Journal of Controlled Release 130 (2008) 46–56

Contents lists available at ScienceDirect

Journal of Controlled Release

j ourna l homepage: www.e lsev ie r.com/ locate / jconre l

GENEDELIVERY

Delivery of siRNA mediated by histidine-containing reducible polycations

Mark Stevenson a,⁎, Victor Ramos-Perez a, Surjeet Singh b, Mahmoud Soliman c, Jon A. Preece d,Simon S. Briggs a, Martin L. Read e, Leonard W. Seymour a

a Department of Clinical Pharmacology, Old Road Campus Research Building, University of Oxford, Old Road Campus, off Roosevelt Drive, Headington, Oxford OX3 7DQ , UKb Glide Pharmaceutical Technologies Limited, Abingdon, Oxfordshire OX14 4RU, UKc School of Pharmacy, University of Nottingham, University Park, Nottingham NG7 2RD, UKd Department of Chemistry, University of Birmingham, Edgbaston, Birmingham B15 2TT, UKe Division of Medical Sciences, Institute for Biomedical Research, University of Birmingham, Edgbaston, Birmingham B15 2TT, UK

⁎ Corresponding author. Tel.: +44 1865 617041; fax: +E-mail address: mark.stevenson@clinpharm.ox.ac.uk

0168-3659/$ – see front matter © 2008 Elsevier B.V. Aldoi:10.1016/j.jconrel.2008.05.014

A B S T R A C T

A R T I C L E I N F O

Article history:

Histidine containing reduci Received 26 February 2008Accepted 9 May 2008Available online 24 May 2008

Keywords:RNAiPlasmodium falciparum circumsporozoiteHepatitisGene therapyNon-viral delivery

ble polycations based on CH6K3H6C monomers (His6 RPCs), are highly effectiveDNA transfection agents combining pH buffering endosomal escape mechanisms with rapid unpackagingfollowing reduction in the cytoplasm. We examined their ability to mediate siRNA uptake into cells focusingon hepatocyte delivery. Co-delivery of EGFP siRNA with pEGFP plasmid DNA reduced reporter geneexpression by 85%. However while DNA transfection efficiency increased with polymer size, with 162 k His6RPCs proving the most effective, delivery of siRNA alone to EGFP stably expressing cells was only possibleusing 36–80 k polymers. Analysis of particle sizes showed that 80 k polymers formed more compact siRNAcomplexes than 162 k polymers. The reducible nature of the polymer was necessary for siRNA activity, sincesiRNA combined with non-reducible polylysine showed little activity. Incorporation of a targeting peptidefrom the Plasmodium falciparum circumsporozoite (CS) protein onto His6 RPCs, significantly improvedtransfection of plasmid DNA and siRNA activity in hepatocytes, but not in most non-liver cells tested. siRNAtargeted to the hepatitis B virus surface antigen delivered by CS-His6 RPC, mediated falls in both mRNA andprotein expression, suggesting that this delivery system could be developed for potential therapies for viralhepatitis.

© 2008 Elsevier B.V. All rights reserved.

1. Introduction

Utilization of RNA interference (RNAi) [1–3] to suppress target geneexpression has widespread potential for therapeutic application.Strategies eliciting RNAi involve targeting exogenous disease causinggenes such as viral pathogens, or endogenous genes playing a role in thedisease process. There are two basic approaches; a drug approachwheresiRNA is administered in itsfinal form, ora gene therapyapproachwhereprecursor hairpin siRNAs, that are subsequently processed, areexpressed from viral or synthetic vectors providing longer termsuppression. The first strategy is both simpler and avoids such problemsas antibody-mediated viral vector neutralization, or restrictive effects ofthe intact nuclear membrane in non-mitosing cells.

Synthetic vectors based on polycations such as polyethylenimine(PEI) and cyclodextrin, commonly used for plasmid DNA delivery, haverecently been used to transfer siRNA to cells [4–7]. Although bothplasmid DNA and siRNA have anionic phosphodiester backbones, withidentical negative charge/nucleotide ratios allowing interactions withcationic polymers, their molecular weight and molecular topology are

44 1865 617028.(M. Stevenson).

l rights reserved.

very different [8]. Consequently it is not a straightforward matterto extrapolate findings from DNA complexation with cationic poly-mers for siRNA vectors. For example plasmid DNA condenses intosmall 60–100 nm nanoparticles following neutralization of 70–90% ofbackbone charges by a cationic agent [9–11]. However there is aminimal size of around 150 bp for plasmid DNA condensation to occur[9,12]. It is not surprising therefore that 21–25 nt siRNA moleculeshave different condensation properties. Electrostatic interactionsbetween siRNA and cationic molecules are relatively uncontrolledleading to particles of excessive size and poor stability [8]. PlasmidDNA and siRNA particle formation should therefore be regarded asdistinct challenges.

We have previously developed nucleic acid delivery using syntheticvectors based on reducible polycations (RPCs) prepared by oxidativepolycondensation. Our first generation polymers based on CK10Cmonomeric units, relied on cleavage of the RPC in the intracellularenvironment, eliminating the toxicity associated with high molecularweight polymers [13]. However these polymers rely on chloroquine orcationic lipids to enhance endosomal escape and mediate transfection.Delivery of nucleic acids with polylysine based polymers, can beimproved by the incorporation of histidyl residues that become cationicupon protonation of the imidazole group below pH6 [14,15]. Wetherefore developed second generation RPCs formed from histidine

47M. Stevenson et al. / Journal of Controlled Release 130 (2008) 46–56

GENEDELIVERY

containing monomers (CH6K3H6C) [16]. These vectors provide multiplefunctions; namely the ability of polycations to condense nucleic acidsinto tight complexes for efficient cellularuptake,with reducible polymerbackbones that can be cleaved in the cytoplasm to promote unpackagingand alleviate toxicity [17,18]. The presence of histidine residues enablesendosomal buffering and escape, removing the requirement forendosomolytic agents such as chloroquine.

In this report we have examined the ability of histidine containingRPCs to deliver siRNA to cells, focusing on hepatocyte delivery fortreating viral hepatitis. Hepatitis B infection affects over 350 millionpeople worldwide [19], with substantial numbers succumbing tochronic liver disease andhepatocellular carcinoma. Immunemodulatorssuch as interferon alpha can provide respite but sustained responses arerare. Consequently several groups have investigated the use of siRNA totarget and down regulate hepatitis B viral gene expression [20–23].

In contrast to plasmid DNA, where the large molecular weightpolymers (162 k) were more efficient vectors, smaller molecularweight His6 RPCs (36 k–80 k) were required for efficient siRNAcomplexation and delivery. These smaller reducible polymers werecapable of releasing biologically active siRNA triggering RNAi inhepatocytes, however the efficiency was generally lower thancommercially available lipids. The incorporation of a hepatocytespecific targeting peptide onto the termini of the RPCs, increaseddelivery and biological activity of plasmid DNA or siRNA, in a tissuespecific manner. Delivery of siRNA targeting Hepatitis B virus surfaceantigen (HBsAg), complexed with His6 RPC, reduced the amount ofviral protein shed fromAlexander cells, demonstrating the potential ofthese vectors to down regulate pathogenic gene expression andprovide therapies for viral hepatitis.

2. Materials and methods

2.1. Cells

The human liver hepatoma line PLC/PRF/5, also known as Alexander(ECACCNo. 85061113), prostate lines PC-3 (ECACCNo. 90112714), PNT1aand PNT2-C2 [24–26], A549 lung carcinoma (ECACC No. 86012804),MDA-MB-231 breast adenocarcinoma (ATCC No. HTB-26), COS-7 SV40transformed African green monkey kidney (ECACC No. 87021302), andA9 mouse fibroblast cells (ATCC No. CCL-1.4), were each maintained inDulbecco's Modified Eagle Medium (DMEM), 4.5 g/l glucose, 2 mMglutamine (PAA Laboratories GmbH, UK), supplemented with 10% foetalcalf serum (FCS), 50 U/ml penicillin and 50 μg/ml streptomycin(Invitrogen, UK). HepG2 human hepatocyte carcinoma (ECACC No.85011430) and SiHa cervical carcinoma cells (ATCC No. HTB-35) weremaintained in Minimal Essential Medium with Earle's salts (EMEM),2mMglutamine (PAA Laboratories GmbH, UK), supplementedwith 10%FCS, 50U/mlpenicillin, 50 μg/ml streptomycin and0.1mMnon-essentialamino-acids. LNCaP human prostate carcinoma (ECACC No. 89110211)and CaSki cervical carcinoma cells (ATCC No. CRL-1550) were main-tained inRPMI1640medium,2mMglutamine (PAALaboratoriesGmbH,UK), supplemented with 10% FCS, 50 U/ml penicillin, 50 μg/mlstreptomycin (Invitrogen, UK). P4E6 an immortalized human prostateepithelial cell line derived fromawell differentiated tumour [27,28],wasmaintained in Keratinocyte-SFM medium, 10% FCS, 2 mM glutamine,5 ng/ml EGF human recombinant and 50 μg/ml bovine pituitary extract(Invitrogen, UK). Human umbilical vein endothelial cells (HUVEC) weremaintained in endothelial cell growth medium containing 2% serum(Promocell, UK). All cells were maintained at 37 °C in a 5% CO2 hu-midified environment.

2.2. Nucleic acids

pEGFP-C1 expressing green fluorescent protein driven by the CMVimmediate early promoter (Clontech, CA, USA) and pcDNA3.1Hygro-LacZ containing the lacZ gene under the control of the CMV promoter,

were grown in Escherichia coli and purified using Qiagen Gigaprepkits. The concentration and purity of plasmid DNA was checked byspectrophotometer at A260 and A280 absorbance wavelengths.

siRNA targeting GFP (siGFP) (target sequence CGGCAAGCTGACCCT-GAAGTTCAT) and luciferase (siLUC) (target sequence AACTTACGCT-GAGTACTTCGA) were purchased from Qiagen, UK. siRNAs targetingHepatitis B surface antigenwere designed using the Dharmacon guide-lines based on Reynolds et al. [29]. Three siRNAs; siHBsAg-1 targetingAACATCACATCAGGATTCCTA, siHBsAg-2 targeting AATCACTCAC-CAACCTCTTGT and siHBsAg-3 targeting CTATATGGATGATGTGGTA,were synthesised by Qiagen, UK.

siGFP was labelled with the fluorescent dye Cy3, using the Label ITsiRNA Tracker Cy3 labelling kit according to the manufacturer'sinstructions (Mirus, Wi, USA).

2.3. Generation of EGFP stably expressing cell lines

Alexander and HepG2 cells stably expressing EGFP were generatedby liposomal transfection followed by antibiotic selection. Briefly3×105 Alexander or HepG2 cells were added to the wells of a 6-welldish. pEGFP-C1 was mixed with DOTAP (Roche) at a w/w ratio of 5:1according to the manufacturer's instructions. Liposomes were addedto cells at 2.5 μg DNA per well in 1.2 ml serum free medium. After 4 hthe medium was removed and replaced with 3 ml of DMEM con-taining 10% FCS. Twenty four hours later, the medium was replacedwith selection medium (DMEM, 10% FCS, 400 μg/ml G418-sulfate(Invitrogen, UK)) to kill off untransfected cells. Cells were culturedreplacing the selection medium every 3 d until EGFP expressingcolonies appeared. Well established colonies containing approxi-mately 100 cells were isolated by trypsinization using cloning cyl-inders (Sigma-Aldrich, UK) and transferred to the wells of a 96-wellplate. The individual clones were subsequently analysed by flowcytometry to determine levels of EGFP expression.

2.4. Synthesis of reducible polycations

CK10C monomers were synthesised as previously described [13,16]and CH6K3H6C (His6) monomers were synthesised by the AdvancedBiotechnology Centre (Imperial College School of Medicine, London,UK). Reducible polycations were generated by oxidative polycondensa-tion as previously described [13,16]. Reactions were terminated atvarious time points by the addition of 8 mol% 2-aminoethanethiol. Themolecular weight of the polymer was determined by gel permeationchromatography using commercially available polylysine standards(Sigma-Aldrich, UK) to calibrate the column. The standards and RPCswere injected onto a CATSEC 300 GPC column (5 U, 25 cm×4.6 mm ID)(Eprogen, IL, USA) and eluted in 300 mMNaCl+0.1% TFA (trifluoroaceticacid). Unreacted monomer and DMSO were removed by purificationusing centrifugal filters with a molecular weight cut off of 10,000.Concentration of RPCswas determined by 2,4,6-trinitrobenzenesulfonicacid (TNBS) assayusingpolylysine calibration. Thepolydispersityof eachRPC was calculated by Mw/Mn (Mw=ΣMi

2Ni/ΣMiNi and Mn=ΣMiNi/ΣNi

where Ni is the number of molecules of molecular weightMi) [30].A targeting peptide derived from the Plasmodium falciparum

circumsporozoite (CS) protein (HNMPNDPNRNVDENANANSAYC) and ascrambled version (HNMPANRDNAPNNDNENVSAYC), were synthesisedby the Advanced Biotechnology Centre (Imperial College School ofMedicine, London, UK). These peptides were attached to His6 RPCs,formed during a 24 h oxidative polycondensation reaction, by re-suspension at 2mg/ml in 0.5× PBS, 50mMHEPES pH7.4, and addition ata final concentration of 1 mg/ml to the polymerisation reaction. Ad-ditional DMSO was employed to maintain 30 vol.% and the reactionincubated at room temperature for a further 24 h. Centrifugal filterswere used to removeDMSOandunattached CS or scrambled CS peptide.

The CS content of the targeted-RPCs was determined by aminoacid analysis following hydrolysis in 6 M HCl at 100 °C for 16 h and

48 M. Stevenson et al. / Journal of Controlled Release 130 (2008) 46–56

GENEDELIVERY

neutralisation with 10 M NaOH. Briefly the samples were deriv-atised with OPT reagent, (27 mg O-phthaldialdehyde, 500 μl ethanol,20 μl 2-mercaptoethanol, 4.5 ml 400 mM borate buffer pH 9.3,) prior toanalysis using a Shimadzu HPLC equipped with a Luna 5 um, C18(2)column, 2×150mm (Phenomenex, UK), and elutedwith an acetonitrile;phosphate buffer (10mM, pH 5.5) gradient. Amino acid standard curveswere generated from derivatised amino-acids using the method above.Polydispersity of the retargeted polymers was determined from eachGPC trace as described for the untargeted polymers.

2.5. Formation of polyplexes

Plasmid DNA or siRNA was diluted, in a polypropylene microcen-trifuge tube, to 100 ng/μl with either, 20mMHEPES-NaOH buffer pH 7.4or HBS (20 mM HEPES-NaOH, 150 mM NaCl pH 7.4). Polycation wasadded to a second polypropylene tube in a two-fold volume ofappropriate buffer, such that following the addition of nucleic acid thedesiredw/w (or N:P) ratiowas generated. The nucleic acid was added tothe RPC and mixed by vortexing, and polyplexes allowed to form byincubation at roomtemperature for20–30min.DOTAP/siRNA liposomeswere formed at aw/w ratio of 5:1 and JetPEI/siRNApolyplexes formed atN:P 5:1, according to the manufacturer's instructions (Roche, UK andPolyplus, France respectively).

Polyplexes comprising both plasmid DNA and siRNA together wereformed by prior mixing of DNA and siRNA at a 13:1 w/w ratio.

2.6. Characterization of polyplexes

The formation of polyplexes containing plasmid DNA, siRNA orboth, were analysed by agarose gel electrophoresis. Complexescontaining 100 ng of nucleic acid prepared at various w/w ratiosranging from 1–20, were added to wells of a 0.8% (plasmid DNA), 2.5%(siRNA) or 1.0% (plasmid DNA and siRNA) agarose gel containing500 ng/ml ethidium bromide. Samples were run at 5 V/cm to resolvenucleic acid mobility and visualised by UV illumination. To simulatereduction mediated destabilisation within the cells, polyplexes wereincubated with 8 mM glutathione (Sigma-Aldrich, UK) for 1 h at 37 °Cprior to analysis by gel electrophoresis.

To assess serum stability, uncomplexed nucleic acid or nucleic acidCS-His6 RPC complexes at w/w 15:1 (N:P 5.6:1) were exposed to 75%foetal calf serum (16.67 ng/μl nucleic acid final concentration) for 16 h.Fifty nanograms of uncomplexed or complexed nucleic acid wasadded towater, buffer (50mMTris HCl pH 7.8, 2.5mMEDTA, 2.5% SDS)or 4mg/ml proteinase K in buffer, incubated for 1min and loaded ontoan agarose gel.

Condensation of plasmid DNA and siRNA by 162 k His6 RPC wasalso determined using an ethidium bromide exclusion assaymeasuredwith an LS-50B fluorimeter (Perkin-Elmer, UK) at 520 nm excitationand 590 nm emission wavelengths.

The physical size and polydispersity of siRNA or DNA/siRNApolyplexes was measured by dynamic light scattering using aZetasizer 3000 (Malvern Instruments, UK) equipped with a 50 MWinternal laser. At least 10 measurements were obtained for eachsample at 25 °C in 20 mM HEPES-NaOH pH 7.4 at a scattering angle of90° and analyzed bymonomodal analysis. The machinewas calibratedusing 199 nm (+/−6 nm) polymer beads (Duke Scientific Corp., CA,USA).

2.7. Transfection and siRNA efficacy studies

For DNA transfection studies 4–5×104 cells were plated into 24 or48-well dishes 24 h prior to delivery. Liposomes and polyplexes wereprepared and added to cells in either 125 μl (0.5 μg pEGFP-C1/well of24-well plate) or 100 μl (0.2 μg pEGFP-C1/well of 48-well plate) serumfree medium. After 4 h medium containing 10% FCS was added andcells cultured for a further 20 h prior to analysing reporter gene

expression. EGFP expression was examined after 48 h by flow cy-tometry using a Becton Dickinson FACSCaliber; analysis performedusing CellQuestPro software.

For DNA/siRNA co-delivery assays, complexes were added to cellssuch that each well received 0.2 μg pEGFP and 10 nM siRNA, reportergene activity determined after 48 h.

For siRNA delivery alone 3×104 Alexander EGFP or HepG2 EGFPcells were plated out in 24 or 48-well dishes. Polyplexes wereprepared and added to cells such that each well received 25–100 nMsiRNA. EGFP expression was examined after 48–72 h.

Uptake of siRNA was assessed by adding Cy3-siGFP/CS-His6 RPCcomplexes to 4×104 Alexander cells, plated into 8-well chamberslides, for 6 h prior to visualization by fluorescence microscopy.

2.8. Cytotoxicity

104 Alexander cells were seeded into a 96-well plate and incubatedovernight. siRNA complexes formulated with 36 k His6 RPC (w/w 40:1,N:P 15:1),114 kHis6 RPC (w/w40:1, N:P 15:1) or DOTAP (w/w 5:1)wereadded to cells at afinal siRNA concentration of 100 nM(62.6 ng perwell)in 40 μl of serum freeDMEM.After4h220 μl ofDMEMcontaining10% fcswas added and cells incubated for a further 20 h. The cell number wasdetermined using CellTitre96Aqueous One Solution (Promega, UK)according to themanufacturer's instructions. The absorbance at 490 nmwas determined using a Wallac Victor2 Platereader.

2.9. HBsAg ELISA

Following delivery of siHBsAg-1, siHBsAg-2 or siHBsAg-3 to Alex-ander cells, the amount of surface antigen shed into the medium wasdetermined using an HBsAg ELISA kit according to the manufacturer'sinstructions (Abazyme,MA, USA). The optical densitywas determined ata wavelength of 450 nm using a Wallac microtiter plate reader.

2.10. Quantitative RT-PCR

Total RNA was extracted from cells using the Qiagen RNeasy Minikit according to the manufacturer's instructions. cDNA was generatedfrom the RNA samples following elimination of genomic DNA, usingQuantiTect Reverse Transcription kit (Qiagen, UK) according tomanufacturer's instructions. The cDNA was analysed for purity andconcentration using a spectrophotometer at 260 nm and 280 nmwavelengths. Quantitative PCR was performed using the QuantiTectProbe PCR kit (Qiagen, UK) using HBsAg forward primer 5′ CAACCT-CTTGTCCTCCAACTTGT 3′, reverse primer 5′ AGGCATAGCAGCA-GGATGAAG 3′ and probe 5′ CTGGATGTGTCTGCGGCGTTTTATCATATT3′ labeled with FAM and TAMRA. Endogenous reference gene GAPDHwas detected using forward primer 5′ GAAGGTGAAGGTCGGAGTC3′, reverse primer 5′ GAAGATGGTGATGGGATTTC 3′ and probe 5′CAAGCTTCCCGTTCTCAGCC 3′ labeled with FAM and TAMRA. In eachcase 100 ng of sample cDNA was added to the reaction. DNA wasamplified using the thermal cycling conditions, 50 °C for 2min, 95 °C for10 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min,generated in an Applied Biosystems 7000 Sequence Detection System.Subsequent analysiswas performedusingABI Prism7000 SDS Software.A standard curve of Ct value vs. log amount of standard was generatedfor HBsAg and GAPDH using 5-fold dilutions of cDNA prepared fromtotal RNA extracted from mock treated control cells.

3. Results

3.1. Histidine containing reducible polycations are excellent DNAtransfection agents

Histidine containing reducible polycations (His6 RPC), basedon repeating CH6K3H6C monomers, were produced by oxidative

Table 1Characterisation of polymers illustrating number average molecular weight (Mn),weight average molecular weight (Mw) and polydispersity (Mw/Mn), following GPC

Polymer Mn (g/mol) Mw (g/mol) Mw/Mn

36 k 21,600 33,500 1.5538 k 28,600 34,600 1.2144 k 31,500 39,100 1.24114 k 27,000 54,000 2.00162 k 44,400 86,600 1.9540 k CS 23,700 32,200 1.3653 k CS 27,600 43,900 1.5989 k CS 33,400 82,400 2.4740 k CS Scr 21,600 29,400 1.36

Weight average molecular weight (Mw)=ΣMi2Ni/ΣMiNi and number average molecular

weight (Mn)=ΣMiNi/ΣNi where Ni is the number of molecules of molecular weight Mi.The descriptive term for each polymer e.g. 36 k, indicates the molecular weight inferredfrom the retention time at the height of the peak generated by GPC. Since the largerpolymers tended to have a right skewed distribution, there is a discrepancy in weightaveragemolecular weight (Mw) andmolecular weight at the peak height. The 36 k, 38 k,44 k, 114 k and 162 k polymers are His6 RPCs; 40 k CS, 53 k CS and 89 k CS are CS-labelled His6 RPCs, and 40 k Scr indicates His6 RPC terminated with the scrambledversion of the CS peptide.

Fig. 2. His6 RPCs can deliver biologically active siRNA in combination with plasmidDNA. (a) DNA/siRNA (w/w 13:1) or DNA only polyplexes formed using 114 k His6 RPC(w/w ratio 2:1 or 5:1 (nucleic acid: RPC)) analysed by agarose gel electrophoresis. (b)Size (Z Ave) and polydispersity of DNA/114 k His6 RPC complexes (white bars) andDNA/siRNA/114 k His6 RPC complexes (black bars) determined by photon correlationspectroscopy. (c) Alexander cells and HepG2 cells transfected with pEGFP combinedwith siRNA targeting EGFP (black bars) or luciferase (striped bars), condensed by 114 kHis6 RPC (w/w 40:1; N:P 15:1 in HEPES buffered saline pH 7.4). EGFP expression wasdetermined after 48 h by flow cytometry and shown as the percentage number ofpositive cells multiplied by the mean fluorescence of the positive population. Mocktreated cells are shown as white bars. Results are shown as mean and standarddeviation for b) and mean and SEM from three samples for c) (⁎ pb0.05, ⁎⁎ pb0.01,⁎⁎⁎ pb0.001, ns = pN0.05).

49M. Stevenson et al. / Journal of Controlled Release 130 (2008) 46–56

GENEDELIVERY

polycondensation; the reaction being terminated at various timepoints to generate polymers of different length (Table 1). Thedescriptive term for each polymer e.g. 36 k, indicates the molecularweight inferred from the retention time at the height of the peakgenerated by GPC. Since the larger polymers tended to have a rightskewed distribution, there is a discrepancy in weight averagemolecular weight (Mw) and molecular weight at the peak height.

Previously we have shown that His6 RPCs can mediate highlyefficient transfection of plasmid DNA in a range of cell lines [16]. Wedemonstrate here that the higher themolecular weight of His6 RPC, thegreater the transfection efficiency (Fig. 1). For example EGFP expressionin PC-3 cells was 3-fold higher (in terms of total transgene expression)using the 162 k polymer than the114 k polymer, and 23-fold higher thanthe 38 k polymer. Indeed transgene expression was higher using 162 kHis6 RPC to deliver plasmid than both a commercially available lipid(DOTAP) and linear polyethylenimine (JetPEI).

3.2. His6 RPC can deliver combined siRNA/DNA payloads to mediate RNAi

Having demonstrated efficient DNA transfection we wished todeterminewhetherHis6RPCs coulddeliver siRNAtocells in abiologicallyactive form. The biological activity of siRNA in liver cells was initiallytested using a transient reporter system, comprising co-delivery of anEGFP reporter gene together with siRNA recognising EGFPmRNA (siGFP)or luciferase (siLUC). Condensation of thesemixed polyplexes (w/w 13:1,DNA:siRNA), was confirmed by gel retardation, which showed that the

Fig. 1. Increasing molecular weight of His6 RPC improves gene transfer. PC-3 or Alexander cells transfected with pEGFP condensed by His6 RPC at indicated molecular weight (w/wratio 15:1 His6 RPC:DNA; N:P 5.6:1 in HEPES buffered saline pH 7.4) (white bars), DOTAP (w/w ratio 5:1) (striped bars), or JetPEI (N:P 5:1) (hatched bars). EGFP expression after 24 hshown as percentage number of expressing cells multiplied by the mean fluorescence of the positive population (total transgene expression). Percentage number of EGFP positivecells is indicated above each bar. Results are shown as mean and SEM values from three samples.

50 M. Stevenson et al. / Journal of Controlled Release 130 (2008) 46–56

GENEDELIVERY

presence of siRNA reduced the amount of free DNA at low weight toweight ratios (w/w 2:1, nucleic acid:RPC), while at weight/weight 5:1both DNA and siRNAwere fully retained in thewell (Fig. 2a). Assessmentby photon correlation spectroscopy showed that the inclusion of siRNAresulted in a minor decrease in particle size (N:P 15:1) (Fig. 2b).

RNAi activity was assessed 48 h after co-transfection, with EGFPexpression (total transgene expression) in cells receiving siGFP being13% (HepG2) and 15% (Alexander) of the level in controls (Fig. 2c). Thepercentage number of EGFP positive cells fell from 5.2 to 2.5% forHepG2 cells and from 3.9 to 2.6% for Alexander cells in the presence ofsiGFP. This result confirms that His6 RPC is capable of delivering siRNAto cells in a biologically active form and that the RNAi machinery isfunctional in these cells. However this system is artificial since DNAand siRNAwill be delivered to the same cells due to complexationwiththe same vector. Secondly the siGFP will be present in the cytoplasmprior to generation of EGFP mRNA, providing an advantage toeliminate mRNA as it is transcribed. For siRNA to be effective as atherapy there is a requirement to silence pre-existing target mRNA.

3.3. Complexation of nucleic acids by His6 RPCs

The complexation of a 21 nt siRNA alone, by various molecularweight His6 RPCs (38–162 k), was assessed using agarose gelelectrophoresis, ethidium bromide exclusion and photon correlationspectroscopy. Complexation of the high molecular weight 162 k His6

Fig. 3. Greater condensation of siRNA polyplexes is achieved using lower molecular weightratios in 20 mM HEPES buffer pH 7.4 or water) and loaded onto an agarose gel to assess mob162 k His6 RPC and DNA (circles) or siRNA (squares); fluorescence measured using a fluorimuncomplexed nucleic acid. (c) siRNA polyplexes formed using 38 k, 44 k, 80 k or 114 k His6electrophoresis. (d) Size (Z Ave) and polydispersity of siRNA polyplexes condensed with 80 kbars) or 162 k His6 RPC (w/w 15:1; N:P 5.6:1) (hatched bars), analysed by photon corr⁎⁎ pb0.01, ⁎⁎⁎ pb0.001, ns = pN0.05). (e) Polyplexes formed between siRNA and polylysine12.2:1; N:P 4.6:1) inwater. Polyplexes were incubated with 8 mM glutathione (GSH) for 1 h t

RPCwith an8.6 kbDNAplasmid at aweight/weight (w/w) ratio of 1 or 2,allowed substantial free DNA to enter the gel, while a ratio of 5:1 (N:P1.9:1) resulted in complete retention in the well (Fig. 3a, left panel). Incontrast when complexed with siRNA, w/w ratios up to 20 (N:P 7.5:1)were insufficient to fully abrogatemobility (Fig. 3a,middle panel). It wasobserved that siRNA was retained in the well at w/w 20 if unbufferedwaterwas used to prepare complexes (Fig. 3a, right panel). This could bedue to the lower ionic strength resulting in greater attraction betweensiRNA and polycation, or solute acidification resulting in protonation ofhistidines and thus a decreased weight/charge ratio. Previous analysishas shown thatHis6RPChas a buffering capacitywith a pKa in the regionof 5–6 corresponding to the pKa of the imidazole group [16]. Ethidiumbromide exclusion assays for DNA revealed a sharp decrease influorescence to 40% at w/w ratio 2:1 (N:P 0.75:1), in contrast with thegradual decrease of siRNA fluorescence to 50% as the w/w ratio wasincreased to 20 (N:P 7.5:1) (Fig. 3b).

Interestingly siRNA complexes formed using lower molecularweight His6 RPCs, namely 38 k, 44 k, 80 k and 114 k, showedcessation of siRNA mobility at a w/w ratio around 10:1 (N:P 3.8)(Fig. 3c). This apparent ability of lower weight polymers to formmore condensed siRNA polyplexes was also demonstrated byphoton correlation spectroscopy, since 80 k His6 RPC was able toform 86–92 nm particles (at w/w 8:1 (N:P 3:1), lower ratios unable toform condensed structures), that were approximately half thediameter of those formed with 162 k His6 RPC (Fig. 3d).

His6 RPCs. (a) DNA or siRNA polyplexes formed using 162 k His6 RPC (at indicated w/wility by electrophoresis. (b) Ethidium bromide exclusion assay for complexes comprisingeter (Ex 520 nm, Em 590 nm), each reading expressed relative to the fluorescence fromRPC (at indicated w/w ratios in 20 mM HEPES buffer pH 7.4) and mobility assessed byHis6 RPC (w/w 8:1; N:P 3:1) (black bars), 162 k His6 RPC (w/w 10:1; N:P 3.8:1) (stripedelation spectroscopy. Results are shown as mean and standard deviation (⁎ pb0.05,(pKK) (w/w 3.2:1; N:P 5:1), CK10C RPC (w/w 3.9:1; (N:P 4.8:1) and 80 k His6 RPC (w/wo reduce disulphide bonds in the RPCs and siRNA mobility examined by electrophoresis.

51M. Stevenson et al. / Journal of Controlled Release 130 (2008) 46–56

GENEDELIVERY

In order for siRNA to be biologically active it is important thatrelease from the delivery vector is efficient. We therefore examinedthe destabilisation of siRNA/polycation complexes under reducingconditions, simulating the environment found in the cytoplasm.Following complexation with either polylysine (Fig. 3e, lane 2), CK10CRPC (lane 3) or His6 RPC (80 k) (lane 10), siRNA was retained withinthe electrophoresis well. Treatment of non-reducible polylysine/siRNAcomplexes with 8 mM glutathione (GSH) for 1 h did not release siRNAfrom retention in the well (lane 6) as expected. In contrast treatmentof CK10C RPC/siRNA or His6 RPC/siRNA complexes with GSH restoredsiRNA mobility (lanes 7 and 12); the resultant band appearing a littlediffuse compared with uncomplexed siRNA, similar to the effect ob-served when siRNA was mixed with CK10C monomer (molecularweight 1506) (lane 4). This would indicate that glutathione success-fully cleaved the disulphide bonds within the RPC causing destabilisa-tion of the complex.

3.4. His6 RPC can deliver siRNA alone

Two stably expressing EGFP liver cell lines, Alexander EGFP andHepG2 EGFP, were generated in order to evaluate the activity of siGFPin His6 RPC/siRNA polyplexes.While siGFP formulated with 162 k His6RPC had no silencing activity at any weight:weight ratio examined(Fig. 4a, data shown for w:w 26:1 (N:P 10:1)), the use of 80 k His6 RPCsmediated a fall in EGFP expression after 48 h, down to 70% (100 nMsiRNA) of that in the mock treated control (Fig. 4b). This was at-tributable to the fall in fluorescence per cell since the percentagenumber of EGFP expressing cells was unaffected. This decrease inexpression was less than the silencing generated when DOTAP wasemployed as a carrier but greater than that achieved using non-re-ducible polylysine to deliver siGFP (Fig. 4b). Delivery of siLUC had noeffect on EGFP expression with any vector.

For smaller RPCs (36 k) excess polymer was required for siRNAactivity, since only complexes prepared at w/w 40 (N:P 15) led to areduction in EGFP expression (Fig. 4c). This is consistent with excesspolymer providing additional buffering capacity and hence endosomalescape. The use of HEPES buffered saline pH 7.4 (HBS) to preparecomplexes resulted in extensive aggregation as determined by PCSanalysis (data not shown). However polyplexes formed using HBS hadno greater silencing effect than complexes formed in HEPES buffer(Fig. 4c), suggesting that aggregation does not mediate greater de-livery of active siRNA.

3.5. Addition of a targeting moiety improves nucleic acid delivery to livercells

Although DOTAP mediated siRNA delivery gave greater levels ofsilencing than His6 RPC, DOTAP is not amenable to further chemicalmodification and has greater cytotoxicity (Fig. 4d and Liu, personalcommunication). To improve His6 RPC mediated siRNA delivery, wemodified the end of the polymer with a peptide taken from thecircumsporozoite (CS) protein of the malaria parasite Plasmodiumfalciparum. This protein is known to aid invasion into hepatocytes

Fig. 4. His6 RPC can deliver biologically active siRNA to silence endogenous EGFPexpression. siGFP (black bars) or siLUC (striped bars) delivered to HepG2 EGFP cells andEGFP expression determined by flow cytometry after 48 h. The percentage number ofEGFP positive cells is indicated above each bar. Mock treated controls included parentalHepG2 cells (grey bar) and HepG2 EGFP cells (white bar). (a) siRNAwas combined with162 k His6 RPC (w/w 26:1; N:P 10:1) or JetPEI (N:P 5) in HEPES buffered saline. (b) siRNAwas combined with DOTAP (w/w 5:1) in water, 80 k His6 RPC (w/w 12.5; N:P 4.6) in20 mM HEPES pH7.4 or polylysine (pKK) at N:P 5 in 20 mM HEPES pH 7.4 and added tocells at the final concentrations indicated. (c) siRNA/36 k His6 RPC polyplexes wereprepared at w/w 10:1 or 40:1 (N:P 3.8 or 15 respectively) in either 20mMHEPES or HBS.(d) The percentage number of cells 24 h after delivery of siGFP complexed with DOTAP(w/w 5:1) or His6 RPC (N:P 15:1) was assessed by MTS assay. (Statistical analysis wasperformed by ANOVA with Bonferroni post hoc analysis ⁎ pb0.05, ns = pN0.05)

during the parasite life cycle [31–33]. The peptide (HNMPNDPNRNVD-NANANSAYC) previously shown to have high hepatocyte bindingproperties [34], was linked onto His6 RPCs by oxidative polyconden-sation (CS-His6 RPC) (Table 1). Characterization of CS-His6 RPC by

52 M. Stevenson et al. / Journal of Controlled Release 130 (2008) 46–56

GENEDELIVERY

amino acid analysis revealed a 3.35:1 molar ratio of CS peptide:RPC.Since each RPC can carry two CS peptides, one at each termini, thiswould indicate a 67.5% excess of free CS peptide remained in thepreparation after centrifugation.

Fig. 5. Linkage of a peptide from Plasmodium falciparum CS protein to His6 RPC improves tranHis6 RPC (white bars) or 53 k CS-His6 RPC (w/w 15:1; N:P 5.6:1) (black bars). EGFP expfluorescence of the positive population determined by flow cytometry after 24 h. (b) Transscrambled CS-His6 RPC (white bars) (w/w 5:1; N:P 1.9:1); EGFP expressionwas measured aftbars) or pEGFP and siLUC (striped bars), condensed by CS-His6 RPC (w/w 5:1; N:P 1.9:1); mwere condensed with 36 k His6 RPC or 89 k CS-His6 RPC (w/w 40:1; N:P 15:1) in 20 mM HEAlexander cells (grey bar) and Alexander EGFP cells (white bar); EGFP expressionwas measuabove each bar. (e) Uptake of Cy3 labelled siGFP complexed with His6 RPC, CS-His6 RPC, DOTAof transfected cells indicative of internalised Cy3-siRNA.

We analyzed the transfection of plasmid DNA (pEGFP) complexedwith CS-His6 RPC in a panel of 13 cell lines and HUVEC. Compared withuntargeted His6 RPC, EGFP expression increased 15-fold in Alexan-der cells and 1.8-fold in HepG2 cells (Fig. 5a), while ten of the twelve

sfection of liver cells. (a) Fourteen cell types transfected with pEGFP condensed by 36 kression shown as the percentage number of expressing cells multiplied by the meanfection of liver cells with pEGFP condensed with 40 k CS-His6 RPC (black bars) or 40 ker 24 h. (c) Transfection of liver cells with pEGFP (hatched bars), pEGFP and siGFP (blackock treated cells are shown by white bars. (d) siGFP (black bars) or siLUC (striped bars)PES pH 7.4 and added to Alexander EGFP cells. Mock treated controls included parentalred after 72 h. For graphs a–d) the percentage number of EGFP positive cells is indicatedP or JetPEI into Alexander cells after 6 h. Arrows indicate punctuate signals in cytoplasm

Fig. 7. siRNA mediated silencing of Hepatitis B surface antigen. siRNA targeting GFP(black bars) or HBsAg (hatched bars) delivered to Alexander cells condensed by 36 kHis6 RPC or 53 k CS-His6 RPC (w/w 15:1; N:P 5.6:1) or JetPEI (N:P 5:1). (a) HBsAg mRNAlevels were determined by QRT-PCR after 19 h, samples having been normalised for

53M. Stevenson et al. / Journal of Controlled Release 130 (2008) 46–56

GENEDELIVERY

non-liver cells showed no increased expression. Surprisingly prostatePC-3 cells showed a 2.8-fold increase and breastMDA231 cells a 1.9-foldincrease in expression. Alexander and HepG2 cells transfected withplasmid DNA using a scrambled version of the CS peptide linked to His6RPC, had significantly lower EGFP expression compared with CS-His6RPC (Fig. 5b). This result was not attributable to differential condensa-tion, since both formed similar sized particles (118 nm for CS-His6 RPC/DNA and 125 nm for scrambled CS-His6 RPC/DNA). The data indicatesthat this CS peptide binds to receptors or sites expressed on liver cellsthat are absent from most but not all other tissue.

The ability of CS-His6 RPC to deliver biologically active siRNA wasthen assessed. Initially the co-delivery of plasmid DNA together withsiGFP, resulted in a mean fluorescence per cell 35% (Alexander) and21% (HepG2) of that in cells receiving plasmid alone (Fig. 5c). Moreimportantly siGFP alone complexed with CS-His6 RPC, reduced EGFPexpression to 53% of the level in mock treated Alexander EGFP cells(Fig. 5d); a significant increase in activity compared with delivery bythe untargeted vector (Figs. 5d and 4b). The loss of EGFP expressionwas manifested as both a fall in mean fluorescence per cell and areduction in the number of EGFP positive cells. The complexation ofsiRNA with ‘stuffer DNA’, comprising irrelevant plasmid DNA, usingCS-His6 RPC, did not increase the amount of silencing followingaddition to Alexander EGFP cells (data not shown).

Fluorescence microscopy confirmed the uptake of Cy3-siGFP/CS-His6RPCcomplexes inAlexandercells, signals appearing aspunctuatespots within the cytoplasm of cells (Fig. 5e arrows). The CS targetedpolymer also appeared to result in greater accumulation of labelled siRNAat the cellular surface than the untargeted polymer (Fig. 5e).

3.6. Assessment of serum stability

The serum stability of siRNA/CS-His6 RPC complexes was examinedby exposing complexes to 75% foetal calf serum for 16 h prior toelectrophoretic analysis. Uncomplexed DNA or siRNAwas undetectablefollowingexposure to serum (Fig. 6 compare lane 1with lane 4; DNA leftpanel, siRNA right panel), only a serum signal being present. Digestionwith proteinase K failed to restore the band (lane 5), suggesting thenucleic acid hadbeendegraded andnot simply bound to serumproteins.In contrast DNA condensed with CS-His6 RPC prior to serum exposurewas detectable in the well (lane 11, left panel). Comparison with non-serum treated DNA/CS-His6 RPC complexes (lane 8, left panel) showedincreased fluorescence suggesting some perturbation of the complexes.

levels of GAPDH and expressed relative to mock treated controls. (b) HBsAg proteinlevels were determined by ELISA after 72 h, with levels expressed relative to mocktreated controls. (c) siRNA targeting GFP (black bars) or HBsAg (hatched bars) wasdelivered to Alexander cells condensed by JetPEI (N:P 5:1); HBsAg protein levels weredetermined by ELISA after 72 h, with levels expressed relative to mock treated controls.Statistical analysis was performed using ANOVA with Bonferroni post hoc analysis forgraph a) and c), and Kruskal–Wallis and Mann Whitney tests for graph b); ns = pN0.05,⁎ = pb0.05, ⁎⁎ = pb0.01.

Fig. 6. Serum destabilises siRNA/CS-His6 RPC complexes. Plasmid DNA (pEGFP) orsiRNA (siGFP) was exposed to foetal calf serumwith or without condensation with 40 kCS-His6 RPC (w/w 15:1). Samples were then added to water, buffer (50 mM Tris HCl pH7.8, 2.5 mM EDTA, 2.5% SDS) or 4 mg/ml proteinase K in buffer, incubated for 1 min priorto loading onto (50 ng per well) an 0.8% agarose (DNA) or 2.5% agarose (siRNA) gel forelectrophoretic analysis. Lane 1; nucleic acid only, lane 2; nucleic acid+buffer, lane 3;nucleic acid+proteinase K, lane 4; nucleic acid+serum, lane 5; nucleic acid+serum+proteinase K, lane 6; buffer only, lane 7; proteinase K only, lane 8; nucleic acid+CS-His6RPC, lane 9; nucleic acid+CS-His6 RPC+buffer, lane 10; nucleic acid+CS-His6 RPC+proteinase K, lane 11; nucleic acid+CS-His6 RPC+serum, lane 12; nucleic acid+CS-His6RPC+serum+proteinase K, lane 13; serum only, lane 14; serum+proteinase K.

Subsequent digestion with proteinase K released the DNA as visualisedby the appearance of the open circular band (lane 12 left panel) albeit atreduced intensity suggesting the RPC provided a degree of protectionfrom serum protein binding and degradation. In contrast siRNA con-densed byCS-His6 RPCwasnot protected from the serumproteins, sincerestoration of siRNA mobility was not observed following proteinase Ktreatment (lane 12 right panel). This would suggest that the siRNA/CS-His6 RPC complexation is insufficient to protect siRNA from unwantedserum protein interactions.

3.7. Use of siRNA to target hepatitis B surface antigen (HBsAg)

Alexander cells express hepatitis B surface antigen, which is se-creted into the medium and can be detected by ELISA. We wereinterested to determine whether His6 RPC based vectors could deliver

54 M. Stevenson et al. / Journal of Controlled Release 130 (2008) 46–56

GENEDELIVERY

siRNA capable of down regulating HBsAg expression. Three siRNAsequences were designed to recognise HBsAg mRNA and delivered tocells using DOTAP, sequence 3 (siHBsAg-3) proving the most effective(data not shown). siHBsAg-3 was complexed with His6 RPC, CS-His6RPC or DOTAP and added to Alexander cells; the effects on HBsAgmRNA and protein levels assessed by qRT-PCR and ELISA respectively.Falls in target mRNAwere observed when using either His6 RPC or CS-His6 RPC to deliver siRNA (Fig. 7a). At the protein level a statisticallysignificant fall was only observed when using the CS-His6 RPC vector(Fig. 7b). This result demonstrates the effective delivery of activesiRNA but suggests the design of a more effective siRNA sequence isrequired for therapy.

4. Discussion

Recent advances in our understanding of RNAi mechanisms, haveled to the development of gene silencing agents currently beingevaluated in phase III clinical trials into serious ophthalmic disorders,such as wet age-related macular degeneration and diabetic macularedema (Opko Ophthalmologics formally Acuity Pharmaceuticals, SirnaTherapeutics). Vectors for targeted delivery of siRNA are essential toenable this technology to fulfil its potential in developing newtherapeutic entities. Conventional nucleic acid transfection agents,based on cationic lipids, are very efficient at delivering siRNA non-specifically to cells in vitro; however target-selective delivery requiresdevelopment of ligand-mediated vectors capable of delivering siRNAvia target-associated membrane receptors.

siRNA is a small, negatively charged, double stranded nucleic acidthat can interact electrostatically with cationic polymers such as PEIand polylysine to form polyelectrolyte complexes, or ‘polyplexes’.These polyelectrolyte systems work well for delivery of plasmid DNA,and can be easily targeted to specific receptors. However they seem tobe less suitable for siRNA delivery, possibly reflecting inefficient in-tracellular unpackaging, since siRNA must be delivered free into thecytoplasm in order to interact with the RNA induced silencing com-plex (RISC).

We have recently developed a bioreversible polyelectrolyte sys-tem, designed for cytoplasmic reduction and efficient intracellularrelease of the nucleic acid delivered. The use of polylysine basedpolymers consisting of cysteine terminated monomers to condensenucleic acids [13,35], results in complex stability outside cells andtriggered release in the cytoplasmic environment due to reduction ofdisulphide bonds. Since macromolecules like siRNA are internalizedby endocytosis followed by lysosomal fusion causing siRNA degrada-tion, endosomal escape is a prerequisite for efficient delivery of intactsiRNA to the cytosol. We have previously demonstrated that inclusionof histidine residues in reducible polycations (His6 RPCs) mediatehighly efficient levels of gene transfer (greater than PEI) withoutrequirement for endosomolytic agents such as chloroquine [16]. Wehave now generated numerous batches of histidine-containing RPCvector confirming that the biological activity of these delivery agentsis reproducible.

We have shown here co-delivery of siRNA (siGFP) and plasmidDNA (pEGFP) by His6 RPC mediated an 85% reduction in geneexpression confirming; the potency of the siRNA sequence, the intactnature of the RNAi processing machinery in the hepatoma cell lines,and the ability of His6 RPCs to deliver biologically active siRNA to cells.However silencing of endogenous expression is likely to be a greaterchallenge since target mRNAs are present in the cell prior to the arrivalof siRNA. Furthermore in transient transfections the siRNA and DNAshare a similar endosomal fate, such that there will be a subset of cellsinwhich nucleic acids successfully escape, leading to nuclear import ofDNA and subsequent transgene expression, together with localizationof siRNA in the cytoplasm to degrade transgene mRNA. Correspond-ingly following siRNA delivery alone to EGFP stably expressing cells,the observed reductions in endogenous gene expression were more

modest decreasing by around 30%. Unlike DOTAP mediated delivery,reduced expression was solely due to decreased fluorescence per cell,rather than a decrease in the percentage number of cells expressingEGFP. However silencing efficiency could also be related to differentialproperties of DNA/siRNA/His6 RPC and siRNA/His6 RPC complexformation.

The 162 k His6 RPC effectively condensed 8.6 kb plasmid DNA at aw/w ratio of 5, however it was unable to condense siRNA. In contrastthe 80 k His6 RPC formed siRNA polyplexes of 90 nm diameter.Efficient complex formation was required for biological activity sincesiRNA/162 k His6 RPC polyplexes were unable to mediate target genesilencing at any of the w:w ratios employed, while 36–114 k polymersdid, smaller ormediumweight polymers being themost effective. Thisresult is in contrast to DNA delivery where larger polymers mediatedgreater levels of transgene expression. These findings are in agree-ment with the study by Leng et al. showing that different composi-tions of branched histidine/lysine peptides were required dependingon whether DNA or siRNA was the cargo [36]. Similarly polyplexesbased on low molecular weight polycations such as 2 kDa PEI havebeen shown to be more efficient at delivering mRNA than 25 kDa PEI,presumably due to fewer electrostatic interactions enabling greateraccess of mRNA to translational machinery [37].

Like DNA, siRNA activity was greater when delivered using re-ducible polymers compared with non-reducible polylysine of similarmolecular weight. Treatment of siRNA/His6 RPC complexeswith 8mMglutathione, cleaved the disulphide bonds within the polymereffectively releasing siRNA. This could imply that non-reduciblepolylysine/siRNA complexes are too stable, and for any complexesescaping the endosomes the polylysine remained associated with thesiRNA limiting its association with the RISC.

Since siRNA/His6 RPCs only generated modest falls in geneexpression, we investigated the addition of a targeting peptide ontothe termini of the RPC to allow uptake by receptor mediated en-docytosis. Previous siRNA delivery strategies have included the ad-dition of RGD to target carriers to integrins [4,36], folate to targetfolate receptors [38,39], sugars to target the asialoglycoprotein re-ceptor [40–45] or incorporation of cell penetrating or fusogenicpeptides [46–48].

The circumsporozoite protein of Plasmodium falciparum is involvedin sporozoite entry into hepatocytes during the parasite life cycle. Theplasma membrane of sporozoites is entirely covered by the CS protein[49] which has specific interactions with the hepatocyte plasmamembrane basolateral domain [31–33]. The CS protein contains asignal sequence at its amino terminus, a central repeat region, twoconserved amino acid motifs in region I and region II and anchorsequence at its carboxyl terminus [50–52]. Suarez et al. identifiedHNMPNDPNRNVDENANANSA in region III as having high bindingactivity to HepG2 cells, the residues shown in italics being particularlyimportant [34]. Simultaneous elimination of heparin sulphateproteoglycans (HSPGs) and lipoprotein receptor related protein(LRP) from the surface of hepatocytes virtually eliminates recombi-nant CS protein binding but does not completely inhibit sporozoiteinvasion [33,53] suggesting other interactions may occur. Thereceptor/binding site for the peptide identified by Suarez et al. ispresently unknown.

We employed a cysteine terminated version of this peptide topermit linkage to the ends of the His6 RPCs by oxidative polyconden-sation. Complexation with plasmid DNA resulted in increasedtransfection compared with His6 RPC of both Alexander and HepG2liver cell lines. There was no increased expression in ten of the twelvenon-liver cell lines tested suggesting that the CS peptide targeted RPCscould be used to improve liver uptake in a specific manner. Theaddition of the CS peptide to His6 RPC was also important for siRNAdelivery, reducing both total EGFP expression and the percentagenumber of cells expressing EGFP compared with untargeted polymer.This suggests CS-His6 RPC mediated delivery of biologically active

55M. Stevenson et al. / Journal of Controlled Release 130 (2008) 46–56

GENEDELIVERY

siRNA to a greater proportion of the cells than the non-targetedpolymer. To our knowledge this is the first time a peptide from thecircumsporozoite protein has been employed to deliver nucleic acids.

Our approach of adding peptides to the termini of the His6 RPCs toimprove biological activity, should prove useful to target a variety ofother cellular receptors mediating nucleic acid uptake into disease-associated tissues. Targeting Hepatitis B surface antigen with siRNAcomplexed with CS-His6 RPC, resulted in a statistically significantreduction in protein levels compared with control siRNA, confirmingthat this approach could down regulate pathogenic viral expression fortreating liver disease. The reason that the CS-His6 RPC was not moreeffective than the untargeted polymer at the mRNA level is unclear.

In order to develop vectors for in vivo delivery the issue of serumstability must be addressed, since the activity of His6 RPC wasattenuated in the presence of serum (Fig. 6 and data not shown). Toimprove stability we envisage the requirement for ligand bearing RPCscontaining mid-chain cysteine residues e.g. CH6KCKH6C (the thiols ofthe mid-chain cysteine being protected with acetamidomethyl) foruse in template assisted condensation. Following oxidative polycon-densation of the monomer and deprotection of the mid-chain thiols,the RPC can be complexed with siRNA and then stabilized by furtheroxidative polycondensation forming reducible crosslinks betweeninternal dilsulphides; this technique having previously been success-fully used for DNA delivery [54].

In conclusion His6 RPCs mediate siRNA delivery, albeit requiringdifferent properties to those that are optimal for plasmid DNA. Rationaldesign of siRNA carriers is fundamental for improving efficiency bymoreeffectively releasing siRNAyetmaintainingprotectionoutside target cells.

Acknowledgements

We wish to acknowledge Fionnadh Carroll (University of Oxford)for the technical assistance and Michal Pechar (Institute for Macro-molecular Chemistry, Prague, Czech Republic) for the useful advise.This work was funded by the Biotechnology and Biological SciencesResearch Council, UK.

References

[1] A. Fire, S. Xu, M.K. Montgomery, S.A. Kostas, S.E. Driver, C.C. Mello, Potent andspecific genetic interference by double-stranded RNA in Caenorhabditis elegans,Nature 391 (6669) (1998) 806–811.

[2] S.M. Elbashir, J. Harborth, W. Lendeckel, A. Yalcin, K. Weber, T. Tuschl, Duplexes of21-nucleotide RNAs mediate RNA interference in cultured mammalian cells,Nature 411 (6836) (2001) 494–498.

[3] T. Tuschl, P.D. Zamore, R. Lehmann,D.P. Bartel, P.A. Sharp, TargetedmRNAdegradationby double-stranded RNA in vitro, Genes Dev. 13 (24) (1999) 3191–3197.

[4] R.M. Schiffelers, A. Ansari, J. Xu, Q. Zhou, Q. Tang, G. Storm, G. Molema, P.Y. Lu, P.V.Scaria, M.C. Woodle, Cancer siRNA therapy by tumor selective delivery with ligand-targeted sterically stabilized nanoparticle, Nucleic Acids Res. 32 (19) (2004) e149.

[5] M. Thomas, J.J. Lu, Q. Ge, C. Zhang, J. Chen, A.M. Klibanov, Full deacylation ofpolyethylenimine dramatically boosts its gene delivery efficiency and specificity tomouse lung, Proc. Natl. Acad. Sci. U. S. A. 102 (16) (2005) 5679–5684.

[6] Q. Ge, L. Filip, A. Bai, T. Nguyen, H.N. Eisen, J. Chen, Inhibition of influenza virusproduction in virus-infected mice by RNA interference, Proc. Natl. Acad. Sci. U. S. A.101 (23) (2004) 8676–8681.

[7] S. Hu-Lieskovan, J.D. Heidel, D.W. Bartlett, M.E. Davis, T.J. Triche, Sequence-specificknockdown of EWS-FLI1 by targeted, nonviral delivery of small interfering RNAinhibits tumor growth in a murine model of metastatic Ewing's sarcoma, CancerRes. 65 (19) (2005) 8984–8992.

[8] M. Keller, A.D.Miller, IntracellularDelivery ofNucleicAcids, Springer, NewYork, 2005.[9] V.A. Bloomfield, Condensation of DNA by multivalent cations: considerations on

mechanism, Biopolymers 31 (13) (1991) 1471–1481.[10] H.G. Hansma, R. Golan, W. Hsieh, C.P. Lollo, P. Mullen-Ley, D. Kwoh, DNA

condensation for gene therapy as monitored by atomic force microscopy, NucleicAcids Res. 26 (10) (1998) 2481–2487.

[11] D. Matulis, I. Rouzina, V.A. Bloomfield, Thermodynamics of DNA binding andcondensation: isothermal titration calorimetry and electrostatic mechanism,J. Mol. Biol. 296 (4) (2000) 1053–1063.

[12] J. Widom, R.L. Baldwin, Cation-induced toroidal condensation of DNA studies withCo3+(NH3)6, J. Mol. Biol. 144 (4) (1980) 431–453.

[13] M.L. Read, K.H. Bremner, D. Oupicky, N.K. Green, P.F. Searle, L.W. Seymour, Vectorsbased on reducible polycations facilitate intracellular release of nucleic acids,J. Gene Med. 5 (3) (2003) 232–245.

[14] P. Midoux, M. Monsigny, Efficient gene transfer by histidylated polylysine/pDNAcomplexes, Bioconjug. Chem. 10 (3) (1999) 406–411.

[15] C. Pichon, M.B. Roufai, M. Monsigny, P. Midoux, Histidylated oligolysines increasethe transmembrane passage and the biological activity of antisense oligonucleo-tides, Nucleic Acids Res. 28 (2) (2000) 504–512.

[16] M.L. Read, S. Singh, Z. Ahmed, M. Stevenson, S.S. Briggs, D. Oupicky, L.B. Barrett, R.Spice, M. Kendall, M. Berry, J.A. Preece, A. Logan, L.W. Seymour, A versatilereducible polycation-based system for efficient delivery of a broad range of nucleicacids, Nucleic Acids Res. 33 (9) (2005) e86.

[17] D.V. Schaffer, N.A. Fidelman, N. Dan, D.A. Lauffenburger, Vector unpacking as apotential barrier for receptor-mediated polyplex gene delivery, Biotechnol. Bioeng.67 (5) (2000) 598–606.

[18] C.M. Ward, M.L. Read, L.W. Seymour, Systemic circulation of poly(L-lysine)/DNAvectors is influenced by polycation molecular weight and type of DNA: differentialcirculation in mice and rats and the implications for human gene therapy, Blood 97(8) (2001) 2221–2229.

[19] E.E. Mast, M.J. Alter, H.S. Margolis, Strategies to prevent and control hepatitis B andC virus infections: a global perspective, Vaccine 17 (13–14) (1999) 1730–1733.

[20] A.P. McCaffrey, H. Nakai, K. Pandey, Z. Huang, F.H. Salazar, H. Xu, S.F. Wieland, P.L.Marion, M.A. Kay, Inhibition of hepatitis B virus in mice by RNA interference, Nat.Biotechnol. 21 (6) (2003) 639–644.

[21] C. Klein, C.T. Bock, H.Wedemeyer, T.Wustefeld, S. Locarnini, H.P. Dienes, S. Kubicka,M.P. Manns, C. Trautwein, Inhibition of hepatitis B virus replication in vivo bynucleoside analogues and siRNA, Gastroenterology 125 (1) (2003) 9–18.

[22] H. Giladi, M. Ketzinel-Gilad, L. Rivkin, Y. Felig, O. Nussbaum, E. Galun, Smallinterfering RNA inhibits hepatitis B virus replication in mice, Mol. Ther. 8 (5)(2003) 769–776.

[23] D.V. Morrissey, K. Blanchard, L. Shaw, K. Jensen, J.A. Lockridge, B. Dickinson, J.A.McSwiggen, C. Vargeese, K. Bowman, C.S. Shaffer, B.A. Polisky, S. Zinnen, Activity ofstabilized short interfering RNA in a mouse model of hepatitis B virus replication,Hepatology 41 (6) (2005) 1349–1356.

[24] O. Cussenot, P. Berthon, R. Berger, I. Mowszowicz, A. Faille, F. Hojman, P. Teillac, A.Le Duc, F. Calvo, Immortalization of human adult normal prostatic epithelial cellsby liposomes containing large T-SV40 gene, J. Urol. 146 (3) (1991) 881–886.

[25] O. Cussenot, P. Berthon, B. Cochand-Priollet, N.J. Maitland, A. Le Duc, Immunocy-tochemical comparison of cultured normal epithelial prostatic cells with prostatictissue sections, Exp. Cell Res. 214 (1) (1994) 83–92.

[26] P. Berthon, O. Cussenot, L. Hopwood, A. Leduc, N.J. Maitland, Functional expressionof SV40 in normal human epithelial and fibroblastic cells-differentiation pattern ofnon-tumorigenic cell lines, Int. J. Oncol. 6 (1995) 333–343.

[27] N.J. Maitland, C.A. Macintosh, J. Hall, M. Sharrard, G. Quinn, S. Lang, In vitro modelsto study cellular differentiation and function in human prostate cancers, Radiat.Res. 155 (1 Pt 2) (2001) 133–142.

[28] C.A. Macintosh, Department of Biology, University of York, 1998.[29] A. Reynolds, D. Leake, Q. Boese, S. Scaringe, W.S. Marshall, A. Khvorova, Rational

siRNA design for RNA interference, Nat. Biotechnol. 22 (3) (2004) 326–330.[30] R. Young, P.A. Lovell, Introduction to Polymers, Chapman and Hall, London, 1991.[31] C. Cerami, U. Frevert, P. Sinnis, B. Takacs, P. Clavijo, M.J. Santos, V. Nussenzweig, The

basolateral domain of the hepatocyte plasma membrane bears receptors for thecircumsporozoite protein of Plasmodium falciparum sporozoites, Cell 70 (6) (1992)1021–1033.

[32] U. Frevert, P. Sinnis, C. Cerami, W. Shreffler, B. Takacs, V. Nussenzweig, Malariacircumsporozoite protein binds to heparan sulfate proteoglycans associated withthe surface membrane of hepatocytes, J. Exp. Med. 177 (5) (1993) 1287–1298.

[33] U. Frevert, P. Sinnis, J.D. Esko, V. Nussenzweig, Cell surface glycosaminoglycans arenot obligatory for Plasmodium berghei sporozoite invasion in vitro, Mol. Biochem.Parasitol. 76 (1–2) (1996) 257–266.

[34] J.E. Suarez, M. Urquiza, A. Puentes, J.E. Garcia, H. Curtidor, M. Ocampo, R. Lopez, L.E.Rodriguez, R. Vera, M. Cubillos, M.H. Torres, M.E. Patarroyo, Plasmodiumfalciparum circumsporozoite (CS) protein peptides specifically bind to HepG2cells, Vaccine 19 (31) (2001) 4487–4495.

[35] D.L. McKenzie, K.Y. Kwok, K.G. Rice, A potent new class of reductively activatedpeptide gene delivery agents, J. Biol. Chem. 275 (14) (2000) 9970–9977.

[36] Q. Leng, P. Scaria, J. Zhu, N. Ambulos, P. Campbell, A.J. Mixson, Highly branched HKpeptides are effective carriers of siRNA, J. Gene Med. 7 (7) (2005) 977–986.

[37] T. Bettinger, R.C. Carlisle, M.L. Read, M. Ogris, L.W. Seymour, Peptide-mediated RNAdelivery: a novel approach for enhanced transfection of primary and post-mitoticcells, Nucleic Acids Res. 29 (18) (2001) 3882–3891.

[38] S.H. Kim, H. Mok, J.H. Jeong, S.W. Kim, T.G. Park, Comparative evaluation of target-specific GFP gene silencing efficiencies for antisense ODN, synthetic siRNA, andsiRNA plasmid complexed with PEI-PEG-FOL conjugate, Bioconjug. Chem. 17 (1)(2006) 241–244.

[39] S.H. Kim, J.H. Jeong, K.C. Cho, S.W. Kim, T.G. Park, Target-specific gene silencing bysiRNA plasmid DNA complexed with folate-modified poly(ethylenimine),J. Control. Release 104 (1) (2005) 223–232.

[40] S.R. Popielarski, S.H. Pun, M.E. Davis, A nanoparticle-based model delivery systemto guide the rational design of gene delivery to the liver. 1. Synthesis andcharacterization, Bioconjug. Chem. 16 (5) (2005) 1063–1070.

[41] X. Sun, L. Hai, Y. Wu, H.Y. Hu, Z.R. Zhang, Targeted gene delivery to hepatoma cellsusing galactosylated liposome-polycation-DNA complexes (LPD), J. Drug Target. 13(2) (2005) 121–128.

[42] H. Hosseinkhani, T. Azzam, Y. Tabata, A.J. Domb, Dextran-spermine polycation: anefficient nonviral vector for in vitro and in vivo gene transfection, Gene Ther. 11 (2)(2004) 194–203.

[43] J.C. Perales, G.A. Grossmann, M. Molas, G. Liu, T. Ferkol, J. Harpst, H. Oda, R.W.Hanson, Biochemical and functional characterization of DNA complexes capable of

56 M. Stevenson et al. / Journal of Controlled Release 130 (2008) 46–56

GENEDELIVERY

targeting genes to hepatocytes via the asialoglycoprotein receptor, J. Biol. Chem.272 (11) (1997) 7398–7407.

[44] G.Y. Wu, C.H. Wu, Delivery systems for gene therapy, Biotherapy 3 (1) (1991) 87–95.[45] A. Sato, M. Takagi, A. Shimamoto, S. Kawakami, M. Hashida, Small interfering RNA

delivery to the liver by intravenous administration of galactosylated cationicliposomes in mice, Biomaterials 28 (7) (2007) 1434–1442.

[46] J.J. Turner, S. Jones, M.M. Fabani, G. Ivanova, A.A. Arzumanov, M.J. Gait, RNAtargeting with peptide conjugates of oligonucleotides, siRNA and PNA, Blood CellsMol. Dis. 38 (1) (2007) 1–7.

[47] S. Oliveira, I. van Rooy, O. Kranenburg, G. Storm, R.M. Schiffelers, Fusogenic peptidesenhance endosomal escape improving siRNA-induced silencing of oncogenes, Int. J.Pharm. 331 (2) (2007) 211–214.

[48] A. Muratovska, M.R. Eccles, Conjugate for efficient delivery of short interferingRNA (siRNA) into mammalian cells, FEBS Lett. 558 (1–3) (2004) 63–68.

[49] V. Nussenzweig, R.S. Nussenzweig, Rationale for the development of an engi-neered sporozoite malaria vaccine, Adv. Immunol. 45 (1989) 283–334.

[50] P. Sinnis, P. Clavijo, D. Fenyo, B.T. Chait, C. Cerami, V. Nussenzweig, Structural andfunctional properties of region II-plus of the malaria circumsporozoite protein,J. Exp. Med. 180 (1) (1994) 297–306.

[51] L.S. Ozaki, P. Svec, R.S. Nussenzweig, V. Nussenzweig, G.N. Godson, Structure of theplasmodium knowlesi gene coding for the circumsporozoite protein, Cell 34 (3)(1983) 815–822.

[52] J.B. Dame, J.L. Williams, T.F. McCutchan, J.L. Weber, R.A. Wirtz, W.T. Hockmeyer, W.L. Maloy, J.D. Haynes, I. Schneider, D. Roberts, et al., Structure of the gene encodingthe immunodominant surface antigen on the sporozoite of the human malariaparasite Plasmodium falciparum, Science 225 (4662) (1984) 593–599.

[53] M. Shakibaei, U. Frevert, Dual interaction of the malaria circumsporozoite proteinwith the low density lipoprotein receptor-related protein (LRP) and heparansulfate proteoglycans, J. Exp. Med. 184 (5) (1996) 1699–1711.

[54] Y. Park, K.Y. Kwok, C. Boukarim, K.G. Rice, Synthesis of sulfhydryl cross-linking poly(ethylene glycol)-peptides and glycopeptides as carriers for gene delivery, Bioconjug.Chem. 13 (2) (2002) 232–239.