

fibronectin (Figure 4.6H), which is associated with poor overall survival (239).

129

Figure 4.6. RGD-targeted ECO/si3 nanoparticles inhibited primary tumor growth and

EMT in mice after systemic administration. A, Schematic of targeted ECO/siRNA

nanoparticle treatment (1.5 mg siRNA/kg) schedule in vivo. Tumor growth was

monitored at the indicated time points B, and quantified by C, BLI (data represents mean

± SE, n=5, *p0.05, **p0.01), and D, caliper measurements (data represents mean ±

SE, n=5, *p0.05, **p0.01). E, Primary tumors were resected at week 9, and final tumor

weights of the indicated treatment groups were obtained (data represents mean ± SE,

n=5, **p0.01). F, Semi-quantitative real-time quantification of 3 integrin mRNA

expression from resected primary tumors of the indicated groups (data represents mean

± SE, n=5, **p0.01). G, H&E staining at 200X of primary tumors. H, H&E, DAPI and

fibronectin immunostaining of the indicated primary tumors (scale bar, 300 μm).

131

Figure 4.7. RGD-ECO/si3 nanoparticles inhibited breast cancer metastasis and

primary tumor recurrence. A, BLI images of mice at week 12 revealed differences in

metastasis and primary tumor recurrence for the different treatment groups after primary

tumor resection on week 9. B, Quantification of primary tumor recurrence (data

represents mean ± SE, n=5, *p0.05). C, Quantification of thoracic metastasis by BLI

(data represents mean ± SE, n=5, *p0.05, **p0.01). Mice were released from

ECO/siRNA therapeutic regimen at week 12. D, Representative BLI of mice on week 16.

E, Quantification of whole body tumors from D. (data represents mean ± SE, n=5,

*p0.05). F, Change in the body weight of mice bearing MDA-MB-231 primary tumors

across various treatment groups over the course of 16 weeks. The body weight was

measured weekly and reported as mean ± S.E. (n = 5) for each group. No significant

difference was observed between the various treatment groups at any time point.

RGD-ECO/si3 treatment resulted in robust inhibition of tumor metastases

(Figure 4.7A and C) and primary tumor recurrence (Figure 4.7B), as compared

to control groups at week 12 post-engraftment. Primary tumor recurrence was

evaluated by restricting the region of interest (ROI) of the bioluminescent image

to that of the area originally occupied by the resected primary tumor.

Interestingly, RAD-ECO/si3 treatment also mediated significant inhibition of

tumor metastases and primary tumor recurrence as compared to RGD-ECO/siNS

treatment, but to a lesser extent than RGD-ECO/si3. This decrease in the

efficacy of RAD-ECO/si3 could be attributed to the lack of specific targeting and

binding of the nanoparticles to the cancer cells. At 12 weeks post-engraftment,

the RGD-ECO/siβ3 group was released from nanoparticle treatment to evaluate

132

the lasting effects of therapeutic β3 integrin silencing on tumor recurrence and

metastases in comparison with the untreated control group. At 4 weeks post-

treatment release (16 weeks post-engraftment), the RGD-ECO/si3-treated mice

remained tumor-free, while the tumor burden of untreated mice continued to

increase (Figure 4.7D and E). Finally, throughout the entire course of treatment,

no significant difference was observed in the body weights across the different

treatment groups, demonstrating the low toxicity of the intravenously

administered, targeted and PEGylated ECO/siRNA nanoparticles (Figure 4.7F).

Collectively, these data highlight the effectiveness and safety of the systemic

administration of RGD-ECO/si3 nanoparticles for the inhibition of TNBC tumor

progression and metastases.

4.4 Discussion

Cancer metastasis involves a cascade of events, including EMT and local

invasion, intravasation, survival in circulation, extravasation, and outgrowth of

disseminated cells at the secondary site. Cancer cell EMT is considered to be a

critical step for the initiation of cancer metastasis. In order to alleviate metastasis,

it is essential to prevent EMT and to eliminate the dissemination and outgrowth of

cells that have already undergone EMT. Silencing EMT-related genes by RNAi

has the potential to revolutionize current treatment standards. β3 integrin has

been implicated as a powerful inducer of EMT (227,240), potentiating the

oncogenic effects of TGF-β by inducing invasion and metastases of MECs. Here,

we demonstrated that silencing the expression of 3 integrin with RGD-ECO/si3

nanoparticles prevented TGF--mediated EMT and inhibited TNBC metastasis.

133

Although functional disruption of β3 integrin has been shown to attenuate

TGF--mediated EMT and tumor progression, the utilization of β3 integrin siRNA

as a therapeutic regimen has been limited due to the lack of a clinically feasible

approach. In the present study, we demonstrated ECO to be a versatile, safe,

and effective siRNA delivery vehicle that forms stable RGD-targeted siRNA

nanoparticles for systemic siRNA delivery, which silenced 3 integrin expression,

and subsequently eliminated post-EMT cells responsible for metastases. The

inhibition of TGF--mediated EMT with ECO/si3 nanoparticles was evident by

the obstruction of TGF--mediated morphological changes, downregulation of

epithelial markers, and upregulation of mesenchymal markers in vitro. Moreover,

silencing 3 integrin also decreased invasiveness and reduced outgrowth of

breast cancer cells in 3D-culture and in vivo. The effectiveness of RGD-targeted

ECO/si3 nanoparticles for treating metastatic TNBC was evident by reduced

primary tumor burden in tumors with diminished expression of 3 integrin. More

importantly, ECO/si3 treatment abrogated metastases and primary tumor

recurrence after treatment release.

Several unique features of ECO and ECO/siRNA nanoparticles render the

delivery system effective for safe and systemic delivery of a therapeutic siRNA in

treating metastatic TNBC. ECO possesses pH-sensitive amphiphilicity, which is

essential to promote endo-lysosomal escape and avoid lysosomal siRNA

degradation. The amino groups within ECO become protonated when exposed to

the increasingly acidic environment of the endo-lysosomes, thereby increasing

the cationic charge of the nanoparticles to promote endo-lysosomal membrane

134

fusion for escape. Thiol groups of the cysteine residues are autoxidized into

disulfide bridges during nanoparticle formulation, which stabilize the

nanoparticles during circulation and become reduced by cytosolic glutathione,

resulting in siRNA release from ECO to initiate RNAi in cytoplasm (221). The thiol

groups also facilitate surface modification of ECO/siRNA nanoparticles with PEG

or targeting peptides. This modification enables targeted in vivo siRNA delivery

into tumor tissues and minimizes potential toxic side effects. This multi-

functionality uniquely resides within a simple small molecular lipid, making ECO a

versatile carrier for highly efficient cytosolic siRNA delivery. The formation of

targeted ECO/siRNA nanoparticles is straightforward and reproducible, and can

be readily scaled-up for clinical development.

We demonstrated that 3 integrin is a powerful therapeutic target for treating

metastatic TNBC, and that RGD-ECO/si3 nanoparticles are an effective vehicle

to systemically silence 3 integrin in post-EMT cancer cells. Specifically, RGD-

ECO/si3 may be beneficial for TNBC patients who currently lack targeted

treatments. Administering RGD-ECO/si3 nanoparticles in combination with

chemotherapy also has the potential to resensitize drug-resistant TNBC cells to

chemotherapy. Moreover, v3 integrin is highly expressed in the angiogenic

vasculature of many cancer types and the RGD peptide is a well-established

strategy for honing the delivery of therapeutics to the tumor (237,241). These

studies highlight the potential of our RGD-ECO/si3 regimen in targeting not only

the primary tumor, but also endothelial cells in angiogenic tumor vasculature for

treating breast cancer. However, β3 integrin silencing may cause potential side

135

effects in wound-healing, which remain to be addressed. Furthermore, ECO/siβ3

treatment of mice bearing established metastatic lesions yielded no therapeutic

effect (data not shown), therefore the proposed ECO/siβ3 regimen is likely most

effective at treating early stage breast cancer. Previous studies suggest that

established metastatic breast lesions utilize 1 integrin to sustain outgrowth

(242,243), which we currently hypothesize to limit the effectiveness of our RGD-

ECO/si3 regimen in the treatment of late stage metastatic breast cancer. Due to

the versatility of our multifunctional ECO/siRNA nanoparticles, targeted

nanoparticles with different targeting ligands and siRNAs, including 1 integrin

siRNA, can be readily formulated to address this issue. We are currently

exploring the effectiveness of dual 1 and 3 integrin targeting using our

ECO/siRNA nanoparticles (240).

4.5 Conclusion

These findings highlight the silencing of 3 integrin expression with our targeted

multifunctional ECO/siβ3 nanoparticles as a promising therapeutic strategy for

the effective treatment of metastatic TNBC associated with elevated β3 integrin.

Integrins have been commonly investigated as therapeutic targets in a multitude

of diseases. In cancers, integrins offer intriguing targets for drug therapy but

effective systemic methods to ablate their function or expression as a strategy to

block metastatic disease have been elusive. While antibodies and inhibitory

peptides have been used to inhibit integrins, RNAi-based technologies are more

attractive in terms of their therapeutic potential. SiRNA-mediated gene silencing

136

both eliminates the physical integrin protein to disrupt membrane and intracellular

interactions, disrupt integrin-related signaling pathways, and attenuate ligand-

dependent actions of integrin receptors. In summary, the peptide-targeted

ECO/siRNA nanoparticle delivery platform is a powerful tool to enable the safe

and efficient in vivo delivery of siRNAs.

4.6 Acknowledgments

Research support was provided, in part, by grants from the National Institutes of

Health to Z-R.L. (EB00489) and W.P.S. (CA129359 and CA177069), a National

Science Foundation Graduate Research Fellowship to M.D.G. (DGE-0951783)

and a Department of Defense Postdoctoral Fellowship to J.G.P (BC133808). We

thank Dr. Amita M. Vaidya for editing and proofreading the manuscript.

137

Chapter 5

Development of a pH-Cleavable PEG Surface Modification Strategy to

Overcome the PEG Dilemma in ECO/siRNA Nanoparticles

138

5.1 Introduction

Recently, we have developed (1-aminoethyl)iminobis[N-(oleicylcysteinyl-1-

amino-ethyl)propionamide] (ECO), a cationic lipid-based carrier that forms stable

nanoparticles with siRNA through ionic charge interactions (221,244). ECO

exhibits multifunctional properties necessary for the cytosolic delivery of siRNA

including pH-dependent membrane disruption and glutathione-mediated

decomplexation and siRNA release (221). While promising, cationic lipid-based

delivery systems exhibit poor pharmacokinetic profiles, short circulatory half-

lives, and suffer from significant RES uptake and clearance when delivered

systemically (73,245,246). Surface-modification with hydrophilic polyethylene

glycol (PEG) polymer chains can impart biocompatibility by masking the cationic

charge of the ECO/siRNA nanoparticles and prolong the pharmacokinetic

behavior of the nanoparticle complexes in vivo (247–249). The terminal groups of

PEG chains can be readily functionalized to reactive groups to allow for facile

covalent coupling to the surface of nanoparticles or targeting peptides. For

example, cysteine residues within the structure of ECO allow modification of the

nanoparticle surface with maleimide-functionalized PEG moieties via simple thiol-

maleimide chemistry. However, the steric hindrance provided to the nanoparticle

surface can negatively impact the gene silencing performance by inhibiting

cellular uptake within the target cells, leading to a significant loss of therapeutic

activity (250,251). It has also been observed that PEGylation can alter the

intracellular trafficking of non-viral gene delivery systems, inhibit endolysosomal

139

escape, and promote endosomal degradation, a generalized phenomenon

referred to as the ‘PEG dilemma’ (252,253).

To overcome the systemic barriers of PEGylated nanomedicines in vivo, a

wide array of stimuli-sensitive systems have been created to leverage various

physiological conditions specific to the disease or delivery site (254–257). Such

systems are engineered to undergo physicochemical changes in response to

endogenous cues, such as the pH gradients that exist at both the cellular and

tissue levels. Several strategies have been explored to improve the delivery

efficiency of PEGylated systems. Transient PEG-modifications have been widely

explored in previous work (258). The use of exchangeable PEG lipids, such as

PEG-ceramides, enables the time-dependent release of PEG from cationic lipid-

based systems to enhance intracellular delivery (259). Delivery systems

responsive towards a tumor-specific microenvironmental cue, such as proteases,

a reducing or acidic environment to affect drug delivery, are also in various

stages of development (260–262). PEG-modifications using disulfide or

orthoester linkages create a reducible system in which the PEG coat sheds in

response to the reductive cytosolic environment by endogenous glutathione

(263). Tumor-specific cleavable PEG systems have likewise been created for

enhanced delivery and efficiency into tumor cells. PEG-lipid systems composed

of the matrix metalloproteinase (MMP)-substrate peptide produce enzymatically

sensitive systems that are cleaved by MMPs that reside in the tumor extracellular

microenvironment (264,265).

140

Strategies dependent upon the exploitation of the acidic tumor

microenvironment have been explored (266–268). The pH of the extracellular

environment of tumor tissues (pH 6.5) is significantly lower than that of normal

tissue (pH 7.4) due to the elevated metabolic activity of tumor cells (269). As

such, cationic lipid-based delivery systems designed to shed their PEG coat in

response to the acidic pH can re-expose the positively charged surface to

improve tumor cell uptake (270). While this strategy improves cellular uptake,

such systems must still possess the ability to promote internalization and

facilitate endolysosomal escape to achieve effective cytosolic delivery of the

siRNA payload (271).

As PEGylation of cationic delivery systems is necessary for in vivo

delivery applications, a pH-cleavable surface modification strategy that can

attenuate cytotoxicity during systemic circulation and also promote internalization

and endolysosomal escape is desired. The present study focuses on the

development of a dual pH-sensitive and peptide-targeted siRNA delivery system.

The inclusion of the acid-labile hydrazone bond within a peptide-targeted PEG

moiety (RGD-PEG(HZ)-ECO/siRNA) created a pH-cleavable coating that sheds

from the core ECO/siRNA nanoparticle in response to the acidic endolysosomal

environment following uptake into tumor cells (Schematic 5.1). Once the core

ECO/siRNA nanoparticle has been re-exposed, the intrinsic pH-sensitive

amphiphilicity of ECO/siRNA nanoparticles enables endolysosomal membrane

disruption and escape to achieve potent gene silencing.

141

Schematic 5.1. A. pH-sensitive surface modification of ECO/siRNA nanoparticles with

RGD-PEG(HZ)-maleimide. B. RGD-PEG(HZ)-ECO/siRNA nanoparticles facilitate

receptor-mediated cellular internalization resulting in trafficking of the nanoparticles into

the late endosomes. Within the late endosomes, the increasingly acidic environment

cleaves the hydrazone linkage to promote shedding of the PEG layer and expose the

core ECO/siRNA nanoparticle. Next, the intrinsic pH-sensitive nature of ECO promotes

endosomal escape by enhancing interactions with the anionic charged lipid bilayer of the

endolysosomes. Once release into the cytosol, endogenous glutathione (GSH) mediates

142

reduction of disulfide bonds formed within ECO/siRNA nanoparticles to release the

siRNA cargo. Upon release, free siRNA is able to initiate RNAi-induced gene silencing.


5.2.1 Cell Culture: Human triple-negative breast cancer MDA-MB-231 cells

expressing a luciferase reporter enzyme (MDA-MB-231-Luc) were obtained from

ATCC (American Type Culture Collection) and cultured in Dulbecco’s modified

Eagle’s media (Invitrogen) and supplemented with 10% fetal bovine serum

(Invitrogen), 100 μg/mL streptomycin, and 100 unites/mL penicillin (Invitrogen).

The cells were maintained in a humidified incubator at 37⁰C and 5% CO2.

5.2.2 Synthesis of mPEG(HZ)-mal and RGD-PEG(HZ)-mal: NHS-PEG-SH

(MW 3400) and mPEG-HZ (MW 5000) were obtained from Nanocs, cRGDfk was

obtained from Peptides International. RGD-PEG-mal was prepared as previously

described (169). Full synthetic schemes and characterization are available within

the Appendix.

To synthesize the non-targeted, pH-cleavable PEG spacer, mPEG5000-

hydrazide (Laysan Bio) was reacted with N-4-acetylphenyl maleimide (APM).

First, 87.8 mg (MW=5000, 1 equivalent, 17.56 μmol) of the hydrazide-derivatized

mPEG5000 was dissolved in 10 mL DCM/MeOH (50/50) and 100 mg Na2SO4 was

added. Next, 11.7 mg (MW=215.2, 3.1 equivalent, 54.44 μmol) of APM was

dissolved in 1 mL DCM/MeOH (50/50) and added drop-wise into the mPEG-

hydrazide solution. After the addition of APM, acetic acid (1.77 μL of 34% v/v

solution in DCM, 0.6 equivalent, 10.54 μmol) was added. The reaction was

stirred for 24 hours at room temperature under nitrogen. After 24 hours, the

143

solution was precipitated into cold diethyl ether (3X) to obtain a purified product.

The H1 NMR spectrum (Solvent: CDCl3) of mPEG5000(HZ)-maleimide was used to

confirm the correct structure using the following characteristic peaks: 8.43 (s, 1H,

-NH-), 8.06 (d, 2H, in phenyl), 7.54 (d, 2H, in phenyl), 6.91 (2, 2H, two olefinic

protons of maleimide), 3.48-3.58 (m, 438H, PEG).

A three-step reaction was used to synthesize the cRGD-targeted pH-

cleavable PEG-hydrazone moiety (272–274). First, cRGDfk was first conjugated

to the heterobifunctional NHS-PEG3400-SH: 25 mg (MW=603.7, 2 equivalent, 41.4

μmol) of c(RGD)fk was dissolved in 5 mL DMF. Cyclic (RGD)fk was used at 2X

molar excess to the NHS-PEG3400-SH. Next, 70.4 mg (MW=3400, 1 equivalent,

20.7 μmol) of NHS-PEG3400-SH was dissolved in 1 mL of DMF and added drop-

wise into the c(RGD)fk/DMF solution. After addition, 100 μL of DIPEA was added

to the solution. The solution was stirred gently at room temperature for 4 hours.

The solution was precipitated into an excess of diethyl ether (3X) to remove

excess c(RGD)fk and obtain the purified cRGD-PEG3400-SH product. To ensure

free thiol availability, 100 mg of dithiothreitol (DTT) was added to the solution and

stirred overnight to reduce any disulfide bonds present in the synthesized cRGD-

PEG-SH. Free DTT was removed using a desalting spin column (1.8K MWCO).

The product was lyophilized, resuspended in chloroform and stored at -80⁰C.

Conjugation of cRGD to PEG was confirmed by an observed shift of ~600 in the

maldi-tof spectrum. To create a hydrazide-activated cRGD-PEG, 25.2 mg

(MW≈4000, 1 equivalent, 6.3 μmol) of cRGD-PEG-SH was dissolved 5 mL

chloroform and reacted with 4.25 mg (N-ε-maleimidocaproic acid) hydrazide

144

(EMCH, MW=225.24, 3 equivalents, 18.9 μmol), 4.39 μL of trimethylamine was

added to the reaction (TEA, 5 equivalents, 31.5 μmol). The reaction was carried

out for 4 hours at room temperature under stirring. After, the reaction solution

was purified using a spin column (1.8K MWCO). The product was lyophilized,

resuspended in chloroform and stored at -80⁰C. For the final step, 12 mg cRGD-

PEG(HZ) (1 equivalent, 2.84 μmol) was reacted with 1.2 mg N-4-acetylphenyl

maleimide (APM, 2 equivalent, 5.68 μmol) overnight at room temperature under

constant stirring. The reaction mixture was purified on a silica gel column using

chloroform:methanol mobile phase (9:1 v/v). The final product was concentrated

and lyophilized. The H1 NMR spectrum (Solvent: DMSO) of cRGD-PEG3400(HZ)-

maleimide was used to confirm the structure with the following characteristic

peaks: 8.48 (s, 1H, -NH-), 8.0 (d, 2H, in phenyl), 7.6-7.8 (m, cRGD), 7.45 (d, 2H,

in phenyl), 7.2 (2, 2H, two olefinic protons of maleimide), 3.1-3.5 (m, 304H,

PEG).

5.2.3 Preparation of PEG-modified ECO/siRNA nanoparticles: The ECO lipid

carrier was synthesized as previously reported (1, 2). ECO/siRNA nanoparticles

were prepared at an N/P ratio of 8, where N/P ratio denotes the ratio of cationic

charge from ECO to anionic charge of the siRNA. ECO (MW=1023) was

dissolved in 100% ethanol at a stock concentration of 2.5 mM for in vitro

experiments and 50 mM for in vivo experiments. The siRNA was reconstituted in

RNase-free water to a concentration of 18.8 μM for in vitro experiments and 50

μM for in vivo experiments. For in vitro experiments, an siRNA transfection

concentration of 100 nM was used. ECO/siRNA nanoparticles were prepared at

145

an N/P ratio of 8 by mixing predetermined volumes of ECO and siRNA for a

period of 30 minutes in RNase-free water (pH 5.5) at room temperature under

gentle agitation to enable complexation between ECO and siRNA. The total

volume of water was determined such that the volume ratio of ethanol:water

remained fixed at 1:20. For PEGylated nanoparticles, the PEG-derivative was

first reacted with ECO in RNase-free water at 2.5 mol% for 30 minutes under

gentle agitation and subsequently mixed with siRNA in RNase-free water for an

additional 30 min. Certain experiments called for conjugation at 1, 5, and 10

mol%. All PEG-derivatives were prepared at a stock solution concentration of

0.625 mM for in vitro experiments and 0.32 mM for in vivo experiments in RNase-

free water. Again, the total volume of water was determined such that the volume

ratio of ethanol:water remained fixed at 1:20. PEG-derivatives include: mPEG-

maleimide (Nanocs), mPEG(HZ)-maleimide, RGD-PEG-maleimide, RGD-

PEG(HZ)-maleimide.

5.2.4 Nanoparticle Characterization: The zeta potential of unmodified, mPEG-

and mPEG(HZ)-modified ECO/siRNA nanoparticle formulations at different pHs

in PBS was determined with a Brookhaven ZetaPALS Particle Size and Zeta

Potential Analyzer (Brookhaven Instruments). For each formulation, the

nanoparticles were diluted in PBS solutions at pH 7.4, 6.5, or 5.4. The zeta

potential measurement was taken at each indicated time point up to 4 hours.

Data represents the mean of three independently conducted experiments.

5.2.5 pH-Dependent Membrane Disruption Hemolysis Measurement: The

hemolytic activity was measured to determine the membrane-disruptive ability of

146

unmodified, mPEG- and mPEG(HZ)-modified ECO/siRNA nanoparticle

formulations at pH levels corresponding to various stages of intracellular

trafficking. Red blood cells (RBCs) isolated from rats (Innovative Research Inc.)

were diluted 1:50 in PBS solutions at pH 7.4, 6.5, and 5.4. ECO/siRNA

nanoparticles were prepared at a volume of 150 μL and incubated with an equal

volume of the various RBC solutions in a 96-well plate at 37⁰C for 2 hours.

Following incubation, samples were centrifuged and the absorbance of the

supernatants was determined at 540 nm. Hemolytic activity was calculated

relative to the hemolytic activity of 1% Triton X-100 (Sigma Aldrich), a non-ionic

surfactant. Each pH was conducted in triplicate and the data presented

represents the mean and standard deviation.

5.2.6 Flow Cytometry for Nanoparticle Cellular Uptake Measurements:

Cellular uptake and intracellular delivery of various ECO/siRNA nanoparticle

formulations include mPEG-maleimide, mPEG(HZ)-maleimide, RGD-PEG-

maleimide, RGD-PEG(HZ)-maleimide were evaluated quantitatively with flow

cytometry. The ECO/siRNA nanoparticle formulations were prepared with 25 nM

AlexaFluor647-labeled siRNA (Qiagen). Approximately 2.5 x 104 MDA-MB-231

cells were seeded onto 12-well plates and grown for an additional 24 hours. The

cells were transfected with each ECO/siRNA nanoparticle formulation in 10%

serum media. After 4 hours, the transfection media was removed and each well

was washed twice with PBS. The cells were harvested by treatment with 0.25%

trypsin containing 0.26 mM EDTA, (Invitrogen) collected by centrifugation at

1000 rpm for 5 min, resuspended in 500 μL of PBS containing 5%

147

paraformaldehyde, and finally passed through a 35μm cell strainer (BD

Biosciences). Cellular internalization of ECO/siRNA nanoparticles was quantified

by the fluorescence intensity measurement of AlexaFluor 647 fluorescence for a

total of 10,000 cells per each sample using a BD FACSCalibur flow cytometer.

Each formulation conducted in triplicate and the data presented represents the

mean fluorescence intensity and standard deviation.

For studying the endocytic trafficking pathway, the following inhibitors

were used 1 hour prior to transfection in MDA-MB-231 cells with the various

ECO/siRNA nanoparticles: 4⁰C, Cytochalasin D (5 μm/mL; Sigma Aldrich),

Genistein (200 μM; Sigma Aldrich), and Nocadozole (20 μM; Sigma Aldrich).

After 1 hour, the various ECO/siRNA nanoparticles formulated with the

fluorescent AF647-labeled siRNA, as descried above, were added to the cells.

After an additional 2 hours, the cells were harvested and processed as described

above. Similarly, cellular internalization of ECO/siRNA nanoparticles was

quantified by the fluorescence intensity measurement of AlexaFluor 647

fluorescence for a total of 10,000 cells per each sample using a BD FACSCalibur

flow cytometer. Each formulation conducted in triplicate and the data presented

represents the mean fluorescence intensity and standard deviation.

5.2.7 Confocal Microscopy of Nanoparticle Uptake and Intracellular Release

of siRNA: Live cell confocal microscopy was used to assess the cellular

uptake, endolysosomal escape, and intracellular release of siRNA.

Approximately 1 x 105 MDA-MB-231 cells were seeded onto glass-bottom micro-

well dishes. After 24 hours, the cells were stained for 30 minutes each with 5

148

µg/mL Hoechst 33342 (Invitrogen) and with 50 nM Lysotracker Green DND-26

(Molecular Probes). RGD-PEG- and RGD-PEG(HZ)- modified ECO/siRNA

nanoparticles were formed at an N/P ratio of 8 and a 25 nM siRNA concentration

with an AlexaFluor 647-labelled siRNA. Images were taken using an Olympus

FV1000 confocal microscope while the cells were housed in a humidified weather

station under 5% CO2.

5.2.8 In Vitro Luciferase Silencing Efficiency: MDA-MB-231-Luc cells were

seeded in 24-well plates at a density of 2 x 104 cells and allowed to grow for 24

hours. Transfections were carried out in 10% serum media with an N/P ratio of 8

and 100 nM anti-luciferase siRNA concentration (Dharmacon: sense sequence:

5’-CUUACGCUGAGUACUUCGAdTdT-3’, anti-sense sequence: 5’-

UCGAAGUACUCAGCGUAAGdTdT-3’). Following a 4 hour transfection period,

the media was replaced with fresh serum-containing media and the cells

continued to grow for up to 72 hours. For experiments using chloroquine (Sigma

Aldrich), transfections were conducted in a similar manner either with or without

100 μM chloroquine. As above, following a 4 hour transfection period, the media

was replaced with fresh serum-containing media and the cells continued to grow

for up to 48 hours. At each time point for luciferase silencing experiments, the

cells were rinsed twice with PBS and lysed using the reporter lysis buffered

provided in the Promega Luciferase Assay kit. Following lysis, the cells were

centrifuged at 10,000 g for 5 minutes and 20 μL cell lysate was transferred to a

96-well plate. To quantify luciferase expression, 100 μL Luciferase Assay

Reagent was added to each well and the luminescence was read using a

149

SpectraMax microplate reader (Molecular Devices). Luciferase activity was

normalized to the total protein content measured from the cell lysate of each well

using the BCA assay (Thermo Scientific). Data was presented relative to the

control, which received no siRNA treatment.

5.2.9 In Vivo Luciferase Silencing Efficiency: MDA-MB-231-Luc cells were

engrafted into the mammary fat pad of female nude mice (2 x 106 cells/mouse).

Once the tumors reached an average of 250 mm3, the mice were randomly

sorted into 5 groups (n=3): 1) PBS control, 2) PEG-ECO/siLuc, 3) PEG(HZ)-

ECO/siLuc, 4) RGD-PEG-ECO/siLuc, 5) RGD-PEG(HZ)-ECO/siLuc. All siRNA

nanoparticle variations were formulated at 1.0 mg/kg siRNA in a total injection

volume of 150 μL. All mice received a single intravenous tail vein injection of the

various nanoparticle formulations following bioluminescent imaging on day 0.

Expression of luciferase was quantified using bioluminescence imaging on day 0,

1, 3, 5, and 7. The bioluminescence signal intensity was quantified from a region

of interest (ROI) placed over the tumor area. Data was normalized to the average

signal intensity of day 0.

5.2.10 Fluorescence Molecular Tomography: Fluorescence imaging of siRNA

accumulation within primary MDA-MB-231 mammary fat pad tumors was

performed using the FMT 2500 quantitative fluorescence tomography system

(Perkin-Elmer). Mice were treated with an intravenous tail vein administration of

AlexaFluor 647-conjugated siRNA (1.0 mg/kg) with the various ECO nanoparticle

formulations in a total injection volume of 150 μL. The mice were imaged before

150

and after intravenous injection of the nanoparticles at 30 min, 1 h, 2 h, 4 h, 8 h,

and 24 h.

5.2.11 Ex vivo flow cytometry and confocal microscopy: Mice treated with AF

647-loaded ECO nanoparticles were sacrificed at 48 hours post-injection

whereupon the primary tumor was resected and disaggregated into single cell

suspensions using mechanical force and disaggregation solution as described

previously (61). The cell suspension was stained with FITC-conjugated mouse

MAb against human epithelial antigen (EpCAM) (HEA125; Miltenyi Biotec,

Auburn, CA) in the dark and on ice for 10 minutes. After staining, the cells were

washed and centrifuged, fixed with paraformaldehyde, and finally passed through

a 35μm cell strainer (BD Biosciences). Flow cytometry was conducted using the

fluorescein channel for HEA-FITC and Cy5 channel for AF647-conjugated siRNA

delivered by the ECO nanoparticles for a total of 10,000 cells per each sample

using a BD FACSCalibur flow cytometer. Gating within the fluorescein channel

was used to identify EpCAM (+) and EpCAM (-) populations. Each formulation

was conducted in triplicate and the data presented represents the mean

fluorescence intensity and standard deviation. Following flow cytometry, the cell

suspensions were examined under an Olympus FV100 confocal microscope.

5.2.12 Statistical analyses

Statistical values were defined using unpaired Student’s t-test, with p < 0.05

considered to be statistically significant.


151

5.3.1 Surface modification of ECO/siRNA nanoparticles with pH-cleavable

PEG layer restores intrinsic pH-sensitive activity

The chemical structure of ECO contains various amino groups such that it

carriers a net positive charge at neutral pH. These amine groups electrostatically

complex with the siRNA cargo and contribute towards the pH-sensitive

amphiphilic characteristic of the delivery system. The amino groups, across a

range of pKa’s, become protonated in an acidic environment to promote pH-

dependent membrane disruption to allow for endolysosomal escape. At an N/P

ratio of 8, ECO/siRNA nanoparticles exhibit a zeta potential of 22.3 ± 1.73 mV at

neutral pH. With increasing acidity, unmodified ECO/siRNA nanoparticles exhibit

a pH-sensitive and time-dependent increase in zeta potential correlating to the

protonation of the cationic ethylenediamine head group (Figure 5.1A). This

protonation is hypothesized to enhance the electrostatic interactions between the

ECO carrier and the anionic membrane lipids to promote bilayer destabilization to

enable escape into the cytosol. It was observed that modification of the siRNA

nanoparticle surface with mPEG3400 at a 2.5 mol% through thiol-maleimide

chemistry decreased the overall zeta potential to 12.3 ± 1.39 mV (Figure 5.1B).

While unmodified ECO/siRNA nanoparticles exhibited pH-sensitivity at pH 6.5

and 5.4, this behavior was attenuated in PEG-modified nanoparticles. After 4

hours of incubation in PBS solutions at pH 6.5 and 5.4, PEGylated ECO/siRNA

nanoparticles carried a zeta potential of 17.4 ± 1.1 mV and 18.6 ± 2.9 mV,

respectively, compared to 32.5 ± 2.7 mV and 39.8 ± 3.1 mV for unmodified

ECO/siRNA nanoparticles. This suggests that the surface aqueous phase formed

152

by PEGylation may impede the protonation of the cationic head group. This was

confirmed with the observation that the pH-sensitivity is further diminished

towards neutrality by increasing the PEG surface density to 10 mol% (Figure

5.1D).

The insertion of the acid-labile hydrazone linkage within the PEG moiety

created a pH-cleavable PEG layer to restore the pH-sensitivity of the core

ECO/siRNA nanoparticles (Figure 5.1C). Hydrazone is a well-characterized

linkage known to hydrolyze at pH levels corresponding to the environment of the

endolysosomal compartments (275). The hydrolysis of hydrazone occurs when

the –C=N nitrogen is protonated causing a nucleophilic attack of water and the

ultimate cleavage of the C-N bond. Previously, the hydrazone linkage has found

popularity as a means to conjugate chemotherapeutics, such as doxorubicin, to a

wide array of drug delivery systems and prodrugs to enhance intracellular

release (275,276). This particular hydrazone-modified PEG linkage has also

been used previously to create PEG(HZ)-phosphatidylethanolamine conjugates

capable of forming micelles (272). The hydrazone-based micelles were found to

be stable at physiological pH but highly sensitive to mildly acidic pHs, resulting in

robust degradation of micelles at pH 5.5. Similarly, the observed increase in zeta

potential at pH 6.5 and 5.4 presumably corresponds to the acid-catalyzed

hydrolysis of the hydrazone linkage and subsequent shedding of the PEG layer

whereupon the cationic ECO/siRNA core nanoparticle surface is exposed. Once

exposed, the ethylenediamine head group within the ECO/siRNA nanoparticles

becomes protonated. At pH 7.4, the zeta potential remains constant at ~12 mV

153

indicating that the PEG layer remains intact as a result of the hydrazone linkage

stability. Importantly, the stability of surface charge at pH 7.4 suggests the

ECO/siRNA nanoparticles will remain PEGylated within the bloodstream at the

normal physiological pH. Following exposure to pH 5.4, the hydrazone bond is

degraded to remove the PEG layer. In turn, the surface zeta potential of

PEG(HZ)-ECO/siRNA nanoparticles gradually increases and after 4 hours is

similar to that of the unmodified ECO/siRNA nanoparticles, 36.3 ± 1.9 mV and

39.8 ± 2.8 mV, respectively. However, the time to reach the maximum zeta

potential is prolonged, possibly due to the slower kinetics involved with the

hydrolysis of the hydrazone linkage.

Figure 5.1. Zeta potential of A) ECO/siRNA, B) PEG-ECO/siRNA, and C) PEG(HZ)-

ECO/siRNA nanoparticles incubated in PBS solutions at pH levels corresponding to

stages of intracellular trafficking (pHs 7.4, 6.5, 5.4). D) Increasing the PEGylation

surface density inhibits the pH-sensitive protonation of the ECO/siRNA nanoparticles.

154

We have previously shown that the protonation of the cationic head group

of ECO is directly coupled with the ability to induce pH-sensitive membrane

disruption, a key step for successful and efficient cytosolic delivery of siRNA

(221). To compare the effect of pH-cleavable to non-cleavable PEGylation, we

examined the pH-sensitive hemolytic activity of ECO/siRNA nanoparticles

modified with both PEGylation strategies (Figure 5.2A). Non-cleavable PEG-

ECO/siRNA nanoparticles had a significantly lowered ability to induce hemolysis

at pH 6.5 and 5.4 compared to unmodified ECO/siRNA nanoparticles. Again, this

is indicative of the PEG layer inhibiting the interactions with the lipid membrane

of the blood cells and also the protonation of the cationic head group of ECO. In

alignment, increasing the PEG surface density further inhibited the hemolytic

activity of the non-cleavable PEGylated nanoparticles (Figure 5.2B). Conversely,

the pH-cleavable PEG(HZ)-ECO/siRNA nanoparticles induced pH-sensitive

hemolysis on par with unmodified ECO/siRNA nanoparticles. As the hemolytic

activity was evaluated 2 hours following exposure of the red blood cells to the

nanoparticles, both formulations of nanoparticles would have reached similar

levels of protonation, as observed in Figure 1A and C, indicating the cleavage of

the hydrazone linkage and subsequent shedding of the PEG layer (Figure 5.1A

and C).

155

Figure 5.2. A) Comparison of hemolytic activity of ECO, PEG-ECO, and PEG(HZ)-ECO

siRNA nanoparticles at pH levels corresponding to stages of intracellular trafficking. B)

Increasing the PEGylation surface density inhibits the pH-sensitive hemolytic activity of

ECO/siRNA nanoparticles. Relative hemolytic activity was calculated with respect to the

hemolytic activity of 1% Triton-X-100.

5.3.2 pH-cleavable RGD-PEG modification induces potent in vitro silencing

efficiency

To facilitate ligand-specific uptake of the ECO/siRNA nanoparticles into

the target population of cells, a cyclic-RGD (RGD) peptide was conjugated to

both pH-cleavable and non-cleavable PEG moieties. Cellular uptake into MDA-

MB-231 human breast cancer cells was quantified using flow cytometry with

nanoparticles formulated with fluorescently labelled siRNA (Figure 5.3A). The

inclusion of the hydrazone linkage in both RGD-targeted and non-targeted

ECO/siRNA nanoparticles had no significant difference in the ability of the

nanoparticles to gain internalization into the cells when compared to the non-

156

cleavable counterparts. Unmodified ECO/siRNA nanoparticles exhibited robust

cellular uptake due to strong ionic interactions with the anionic cellular

membrane. PEGylation endows neutrality to the nanoparticle surface and

impedes such interactions with the cell surface. The addition of the RGD

targeting peptide enhanced the cellular uptake and internalization due to specific

binding of the RGD peptide to the αvβ3 integrin known to be present on the

cellular surface of the MDA-MB-231 cells (277).

Surface modification of nanoparticles has been shown to influence the

endocytic mechanism through which they are internalized by cells (142,278).

Further, the endocytic mechanism can dictate the fate of nanoparticles within the

intracellular trafficking pathways. By using a series of known pharmacological

inhibitors of various endocytic pathways (279), the primary mechanism of uptake

was elucidated for the various formulations of ECO/siRNA nanoparticles in MDA-

MB-231 cells: 1) incubation of cells at 4⁰C to inhibit energy-dependent endocytic

mechanisms, 2) cytochalasin D is generally classified as an inhibitor of

macropinicytosis/phagocytosis but recently has been implicated with inhibition of

clathrin- and caveolae-mediated pathways (280), 3) Genistein inhibits caveolae-

mediated endocytosis and 4) Nocodazole inhibits clathrin-mediated pathways.

PEGylated ECO/siRNA nanoparticles were found to be internalized primarily via

clathrin-mediate endocytosis while RGD-targeted nanoparticles entered primarily

via caveolae-mediated endocytosis (Figure 5.3B). Interestingly, unmodified

ECO/siRNA nanoparticles were found to rely on both energy-dependent and

independent mechanisms suggesting that the ECO lipid may be able to directly

157

fuse with the phospholipid membrane of cells. Clathrin- and caveolae-dependent

endocytosis of nanoparticles are often transferred to the lysosomes for

degradation, therefore, the ability of both RGD-targeted and non-targeted

nanoparticles to escape from the endolysosomal pathway is an important step for

achieving gene silencing. No significant difference was observed in endocytic

pathways between pH-cleavable and non-cleavable surface modifications (data

not shown).

The in vitro luciferase silencing efficacy of the surface modified

ECO/siRNA nanoparticles was evaluated in the MDA-MB-231-Luc cell line

(Figure 5.3C). We have shown that unmodified ECO/siRNA nanoparticles induce

potent and sustained gene silencing upwards of 95% due to their ability to readily

become internalized, escape from the endolysosomal pathway, and release the

cargo siRNA into the cytosol (172,221). Accordingly, ECO/siRNA nanoparticles

achieved 92.33 ± 2.08% luciferase silencing 72 hours post-treatment in MDA-

MB-231-Luc cells. The luciferase silencing efficiency was significantly inhibited

upon non-cleavable PEGylation of the nanoparticles (PEG-ECO/siRNA) to only

23.45 ± 1.52% after 72 hours. While decreased cellular uptake contributes to the

attenuated silencing efficiency, our hemolysis assay data suggests PEGylation

also interferes with the ability of the nanoparticles to escape from the

endolysosomal pathway (Figure 5.2). Indeed, the silencing efficiency significantly

increased to 47.86 ± 10.59% when the pH-cleavable PEG was used when

compared to PEG-ECO/siRNA. This observation was highlighted with the

addition of the RGD targeting peptide. Non-cleavable RGD-PEG-ECO/siRNA

158

nanoparticles only achieved 54.17 ± 10.01% luciferase silencing while the pH-

cleavable RGD-PEG(HZ)-ECO/siRNA formulation reached 83.64 ± 4.58%

luciferase silencing 72 hours post-treatment.

5.3.3 Inclusion of hydrazone linkage enhances endosomal escape

The ability of the hydrazone linkage to enable successful endolysosomal

escape was confirmed through live cell confocal imaging (Figure 5.4). MDA-MB-

231 cells were transfected with pH-cleavable and non-cleavable RGD-targeted

ECO nanoparticles formulated with a fluorescently labelled siRNA (red) while co-

stained with Lysotracker (green) to visualize the acidic compartments of the

endosomes and lysosome. Images taken after 10 minutes reveal that both RGD-

targeted nanoparticle formulations have similar interactions with the cellular

membranes, in accordance with similar levels of cellular uptake quantified in

Figure 5.3A. At 3 hours, both formulations exhibit strong co-localization (yellow)

with the late endosomes and lysosomes, consistent with the intracellular

trafficking of caveolae-mediated endocytosis. However, 6 hours post-treatment,

the non-cleavable RGD-targeted nanoparticles appear contained within the

endolysosomes as evident by the co-localization of the siRNA and Lysotracker

fluorescent signal. In contrast, the pH-cleavable RGD-targeted nanoparticles

appear to have successfully escaped from the endolysosomal pathway. Minimal

co-localization of the siRNA and Lysotracker signal is observed and the

dispersed siRNA signal within the cytosol indicates the siRNA has been released

from the nanoparticles, as seen with unmodified ECO/siRNA nanoparticles

(172,221). The inability of the non-cleavable RGD-targeted nanoparticles to

159

escape into the cytosol further validates the observed discrepancy in gene

silencing efficiency when compared with the pH-cleavable counterpart (Figure

5.3C).

Figure 5.3. A) Cellular uptake of unmodified, PEG-, PEG(HZ)-, RGD-PEG-, and RGD-

PEG(HZ)-modified ECO/siRNA nanoparticles quantified with flow cytometry using an

AF647-labeled siRNA. B) Cellular uptake of nanoparticle formulations using inhibitors for

the different mechanisms of endocytosis: 4⁰C: energy-dependent, Cytochalasin D:

macropinicytosis, phagocytosis, clathrin- and caveolae-dependent, Genistein: caveolae-

mediated, Nocodazole: clathrin-mediated. C) Luciferase silencing of unmodified, PEG-,

PEG(HZ)-, RGD-PEG-, and RGD-PEG(HZ)-modified ECO/siRNA nanoparticles in MDA-

MB-231-luc triple-negative breast cancer cells.

160

Figure 5.4. Confocal microscopy images of MDA-MB-231 cells incubated with RGD-

PEG-, and RGD-PEG(HZ)-modified ECO/siRNA nanoparticles at 10 min, 3 hr, and 6 hr.

DAPI, cell nucleus (blue); Lysotracker DND-26, lysosomes (green); siRNA, AF-647 (red).

161

The endosomolytic agent chloroquine that causes endosome rupture and

content release into the cytosol was used to further verify the role the hydrazone

linkage plays in promoting escape (281). For both targeted and non-targeted

nanoparticles, the silencing efficiency of pH-cleavable nanoparticles was not

affected by chloroquine whereas non-cleavable nanoparticles exhibited a

significantly enhanced silencing efficiency (Figure 5.5). The data suggests that

upon treatment with chloroquine, complexes modified with the non-cleavable

PEG were trapped within endolysosomes were then freed into the cytosol while

nanoparticles modified with the pH-cleavable PEG moiety had already escaped

from the endolysosomes.

Figure 5.5. Luciferase silencing efficiency after 48 hours in MDA-MB-231-luc cells

transfected with or without the endosomolytic agent chloroquine.

162

5.3.4 Targeted pH-sensitive nanoparticles exhibit potent and sustained in

vivo gene silencing

To study differences in the in vivo gene silencing efficiency of the

developed pH-cleavable surface modification strategy, the delivery of anti-

luciferase siRNA (1.0 mg/kg) following a single systemic administration of the

was investigated using bioluminescent imaging in a primary mammary fat pad

MDA-MB-231 breast cancer tumor model (Figure 5.6A and B). Unlike the in vitro

luciferase silencing findings, the non-targeted ECO/siRNA nanoparticles, both

pH-cleavable and non-cleavable formulations, had negligible silencing effect on

luciferase expression, suggesting minimal cellular uptake of the siRNA into the

tumor cells. In contrast, both RGD-targeted formulations induced luciferase

silencing to varying degrees for up to 7 days: the non-cleavable RGD-targeted

ECO achieved 52.04% luciferase silencing while the pH-cleavable RGD-targeted

formulation achieved 85.17% silencing compared to the no treatment control on

day 7. This trend is consistent with the enhancement of silencing efficiency

observed in vitro (Figure 5.3C).

163

Figure 5.6. In vivo luciferase silencing efficiency following a single i.v. treatment with

various surface-modified ECO/siRNA nanoparticles (1.0 mg/kg siRNA dose). A)

Quantification of bioluminescence signal from ROIs drawn over the tumor. B)

Representative BLI images of the different treatment groups.

5.3.5 Targeting ligand enhances tumor retention of nanoparticles by

promoting internalization within tumor cells

The tumor localization and subsequent delivery of functional siRNA

following systemic administration of the various siRNA nanoparticle formulations

was investigated. Fluorescence molecular tomography (FMT) enabled the

analysis of tumor accumulation and retention of the nanoparticle-delivered siRNA

over time. Mice received a single systemically administered dose of

fluorescently-labeled siRNA (AF 647) delivered by the various surface modified

ECO/siRNA nanoparticle formulations. Recent studies have demonstrated that

the presence of a targeting ligand does not impact the initial tumor accumulation

of the nanomedicine delivery system, but rather facilitates tumor cell targeting

164

resulting in longer tumor retention (34, 43). In alignment, longitudinal FMT

imaging studies revealed that the initial tumor localization of siRNA delivered by

the targeted and non-targeted nanoparticles was not significantly different for the

first 4 hours following systemic administration (Figure 5.7A and B). By 8 hours

however, RGD-targeted nanoparticles were observed to accumulate within the

tumor to a greater extent than the non-targeted formulations, regardless of

whether the PEG modification was pH-cleavable or not. At 24 hours, both RGD-

targeted nanoparticle formulations were retained within the tumor while the non-

targeted formulations appeared to be washed out, due in part to the inability of

the non-targeted nanoparticles to promote cellular internalization, as evident by

the minimal presence of siRNA signal from the tumor ROI.

Figure 5.7. Tumor accumulation and retention of surface-modified ECO/siRNA

nanoparticles following i.v. administration. A) Representative FMT images of a single

mouse from each treatment group over 24 hours post-treatment with nanoparticles

formulated with an AF647-tagged siRNA. An ROI was drawn over the area containing

the tumor. B) Quantification of fluorescence signal from each ROI.

165

Active targeting of the ECO/siRNA nanoparticles using the RGD peptide

may aid in the specific selection of cancer cells within the tumor site and promote

internalization of the nanoparticles to a greater extent inside the target cells

compared to non-target cells. To evaluate if selective uptake dependent upon cell

type occurred, ex vivo flow cytometry was used to quantify siRNA internalization

to study differences in cellular uptake of the targeted and non-targeted

nanoparticles between human tumor and murine stromal cells. At 48 hours,

tumors from the systemically treated mice were excised, disaggregated into

single cell suspensions, and stained for the epithelial cellular adhesion molecular

(EpCAM) using HEA-FITC to distinguish between the human MDA-MB-231

cancer cells and the murine stromal cells (61). FACS analysis of the cell

suspensions in the FITC channel revealed two distinct cellular populations:

EpCAM (+), human cancer cells and EpCAM (-), murine stromal cells (Figure

5.8A). Gating for EpCAM (-) cells in the AlexaFluor 647 channel revealed a

minimal shift in fluorescence between both targeted and non-targeted

nanoparticle formulations compared to the PBS negative control (Figure 5.8B). A

distinct shift was observed in EpCAM (+) cells for targeted nanoparticles

compared to both the non-targeted and PBS control groups, suggesting that the

RGD-targeted nanoparticles are internalized more efficiently and preferentially by

the human cancer cells (Figure 5.8C). Contour plots highlight the two distinct

EpCAM (+) and EpCAM (-) cellular populations (Figure 5.8D). While the siRNA

signal from non-targeted nanoparticle formulations was evenly distributed

throughout both populations, the siRNA signal in EpCAM (+) cells was markedly

166

higher for the RGD-targeted nanoparticle formulations. No difference was

observed between pH- and non-cleavable formulations (data not shown).

Figure 5.8. Flow cytometry and confocal microscopy analysis of single cell suspensions

obtained from primary MDA-MB-231 mammary fat pad tumors following i.v.

administration of various surface modified ECO/siRNA nanoparticles. A) FACS analysis

following staining for EpCAM expression using a FITC labeled anti-EpCAM antibody in

tumor cell suspensions in the FITC channel revealed two populations of EpCAM(+) and

EpCAM(-) cells. B) Gaiting for the EpCAM(-) cell population and examining in the AF647

channel revealed minimal uptake of both non-targeted and RGD-targeted nanoparticles

when compared to PBS control (data shown for pH-cleavable systems). C) Gaiting for

the EpCAM (+) cell population in the AF647 channel revealed a significant shift for RGD-

targeted nanoparticles compared to the non-targeted and PBS control (data shown for

pH-cleavable systems). D) Data represented as a two dimensional contour plot

highlights the EpCAM (-) and EpCAM (+) populations along the FITC channel axis. For

targeted nanoparticles, fluorescent signal from siRNA in AF647 channel axis is distinctly

greater in the EpCAM (+) population. For non-targeted nanoparticles, the AF647 signal

167

is evenly distributed between EpCAM (-) and EpCAM (+) populations. E) Single cell

suspensions prepared from primary tumor disaggregates were examined under a

confocal microscope. Targeted nanoparticle formulations display a greater amount of

siRNA signal (red) in the EpCAM (+) (green) cells.

Following flow cytometry, the cell suspensions were observed under a

confocal microscope (Figure 5.8E). Microscopy analysis revealed both pH-

cleavable and non-cleavable RGD-targeted nanoparticle formulations were

readily internalized by EpCAM (+) cells whereas the non-targeted formulations

showed minimal uptake. While the targeted ECO/siRNA nanoparticles did not

initially transport the siRNA cargo to the tumor site more efficiently than non-

targeted nanoparticles according to the FMT data (Figure 5.7), it appears that

RGD peptide enabled cell-specific recognition and internalization of the siRNA.

The enhanced cellular uptake correlated to the prolonged retention of fluorescent

signal within the tumor ROI as determined by FMT (Figure 5.7) and also the

sustained luciferase silencing efficiency of the targeted nanoparticles (Figure

5.6). As internalization of siRNA from pH-cleavable and non-cleavable RGD-

targeted nanoparticle formulations appeared similar according to FMT and ex

vivo confocal microscopy, the improvement in silencing efficiency of the pH-

cleavable formulation may be a direct result of enhanced endolysosomal escape.

A surface modification strategy that combines PEGylation and active

targeting not only allows the ECO/siRNA nanoparticles to retain stealth

properties during circulation and accumulate at the tumor site by passive

targeting, but the PEG shielding moiety provides a tether for versatile

168

incorporation of various active targeting ligands. When further combined with the

pH-cleavable hydrazone linkage, the developed surface modification strategy

may significantly improve the therapeutic efficacy of the ECO/siRNA nanoparticle

delivery system compared to the non-targeted and non-cleavable systems.

Taken together with the in vivo luciferase silencing data, the differences in

silencing efficiency across all formulations suggest: i) targeted nanoparticles are

internalized to a greater extent by the tumor cells and ii) once internalized,

formulations with the pH-cleavable PEG modification are more effective in

delivering siRNA into the cytosol due to enhanced endolysosomal escape.

5.4 Conclusion

In summary, we have leveraged and incorporated the pH-cleavable

hydrazone linkage into a PEG spacer to enhance the transfection efficiency of

our PEGylated ECO/siRNA nanoparticle system both in vitro and in vivo. While

the non-cleavable PEG strategy displayed minimal gene knockdown, the pH-

cleavable PEG significantly enhanced RNAi activity, mediated by a restoration in

the ability to escape from the endolysosomes. When functionalized with an

RGD targeting peptide, the targeted and pH-cleavable PEG modification

achieved a silencing efficiency similar to that of unmodified ECO/siRNA

nanoparticles. The initial tumor accumulation of the non-targeted and targeted

nanoparticles was approximately equal within the first 4 hours of delivery;

however, RGD-targeted nanoparticles remained localized within the tumor area

to a greater extent over 24 hours. The greater uptake within tumor cells coupled

169

with the added pH-sensitivity allowed the pH-cleavable RGD-targeted

nanoparticles to achieve greater in vivo luciferase silencing activity compared to

the non-cleavable targeted formulation.

5.5 Acknowledgments




170

Chapter 6

Targeting eIF4E with a Dual pH-responsive siRNA Delivery System to

Overcome Drug Resistance in Triple-Negative Breast Cancer

171

6.1 Introduction

Breast cancer remains the leading diagnosis of cancer cases within

women in the United States (1, 2). Recently, the rate of mortality associated with

breast cancer has experienced a sharp decline, due in part to improved

diagnostic methods, the advent of targeted therapies, and refinements in the

dosing and formulation of systemic chemotherapies (284–286). As described in

Chapter 4, triple-negative breast cancer (TNBC) is a highly aggressive subtype

of breast cancer that accounts for approximately 10-15% of all diagnosed breast

cancer cases (287). TNBCs have limited treatment options due to their lack of

hormone targets, which typically include estrogen receptor (ER), progesterone

receptor (PR), and HER2-negative status (7, 8). Due to the lack of established

therapeutic targets, patients that present with TNBC are not candidates for

target-specific therapies directed at ER, PR, or HER2 receptors leaving systemic

chemotherapy as the sole therapeutic option. While initially responsive to

anthracycline- and taxane-based chemotherapy regimens, such as doxorubicin

and paclitaxel, TNBCs have a high incidence of drug resistance leading to

relapse and metastasis, leaving the 5 year survival rate at only 20% (29,208).

Therefore, there is an urgent need to uncover and validate therapeutic targets

that can circumvent drug resistance to improve the outcome of TNBC.

The eukaryotic translation initiation factor 4E (eIF4E) is the 5’ cap mRNA-

binding protein involved in the complex and multistep process of mRNA

translation, where it plays a rate limiting role for all cap-dependent translation

(288). It has been demonstrated that eIF4E exerts specific regulation over mRNA

172

targets with long 5’ untranslated regions rich in G/C content. Included within

these mRNAs are gene involved with cellular growth, proliferation, differentiation

and apoptosis (289). Within the context of cancers, eIF4E favors the selective

translation of a wide array of mRNAs implicated with tumorigenesis including: c-

Myc, cyclin D1, survivin, Bcl-2, Bcl-xL, VEGF, and MMP-9 (290,291). Such

control over the upregulation of downstream gene products suggests that eIF4E

overexpression can result in multiple modes of resistance to chemotherapeutic

agents.

Specifically within TNBCs, eIF4E expression correlates with overall and

disease-free survival; patients with elevated eIF4E expression exhibit a worse

prognosis (292–297). In fact, patients with stage I-III breast cancer and eIF4E

overexpression greater than 7-fold exhibit a greater rate of recurrence and

cancer-related death compared to patients with less than 7-fold overexpression

(298). Additionally, the expression of eIF4E may also play a predictive role in

surmising the response of TNBCs towards chemotherapy. A retrospective study

determined that patients whose tumors presented with low eIF4E expression

following neoadjuvant therapy had lower cancer recurrence compared with those

whose tumors exhibited high eIF4E overexpression (292). Therefore, knowledge

of eIF4E expression could help to guide future treatment regimens.

Previous studies have established that silencing of eIF4E in vitro induces

cell cycle arrest and enhances the chemosensitivity of MDA-MB-231 TNBC cells

to multiple chemotherapies, including paclitaxel, through an increase in the

Bax/Bcl-2 ratio involved in chemotherapeutic drug-induced apoptosis (299–301).

173

As such, the role of eIF4E as a potential cancer therapeutic has compelled the

exploration of therapies aimed to regulate eIF4E activity. Currently, there are a

handful of therapeutic strategies aimed to either directly or indirectly block eIF4E

expression or activity in various phases of pre-clinical and clinical development: i)

gene therapy using antisense oligonucleotides or siRNAs (302,303), ii) suicide

gene therapy (304), iii) hormone analog-4EBP fusion peptide (305), iv) inhibitory

small molecules (ie, ribavirin, 4EGI-1) (306,307).

Of particular interest, antisense or RNAi-based gene therapies have been

used to directly modulate the expression of eIF4E. The antisense oligonucleotide

LY2275796 has demonstrated that eIF4E silencing can reduce in vivo tumor

growth in PC-3 prostate and MDA-MB-231 breast cancer models (308). Despite

promising initial pre-clinical success, a Phase I clinical trial found that eIF4E

inhibition was not sufficient to achieve tumor inhibition (309). As human cancers

inevitably contain magnitudes more complexity compared to animal models, the

clinical data suggests that human cancers cells may bypass eIF4E-dependent

pathways due to the presence of redundant mechanisms, thus highlighting the

necessity for combination therapy.

While various attempts have been made to create eIF4E therapies,

siRNA-mediated RNAi strategies have yet to be employed in vivo. Further, to our

knowledge, the effect of eIF4E silencing in a drug-resistant TNBC cell line has

yet to be established or be translated into a viable systemically-administered

therapeutic regimen. As discussed in Chapter 5, a targeted, pH-cleavable

PEGylated siRNA delivery system may exhibit superior in vivo therapeutic

174

efficacy due to enhanced cytosolic delivery of siRNA into target cancer cells. The

present study focuses on leveraging the recently developed dual pH-sensitive

and peptide-targeted siRNA delivery system from Chapter 5 to silence eIF4E

and resensitize drug-resistant TNBC to paclitaxel therapy.


6.2.1 Cell Culture: Human triple-negative breast cancer MDA-MB-231 cells

expressing a luciferase reporter enzyme (MDA-MB-231-Luc) were obtained from

ATCC (American Type Culture Collection) and cultured in Dulbecco’s modified

Eagle’s media (Invitrogen) and supplemented with 10% fetal bovine serum

(Invitrogen), 100 μg/mL streptomycin, and 100 unites/mL penicillin (Invitrogen).

The cells were maintained in a humidified incubator at 37⁰C and 5% CO2. A

paclitaxel-resistant subline of the MDA-MB-231 cell line (MDA-MB-231.DR) was

induced by chronic exposure of MDA-MB-231 cells to 5 nM paclitaxel with

increasing concentration at each passage over 8 weeks to reach a final

concentration of 20 nM. Initially, cells were maintained at 5 nM paclitaxel (PTX)

with increasing concentration in increments of 5 nM after every other passage

over 8 weeks to reach a final concentration of 20 nM. Once resistance to

paclitaxel was confirmed, the MDA-MB-231.DR cells were maintained at 5 nM

PTX.

6.2.2 Preparation of PEG-modified ECO/siRNA nanoparticles: The ECO lipid

carrier was synthesized as described previously (221). ECO (MW=1023) was

dissolved in 100% ethanol at a stock concentration of 2.5 mM for in vitro

experiments and 50 mM for in vivo experiments. The siRNA was reconstituted in

175

RNase-free water to a concentration of 18.8 μM for in vitro experiments and 25

μM for in vivo experiments. For in vitro experiments, an siRNA transfection

concentration of 100 nM was used. ECO/siRNA nanoparticles were prepared at

an N/P ratio of 8 by mixing predetermined volumes of ECO and siRNA for a

period of 30 minutes in RNase-free water (pH 5.5) at room temperature under

gentle agitation to enable complexation between ECO and siRNA. The total


remained fixed at 1:20. For RGD-PEG(HZ)-modified ECO/siRNA nanoparticles,

RGD-PEG(HZ)-Mal was first reacted with ECO in RNase-free water at 2.5 mol%

for 30 minutes under gentle agitation and subsequently mixed with siRNA in

RNase-free water for an additional 30 min. RGD-PEG(HZ)-mal was prepared at a

stock solution concentration of 0.32 mM in RNase-free water. Again, the total


remained fixed at 1:20.

6.2.3 Semi-quantitative real-time PCR analyses: Real-time PCR studies were

performed as described previously. Briefly, MDA-MB-231 or MDA-MB-231.DR

cells (100,000 cells/well) were seeded overnight onto 6-well plates. The cells

were then treated with ECO nanoparticles with a non-specific siRNA or eiF4E-

specific siRNA (eIF4E: AAGCAAACCUGCGGCUGAUCU (GE Dharmacon) [33]).

At each indicated time point, total RNA was isolated using the RNeasy Plus Kit

(Qiagen, Valencia, CA) and reverse transcribed using the iScript cDNA Synthesis

System (Bio-Rad, Hercules, CA). Semi-quantitative real-time PCR was

conducted using iQ-SYBR Green (Bio-Rad) according to manufacturer’s

176

recommendations. In all cases, differences in RNA expression for each individual

gene were normalized to their corresponding GAPDH RNA signals.

Primer sequences:

eIF4E:

Sense 5’- CTACTAAGAGCGGCTCCACCAC-3’

Antisense 5’- TCGATTGCTTGACGCAGTCTCC-3’

VEGF:

Sense 5’-CCATGAACTTTCTGCTGTCTT-3’

Antisense 5’-ATCGCATCAGGGGCACACAG-3’

Survivin

Sense 5’-ATGGCCGAGGCTGGCTTCATC-3’;

Antisense 5’-ACGGCGCACTTTCTTCGCAGTT-3’

Cyclin-D

Sense, 5’-AGACCTGCGCGCCCTCGGTG-3’

Antisense, 5’-GTAGTAGGACAGGAAGTTGTTC-3’

GAPDH

Sense 5’-ACGGATTTGGTCGTATTGGGCG-3’;

Antisense 5’-CTCCTGGAAGATGGTGATGG-3’.

6.2.4 Western blot analyses: Immunoblotting analyses were performed as

previously described. Briefly, MDA-MB-231 and MDA-MB-231.DR cells were

seeded into 6-well plates (1.5 × 105 cells/well) and allowed to adhere overnight.

The cells were then treated with RGD-PEG(HZ)-ECO/siRNA complexes (N/P=8,

siRNA concentration of 100 nM) in complete growth medium. After 5 days,

177

detergent-solubilized whole cell extracts (WCE) were prepared by lysing the cells

in Buffer H (50 mM -glycerophosphate, 1.5 mM EGTA, 1 mM DTT, 0.2 mM

sodium orthovanadate, 1 mM benzamidine, 10 mg/mL leupeptin, and 10 mg/mL

aprotinin, pH 7.3). The clarified WCE (20 mg/lane) were separated through 10%

SDS-PAGE, transferred electrophoretically to nitrocellulose membranes, and

immunoblotted with the primary antibodies, anti-eIF4E (1:1000; Abcam) and anti-

-actin (1:1000; Santa Cruz Biotechnology).

6.2.5 Cytotoxicity Assay: Cytotoxicity assays were performed in a 96-well plate

as described previously, by seeding 2,000 MDA-MB-231 or MDA-MB-231.DR

cells/well. First, RGD-PEG(HZ)-modified ECO/siRNA nanoparticles were used to

transfect MDA-MB-231 or MDA-MB-231.DR with either siNS or sieIF4E for 48

hours. Next, the wells were washed twice with PBS and incubatiion with various

concentrations of PTX in fresh media. After 2 additional days, the MTT reagent

(Invitrogen) was added to the cells for 4 hours followed by the addition of SDS-

HCl and further incubation for 4 hours. The absorbance of each well was

measured at 570 nm using a SpectraMax spectrophotometer (Molecular

Devices). Cellular viability was calculated as the average of the set of triplicates

for each PTX concentration and was normalized relative to the no treatment

control. Drug resistance was confirmed with an MTT assay to determine the IC50

of paclitaxel. The IC50 was defined as the dose of drug required to inhibit cell

viability by 50%.

6.2.6 In vivo tumor growth inhibition study: For in vivo anti-tumor efficacy

studies, MDA-MB-231.DR cells (2 x 106 cells/mouse) were inoculated in the

178

mammary fat pads of female nu/nu mice. When the tumors reached and average

of 150 mm3, the mice were randomly sorted into 4 groups (n=5): 1) PBS control,

2) RGD-PEG(HZ)-ECO/siNS (1.5 mg/kg siRNA) + PTX (5 mg/kg), 3) RGD-

PEG(HZ)-ECO/sieIF4E (1.5 mg/kg siRNA) + PTX (5 mg/kg), 4) RGD-PEG(HZ)-

ECO/sieIF4E (1.5 mg/kg siRNA). RGD-PEG(HZ)-ECO/siRNA nanoparticles were

administered by intravenous injection into the lateral tail vein while PTX was

administered in 10% DMSO/PBS with an intraperitoneal injection. Tumor growth

was monitored by BLI and tumor size was monitored with caliper measurements.

Three days after the final treatment, the mice were sacrificed to harvest tumor

tissues.

6.2.7 Bioluminescent imaging: Longitudinal imaging of the mice was performed

using the Xenogen IVIS 100 imaging system. D-luciferin (Xenogen) was

dissolved in PBS (15 mg/mL), and 200 μL of the luciferin stock solution (15

mg/mL) was injected i.p. 5 minutes before measuring the light emission. Mice

were anesthetized and maintained under 2.5% isoflurane. Bioluminescent signals

were quantified using Living Image software (Xenogen) by drawing an ROI over

the tumor area.

.

6.2.8 Toxicity, immune response, and pathology studies: Female BALB/c

mice (Jackson Laboratories) were used to study the toxicity and immune

response of systemic treatment with ECO/siRNA and RGD-PEG(HZ)-

ECO/siRNA nanoparticles. Following 1, 3 and 5 injections (n=5 for each amount

of injections) spaced 5 days apart, blood was collected at 2 h and 24 h post-

179

injection. Plasma was isolated from blood samples using Microtainer tubes

(Becton Dickinson). To measure plasma cytokine levels, TNFα, IL-6, IL1-2, INFγ

were quantified by ELISA according to the manufacturer’s instructions

(Invitrogen).


6.3.1. Silencing eIF4E by RGD-targeted pH-cleavable PEG-modified

ECO/siRNA nanoparticles enhances sensitivity to paclitaxel in a drug-

resistance triple-negative breast cancer cell line

The ability of the pH-cleavable RGD-PEG(HZ)-ECO/siRNA nanoparticles

to mediate knockdown of eIF4E mRNA and protein was first evaluated in vitro.

To study the therapeutic consequence of eIF4E downregulation on drug-resistant

breast cancer cells, a paclitaxel-resistant subline of the MDA-MB-231 cell line

(MDA-MB-231.DR) was induced by chronic exposure of MDA-MB-231 cells to

paclitaxel. Initially, cells were maintained at 5 nM paclitaxel (PTX) with increasing

concentration in increments of 5 nM after every other passage over 8 weeks to

reach a final concentration of 20 nM. Once resistance to PTX was confirmed, the

MDA-MB-231.DR cells were maintained at 5 nM PTX. PTX-resistant cells were

found to upregulate eIF4E expression (Figure 6.1A and B). While a widely used

chemotherapeutic agent, PTX has been shown to activate signaling pathways

that both promote and inhibit cell death (310). The mechanism of action for PTX

involves the stabilization of microtubules to interfere with cell division and induce

a mitotic blockade. The inhibition of microtubule function upregulates the

proapoptotic family protein Bax and downregulates the antiapoptotic family

180

protein Bcl-2 (310). At the same time, PTX can also increase expression of

various survival factors and activate the phosphatidylinositol 3-kinase (PI3))/akt

pathway, an important regulation mechanism of cap-dependent translation.

Normally, binding of 4E-BP1 to eIF4E will prevent eIF4E from binding to eIF4G

and initiating cap-dependent translation. PTX has been found to diminish the

suppressive role of 4E-BP1 through hyperphosphorylation to reduce the

association affinity with eIF4E and promote its release (310). By doing so, eIF4E

activity is elevated through a regained association with eIF4G and initiation of

translation. Along these lines, treatment of MDA-MB-231 cells with PTX has been

demonstrated elsewhere to also increase eIF4E expression in a dose-dependent

manner (310). Importantly, treatment of both cell lines with sieIF4E delivered by

targeted and pH-cleavable nanoparticles was able to sustain potent eIF4E mRNA

and protein silencing for upwards of 5 days. Nanoparticles delivering a non-

specific siRNA induced no significant downregulation of eIF4E expression

suggesting that all silencing activity was due to the siRNA and not the ECO

carrier.

181

Figure 6.1. Evaluation of eIF4E mRNA and protein expression as determined by A)

qRT-PCR and B) western blot analysis in MDA-MB-231 and MDA-MB-231.DR cells 5

days following treatment with RGD-PEG(HZ)-ECO/siRNA nanoparticles (N/P=8)

delivering either sieIF4E or siNS (100 nM).

The therapeutic response of eIF4E silencing on enhancing the sensitivity

of breast cancer cells to paclitaxel was determined by quantifying the cell viability

after a combination of eIF4E silencing by the siRNA nanoparticles followed by

treatment with PTX (Figure 6.2). Cells were first treated with RGD-PEG(HZ)-

ECO/siRNA nanoparticles for 48 hours followed by treatment with varying

concentrations of PTX for an additional 48 hours. For all conditions, cell viability

decreased in a PTX concentration-dependent manner. The acquisition of

resistance to PTX in the MDA-MB-231.DR subline was evident by a shift in the

dose-response curve and the IC50. A clear re-sensitization of MDA-MB-231.DR

cells to PTX was observed when eIF4E was down-regulated using siRNA

delivered by RGD-PEG(HZ)-ECO/siRNA nanoparticles. For example, at 0.5

ng/mL PTX, treatment with PTX alone induced 44.6 ± 6.6 % viability in MDA-MB-

231 cells and 80.7 ± 2.9 % viability in the drug-resistant subline. When coupled

with silencing of eIF4E, viability dropped to 7.5 ± 5.4 % and 26.3 ± 3.6 % in MDA-

MB-231 and MDA-MB-231.DR, respectively, using the same concentration of

PTX.

182

Figure 6.2. Dose-response curves as determined by MTT assay of MDA-MB-231 and

MDA-MB-231.DR cells treated with varying concentrations of PTX following prior

treatment with RGD-PEG(HZ)-ECO/siRNA nanoparticles delivering sieIF4E or siNS.

Cells were first treated with RGD-PEG(HZ)-ECO/siRNA nanoparticles for 48 hours

followed by treatment with varying concentrations of PTX for an additional 48 hours.

6.3.2. Combination of siRNA targeting eIF4E and paclitaxel inhibits primary

tumor growth of drug-resistant MDA-MB-231 cells

The ability of the pH-cleavable RGD-PEG(HZ)-modified ECO/siRNA

nanoparticles to re-sensitize PTX-resistant MDA-MB-231.DR tumors was

evaluated in vivo. Female nude mice were engrafted with MDA-MB-231.DR cells

in the mammary fat pad. When the tumors reached approximately 150 mm3 in

183

volume, the mice began receiving alternating treatments with siRNA

nanoparticles (1.5 mg/kg siRNA dose) and PTX (5 mg/kg) every 6 days.

Treatment with nanoparticles delivering non-specific siRNA (siNS) in combination

with PTX had no inhibitory effect on tumor growth. In fact, after several weeks of

treatment, the tumors of mice treated with siNS + PTX grew larger and more

rapidly compared to the no treatment control, as determined by bioluminescent

imaging and tumor volume measurements (Figure 6.3 and Figure 6.4). After 42

days of treatment, the no treatment control tumors were an average of 430.1 ±

37.8 mm3 in volume and weighed 404.9 ± 43.6 mg whereas siNS + PTX tumors

were 560.3 ± 46.2 mm3 in volume and weighed 715.3 ± 101.5 mg (Figure 6.4).

Interestingly, siNS + PTX-treated tumors exhibited elevated levels of eIF4E,

survivin, cyclin D1 and VEGF mRNA compared to the no treatment group,

suggesting that treatment of drug-resistance cancers with PTX can further drive

cancers to become more aggressive (Figure 6.5). This may occur through

activation of the (PI3K)/akt signaling pathway implicated with both cell survival

and drug resistance. As PTX relies upon apoptosis to induce tumor regression,

elevated expression of survivin, an antiapoptotic factor, may contribute to the

observed resistance to PTX therapy: experimental upregulation of survivin has

been shown to confer taxol resistance (311,312). Treatment of tumors with

nanoparticles delivering anti-eIF4E siRNA alone significantly attenuated tumor

growth to 240.4 ± 35.7 mm3 and 256.8 ± 33.5 mg at day 42. This finding is

supported by previously established data which demonstrates that silencing of

eIF4E induces cell growth arrest (308). Likewise, Phase I clinical evaluation of

184

the LY2275796 antisense oligonucleotide targeting eIF4E found only cytostasis,

and not anti-tumor activity, was achieved upon eIF4E downregulation (309). A

combination of sieIF4E and PTX significantly inhibited tumor growth and lead to

tumor regression, 50.2 ± 35.7 mm3 and 103.2 ± 67.4 mg. Significant knockdown

of eIF4E mRNA in addition to several downstream targets including the

antiapoptotic protein survivin, the oncogene cyclin D1, and the angiogenesis

factor VEGF was observed in both groups of mice treated with RGD-PEG(HZ)-

ECO/sieIF4E nanoparticles (Figure 6.5). By observing the downregulation of

these additional targets, the data suggests that targeting eIF4E may inhibit tumor

growth and resensitize cancer cells to PTX through multiple mechanism and

pathways. A downregulation of survivin may help suppress tumor growth by

increasing the susceptibility of cancer cells to apoptosis, particularly when

coupled with PTX therapy. Tumor growth may also be suppressed through a

reduction of angiogenesis, a consequence of VEGF downregulation. The mRNA

expression data in conjunction with the significant tumor regression observed for

the sieIF4E + PTX treatment group indicates that knockdown of eIF4E re-

sensitized the MDA-MB-231.DR cells to the cytotoxic effect of PTX.

185

Figure 6.3. In vivo efficacy of combination therapy involving PTX and RGD-PEG(HZ)-

ECO/sieIF4E nanoparticles. Alternating treatment of siRNA nanoparticles and PTX every

6 days began after 4 weeks once the primary tumors reach an average of 150 mm3. A)

Quantification of bioluminescent imaging over the course of the experiment (data

represents mean ± SE, n=5, *p0.05, **p0.01) and B) BLI images at week 10.

186

Figure 6.4. In vivo efficacy of combination therapy involving PTX and RGD-PEG(HZ)-

ECO/sieIF4E nanoparticles. Alternating treatment of siRNA nanoparticles and PTX every

6 days began after 4 weeks once the primary tumors reach an average of 150 mm3. A)

Tumor growth was monitored using digital caliper measurements (data represents mean

± SE, n=5, *p0.05, **p0.01). B) Primary tumors were resected at week 10 and C) final

tumor weights were obtained (data represents mean ± SE, n=5, *p0.05, **p0.01).

187

A concern of an RNAi-based approach to eIF4E therapy is the implication

of non-specific silencing of eIF4E in healthy tissues. While the inclusion of the

RGD-targeting peptide can enhance selective uptake within tumor cells, as

demonstrated in Chapter 5, accumulation of the siRNA nanoparticles in non-

specific tissues may lead to eIF4E downregulation outside of the tumor. In the

current study, the expression of eIF4E following treatment with the siRNA

nanoparticles was not evaluated in other vital organs, however, it has been

reported elsewhere that no systemic toxicity was observed when 80%

knockdown of eIF4E was achieved in essential organs using antisense

technology (308). This may be explained by the phenomenon known as

oncogene addition whereby cancer cells are overly dependent on the expression

of a single gene for continued survival and proliferation. Under normal conditions,

eIF4E is likely to be inactive due to being bound to the inhibitory 4E-BPs (313). A

reduction in eIF4E levels would therefore have a minimal effect. Cancer cells

characterized with elevated eIF4E expression, however, are more dependent on

eIF4E expression than non-malignant cells or cancer cells with normal eIF4E

expression. The small-molecule inhibitor ribavirin, which inhibits eIF4E from

interacting with the 7-methylguanosine cap structure and 4EG1-1, disrupts the

assembly of eIF4E with eIF4F/eIF4G to inhibit translation, and can selectively

target the proliferation of cells overexpressing eIF4E (306). Additionally, studies

examining the global effect of eIF4E downregulation found that modulation of

eIF4E expression or function has negligible effects on global protein synthesis:

the translation of many growth factors is reliant upon eIF4E expression yet the

188

majority of cellular mRNAs can be translated with minimal eIF4E availability

(302).

Histopathological examination of liver and kidney tissues from mice

receiving the long-term PTX and nanoparticle treatments was performed by

hematoxylin and eosin (H&E) staining (Figure 6.6). No substantial toxicity or

tissue damage to the liver or kidney was observed across all treatment groups.

The absence of toxicity from treatment groups who received multiple

administrations of PTX may be attributed to the relatively low and infrequent

dosing: 5 mg/kg every 6 days compared to the conventional dose of 10 mg/kg.

Treatment groups who received sieIF4E treatment also revealed no structural

damage to the tissues, suggesting any systemic silencing of eIF4E harbors

minimal toxicity. Taken together, these data demonstrate the long-term safety of

a combinatory strategy of PTX and RGD-PEG(HZ)-ECO/sieIF4E nanoparticle

therapy.

Chemoresistance is a critical limitation in the treatment of patients with

TNBC, where the lack of effective targeted therapies has left small-molecule

based strategies as the sole option. Molecular targets exploited for targeted

therapy against drug-resistant TNBCs could contribute significantly to an

improved standard of care. While eIF4E has been explored as a therapeutic

target in TNBCs before, the presented study represents the first evaluation of

eIF4E in a drug-resistance TNBC cell line, therefore adding to the promising

body of work surrounding eIF4E. A distinct advantage of siRNA-based gene

therapy over ASO-mediated therapy is the ability to achieve therapeutic efficacy

189

with a much lower dose. ASOs require a stoichiometric one-to-one ratio of

silencing molecule to target mRNA, unlike siRNAs which can target and degrade

multiple mRNA targets with a single molecule. As such, pre-clinical studies using

ASOs have required a systemic dose of 25 mg/kg in order to suppress tumor

growth (302), whereas an siRNA dose of 1.5 mg/kg was able to achieve a similar

therapeutic effect. For clinical implementation of ASOs, although eIF4E mRNA

and protein expression was found to be down-regulated in tumor biopsies,

minimal tumor response was observed. Similarly, in our study sole targeting of

eIF4E with siRNA induced cytostasis of the tumors, resulting in stable disease.

Therefore, it may be that clinical translation of eIF4E therapy will require

complement treatment with other cytotoxic chemotherapeutics, similar to the

regimen proposed within this study, in order to fully exploit the effect of eIF4E is

silencing.

190

Figure 6.5. Semi-quantitative real-time quantification of eIF4E, Survivin, Cyclin D1, and

VEGF mRNA expression from the resected primary tumors (data represents mean ± SE,

n=5, *p0.05, **p0.0, #p>0.05).

Figure 6.6. Histological evaluation of liver, kidney, and primary tumor.

6.3.3. Long-term systemic administration of RGD-PEG(HZ)-ECO/siRNA

nanoparticles elicits no chronic immune response or organ damage

As nude mice bear an inhibited immune system, such animals are not a

suitable model to study potential immunogenic responses following systemic

administration of ECO/siRNA nanoparticles. Accordingly, immunocompetent

BALB/c mice were used to study the possible immune response following

repeated tail-vein injections for RGD-PEG(HZ)-modified ECO/siRNA

nanoparticles (Figure 6.7). Blood was collected at 2 h or 24 h following injections

following 1, 3 and 5 injections spaced 5 days apart. Systemic treatment with

191

unmodified ECO/siRNA nanoparticles elicited a robust activation of all cytokines

measured at both the 2 h and 24 h timepoints due to the high surface charge of

the nanoparticles. PEGylation in the form of RGD-PEG(HZ)-modification

significantly attenuated the immune response for all tested cytokines. While

cytokine levels increased at 2 h for IL-6, IL-12 and IFN-γ, the serum levels were

reduced to basal levels at 24 h, indicative of a transient response. Importantly,

serum levels were not compounded over the course of 5 repeated injections.

These data, in conjunction with pathological examination of the liver and kidneys

in Figure 6.6 are indicative of the long-term safety of PEGylated ECO/siRNA

nanoparticles.

Figure 6.7. Evaluation of immunogenicity of ECO and RGD-PEG(HZ)-modified

ECO/siRNA nanoparticles in mice following intravenous administration. At 2 h and 24 h

following each injection set, blood was collected and the plasma was isolated to be used

for cytokine ELISA measurements of TNF-α, IL-12, IFN-γ and IL-6 (data represents

192

mean ± SE, n=5, *p0.05, **p0.01). Solid and dotted lines indicate the mean ± SE

pertaining to baseline levels of each cytokine.

6.4 Conclusions

This study demonstrates that eIF4E is a promising therapeutic target to

address PTX-induced drug resistance in TNBCs. Furthermore, it confirms the

need to couple anti-eIF4E therapy with a secondary chemotherapeutic agent to

unlock the true potential of targeting eIF4E. Knockdown of eIF4E expression in

vitro re-sensitized PTX-resistant MDA-MB-231.DR cells to low doses of PTX.

When coupled with PTX therapy, delivery of an siRNA targeted against eIF4E

with the RGD-PEG(HZ)-ECO/siRNA nanoparticles resulted in robust silencing of

eIF4E and a significant regression of tumor growth. Efficient in vivo delivery of

siRNA was achieved through use of the targeted pH-cleavable PEG modification

on the ECO/siRNA nanoparticles, where a significant inhibition of tumor growth

was observed as early as after only 3 systemic treatments. We believe the

explored combinatory strategy may be useful for the treatment of drug-resistant

TNBCs. As eIF4E silencing has been demonstrated to sensitize cancers to many

types of chemotherapy drugs, the proposed delivery strategy may hold broad

applicability throughout cancer therapy. Future work should explore the ability of

eIF4E to re-sensitize cancers to additional chemotherapies, thus broadening the

therapeutic potential of this novel target.

6.5 Acknowledgments

193




194

Chapter 7

Future Work

195

7.1 Summary of Work

The aim of this thesis is to further the development of a platform cationic

lipid-based siRNA delivery system for cancer therapy, specifically for the

treatment of triple-negative breast cancers. While RNAi holds tremendous

therapeutic promise, insufficiencies in the delivery capabilities of siRNA-based

technologies have prevented clinical success. A recurrent theme throughout the

work is the focus on the multifunctionality required for cytosolic delivery of siRNA.

In Chapter 3, a rationally designed cationic lipid-based siRNA carrier, ECO, was

developed. Through a systematic exploration as to how the N/P ratio between

ECO and siRNA impacted physiochemical properties and biological activity, the

formulation of ECO/siRNA nanoparticles was optimized. Careful chemical design

of the lipid structure endowed ECO/siRNA nanoparticles with a host of

multifunctional properties. Specifically, ECO/siRNA nanoparticle exhibited pH-

sensitive amphiphilicity and glutathione-mediated reduction to allow for

endolysosomal escape and cytosolic release of the siRNA cargo, two rate-

limiting steps for siRNA delivery. ECO/siRNA nanoparticles were also designed

to enable facile surface modification with PEG and/or targeting ligands.

7.2 Long-term stability of ECO/siRNA nanoparticle formulations

With an eye towards commercialization, additional work should investigate

the ability to translate ECO/siRNA nanoparticle formulations into a clinical

product. In Chapter 2, the efficacy of ECO/siRNA nanoparticles in various

transfection conditions was described in detail. However, all data reported

196

throughout this thesis were from experiments using freshly prepared siRNA

nanoparticles. In the clinic, preparation of fresh formulations would require

extensive training to healthcare workers, and potentially introducing variability

between formulations. To prepare nanoparticles ready for clinical

implementation, the formulations should withstand storage for long periods of

time under controlled temperatures and conditions to maintain overall particle

size, shape and siRNA complexation (314).

Initial studies have begun to characterize the long-term stability of

unmodified and PEGylated ECO/siRNA nanoparticles. Both unmodified and

PEGylated ECO/siRNA nanoparticles have been demonstrated to maintain their

gene silencing efficiencies following short-term storage after lyophilization, further

evaluation of long-term storage of lyophilized nanoparticles is underway. When

stored in liquid solution at 4⁰C for 2 and 4 weeks, unmodified and RGD-

PEG(HZ)-modified nanoparticles were found to maintain silencing efficiencies of

59.17 ± 7.13% and 68.77 ± 8.67% at 2 weeks and 27.07 ± 9.22% and 21.43 ±

7.01% at 4 weeks. A thorough understanding of how the physicochemical

properties of both lyophilized and solution-stored ECO/siRNA nanoparticles are

maintained or altered following long-term storage would provide key insights into

possible formulation strategies used for the transportation and storage of

nanoparticles.

197

7.3 Treatment of late-stage, metastatic disease

In Chapter 4, RGD-targeted ECO/siRNA nanoparticles were employed to

deliver siRNA targeting integrin β3 to prevent metastasis of triple-negative breast

cancers through the inhibition of TGF-β-mediated EMT. Across two animal

models, RGD-targeted ECO/siβ3 nanoparticles demonstrated a significant ability

to inhibit the pulmonary outgrowth and metastasis of metastatic triple-negative

breast cancer cells. Importantly, over the course of 16 weeks, mice treated with

repeated systemic injections of PEGylated ECO/siRNA nanoparticles displayed

minimal toxicity, as determined by monitoring body weight. The RGD peptide is

known to primarily target αvβ3 integrins expressed on tumor-associated

vasculature. Targeting tumor vasculature and endothelial has become a popular

alternative to targeting tumor cells directly due to the potential to disrupt the

supply of blood, oxygen and essential nutrients to the tumor tissue. While robust

silencing of integrin β3 was observed in tumor tissue, it was not established

whether silencing of integrin β3 was observed in the tumor vasculature, and what

role, if any, that played in the inhibition of tumor growth and metastasis.

While moderate, but not statistically significant knockdown of integrin β3

was observed using the RAD-targeted ECO/siβ3 nanoparticles, mice treated with

the non-specific targeted nanoparticles exhibited attenuated primary tumor

growth and a significantly reduced primary tumor recurrence. Additional studies

establishing the in vivo target knockdown threshold and duration required to elicit

a desired phenotypic disease response will be critical for the design of dosing

regimens.

198

Although not shown, RGD-targeted ECO/siβ3 nanoparticles were

administered to mice bearing metastatic tumors in an attempt to treat late-stage

disease, although no efficacy was noted. Results from these experiments

suggest either i) RGD-targeted ECO/siRNA nanoparticles are unable to localize

to the metastatic sites or ii) integrin β3 may not be an appropriate target for late-

stage disease. Future work should assess the ability of RGD-targeted

ECO/siRNA nanoparticles to target and accumulate within metastatic lesions,

potentially through the use of whole mouse cryo-imaging techniques. While

nano-sized materials can readily gain vascular access to tumors through the

EPR effect, small metastases (<100 mm3 in size) typically do not exhibit the

extensive vascular networks displayed by larger, primary tumors (315). As such,

nanoparticles may require alternative targeting strategies to effectively and

selectively target metastatic sites. Depending on the metastatic site, the

physiochemical properties of ECO/siRNA nanoparticles may need to be altered

to achieve effective targeting to various organs as summarize in Table 7.1. By

optimizing the N/P ratio, as described in Chapter 3, the size and surface charge

of ECO/siRNA nanoparticles can be fine-tuned. Additional customization can

occur through use of different targeting strategies using the thiol-maleimide

chemistries.

199

Table 7.1. Considerations for nanoparticle delivery to specific sites. Adapted from (315).

If the siRNA nanoparticles are indeed able to localize to metastatic

lesions, alternate gene targets should be explored to be used alone or in concert

with integrin β3. Metastatic cells (post-EMT cells) are hypothesized to undergo a

reciprocal process, known as mesenchymal-epithelial transition (MET), at the

secondary site, in which the role of integrin β3 may become less important in cell

survival. Integrin β1 may serve as a promising starting point as expression of

integrin β1 has been established as necessary for metastatic outgrowth (219).

Further, dual inactivation of integrin β1 and β3 was more effective in reducing

breast cancer metastasis compared to sole targeting of integrin β1. Therefore,

co-delivery of siRNAs against integrin β1 and β3 may address late-stage disease

more effectively than targeting either integrin alone. Unlike other drug delivery

systems that are designed around the specific chemical properties of their drug

load (ie, hydrophobicity, molecular weight, release profile, etc), the platform

nature of ECO can be easily and quickly exploited to formulate nanoparticles with

Target site Nanoparticle size Surface characteristics Additional comments

Brain

5–100 nm: uptake efficiency

decreases exponentially with

size

Lipophilic moieties and neutral

charge enhance brain uptake

Leukocytes can take up nanoparticles in

circulation and then carry them to disease

sites in the brain

Lung>200 nm: particles are trapped

in lung capillariesPositive surface charge

Inhaled particles with low density (<0.4 g

per cm3) and of large size (>5 mm) are

also retained in the lung

Liver

<100 nm, to cross liver

fenestrae and target

hepatocytes. <100 nm

particles will be taken up by

Kupffer cells

No specificity neededLipid and lipid-like materials tend to

accumulate in the liver

Lymph nodes

6–34 nm: intra-tracheal

administration. 80 nm:

subcutaneous administration

Non-cationic, non-pegylated and

sugar-based particles

200 nm particles in circulation can be

taken up by leukocytes and trafficked to

lymph nodes

Bone Yet to be established

Compounds such as

alendronate and aspartic acid

adhere to bone and have been

used for bone targeting

Despite great importance, bone targeting

is under-researched

200

any siRNA and develop new targeting strategies using alternate targeting

peptides.

7.4 Alternative surface-modification strategies

In Chapter 5, a modified pH-cleavable PEGylation strategy was

developed to overcome the PEG dilemma, in which covalent PEGylation inhibits

cellular uptake, endolysosomal escape, and gene silencing efficiency.

Incorporation of a pH-cleavable hydrazone linkage into the RGD-targeted

PEG(HZ) moiety enhanced both endolysosomal escape and gene silencing

efficiency. While sustained gene silencing was observed in vivo using a

luciferase reporter gene, the FMT imaging study revealed only a fraction of the

injected nanoparticle dose accumulated within the tumor. A more robust

biodistribution and pharmacokinetic study could reveal the fate of the siRNA

nanoparticles following systemic administration.

A deeper understanding of the intratumoral distribution of siRNA delivered

by the ECO nanoparticles is also critical. Targeted nanoparticles may suffer from

a binding site barrier in which the targeted nanoparticles cannot penetrate deep

into the target tissue due to the high avidity of the targeting agent, a phenomenon

first observed in antibody-based therapeutics (316,317). While Chapter 5

showed specific internalization of siRNA into cancer cells, the question of how

deep into the tumor tissue the ECO/siRNA nanoparticles can penetrate has yet to

be answered. If the siRNA nanoparticles are found to be highly concentrated at

the periphery of the tumor tissue, optimization of the targeting ligand density

201

and/or the affinity of the ligand may enhance penetration. Again, re-optimization

of the N/P ratio may be necessary to alter the nanoparticle size and/or surface

charge, parameters that govern the tumor penetration capabilities.

Along these lines, it is not clear if the surface-modified ECO/siRNA

nanoparticles remain intact within the tumor tissue or if the siRNA cargo is first

release within the microenvironment before internalization. Comparison of gene

silencing efficiency using a nuclease-stabilized siRNA load with a non-stabilized

siRNA may allow investigation into this topic. Previous studies have

demonstrated that nuclease-stabilized siRNAs exert superior RNAi activity over

non-stabilized siRNA only in the presence of nucleases, similar to the nuclease-

rich extracellular environment (318). Similar levels and duration of gene silencing

for siRNA nanoparticles formulated with both types of siRNAs would be indicative

of siRNA release following cellular internalization. However, nanoparticles

formulated with nuclease-stabilized siRNA producing a more robust gene

silencing would suggest that the siRNA cargo is release extracellularly prior to

internalization.

An additional surface modification strategy could also be employed using

a pH-sensitive charge-conversion polymer to endow the siRNA nanoparticles

with extracellular pH-sensitivity while maintaining intracellular pH-sensitivity.

Such a modification would allow the siRNA nanoparticle to be delivered in a

“stealth” or “inactive” mode throughout circulation before becoming “active” within

the acidic tumor microenvironment (319,320). Extracellular pH-sensitivity is

important to address challenges with cellular uptake within the characteristically

202

acidic tumor microenvironment and to minimize non-specific uptake in non-target

tissues. While pH-sensitive delivery systems have been developed, these

systems are severely limited in their efficacy due to responding to only a single

pH condition, targeting either the tumor extracellular (pHe) or the intracellular pH

(pHi) condition: the delivery systems that respond to pHe often release the siRNA

payloads extracellularly, making them inefficient in silencing the target gene,

while those capable of responding to pHi cannot efficiently enhance the cellular

internalization of the delivery system.

At neutral pH, a charge-conversion polymer is anionic and can bind

electrostatically to the surface of cationic ECO/siRNA nanoparticles. Within the

tumor extracellular environment, the polymer layer would undergo charge-

conversion to become cationic and shed due to increased electrostatic repulsion

with the ECO/siRNA nanoparticles. Upon doing so, the cationic surface of the

nanoparticles would become re-exposed to facilitate tumor cell internalization. If

targeting ligands, such as the RGD-PEG(HZ) moiety developed in Chapter 5,

are functionalized to the nanoparticle surface through exploitation of free thiol

groups within the cysteine-based linker domain, they too will be re-exposed and

further enhance cellular targeting and uptake.

7.5 Synergy in co-delivery of siRNA and PTX

In Chapter 6, the benefits of combination therapy involving siRNA

targeted against eIF4E with the small-molecule paclitaxel against a drug-

resistance triple-negative breast cancer cell line were studied. Data gleaned from

203

an in vivo animal model demonstrated that the combination therapy was able to

re-sensitize drug-resistant cancer cells to PTX and significantly inhibit primary

tumor growth. While the siRNA was delivered using the surface-modification

strategy developed in Chapter 5, PTX was administered i.p. in a 10%

DMSO/PBS vehicle; the delivery of siRNA and PTX from the same delivery

vehicle has yet to be studied. The first step would be to determine if ECO can

effectively load PTX into a stable nanoparticle. With a highly hydrophobic

structure, it may be that PTX could be loaded into ECO/siRNA nanoparticles

through hydrophobic interactions with the oleic acid lipid tails. An alternate

strategy involving covalent attachment of PTX to ECO via a PEG linker could

also be explored. A thorough understand of how PTX incorporation into

ECO/siRNA nanoparticles would affect the physicochemical properties of the

siRNA nanoparticles, including siRNA binding efficiency, stability, pH-sensitive

hemolysis, and glutathione-mediated reduction would need to be evaluated.

While there are clear advantages to formulating PTX into a nanoparticle, such as

improved biodistribution, tumor targeting and a reduction of systemic toxicities, it

is unclear if formulation of siRNA and PTX into the same system would offer any

distinct advantage over their separate delivery.

The aforementioned studies will substantially enhance the understanding

of the ECO/siRNA platform delivery system and help to streamline the clinical

development of such a system. The key advantages of the ECO/siRNA delivery

system are provided by the chemical structure of the ECO lipid which generates

multiple levels of functionality and responsiveness to counter the complex

204

delivery barriers. The ability to easily customize the physicochemical properties

of the nanoparticles, alter the siRNA cargo towards targeting any gene, and

functionalize the surface with various modifications and targeting strategies will

allow the platform system to be configured to meet the needs of many diseases.

Through multidisciplinary collaborations, the ECO/siRNA delivery system has

already been used to sensitize human glioblastoma tumors to radiation therapy

and is currently under investigation targeting key genes against the Ebola virus.

Further development through continued collaboration between clinicians,

biologists and engineers will contribute to the already compelling body of

therapeutic data, expedite and streamline clinical translation, and ultimately

improve the disease outcomes of not only patients with triple-negative breast

cancers, but of all types.

205

Appendix

206

A.1. Synthesis of ECO

The synthesis of (1-aminoethyl)imino-bis[N-(oleicyl-cysteinyl-1-

aminoethyl)propionamide] (ECO) was done by liquid-phase chemistry and is

described below. The reaction scheme can be seen in Figure A1. The

ethylenediamine head group was synthesized first followed by the cysteine/oleic

acid tail groups. Once these two groups were synthesized they were reacted

together to arrive at the final ECO product. Each reaction intermediate was

confirmed through 1H NMR.

Figure A1. Synthetic Procedure of ECO

1. Synthesis of intermediate (1)

207

A solution of di-tert-butyl dicarbonate (4.0 g, 18.3 mmol) in 100 mL of methylene

chloride (DCM) was added dropwise to a DCM (50 mL) solution of

ethylenediamine (6.6 g, 109.8 mmol) at 0⁰C. The reaction mixture was stirred at

room temperature overnight and excess solvent was removed by a rotary

evaporator. The crude product was collected and dissolved in 50 mL distilled

water and then extracted with 100 mL DCM (x 3). Sodium sulfate was added to

the extracted product, and the solution was then filtered and excess solvent

evaporated to yield the final intermediate (1) product.

Figure A2. Reaction scheme and 1H NMR of Intermediate (1).

208


A solution of intermediate (1) (2.0 g, 12.5 mmol) in 10 mL of methanol was added

dropwise under nitrogen to a stirred solution of methyl acrylate (4.33 g, 50.9

mmol) in 20mL of methanol at 0⁰C. The resulting solution was allowed to warm to

room temperature and was stirred for 2 days. The solvent was removed under

reduced pressure using a rotary evaporator, dissolved in 30 mL of water and

extracted with 30 mL of DCM (x 3). The crude product was dried with sodium

sulfate followed by filtering of the solution. The filtered solution was placed in a

vacuum oven for 2 days to yield the final intermediate (2) product.

209



A solution of intermediate (2) (4.0 g, 12.05 mmol) in 20 mL of methanol was

added dropwise under nitrogen to a solution of ethylenediamine (45 g, 753 mmol)

in 30 mL of methanol over 1 hour at 0⁰C. The reaction mixture was allowed to

warm up to room temperature and stirred for 5 days. The solvent was removed

and the product was washed with 15 mL of diethyl ether (x 3).



210

Oleic acid (4.0 g, 14.2 mmol), N-hydroxysuccinimide (NHS) (1.85g, 15.75 mmol),

and N,N'-Dicyclohexylcarbodiimide (DCC) (3.71 g, 18.01 mmol) were added to

ethyl acetate (15 mL). The reaction was allowed to react overnight at room

temperature and the by-product, ducyclohexylurea (DCU), was removed by

centrifugation and filtering of the reaction solution. Excess solvent was

evaporated and product was dried over phosphorous pentoxide.



Intermediate (4) (4.87 g, 12.51 mmol) was then reacted with H-Cysteine(Trt)-OH

(5.08 g, 13.98 mmol) and N,N-diisopropylethylamine (DIPEA) (6 mL) in 60 mL of

211

DCM. The solution reacted for 7 hours at room temperature. After the solvent

was evaporated, the product was dissolved in a small amount of DCM and was

then purified by silica gel column chromatography using DCM/methanol (20:1,

v/v).



Intermediate (5) (3.56 g, 5.47 mmol) and intermediate (3) (1.0 g, 2.57 mmol)

were added to a solution of 15 mL of DCM containing 2-(1H-Benzotriazol-l-yl)-

212

1,1,3,3-tetramethyluronium hyexafluorophosphate (HBTU, 2.15 g, 5.67 mmol)

and 1-hydroxybenzotriazole (HoBT, 0.76 g, 5.64 mmol). DIPEA (3 mL) was

added to the solution and stirred at room temperature overnight. The solvent was

removed and product was washed with ether (3 x 25 mL) to remove HBTU,

HoBT and DIPEA. The product was dissolved in water and extracted with DCM

to remove excess intermediate (5) and the organic phase was evaporated and

dried with sodium sulfate.


7. Final synthesis of ECO

213

Intermediate (6) was deprotected with DCM:TFA:triisobutylsilane:ethanedithiol at

a 7:2:1:1 ratio at room temperature for 30 minutes. The solvent was removed and

diethyl ether was added to the product and was precipitated and washed with

hexane to remove free protecting groups. The residue was dissolved again in

diethyl ether and re-dispersed in acetonitrile. The precipitate was collected,

dissolved in water and lyophilized to give the final product (1-

aminoethyl)iminobis[N-(oleicylcysteinyl-1-amino-ethyl)propionamide] (ECO).

Figure A8. Reaction scheme and 1H NMR of ECO.

214

Figure A9. Maldi-Tof Spectra of ECO. Peak at 1023.632 indicating ECO and

1045.629 indicating ECO+ Na+

A.2. Synthesis of cRGD-PEG-maleimide

Figure A10. Synthetic procedure of cRGD-PEG3400-maleimide

A cRGD-targeted PEG spacer was synthesized by reacting the activated NHS

ester of a heterobifunctional PEG linker and the primary amine of a c(RGD)fk

1045.629

1023.632

0

50

100

150

200

250

300

Inte

ns.

[a.u

.]

950 1000 1050 1100 1150 1200m/z

215

peptide. First, 5 mg (MW=603.7, 2 equivalent, 8.28 μmol) of c(RGD)fk was

dissolved in 5 mL DMF. Cyclic (RGD)fk was used at 2X molar excess to the

NHS-PEG3400-maleimide. Next, 14.1 mg (MW=3400, 1 equivalent, 4.14 μmol)

of NHS-PEG3400-Maleimide was dissolved in 1 mL of DMF and added drop-wise

into the c(RGD)fk/DMF solution. After addition, 100 μL of DIPEA was added to

the solution. The solution was stirred gently at room temperature for 4 hours. The

solution was precipitated into an excess of diethyl ether (3X) to obtain the purified

cRGD-PEG3400-Maleimide product.

0

50

100

150

200

Inte

ns. [a

.u.]

1500 2000 2500 3000 3500 4000 4500 5000 5500m/z

216

Figure A11. Maldi-tof and H1-NMR spectrum (Solvent: D2O) of cRGD-PEG3400-

maleimide.

A.3. Synthesis of mPEG(HZ)-maleimide

Figure A12. Synthetic procedure of mPEG5000(HZ)-Maleimide.

217

Figure A13. H1 NMR spectrum (Solvent: CDCl3) of mPEG5000(HZ)-maleimide.

Characteristic peaks: 8.43 (s, 1H, -NH-), 8.06 (d, 2H, in phenyl), 7.54 (d, 2H, in

phenyl), 6.91 (2, 2H, two olefinic protons of maleimide), 3.48-3.58 (m, 438H,

PEG).

A.4. Synthesis of cRGD-PEG(HZ)-maleimide

218

Figure A14. Synthetic procedure of cRGD-PEG3400(HZ)-maleimide.

219

Figure A15. H1 NMR spectrum (Solvent: DMSO of cRGD-PEG3400(HZ)-

maleimide. Characteristic peaks: 8.48 (s, 1H, -NH-), 8.0 (d, 2H, in phenyl), 7.6-

7.8 (m, cRGD), 7.45 (d, 2H, in phenyl), 7.2 (2, 2H, two olefinic protons of

maleimide), 3.1-3.5 (m, 304H, PEG).

Figure A16. H1 NMR spectrum (Solvent: D2O) of cRGD-PEG3400(HZ)-maleimide.

220

References

1. Howlander N, Noone AM, Krapcho M, Garshell J, Miller D, Altekruse SF. SEER cancer statistics review, 1975–2011. Bethesda, MD: National Cancer Institute; 2014.

2. Siegel, R., Ma, J., Zou, Z. and Jemal A. Cancer statistics, 2014. A Cancer Journal for Clinicians. 2014;64:9–29.

3. Dawood S, Hu R, Homes MD, Collins LC, Schnitt SJ, Connolly J, et al. Defining breast cancer prognosis based on molecular phenotypes: results from a large cohort study. Breast cancer research and treatment. Springer; 2011;126:185–92.

4. Murray CJL, Lopez AD. Measuring the global burden of disease. New England Journal of Medicine. Mass Medical Soc; 2013;369:448–57.

5. Mariotto AB, Yabroff KR, Shao Y, Feuer EJ, Brown ML. Projections of the cost of cancer care in the United States: 2010–2020. Journal of the National Cancer Institute. Oxford University Press; 2011;

6. Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K, Tuschl T. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. nature. Nature Publishing Group; 2001;411:494–8.

7. Carmell MA, Hannon GJ. RNase III enzymes and the initiation of gene silencing. Nature structural & molecular biology. Nature Publishing Group; 2004;11:214–8.

8. Sontheimer EJ. Assembly and function of RNA silencing complexes. Nature Reviews Molecular Cell Biology. Nature Publishing Group; 2005;6:127–38.

9. Bernstein E, Caudy AA, Hammond SM, Hannon GJ. Role for a bidentate ribonuclease in the initiation step of RNA interference. nature. Nature Publishing Group; 2001;409:363–6.

10. Rand TA, Ginalski K, Grishin N V, Wang X. Biochemical identification of Argonaute 2 as the sole protein required for RNA-induced silencing complex activity. Proceedings of the National Academy of Sciences of the United States of America. National Acad Sciences; 2004;101:14385–9.

11. Matranga C, Tomari Y, Shin C, Bartel DP, Zamore PD. Passenger-strand cleavage facilitates assembly of siRNA into Ago2-containing RNAi enzyme complexes. Cell. Elsevier; 2005;123:607–20.

221

12. Ameres SL, Martinez J, Schroeder R. Molecular basis for target RNA recognition and cleavage by human RISC. Cell. Elsevier; 2007;130:101–12.

13. Rand TA, Petersen S, Du F, Wang X. Argonaute2 cleaves the anti-guide strand of siRNA during RISC activation. Cell. Elsevier; 2005;123:621–9.

14. Hutvágner G, Zamore PD. A microRNA in a multiple-turnover RNAi enzyme complex. Science. American Association for the Advancement of Science; 2002;297:2056–60.

15. John M, Constien R, Akinc A, Goldberg M, Moon Y-A, Spranger M, et al. Effective RNAi-mediated gene silencing without interruption of the endogenous microRNA pathway. Nature. Nature Publishing Group; 2007;449:745–7.

16. De Fougerolles A, Vornlocher H-P, Maraganore J, Lieberman J. Interfering with disease: a progress report on siRNA-based therapeutics. Nature Reviews Drug Discovery. Nature Publishing Group; 2007;6:443–53.

17. Bumcrot D, Manoharan M, Koteliansky V, Sah DWY. RNAi therapeutics: a potential new class of pharmaceutical drugs. Nature chemical biology. Nature Publishing Group; 2006;2:711–9.

18. Kim DH, Rossi JJ. Strategies for silencing human disease using RNA interference. Nature reviews Genetics. 2007;8:173–84.

19. Kim S-S, Garg H, Joshi A, Manjunath N. Strategies for targeted nonviral delivery of siRNAs in vivo. Trends in molecular medicine. Elsevier; 2009;15:491–500.

20. Leung RKM, Whittaker PA. RNA interference: from gene silencing to gene-specific therapeutics. Pharmacology & therapeutics. Elsevier; 2005;107:222–39.

21. Frank-Kamenetsky M, Grefhorst A, Anderson NN, Racie TS, Bramlage B, Akinc A, et al. Therapeutic RNAi targeting PCSK9 acutely lowers plasma cholesterol in rodents and LDL cholesterol in nonhuman primates. Proceedings of the National Academy of Sciences. National Acad Sciences; 2008;105:11915–20.

22. Sato Y, Murase K, Kato J, Kobune M, Sato T, Kawano Y, et al. Resolution of liver cirrhosis using vitamin A–coupled liposomes to deliver siRNA against a collagen-specific chaperone. Nature biotechnology. Nature Publishing Group; 2008;26:431–42.

222

23. Song E, Lee S-K, Wang J, Ince N, Ouyang N, Min J, et al. RNA interference targeting Fas protects mice from fulminant hepatitis. Nature medicine. Nature Publishing Group; 2003;9:347–51.

24. NIU X, PENG Z, DUAN W, Wang H, Wang P. Inhibition of HPV 16 E6 oncogene expression by RNA interference in vitro and in vivo. International Journal of Gynecological Cancer. Wiley Online Library; 2006;16:743–51.

25. Halder J, Kamat AA, Landen CN, Han LY, Lutgendorf SK, Lin YG, et al. Focal adhesion kinase targeting using in vivo short interfering RNA delivery in neutral liposomes for ovarian carcinoma therapy. Clinical Cancer Research. AACR; 2006;12:4916–24.

26. Vogelstein B, Kinzler KW. Cancer genes and the pathways they control. Nature medicine. Nature Publishing Group; 2004;10:789–99.

27. Pai SI, Lin YY, Macaes B, Meneshian A, Hung CF, Wu TC. Prospects of RNA interference therapy for cancer. Gene therapy. Nature Publishing Group; 2006;13:464–77.

28. Dent R, Trudeau M, Pritchard KI, Hanna WM, Kahn HK, Sawka CA, et al. Triple-negative breast cancer: clinical features and patterns of recurrence. Clinical Cancer Research. AACR; 2007;13:4429–34.

29. O’Toole S, Beith JM, Millar EK, West R, McLean A, Cazet A, et al. Therapeutic targets in triple negative breast cancer. Journal of clinical pathology. 2013;66:530–42.

30. Williford J-M, Wu J, Ren Y, Archang MM, Leong KW, Mao H-Q. Recent advances in nanoparticle-mediated siRNA delivery. Annual review of biomedical engineering. 2014;16:347–70.

31. De Fougerolles A, Novobrantseva T. siRNA and the lung: research tool or therapeutic drug? Current opinion in pharmacology. Elsevier; 2008;8:280–5.

32. Alexis F, Pridgen E, Molnar LK, Farokhzad OC. Factors affecting the clearance and biodistribution of polymeric nanoparticles. Molecular pharmaceutics. ACS Publications; 2008;5:505–15.

33. Scherphof GL. In vivo behavior of liposomes: Interactions with the mononuclear phagocyte system and implications for drug targeting. Targeted drug delivery. Springer; 1991. page 285–327.

34. Zamecnik J, Vargova L, Homola A, Kodet R, Sykova E. Extracellular matrix glycoproteins and diffusion barriers in human astrocytic tumours.

223

Neuropathology and applied neurobiology. Wiley Online Library; 2004;30:338–50.

35. Akhtar S, Benter IF. Nonviral delivery of synthetic siRNAs in vivo. The Journal of clinical investigation. American Society for Clinical Investigation; 2007;117:3623.

36. Oliveira S, Van Rooy I, Kranenburg O, Storm G, Schiffelers RM. Fusogenic peptides enhance endosomal escape improving siRNA-induced silencing of oncogenes. International journal of pharmaceutics. Elsevier; 2007;331:211–4.

37. Di Guglielmo GM, Le Roy C, Goodfellow AF, Wrana JL. Distinct endocytic pathways regulate TGF-β receptor signalling and turnover. Nature cell biology. Nature Publishing Group; 2003;5:410–21.

38. Boussif O, Lezoualc’h F, Zanta MAntoniet, Mergny MD, Scherman D, Demeneix B, et al. A versatile vector for gene and oligonucleotide transfer into cells in culture and in vivo: polyethylenimine. Proceedings of the National Academy of Sciences. National Acad Sciences; 1995;92:7297–301.

39. Akinc A, Thomas M, Klibanov AM, Langer R. Exploring polyethylenimine-mediated DNA transfection and the proton sponge hypothesis. The journal of gene medicine. 2005;7:657–63.

40. Juliano R, Alam MR, Dixit V, Kang H. Mechanisms and strategies for effective delivery of antisense and siRNA oligonucleotides. Nucleic acids research. 2008;36:4158–71.

41. Aigner A. Nonviral in vivo delivery of therapeutic small interfering RNAs. Current opinion in molecular therapeutics. 2007;9:345–52.

42. Ozpolat B, Sood AK, Lopez‐Berestein G. Nanomedicine based approaches for the delivery of siRNA in cancer. Journal of internal medicine. Wiley Online Library; 2010;267:44–53.

43. Rappaport J, Hanss B, Kopp JB, Copeland TD, Bruggeman LA, Coffman TM, et al. Transport of phosphorothioate oligonucleotides in the kidney: Implications for molecular therapy. Kidney international. New York: Springer-Verlag; 1995;47:1462–9.

44. Santel A, Aleku M, Keil O, Endruschat J, Esche V, Fisch G, et al. A novel siRNA-lipoplex technology for RNA interference in the mouse vascular endothelium. Gene therapy. Nature Publishing Group; 2006;13:1222–34.

224

45. McNamara JO, Andrechek ER, Wang Y, Viles KD, Rempel RE, Gilboa E, et al. Cell type–specific delivery of siRNAs with aptamer-siRNA chimeras. Nature biotechnology. Nature Publishing Group; 2006;24:1005–15.

46. Braasch DA, Paroo Z, Constantinescu A, Ren G, Öz OK, Mason RP, et al. Biodistribution of phosphodiester and phosphorothioate siRNA. Bioorganic & medicinal chemistry letters. Elsevier; 2004;14:1139–43.

47. Bogdanov AA. Merging molecular imaging and RNA interference: early experience in live animals. Journal of cellular biochemistry. Wiley Online Library; 2008;104:1113–23.

48. Torchilin VP, Levchenko TS, Rammohan R, Volodina N, Papahadjopoulos-Sternberg B, D’Souza GGM. Cell transfection in vitro and in vivo with nontoxic TAT peptide-liposome–DNA complexes. Proceedings of the National Academy of Sciences. National Acad Sciences; 2003;100:1972–7.

49. Auguste DT, Furman K, Wong A, Fuller J, Armes SP, Deming TJ, et al. Triggered release of siRNA from poly (ethylene glycol)-protected, pH-dependent liposomes. Journal of Controlled Release. Elsevier; 2008;130:266–74.

50. Martina M-S, Nicolas V, Wilhelm C, Menager C, Barratt G, Lesieur S. The in vitro kinetics of the interactions between PEG-ylated magnetic-fluid-loaded liposomes and macrophages. Biomaterials. Elsevier; 2007;28:4143–53.

51. Mao S, Neu M, Germershaus O, Merkel O, Sitterberg J, Bakowsky U, et al. Influence of polyethylene glycol chain length on the physicochemical and biological properties of poly (ethylene imine)-graft-poly (ethylene glycol) block copolymer/SiRNA polyplexes. Bioconjugate chemistry. ACS Publications; 2006;17:1209–18.

52. Barquinero J, Eixarch H, Perez-Melgosa M. Retroviral vectors: new applications for an old tool. Gene therapy. Nature Publishing Group; 2004;11:S3–S9.

53. Vandenbroucke RE, De Geest BG, Bonné S, Vinken M, Van Haecke T, Heimberg H, et al. Prolonged gene silencing in hepatoma cells and primary hepatocytes after small interfering RNA delivery with biodegradable poly

(β‐amino esters). The journal of gene medicine. Wiley Online Library; 2008;10:783–94.

54. Allen TM. Ligand-targeted therapeutics in anticancer therapy. Nature Reviews Cancer. Nature Publishing Group; 2002;2:750–63.

225

55. Gu FX, Karnik R, Wang AZ, Alexis F, Levy-Nissenbaum E, Hong S, et al. Targeted nanoparticles for cancer therapy. Nano today. Elsevier; 2007;2:14–21.

56. Zureikat AH, McKee MD. Targeted therapy for solid tumors: current status. Surgical oncology clinics of North America. Elsevier; 2008;17:279–301.

57. Liu B. Exploring cell type-specific internalizing antibodies for targeted delivery of siRNA. Briefings in functional genomics & proteomics. Oxford University Press; 2007;6:112–9.

58. Sugita T, Yoshikawa T, Mukai Y, Yamanada N, Imai S, Nagano K, et al. Improved cytosolic translocation and tumor-killing activity of Tat-shepherdin conjugates mediated by co-treatment with Tat-fused endosome-disruptive HA2 peptide. Biochemical and biophysical research communications. Elsevier; 2007;363:1027–32.

59. Pirollo KF, Rait A, Zhou Q, Hwang SH, Dagata JA, Zon G, et al. Materializing the potential of small interfering RNA via a tumor-targeting nanodelivery system. Cancer research. AACR; 2007;67:2938–43.

60. Tseng Y-L, Liu J-J, Hong R-L. Translocation of liposomes into cancer cells by cell-penetrating peptides penetratin and tat: a kinetic and efficacy study. Molecular pharmacology. ASPET; 2002;62:864–72.

61. Kirpotin DB, Drummond DC, Shao Y, Shalaby MR, Hong K, Nielsen UB, et al. Antibody targeting of long-circulating lipidic nanoparticles does not increase tumor localization but does increase internalization in animal models. Cancer research. 2006;66:6732–40.

62. Bartlett D, Su H. Impact of tumor-specific targeting on the biodistribution and efficacy of siRNA nanoparticles measured by multimodality in vivo imaging. Proceedings of the National Academy of Science. 2007;104:15549–54.

63. Hornung V, Guenthner-Biller M, Bourquin C, Ablasser A, Schlee M, Uematsu S, et al. Sequence-specific potent induction of IFN-α by short interfering RNA in plasmacytoid dendritic cells through TLR7. Nature medicine. Nature Publishing Group; 2005;11:263–70.

64. Harborth J, Elbashir SM, Vandenburgh K, Manninga H, Scaringe SA, Weber K, et al. Sequence, chemical, and structural variation of small interfering RNAs and short hairpin RNAs and the effect on mammalian gene silencing. Antisense and Nucleic Acid Drug Development. Mary Ann Liebert, Inc.; 2003;13:83–105.

226

65. Czauderna F, Fechtner M, Dames S, AyguÈn H, Klippel A, Pronk GJ, et al. Structural variations and stabilising modifications of synthetic siRNAs in mammalian cells. Nucleic acids research. Oxford Univ Press; 2003;31:2705–16.

66. Hall AHS, Wan J, Shaughnessy EE, Shaw BR, Alexander KA. RNA interference using boranophosphate siRNAs: structure–activity relationships. Nucleic acids research. Oxford Univ Press; 2004;32:5991–6000.

67. Whitehead K a, Langer R, Anderson DG. Knocking down barriers: advances in siRNA delivery. Nature reviews Drug discovery. 2009;8:129–38.

68. Crooke ST. Antisense drug technology: principles, strategies, and applications. CRC Press; 2007.

69. Torchilin VP. Recent advances with liposomes as pharmaceutical carriers. Nature reviews Drug discovery. Nature Publishing Group; 2005;4:145–60.

70. Bedi D, Musacchio T, Fagbohun OA, Gillespie JW, Deinnocentes P, Bird RC, et al. Delivery of siRNA into breast cancer cells via phage fusion protein-targeted liposomes. Nanomedicine: Nanotechnology, Biology and Medicine. Elsevier; 2011;7:315–23.

71. Kim HS, Song IH, Kim JC, Kim EJ, Jang DO, Park YS. In vitro and in vivo gene-transferring characteristics of novel cationic lipids, DMKD (O, O’-dimyristyl-N-lysyl aspartate) and DMKE (O, O'-dimyristyl-N-lysyl glutamate). Journal of controlled release. Elsevier; 2006;115:234–41.

72. Rust DM, Jameson G. The novel lipid delivery system of amphotericin B: drug profile and relevance to clinical practice. Oncology nursing forum. 1997. page 35–48.

73. Lv H, Zhang S, Wang B, Cui S, Yan J. Toxicity of cationic lipids and cationic polymers in gene delivery. Journal of Controlled Release. 2006;114:100–9.

74. Kim HS, Song IH, Kim JC, Kim EJ, Jang DO, Park YS. In vitro and in vivo gene-transferring characteristics of novel cationic lipids, DMKD (O, O’-dimyristyl-N-lysyl aspartate) and DMKE (O, O'-dimyristyl-N-lysyl glutamate). Journal of controlled release. Elsevier; 2006;115:234–41.

75. Pardridge WM. shRNA and siRNA delivery to the brain. Advanced drug delivery reviews. Elsevier; 2007;59:141–52.

227

76. Zhang Y, Zhang Y, Bryant J, Charles A, Boado RJ, Pardridge WM. Intravenous RNA interference gene therapy targeting the human epidermal growth factor receptor prolongs survival in intracranial brain cancer. Clinical Cancer Research. AACR; 2004;10:3667–77.

77. Pirollo KF, Zon G, Rait A, Zhou Q, Yu W, Hogrefe R, et al. Tumor-targeting nanoimmunoliposome complex for short interfering RNA delivery. Human gene therapy. Mary Ann Liebert, Inc. 2 Madison Avenue Larchmont, NY 10538 USA; 2006;17:117–24.

78. Lavigne C, Thierry AR. Specific subcellular localization of siRNAs delivered by lipoplex in MCF-7 breast cancer cells. Biochimie. Elsevier; 2007;89:1245–51.

79. Landen CN, Chavez-Reyes A, Bucana C, Schmandt R, Deavers MT, Lopez-Berestein G, et al. Therapeutic EphA2 gene targeting in vivo using neutral liposomal small interfering RNA delivery. Cancer research. AACR; 2005;65:6910–8.

80. Meryet-Figuières M, Resina S, Lavigne C, Barlovatz-Meimon G, Lebleu B, Thierry AR. Inhibition of PAI-1 expression in breast cancer carcinoma cells by siRNA at nanomolar range. Biochimie. Elsevier; 2007;89:1228–33.

81. Landen CN, Merritt WM, Mangala LS, Sanguino AM, Bucana C, Lu C, et al. Intraperitoneal delivery of liposomal siRNA for therapy of advanced ovarian cancer. Cancer biology & therapy. Taylor & Francis; 2006;5:1708–13.

82. Thaker PH, Han LY, Kamat AA, Arevalo JM, Takahashi R, Lu C, et al. Chronic stress promotes tumor growth and angiogenesis in a mouse model of ovarian carcinoma. Nature medicine. Nature Publishing Group; 2006;12:939–44.

83. Merritt WM, Lin YG, Spannuth WA, Fletcher MS, Kamat AA, Han LY, et al. Effect of interleukin-8 gene silencing with liposome-encapsulated small interfering RNA on ovarian cancer cell growth. Journal of the National Cancer Institute. Oxford University Press; 2008;100:359–72.

84. Gary DJ, Puri N, Won Y-Y. Polymer-based siRNA delivery: perspectives on the fundamental and phenomenological distinctions from polymer-based DNA delivery. Journal of controlled release : official journal of the Controlled Release Society. 2007;121:64–73.

85. Howard KA, Rahbek UL, Liu X, Damgaard CK, Glud SZ, Andersen MØ, et al. RNA interference in vitro and in vivo using a chitosan/siRNA nanoparticle system. Molecular Therapy. Nature Publishing Group; 2006;14:476–84.

228

86. De Martimprey H, Bertrand J-R, Fusco A, Santoro M, Couvreur P, Vauthier C, et al. siRNA nanoformulation against the ret/PTC1 junction oncogene is efficient in an in vivo model of papillary thyroid carcinoma. Nucleic acids research. Oxford Univ Press; 2008;36:e2–e2.

87. Pillé J-Y, Li H, Blot E, Bertrand J-R, Pritchard L-L, Opolon P, et al. Intravenous delivery of anti-RhoA small interfering RNA loaded in nanoparticles of chitosan in mice: safety and efficacy in xenografted aggressive breast cancer. Human gene therapy. Mary Ann Liebert, Inc. 2 Madison Avenue Larchmont, NY 10538 USA; 2006;17:1019–26.

88. Grayson ACR, Doody AM, Putnam D. Biophysical and structural characterization of polyethylenimine-mediated siRNA delivery in vitro. Pharmaceutical research. Springer; 2006;23:1868–76.

89. Khan A, Benboubetra M, Sayyed PZ, Wooi Ng K, Fox S, Beck G, et al. Sustained polymeric delivery of gene silencing antisense ODNs, siRNA, DNAzymes and ribozymes: in vitro and in vivo studies. Journal of drug targeting. Informa UK Ltd UK; 2004;12:393–404.

90. Husmann M, Schenderlein S, Lück M, Lindner H, Kleinebudde P. Polymer erosion in PLGA microparticles produced by phase separation method. International journal of pharmaceutics. Elsevier; 2002;242:277–80.

91. Cherng J-Y, Talsma H, Verrijk R, Crommelin DJA, Hennink WE. The effect of formulation parameters on the size of poly ((2-dimethylamino) ethyl methacrylate)-plasmid complexes. European journal of pharmaceutics and biopharmaceutics. Elsevier; 1999;47:215–24.

92. Bishop NE. An Update on Non‐clathrin‐coated Endocytosis. Reviews in medical virology. Wiley Online Library; 1997;7:199–209.

93. Boussif O, Zanta MA, Behr J-P. Optimized galenics improve in vitro gene transfer with cationic molecules up to 1000-fold. Gene therapy. 1996;3:1074–80.

94. Boeckle S, Von Gersdorff K, Van der Piepen S, Culmsee C, Wagner E, Ogris M. Purification of polyethylenimine polyplexes highlights the role of free polycations in gene transfer. The journal of gene medicine. Wiley Online Library; 2004;6:1102–11.

95. Hunter AC. Molecular hurdles in polyfectin design and mechanistic background to polycation induced cytotoxicity. Advanced drug delivery reviews. Elsevier; 2006;58:1523–31.

229

96. Thomas M, Klibanov AM. Enhancing polyethylenimine’s delivery of plasmid DNA into mammalian cells. Proceedings of the National Academy of Sciences. National Acad Sciences; 2002;99:14640–5.

97. Fischer D, Von Harpe A, Kunath K, Petersen H, Li Y, Kissel T. Copolymers of ethylene imine and N-(2-hydroxyethyl)-ethylene imine as tools to study effects of polymer structure on physicochemical and biological properties of DNA complexes. Bioconjugate chemistry. ACS Publications; 2002;13:1124–33.

98. Urban-Klein B, Werth S, Abuharbeid S, Czubayko F, Aigner A. RNAi-mediated gene-targeting through systemic application of polyethylenimine (PEI)-complexed siRNA in vivo. Gene therapy. Nature Publishing Group; 2005;12:461–6.

99. Bettuzzi S. The new anti-oncogene clusterin and the molecular profiling of prostate cancer progression and prognosis. Acta Biomed Ateneo Parmense. 2003;74:101–4.

100. Sutton D, Kim S, Shuai X, Leskov K, Marques JT, Williams BRG, et al. Efficient suppression of secretory clusterin levels by polymer-siRNA nanocomplexes enhances ionizing radiation lethality in human MCF-7 breast cancer cells in vitro. International journal of nanomedicine. Dove Press; 2006;1:155.

101. Lawlor MA, Alessi DR. PKB/Akt a key mediator of cell proliferation, survival and insulin responses? Journal of cell science. The Company of Biologists Ltd; 2001;114:2903–10.

102. Li J, Simpson L, Takahashi M, Miliaresis C, Myers MP, Tonks N, et al. The PTEN/MMAC1 tumor suppressor induces cell death that is rescued by the AKT/protein kinase B oncogene. Cancer research. AACR; 1998;58:5667–72.

103. Xu C-X, Jere D, Jin H, Chang S-H, Chung Y-S, Shin J-Y, et al. Poly (ester amine)-mediated, aerosol-delivered Akt1 small interfering RNA suppresses lung tumorigenesis. American journal of respiratory and critical care medicine. Am Thoracic Soc; 2008;178:60–73.

104. Wang Y, Gao S, Ye W-H, Yoon HS, Yang Y-Y. Co-delivery of drugs and DNA from cationic core–shell nanoparticles self-assembled from a biodegradable copolymer. Nature materials. Nature Publishing Group; 2006;5:791–6.

105. Del Vecchio S, Zannetti A, Fonti R, Pace L, Salvatore M. Nuclear imaging in cancer theranostics. The quarterly journal of nuclear medicine and

230

molecular imaging: official publication of the Italian Association of Nuclear Medicine (AIMN)[and] the International Association of Radiopharmacology (IAR),[and] Section of the Society of. 2007;51:152–63.

106. Ferrari M. Cancer nanotechnology: opportunities and challenges. Nature Reviews Cancer. Nature Publishing Group; 2005;5:161–71.

107. Peer D, Karp JM, Hong S, Farokhzad OC, Margalit R, Langer R. Nanocarriers as an emerging platform for cancer therapy. Nature nanotechnology. Nature Publishing Group; 2007;2:751–60.

108. Wang Y, Shim MS, Levinson NS, Sung H-W, Xia Y. Stimuli-Responsive Materials for Controlled Release of Theranostic Agents. Advanced functional materials. 2014;24:4206–20.

109. Sumer B, Gao J. Theranostic nanomedicine for cancer. Nanomedicine. London: Future Medicine, c2006-; 2008;3:137–40.

110. Medarova Z, Pham W, Farrar C, Petkova V, Moore A. In vivo imaging of siRNA delivery and silencing in tumors. Nature medicine. Nature Publishing Group; 2007;13:372–7.

111. Zaffaroni N, Pannati M, Diadone MG. Survivin as a target for new anticancer interventions. Journal of cellular and molecular medicine. Wiley Online Library; 2005;9:360–72.

112. Lee J, Lee K, Moon SH, Lee Y, Park TG, Cheon J. All‐in‐One Target‐Cell‐Specific Magnetic Nanoparticles for Simultaneous Molecular Imaging and siRNA Delivery. Angewandte Chemie. Wiley Online Library; 2009;121:4238–43.

113. Tabernero J, Shapiro GI, LoRusso PM, Cervantes A, Schwartz GK, Weiss GJ, et al. First-in-humans trial of an RNA interference therapeutic targeting VEGF and KSP in cancer patients with liver involvement. Cancer discovery. AACR; 2013;3:406–17.

114. Davidson BL, McCray PB. Current prospects for RNA interference-based therapies. Nature reviews Genetics. Nature Publishing Group; 2011;12:329–40.

115. Burnett JC, Rossi JJ, Tiemann K. Current progress of siRNA/shRNA therapeutics in clinical trials. Biotechnology journal. Wiley Online Library; 2011;6:1130–46.

231

116. Davis ME. The first targeted delivery of siRNA in humans via a self-assembling, cyclodextrin polymer-based nanoparticle: from concept to clinic. Molecular pharmaceutics. ACS Publications; 2009;6:659–68.

117. Zuckerman JE, Gritli I, Tolcher A, Heidel JD, Lim D, Morgan R, et al. Correlating animal and human phase Ia/Ib clinical data with CALAA-01, a targeted, polymer-based nanoparticle containing siRNA. Proceedings of the National Academy of Sciences. National Acad Sciences; 2014;111:11449–54.

118. Wagle R, Ohtsuka M, Ling H, Pichler M. RNA interference in the clinics: where are we standing now? Future oncology (London, England). 2015;11:185–7.

119. Miele E, Spinelli G. Nanoparticle-based delivery of small interfering RNA: challenges for cancer therapy. International journal …. 2012;3637–57.

120. Burnett J, Rossi J. RNA-based therapeutics: current progress and future prospects. Chemistry & biology. 2012;19:60–71.

121. Zhu L, Mahato R. Lipid and polymeric carrier-mediated nucleic acid delivery. Expert opinion on drug delivery. 2010;7:1209–26.

122. Dorsett Y, Tuschl T. siRNAs: applications in functional genomics and potential as therapeutics. Nature reviews Drug discovery. 2004;3:318–29.

123. Spagnou S, Miller A, Keller M. Lipidic carriers of siRNA: differences in the formulation, cellular uptake, and delivery with plasmid DNA. Biochemistry. 2004;13348–56.

124. Mével M, Kamaly N, Carmona S, Oliver MH, Jorgensen MR, Crowther C, et al. DODAG; a versatile new cationic lipid that mediates efficient delivery of pDNA and siRNA. Journal of controlled release : official journal of the Controlled Release Society. Elsevier B.V.; 2010;143:222–32.

125. Ewert KK, Zidovska A, Ahmad A, Bouxsein NF, Evans HM, Mcallister CS, et al. Cationic Liposome – Nucleic Acid Complexes for Gene Delivery and Silencing : Pathways and Mechanisms for Plasmid DNA and siRNA. 2010;

126. Xu Y, Szoka F. Mechanism of DNA release from cationic liposome/DNA complexes used in cell transfection. Biochemistry. 1996;2960:5616–23.

127. Mintzer M, Simanek E. Nonviral vectors for gene delivery. Chemical reviews. 2008;259–302.

232

128. Zhang S, Zhao B, Jiang H, Wang B, Ma B. Cationic lipids and polymers mediated vectors for delivery of siRNA. Journal of controlled release : official journal of the Controlled Release Society. 2007;123:1–10.

129. Malone R. Cationic liposome-mediated RNA transfection. Proceedings of the …. 1989;86:6077–81.

130. Bouxsein N, McAllister C, Ewert K. Structure and gene silencing activities of monovalent and pentavalent cationic lipid vectors complexed with siRNA. Biochemistry. 2007;4785–92.

131. Ren T, Song Y, Zhang G, Liu D. Structural basis of DOTMA for its high intravenous transfection activity in mouse. Gene therapy. 2000;764–8.

132. Lu J, Langer R, Chen J. A novel mechanism is involved in cationic lipid-mediated functional siRNA delivery. Molecular pharmaceutics. 2009;6:763–71.

133. Larson SD, Jackson LN, Chen LA, Rychahou PG, Evers BM. Effectiveness of siRNA uptake in target tissues by various delivery methods. Surgery. 2007;142:262–9.

134. Garbuzenko OB, Saad M, Betigeri S, Zhang M, Vetcher A a, Soldatenkov V a, et al. Intratracheal versus intravenous liposomal delivery of siRNA, antisense oligonucleotides and anticancer drug. Pharmaceutical research. 2009;26:382–94.

135. Akinc A, Zumbuehl A, Goldberg M, Leshchiner ES, Busini V, Hossain N, et al. A combinatorial library of lipid-like materials for delivery of RNAi therapeutics. Nature biotechnology. 2008;26:561–9.

136. Parton RG, Simons K. The multiple faces of caveolae. Nature reviews Molecular cell biology. 2007;8:185–94.

137. Le Roy C, Wrana JL. Clathrin- and non-clathrin-mediated endocytic regulation of cell signalling. Nature reviews Molecular cell biology. 2005;6:112–26.

138. Hoekstra D, Rejman J. Gene delivery by cationic lipids: in and out of an endosome. Biochemical Society …. 2007;35:68–71.

139. Reddy J, Low P. Enhanced folate receptor mediated gene therapy using a novel pH-sensitive lipid formulation. Journal of Controlled Release. 2000;64:27–37.

233

140. Champion J, Mitragotri S. Role of target geometry in phagocytosis. … of the United States of America. 2006;2006.

141. Chithrani B, Chan W. Elucidating the mechanism of cellular uptake and removal of protein-coated gold nanoparticles of different sizes and shapes. Nano letters. 2007;

142. Iversen T-G, Skotland T, Sandvig K. Endocytosis and intracellular transport of nanoparticles: Present knowledge and need for future studies. Nano Today. Elsevier Ltd; 2011;6:176–85.

143. Jin H, Heller D, Strano M. Single-particle tracking of endocytosis and exocytosis of single-walled carbon nanotubes in NIH-3T3 cells. Nano letters. 2008;

144. Sahay G, Querbes W, Alabi C, Eltoukhy A, Sarkar S, Zurenko C, et al. Efficiency of siRNA delivery by lipid nanoparticles is limited by endocytic recycling. Nature biotechnology. Nature Publishing Group; 2013;31:653–8.

145. Sun X, Yau VK, Briggs BJ, Whittaker GR. Role of clathrin-mediated endocytosis during vesicular stomatitis virus entry into host cells. Virology. 2005;338:53–60.

146. Harush-Frenkel O, Debotton N, Benita S, Altschuler Y. Targeting of nanoparticles to the clathrin-mediated endocytic pathway. Biochemical and biophysical research communications. 2007;353:26–32.

147. Davis J, Clare D, Hodges R, Bloom M. Interaction of a synthetic amphiphilic polypeptide and lipids in a bilayer structure. Biochemistry. 1983;5298–305.

148. Yang Y, Guo X, Lin W, Zhang L. Amphiphilic copolymer brush with random pH-sensitive/hydrophobic structure: synthesis and self-assembled micelles for sustained drug delivery. Soft Matter. 2012;454–64.

149. Sonawane ND, Szoka FC, Verkman a S. Chloride accumulation and swelling in endosomes enhances DNA transfer by polyamine-DNA polyplexes. The Journal of biological chemistry. 2003;278:44826–31.

150. Creusat G, Rinaldi A. Proton sponge trick for pH-sensitive disassembly of polyethylenimine-based siRNA delivery systems. Bioconjugate …. 2010;994–1002.

151. Koynova R. An intracellular lamellar–nonlamellar phase transition rationalizes the superior performance of some cationic lipid transfection agents. Proceedings of the …. 2006;103:14373–8.

234

152. Koltover I, Salditt T, Rädler J, Safinya C. An inverted hexagonal phase of cationic liposome-DNA complexes related to DNA release and delivery. Science. 1998;281:78–81.

153. Wang L, Koynova R, Parikh H, MacDonald RC. Transfection activity of binary mixtures of cationic o-substituted phosphatidylcholine derivatives: the hydrophobic core strongly modulates physical properties and DNA delivery efficacy. Biophysical journal. 2006;91:3692–706.

154. Simberg D, Danino D, Talmon Y, Minsky a, Ferrari ME, Wheeler CJ, et al. Phase behavior, DNA ordering, and size instability of cationic lipoplexes. Relevance to optimal transfection activity. The Journal of biological chemistry. 2001;276:47453–9.

155. Tenchov BG, Wang L, Koynova R, MacDonald RC. Modulation of a membrane lipid lamellar-nonlamellar phase transition by cationic lipids: a measure for transfection efficiency. Biochimica et biophysica acta. 2008;1778:2405–12.

156. Heyes J, Palmer L, Bremner K, MacLachlan I. Cationic lipid saturation influences intracellular delivery of encapsulated nucleic acids. Journal of controlled release : official journal of the Controlled Release Society. 2005;107:276–87.

157. Zuhorn IS, Bakowsky U, Polushkin E, Visser WH, Stuart MC a, Engberts JBFN, et al. Nonbilayer phase of lipoplex-membrane mixture determines endosomal escape of genetic cargo and transfection efficiency. Molecular therapy : the journal of the American Society of Gene Therapy. 2005;11:801–10.

158. Connor J, Huang L. pH-sensitive immunoliposomes as an efficient and target-specific carrier for antitumor drugs. Cancer research. 1986;3431–6.

159. Drummond D, Daleke D. Synthesis and characterization of N-acylated, pH-sensitive “caged”aminophospholipids. Chemistry and physics of lipids. 1995;75:27–41.

160. Jayaraman M, Ansell SM, Mui BL, Tam YK, Chen J, Du X, et al. Maximizing the potency of siRNA lipid nanoparticles for hepatic gene silencing in vivo. Angewandte Chemie (International ed in English). 2012;51:8529–33.

161. Wang X-L, Jensen R, Lu Z-R. A novel environment-sensitive biodegradable polydisulfide with protonatable pendants for nucleic acid delivery. Journal of controlled release : official journal of the Controlled Release Society. 2007;120:250–8.

235

162. Wang X, Ramusovic S. Novel polymerizable surfactants with pH-sensitive amphiphilicity and cell membrane disruption for efficient siRNA delivery. Bioconjugate …. 2007;2169–77.

163. Xu R, Lu Z-R. Design, synthesis and evaluation of spermine-based pH-sensitive amphiphilic gene delivery systems: Multifunctional non-viral gene carriers. Science China Chemistry. 2011;54:359–68.

164. Xu R, Wang X, Lu Z-R. Intracellular siRNA delivery with novel spermine based surfactants. Chinese Science Bulletin. 2012;57:3979–84.

165. Nag OK, Awasthi V. Surface engineering of liposomes for stealth behavior. Pharmaceutics. 2013;5:542–69.

166. Schroeder A, Sigal A, Turjeman K, Barenholz Y. Using PEGylated nano-liposomes to target tissue invaded by a foreign body. Journal of drug targeting. 2008;16:591–5.

167. Kizelsztein P, Ovadia H, Garbuzenko O, Sigal A, Barenholz Y. Pegylated nanoliposomes remote-loaded with the antioxidant tempamine ameliorate experimental autoimmune encephalomyelitis. Journal of neuroimmunology. Elsevier B.V.; 2009;213:20–5.

168. Wang X-L, Xu R, Lu Z-R. A peptide-targeted delivery system with pH-sensitive amphiphilic cell membrane disruption for efficient receptor-mediated siRNA delivery. Journal of controlled release : official journal of the Controlled Release Society. Elsevier B.V.; 2009;134:207–13.

169. Wang X, Xu R, Wu X. Targeted systemic delivery of a therapeutic siRNA with a multifunctional carrier controls tumor proliferation in mice. Molecular Pharmaceutics. 2009;86:738–46.

170. Gillespie D, Aguirre M. RNA interference targeting hypoxia-inducible factor 1α via a novel multifunctional surfactant attenuates glioma growth in an intracranial mouse model. Journal of …. 2014;122:331–41.

171. Xu R, Wang X-L, Lu Z-R. New amphiphilic carriers forming pH-sensitive nanoparticles for nucleic acid delivery. Langmuir : the ACS journal of surfaces and colloids. 2010;26:13874–82.

172. Malamas AS, Gujrati M, Kummitha CM, Xu R, Lu Z-R. Design and evaluation of new pH-sensitive amphiphilic cationic lipids for siRNA delivery. Journal of Controlled Release. Elsevier B.V.; 2013;171:296–307.

236

173. Kurreck J. RNA interference: from basic research to therapeutic applications. Angewandte Chemie International Edition. Wiley Online Library; 2009;48:1378–98.

174. Hannon G. RNA interference. Nature. 2002;418:24–6.

175. Tuschl T, Zamore PD, Lehmann R, Bartel DP, Sharp PA. Targeted mRNA degradation by double-stranded RNA in vitro. Genes & development. Cold Spring Harbor Lab; 1999;13:3191–7.

176. Sinn PL, Sauter SL, McCray PB. Gene therapy progress and prospects: development of improved lentiviral and retroviral vectors–design, biosafety, and production. Gene therapy. Nature Publishing Group; 2005;12:1089–98.

177. Shegokar R, Al Shaal L, Mishra PR. SiRNA delivery: challenges and role of carrier systems. Die Pharmazie-An International Journal of Pharmaceutical Sciences. Govi-Verlag; 2011;66:313–8.

178. Shim MS, Kwon YJ. Efficient and targeted delivery of siRNA in vivo. FEBS journal. Wiley Online Library; 2010;277:4814–27.

179. Morris K V, Rossi JJ. Lentiviral-mediated delivery of siRNAs for antiviral therapy. Gene therapy. Nature Publishing Group; 2006;13:553–8.

180. Devroe E, Silver PA. Therapeutic potential of retroviral RNAi vectors. Expert opinion on biological therapy. Ashley Publications Ltd London, UK; 2004;4:319–27.

181. Somia N, Verma IM. Gene therapy: trials and tribulations. Nature Reviews Genetics. Nature Publishing Group; 2000;1:91–9.

182. Fenske DB, Chonn A, Cullis PR. Liposomal nanomedicines: an emerging field. Toxicologic pathology. Sage Publications; 2008;36:21–9.

183. Wang Y, Li Z, Han Y, Hwa Liang L, Ji A. Nanoparticle-based delivery system for application of siRNA in vivo. Current drug metabolism. Bentham Science Publishers; 2010;11:182–96.

184. Yuan X, Naguib S, Wu Z. Recent advances of siRNA delivery by nanoparticles. Expert opinion on drug delivery. Informa UK, Ltd. London; 2011;8:521–36.

185. Li S, Huang L. Nonviral gene therapy: promises and challenges. Gene therapy. Citeseer; 2000;7:31–4.

237

186. Jones LJ, Yue ST, Cheung C-Y, Singer VL. RNA quantitation by fluorescence-based solution assay: RiboGreen reagent characterization. Analytical biochemistry. Elsevier; 1998;265:368–74.

187. Sanvicens N, Marco MP. Multifunctional nanoparticles–properties and prospects for their use in human medicine. Trends in biotechnology. Elsevier; 2008;26:425–33.

188. Liu X, Howard KA, Dong M, Andersen MØ, Rahbek UL, Johnsen MG, et al. The influence of polymeric properties on chitosan/siRNA nanoparticle formulation and gene silencing. Biomaterials. Elsevier; 2007;28:1280–8.

189. Kong W-H, Sung D-K, Shim Y-H, Bae KH, Dubois P, Park TG, et al. Efficient intracellular siRNA delivery strategy through rapid and simple two steps mixing involving noncovalent post-PEGylation. Journal of Controlled Release. Elsevier; 2009;138:141–7.

190. Wu Y, Wang W, Chen Y, Huang K, Shuai X, Chen Q, et al. The investigation of polymer-siRNA nanoparticle for gene therapy of gastric cancer in vitro. International journal of nanomedicine. Dove Press; 2010;5:129.

191. Bettinger T, Carlisle RC, Read ML, Ogris M, Seymour LW. Peptide-mediated RNA delivery: a novel approach for enhanced transfection of primary and post-mitotic cells. Nucleic acids research. Oxford Univ Press; 2001;29:3882–91.

192. Ruponen M, Rönkkö S, Honkakoski P, Pelkonen J, Tammi M, Urtti A. Extracellular glycosaminoglycans modify cellular trafficking of lipoplexes and polyplexes. Journal of Biological Chemistry. ASBMB; 2001;276:33875–80.

193. Wei J, Jones J, Kang J, Card A, Krimm M, Hancock P, et al. RNA-induced silencing complex-bound small interfering RNA is a determinant of RNA interference-mediated gene silencing in mice. Molecular pharmacology. ASPET; 2011;79:953–63.

194. Grimm D, Streetz KL, Jopling CL, Storm TA, Pandey K, Davis CR, et al. Fatality in mice due to oversaturation of cellular microRNA/short hairpin RNA pathways. Nature. Nature Publishing Group; 2006;441:537–41.

195. Lewinski N, Colvin V, Drezek R. Cytotoxicity of nanoparticles. small. Wiley Online Library; 2008;4:26–49.

238

196. Katas H, Alpar HO. Development and characterisation of chitosan nanoparticles for siRNA delivery. Journal of controlled release. Elsevier; 2006;115:216–25.

197. Monopoli MP, Walczyk D, Campbell A, Elia G, Lynch I, Baldelli Bombelli F, et al. Physical− chemical aspects of protein corona: relevance to in vitro and in vivo biological impacts of nanoparticles. Journal of the American Chemical Society. ACS Publications; 2011;133:2525–34.

198. Lundqvist M, Stigler J, Elia G, Lynch I, Cedervall T, Dawson KA. Nanoparticle size and surface properties determine the protein corona with possible implications for biological impacts. Proceedings of the National Academy of Sciences. National Acad Sciences; 2008;105:14265–70.

199. Lesniak A, Salvati A, Santos-Martinez MJ, Radomski MW, Dawson KA, Åberg C. Nanoparticle adhesion to the cell membrane and its effect on nanoparticle uptake efficiency. Journal of the American Chemical Society. ACS Publications; 2013;135:1438–44.

200. Wilhelm C, Gazeau F, Roger J, Pons JN, Bacri J-C. Interaction of anionic superparamagnetic nanoparticles with cells: kinetic analyses of membrane adsorption and subsequent internalization. Langmuir. ACS Publications; 2002;18:8148–55.

201. Kwon YJ. Before and after endosomal escape: roles of stimuli-converting siRNA/polymer interactions in determining gene silencing efficiency. Accounts of chemical research. ACS Publications; 2011;45:1077–88.

202. Semple SC, Akinc A, Chen J, Sandhu AP, Mui BL, Cho CK, et al. Rational design of cationic lipids for siRNA delivery. Nature biotechnology. Nature Publishing Group; 2010;28:172–6.

203. Xiao K, Li Y, Luo J, Lee JS, Xiao W, Gonik AM, et al. The effect of surface charge on in vivo biodistribution of PEG-oligocholic acid based micellar nanoparticles. Biomaterials. Elsevier Ltd; 2011;32:3435–46.

204. Won Y-W, Yoon S-M, Lee K-M, Kim Y-H. Poly (oligo-D-arginine) with internal disulfide linkages as a cytoplasm-sensitive carrier for siRNA delivery. Molecular Therapy. Nature Publishing Group; 2011;19:372–80.

205. Manickam DS, Li J, Putt DA, Zhou Q-H, Wu C, Lash LH, et al. Effect of innate glutathione levels on activity of redox-responsive gene delivery vectors. Journal of Controlled Release. Elsevier; 2010;141:77–84.

239

206. Drew R, Miners JO. The effects of buthionine sulphoximine (BSO) on glutathione depletion and xenobiotic biotransformation. Biochemical pharmacology. Elsevier; 1984;33:2989–94.

207. Namgung R, Kim WJ. A Highly Entangled Polymeric Nanoconstruct

Assembled by siRNA and its Reduction‐Triggered siRNA Release for Gene Silencing. Small. Wiley Online Library; 2012;8:3209–19.

208. Siegel R, DeSantis C, Virgo K. Cancer treatment and survivorship statistics, 2012. A Cancer Journal for Clinicians. 2012;62:220–41.

209. Metzger-Filho O, Tutt A, De Azambuja E, Saini KS, Viale G, Loi S, et al. Dissecting the heterogeneity of triple-negative breast cancer. Journal of clinical oncology. American Society of Clinical Oncology; 2012;30:1879–87.

210. Turner N, Moretti E, Siclari O, Migliaccio I, Santarpia L, D’Incalci M, et al. Targeting triple negative breast cancer: is p53 the answer? Cancer treatment reviews. Elsevier; 2013;39:541–50.

211. Duffy MJ, McGowan PM, Crown J. Targeted therapy for triple‐negative breast cancer: Where are we? International Journal of Cancer. Wiley Online Library; 2012;131:2471–7.

212. Micalizzi DS, Farabaugh SM, Ford HL. Epithelial-mesenchymal transition in cancer: parallels between normal development and tumor progression. Journal of mammary gland biology and neoplasia. Springer; 2010;15:117–34.

213. Kalluri R. EMT: when epithelial cells decide to become mesenchymal-like cells. The Journal of clinical investigation. American Society for Clinical Investigation; 2009;119:1417.

214. Creighton CJ, Chang JC, Rosen JM. Epithelial-mesenchymal transition (EMT) in tumor-initiating cells and its clinical implications in breast cancer. Journal of mammary gland biology and neoplasia. Springer; 2010;15:253–60.

215. Taylor MA, Parvani JG, Schiemann WP. The pathophysiology of epithelial-mesenchymal transition induced by transforming growth factor-β in normal and malignant mammary epithelial cells. Journal of mammary gland biology and neoplasia. Springer; 2010;15:169–90.

216. Galliher AJ, Schiemann WP. Beta3 integrin and Src facilitate transforming growth factor-beta mediated induction of epithelial-mesenchymal transition in mammary epithelial cells. Breast Cancer Res. 2006;8:R42.

240

217. Galliher AJ, Schiemann WP. Src phosphorylates Tyr284 in TGF-β type II receptor and regulates TGF-β stimulation of p38 MAPK during breast cancer cell proliferation and invasion. Cancer research. AACR; 2007;67:3752–8.

218. Galliher-Beckley AJ, Schiemann WP. Grb2 binding to Tyr284 in TβR-II is essential for mammary tumor growth and metastasis stimulated by TGF-β. Carcinogenesis. Oxford Univ Press; 2008;29:244–51.

219. Parvani JG, Galliher-Beckley AJ, Schiemann BJ, Schiemann WP. Targeted inactivation of β1 integrin induces β3 integrin switching, which drives breast cancer metastasis by TGF-β. Molecular biology of the cell. 2013;24:3449–59.

220. Whitehead KA, Dahlman JE, Langer RS, Anderson DG. Silencing or stimulation? siRNA delivery and the immune system. Annual review of chemical and biomolecular engineering. Annual Reviews; 2011;2:77–96.

221. Gujrati M, Malamas A, Shin T, Jin E, Lu Z-R. Multifunctional cationic lipid-based nanoparticles facilitate endosomal escape and reduction-triggered cytosolic siRNA release. Molecular Pharmaceutics. 2014;11:2734–44.

222. Wendt MK, Schiemann WP. Therapeutic targeting of the focal adhesion complex prevents oncogenic TGF-beta signaling and metastasis. Breast Cancer Res. 2009;11:R68.

223. Taylor MA, Davuluri G, Parvani JG, Schiemann BJ, Wendt MK, Plow EF, et al. Upregulated WAVE3 expression is essential for TGF-β-mediated EMT and metastasis of triple-negative breast cancer cells. Breast cancer research and treatment. Springer; 2013;142:341–53.

224. Balanis N, Yoshigi M, Wendt MK, Schiemann WP, Carlin CR. β3 Integrin–EGF receptor cross-talk activates p190RhoGAP in mouse mammary gland epithelial cells. Molecular biology of the cell. Am Soc Cell Biol; 2011;22:4288–301.

225. Shastry M, Yardley DA. Updates in the treatment of basal/triple-negative breast cancer. Current Opinion in Obstetrics and Gynecology. LWW; 2013;25:40–8.

226. Wendt MK, Smith JA, Schiemann WP. Transforming growth factor-β-induced epithelial–mesenchymal transition facilitates epidermal growth factor-dependent breast cancer progression. Oncogene. Nature Publishing Group; 2010;29:6485–98.

241

227. Wendt MK, Taylor MA, Schiemann BJ, Sossey-Alaoui K, Schiemann WP. Fibroblast growth factor receptor splice variants are stable markers of oncogenic transforming growth factor-β1 signaling in metastatic breast cancers. Breast Cancer Res. 2014;16:R24.

228. Taylor MA, Amin JD, Kirschmann DA, Schiemann WP. Lysyl oxidase contributes to mechanotransduction-mediated regulation of transforming growth factor-β signaling in breast cancer cells. Neoplasia. Elsevier; 2011;13:406–IN2.

229. Paszek MJ, Zahir N, Johnson KR, Lakins JN, Rozenberg GI, Gefen A, et al. Tensional homeostasis and the malignant phenotype. Cancer cell. Elsevier; 2005;8:241–54.

230. Wendt MK, Taylor MA, Schiemann BJ, Schiemann WP. Down-regulation of epithelial cadherin is required to initiate metastatic outgrowth of breast cancer. Molecular biology of the cell. Am Soc Cell Biol; 2011;22:2423–35.

231. Lehmann BD, Bauer JA, Chen X, Sanders ME, Chakravarthy AB, Shyr Y, et al. Identification of human triple-negative breast cancer subtypes and preclinical models for selection of targeted therapies. The Journal of clinical investigation. American Society for Clinical Investigation; 2011;121:2750.

232. Parvani JG, Taylor MA, Schiemann WP. Noncanonical TGF-β signaling during mammary tumorigenesis. Journal of mammary gland biology and neoplasia. Springer; 2011;16:127–46.

233. Wendt MK, Smith JA, Schiemann WP. p130Cas is required for mammary tumor growth and transforming growth factor-β-mediated metastasis through regulation of Smad2/3 activity. Journal of Biological Chemistry. ASBMB; 2009;284:34145–56.

234. Butcher DT, Alliston T, Weaver VM. A tense situation: forcing tumour progression. Nature Reviews Cancer. Nature Publishing Group; 2009;9:108–22.

235. Florence AT, Hussain N. Transcytosis of nanoparticle and dendrimer delivery systems: evolving vistas. Advanced drug delivery reviews. Elsevier; 2001;50:S69–S89.

236. Oh Y-K, Park TG. siRNA delivery systems for cancer treatment. Advanced drug delivery reviews. Elsevier; 2009;61:850–62.

237. Gasparini G, Brooks PC, Biganzoli E, Vermeulen PB, Bonoldi E, Dirix LY, et al. Vascular integrin alpha (v) beta3: a new prognostic indicator in breast cancer. Clinical Cancer Research. AACR; 1998;4:2625–34.

242

238. Polyak K. Heterogeneity in breast cancer. The Journal of clinical investigation. American Society for Clinical Investigation; 2011;121:3786.

239. Balanis N, Wendt MK, Schiemann BJ, Wang Z, Schiemann WP, Carlin CR. Epithelial to mesenchymal transition promotes breast cancer progression via a fibronectin-dependent STAT3 signaling pathway. Journal of Biological Chemistry. ASBMB; 2013;288:17954–67.

240. Parvani JG, Galliher-Beckley AJ, Schiemann BJ, Schiemann WP. Targeted inactivation of β1 integrin induces β3 integrin switching, which drives breast cancer metastasis by TGF-β. Molecular biology of the cell. Am Soc Cell Biol; 2013;24:3449–59.

241. Jin H, Varner J. Integrins: roles in cancer development and as treatment targets. British Journal of Cancer. Nature Publishing Group; 2004;90:561–5.

242. Barkan D, El Touny LH, Michalowski AM, Smith JA, Chu I, Davis AS, et al. Metastatic growth from dormant cells induced by a col-I–enriched fibrotic environment. Cancer research. AACR; 2010;70:5706–16.

243. Barkan D, Kleinman H, Simmons JL, Asmussen H, Kamaraju AK, Hoenorhoff MJ, et al. Inhibition of metastatic outgrowth from single dormant tumor cells by targeting the cytoskeleton. Cancer research. AACR; 2008;68:6241–50.

244. Malamas AS, Gujrati M, Kummitha CM, Xu R, Lu Z-R. Design and evaluation of new pH-sensitive amphiphilic cationic lipids for siRNA delivery. Journal of controlled release : official journal of the Controlled Release Society. Elsevier B.V.; 2013;171:296–307.

245. Tseng Y-C, Mozumdar S, Huang L. Lipid-based systemic delivery of siRNA. Advanced Drug Delivery Reviews. Elsevier B.V.; 2009;61:721–31.

246. Li S-D, Huang L. Gene therapy progress and prospects: non-viral gene therapy by systemic delivery. Gene therapy. 2006;13:1313–9.

247. Otsuka H, Nagasaki Y, Kataoka K. PEGylated nanoparticles for biological and pharmaceutical applications. Advanced Drug Delivery Reviews. 2003;55:403–19.

248. Jokerst J, Lobovkina T, Zare R, Gambhir S. Nanoparticle PEGylation for imaging and therapy. Nanomedicine. 2011;6:715–28.

243

249. Peracchia M, Fattal E, Desmaele D. Stealth® PEGylated polycyanoacrylate nanoparticles for intravenous administration and splenic targeting. Journal of Controlled Release. 1999;60:121–8.

250. Van Vlerken LE, Vyas TK, Amiji MM. Poly(ethylene glycol)-modified nanocarriers for tumor-targeted and intracellular delivery. Pharmaceutical research. 2007;24:1405–14.

251. Li S, Huang L. Stealth nanoparticles: high density but sheddable PEG is a key for tumor targeting. Journal of Controlled Release. 2010;145:178–81.

252. Hatakeyama H, Akita H, Harashima H. The Polyethyleneglycol Dilemma : Advantage and Disadvantage of PEGylation of Liposomes for Systemic Genes and Nucleic Acids Delivery to Tumors. Biological and Pharmaceutical Bulletin. 2013;36:892–9.

253. Liu T, Thierry B. A solution to the PEG dilemma: efficient bioconjugation of large gold nanoparticles for biodiagnostic applications using mixed layers. Langmuir. 2012;28:15634–42.

254. Stuart M a C, Huck WTS, Genzer J, Müller M, Ober C, Stamm M, et al. Emerging applications of stimuli-responsive polymer materials. Nature materials. Nature Publishing Group; 2010;9:101–13.

255. Torchilin V. Multifunctional and stimuli-sensitive pharmaceutical nanocarriers. European journal of pharmaceutics and biopharmaceutics. Elsevier B.V.; 2009;71:431–44.

256. Ganta S, Devalapally H, Shahiwala A, Amiji M. A review of stimuli-responsive nanocarriers for drug and gene delivery. Journal of controlled release. 2008;126:187–204.

257. Rapoport N. Physical stimuli-responsive polymeric micelles for anti-cancer drug delivery. Progress in Polymer Science. 2007;32:962–90.

258. Petros R a, DeSimone JM. Strategies in the design of nanoparticles for therapeutic applications. Nature reviews Drug discovery. Nature Publishing Group; 2010;9:615–27.

259. Rejman J, Wagenaar A, Engberts JBF., Hoekstra D. Characterization and transfection properties of lipoplexes stabilized with novel exchangeable polyethylene glycol–lipid conjugates. Biochimica et Biophysica Acta (BBA) - Biomembranes. 2004;1660:41–52.

244

260. Choi JS, Mackay JA, Szoka FC. Low-pH-Sensitive PEG-Stabilized Plasmid-Lipid Nanoparticles : Preparation and Characterization. 2003;420–9.

261. Soppimath KS, Tan DC-W, Yang Y-Y. pH-Triggered Thermally Responsive Polymer Core-Shell Nanoparticles for Drug Delivery. Advanced Materials. 2005;17:318–23.

262. Zhang J. Pharmaco attributes of dioleoylphosphatidylethanolamine/cholesterylhemisuccinate liposomes containing different types of cleavable lipopolymers. Pharmacological Research. 2004;49:185–98.

263. Dong W, Kishimura A, Anraku Y, Chuanoi S, Kataoka K. Monodispersed Polymeric Nanocapsules : Spontaneous Evolution and Morphology Transition from Reducible Hetero-PEG PICmicelles by Controlled Degradation. 2009;33:3804–5.

264. Hatakeyama H, Akita H, Kogure K, Oishi M, Nagasaki Y, Kihira Y, et al. Development of a novel systemic gene delivery system for cancer therapy with a tumor-specific cleavable PEG-lipid. Gene Therapy. 2006;14:68–77.

265. Hatakeyama H, Akita H, Ito E, Hayashi Y, Oishi M, Nagasaki Y, et al. Systemic delivery of siRNA to tumors using a lipid nanoparticle containing a tumor-specific cleavable PEG-lipid. Biomaterials. Elsevier Ltd; 2011;32:4306–16.

266. Tomlinson R, Heller J, Brocchini S, Duncan R. Polyacetal-Doxorubicin Conjugates Designed for pH-Dependent Degradation. 2003;1096–106.

267. Shin J, Shum P, Thompson DH. A cid-triggered release via dePEGylation of DOPE liposomes containing acid-labile vinyl ether PEG – lipids. 2003;91:187–200.

268. Kirpotin D, Hong K, Mullah N, Papahadjopoulos D, Zalipsky S. Liposomes with detachable polymer coating " destabilization and fusion of dioleoylphosphatidylethanolamine vesicles triggered by cleavage of surface-grafted poly ( ethylene glycol ). 1996;388:115–8.

269. Martin G, Jain R. Fluorescence ratio imaging measurement of pH gradients: calibration and application in normal and tumor tissues. Microvascular research. 1993;

270. Lee ES, Na K, Bae YH. Doxorubicin loaded pH-sensitive polymeric micelles for reversal of resistant MCF-7 tumor. Journal of controlled

245

release : official journal of the Controlled Release Society. 2005;103:405–18.

271. Walker GF, Fella C, Pelisek J, Fahrmeir J, Boeckle S, Ogris M, et al. Toward synthetic viruses: endosomal pH-triggered deshielding of targeted polyplexes greatly enhances gene transfer in vitro and in vivo. Molecular therapy : the journal of the American Society of Gene Therapy. 2005;11:418–25.

272. Kale A, Torchilin V. Design, synthesis, and characterization of pH-sensitive PEG-PE conjugates for stimuli-sensitive pharmaceutical nanocarriers: the effect of substitutes at the hydrazone linkage. Bioconjugate chemistry. 2007;18:363–70.

273. Koren E, Apte A, Jani A, Torchilin VP. Multifunctional PEGylated 2C5-immunoliposomes containing pH-sensitive bonds and TAT peptide for enhanced tumor cell internalization and cytotoxicity. Journal of controlled release. Elsevier B.V.; 2012;160:264–73.

274. Christie R, Anderson D, Grainger D. Comparison of hydrazone heterobifunctional cross-linking agents for reversible conjugation of thiol-containing chemistry. Bioconjugate chemistry. 2010;21:1779–87.

275. Prabaharan M, Grailer JJ, Pilla S, Steeber D a, Gong S. Amphiphilic multi-arm-block copolymer conjugated with doxorubicin via pH-sensitive hydrazone bond for tumor-targeted drug delivery. Biomaterials. Elsevier Ltd; 2009;30:5757–66.

276. Yoo H, Lee E, Park T. Doxorubicin-conjugated biodegradable polymeric micelles having acid-cleavable linkages. Journal of Controlled Release. 2002;82:17–27.

277. Haubner R, Wester H. Glycosylated RGD-containing peptides: tracer for tumor targeting and angiogenesis imaging with improved biokinetics. Journal of Nuclear Medicine. 2001;42:326–37.

278. Wilhelm C, Billotey C, Roger J, Pons J. Intracellular uptake of anionic superparamagnetic nanoparticles as a function of their surface coating. Biomaterials. 2003;24:1001–11.

279. Nam HY, Kwon SM, Chung H, Lee S-Y, Kwon S-H, Jeon H, et al. Cellular uptake mechanism and intracellular fate of hydrophobically modified glycol chitosan nanoparticles. Journal of Controlled Release. Elsevier B.V.; 2009;135:259–67.

246

280. Gratton SEA, Ropp PA, Pohlhaus PD, Luft JC, Madden VJ, Napier ME, et al. The effect of particle design on cellular internalization pathways. 2008;105.

281. Olbrich C, Bakowsky U, Lehr C, Muller RH, Kneuer C. Cationic solid-lipid nanoparticles can efficiently bind and transfect plasmid DNA. Journal of Controlled Release. 2001;77:345–55.

282. Moulder, S, Hortobagyi G. Advances in the treatment of breast cancer. Clinical pharmacology and therapeutics. 2008;83:26–36.

283. Berry D, Cronin K, Plevritis S, Fryback D, Clarke L, Zelen M, et al. Effect of screening and adjuvant therapy on mortality from breast cancer. The New England Journal of Medicine. 2005;353:1784–92.

284. Trends C, Report P. Image description. Cancer Trends Progress Report - 2007 Update End of image description. 2007;

285. Osbourne C. Steroid hormone receptors in breast cancer management. Breast Cancer Research Treatment. 1998;

286. Nahta R, Esteva FJ. Trastuzumab: triumphs and tribulations. Oncogene. 2007;26:3637–43.

287. Siegel R, Naishadham D, Jemal A. Cancer statistics, 2012. A Cancer Journal for Clinicians. 2012;62:10–29.

288. Hsieh AC, Ruggero D. Targeting eukaryotic translation initiation factor 4E (eIF4E) in cancer. Clinical Cancer Research. 2010;16:4914–20.

289. Wendel H, Silva R, Malina A, Mills J, Zhu H, Ueda T, et al. Dissecting eIF4E action in tumorigenesis. Genes and Development. 2007;21:3232–7.

290. Konicek BW, Dumstorf CA, Graff JR. Targeting the eIF4F translation initiation complex for cancer therapy. Cell Cycle. 2014;7:2466–71.

291. Silvera D, Formenti SC, Schneider RJ. Translational control in cancer. Nature Reviews. Nature Publishing Group; 2010;10:254–66.

292. Hiller DJ, Chu Q, Meschonat C, Panu L, Burton G, Li BDL. Predictive value of eIF4E reduction after neoadjuvant therapy in breast cancer. The Journal of surgical research. Elsevier Ltd; 2009;156:265–9.

293. McClusky DR, Chu Q, Yu H, DeBenedetti A, Johnson LW, Meschonat C, et al. A Prospective Trial on Initiation Factor 4E (eIF4E) Overexpression and

247

Cancer Recurrence in Node-Positive Breast Cancer. Annals of Surgery. 2005;242:584–92.

294. Byrnes KW, DeBenedetti A, Holm NT, Luke J, Nunez J, Chu QD, et al. Correlation of TLK1B in Elevation and Recurrence in Doxorubicin-Treated Breast Cancer Patients with High eIF4E Overexpression. Journal of the American College of Surgeons. 2007;204:925–33.

295. Holm N, Byrnes K, Johnson L, Abreo F, Sehon K, Alley J, et al. A Prospective Trial on Initiation Factor 4E (eIF4E) Overexpression and Cancer Recurrence in Node-Negative Breast Cancer. Annals of Surgical Oncology. 2008;15:3207–15.

296. Li B, Gruner J, Abreo F, Johnson L, Yu H, Nawas S, et al. Prospective Study of Eukaryotic Initiation Factor 4E Protein Elevation and Breast Cancer Outcome. Annals of Surgery. 2002;235:732–9.

297. Flowers A, Chu QD, Panu L, Meschonat C, Caldito G, Lowery-Nordberg M, et al. Eukaryotic initiation factor 4E overexpression in triple-negative breast cancer predicts a worse outcome. Surgery. Mosby, Inc.; 2009;146:220–6.

298. Li B, McDonald J, Nassar R, De Benedetti A. Clinical outcome in stage I to III breast carcinoma and eIF4E overexpression. Annals of surgery. 1998;227:756–61.

299. Zhou F, Yan M, Guo G, Wang F, Qiu H, Zheng F, et al. Knockdown of eIF4E suppresses cell growth and migration, enhances chemosensitivity and correlates with increase in Bax/Bcl-2 ratio in triple-negative breast cancer cells. Medical oncology (Northwood, London, England). 2011;28:1302–7.

300. Dong K, Wang R, Wang X, Lin F, Shen J-J, Gao P, et al. Tumor-specific RNAi targeting eIF4E suppresses tumor growth, induces apoptosis and enhances cisplatin cytotoxicity in human breast carcinoma cells. Breast Cancer Research and Treatment. 2008;113:443–56.

301. Oridate N, Kim H-J, Xu X, Lotan R. Growth inhibition of head and neck squamous carcinoma cells by small interfering RNAs targeting eIF4E or cyclin D1 alone or combined with cisplatin. Cancer Biology & Therapy. 2014;4:318–23.

302. Graff J, Konicek B. Therapeutic suppression of translation initiation factor eIF4E expression reduces tumor growth without toxicity. The Journal of …. 2007;117.

248

303. DeFatta R, Nathan C, De Benedetti A. Antisense RNA to eIF4E suppresses oncogenic properties of a head and neck squamous cell carcinoma cell line. The Laryngoscope. 2000;110:928–33.

304. Siegele B, Cefalu C, Holm N, Sun G, Tubbs J, Meschonat C, et al. eIF4E-targeted suicide gene therapy in a minimal residual mouse model for metastatic soft-tissue head and neck squamous cell carcinoma improves disease-free survival. The Journal of surgical research. 2008;148:83–9.

305. Culjkovic B, Borden KL. Understanding and Targeting the Eukaryotic Translation Initiation Factor eIF4E in Head and Neck Cancer. Journal of Oncology. 2009;2009:1–12.

306. Kentsis A, Topisirovic I. Ribavirin suppresses eIF4E-mediated oncogenic transformation by physical mimicry of the 7-methyl guanosine mRNA cap. Proceedings of the National Academy of Science. 2004;101:18105–10.

307. Moerke NJ, Aktas H, Chen H, Cantel S, Reibarkh MY, Fahmy A, et al. Small-molecule inhibition of the interaction between the translation initiation factors eIF4E and eIF4G. Cell. 2007;128:257–67.

308. Soni A, Akcakanat A, Singh G, Luyimbazi D, Zheng Y, Kim D, et al. eIF4E knockdown decreases breast cancer cell growth without activating Akt signaling. Molecular cancer therapeutics. 2008;7:1782–8.

309. Hong DS, Kurzrock R, Oh Y, Wheler J, Naing A, Brail L, et al. A phase 1 dose escalation, pharmacokinetic, and pharmacodynamic evaluation of eIF-4E antisense oligonucleotide LY2275796 in patients with advanced cancer. Clinical Cancer Research. 2011;17:6582–91.

310. Greenberg VL, Zimmer SG. Paclitaxel induces the phosphorylation of the eukaryotic translation initiation factor 4E-binding protein 1 through a Cdk1-dependent mechanism. Oncogene. 2005;24:4851–60.

311. Li F, Ambrosini G, Chu E, Plescia J. Control of apoptosis and mitotic spindle checkpoint by survivin. Nature. 1998;396:1–5.

312. Ling X, Bernacki RJ, Brattain MG, Li F. Induction of survivin expression by taxol (paclitaxel) is an early event, which is independent of taxol-mediated G2/M arrest. The Journal of biological chemistry. 2004;279:15196–203.

313. Hsieh AC, Ruggero D. Targeting eukaryotic translation initiation factor 4E (eIF4E) in cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 2010;16:4914–20.

249

314. Kundu AK, Chandra PK, Hazari S, Ledet G, Pramar Y V, Dash S, et al. Stability of lyophilized siRNA nanosome formulations. International journal of pharmaceutics. Elsevier B.V.; 2012;423:525–34.

315. Schroeder A, Heller D a, Winslow MM, Dahlman JE, Pratt GW, Langer R, et al. Treating metastatic cancer with nanotechnology. Nature reviews Cancer. Nature Publishing Group; 2012;12:39–50.

316. Chauhan VP, Jain RK. Strategies for advancing cancer nanomedicine. Nature materials. Nature Publishing Group; 2013;12:958–62.

317. Cheng Z, Zaki A Al, Hui J, Muzykantov V, Tsourkas A. Multifunctional nanoparticles: cost versus benefit of adding targeting and imaging capabilities. Science. 2012;338:903–10.

318. Hernandez FJ, Stockdale KR, Huang L, Horswill AR, Behlke M a, McNamara JO. Degradation of nuclease-stabilized RNA oligonucleotides in Mycoplasma-contaminated cell culture media. Nucleic acid therapeutics. 2012;22:58–68.

319. Yuan Y-Y, Mao C-Q, Du X-J, Du J-Z, Wang F, Wang J. Surface charge switchable nanoparticles based on zwitterionic polymer for enhanced drug delivery to tumor. Advanced materials (Deerfield Beach, Fla). 2012;24:5476–80.

320. Du J, Du X, Mao C, Wang J. Tailor-made dual pH-sensitive polymer–doxorubicin nanoparticles for efficient anticancer drug delivery. Journal of the American …. 2011;17560–3.

based sirna delivery system for the treatment of triple-negative ...

Documents

Transcript of based sirna delivery system for the treatment of triple-negative ...