Genetica 94: 181-193, 1994. 181 (g) 1994 Kluwer Academic Publishers. Printed in the Netherlands.

Aspects of regulation of ribosomal protein synthesis in Xenopus laevis R e v i e w

P a o l a P i e r a n d r e i - A m a l d i 1 & F r a n c e s c o A m a ld i 2 1 Istituto di Biologia Cellulare, C.N.R., O0137Roma, Italy 2 Dipartimento di Biologia, Universita di Roma 'Tor Vergata', 00133 Roma, Italy

Received and accepted 25 March 1994

Key words. gene structure, Ribosomal proteins, Ribosome, Translational regulation, Xenopus laevis

Abstract

The work carried out in the authors' laboratories on the structure and expression of ribosomal protein genes in Xenopus is reviewed, with some comparisons with other systems. These genes form a class that shares several structural features, especially in the region surrounding the 5' ends. These similar structures appear to be involved in coregulated expression that is attained at various regulatory levels: transcriptional, transcript processing and stability, and translational. Particular attention is paid here to the one operating at the translational level, which has been studied during Xenopus oogenesis and embryogenesis, and also during nutritional changes of Xenopus cultured cells. This regulation, which responds to the cellular need for new ribosomes, operates by changing the fraction of rp-mRNA engaged on polysomes, leaving each translated rp-mRNA molecule always fully loaded with ribosomes. Responsible for this translational behaviour is the typical 5'UTR, which characterizes all rp-mRNAs analyzed up to now, and that can bind in vitro some proteins, putative trans-acting factors for this translational regulation.

Introduction

The ribosome represents one of the largest multimolec- ular complexes present in living organisms. Since it carries out a fundamental function, indispensable in all living cells, its general structure, which includes three/four RNA molecules and fifty/ninety different ribosomal proteins according to species, has been high- ly conserved during evolution. A large amount of work has been carried out for over thirty years on different aspects of ribosome biology: its structure, its function in the process of protein synthesis, its synthesis and the regulation of synthesis (for references see: Nomura, 1990). We are mainly interested in this last aspect, i.e. how the cell is able to produce balanced amounts of the many RNA and protein components of the ribosome and how it can coordinately change the production of all of them in order to adjust the ribosome synthesis rate to the changing needs of the cell. While the reg- ulation of ribosome synthesis is relatively well under-

stood in E. coli, much less is known for eukaryotic sys- tems where a complex situation is beginning tO emerge with various types of controls operating simultaneous- ly at different levels to respond to different internal and external signals (for reviews see Planta & Rau6, 1988; Amaldi etal., 1989; Perry & Meyuhas, 1990). Here we review in some detail those aspects of r-protein gene structure and ribosome synthesis regulation on which our research groups have been actively working using Xenopus laevis as an experimental system, with only a brief mention of the studies carried out by other groups and/or in other systems.

Of the eukaryotic systems used for ribosome stud- ies, yeast is the most widely studied due to the advan- tage of good genetics (Planta & Rau6, 1988; Warn- er et aI., 1990); however, it cannot be considered as a model for differentiated higher eukaryotes. Among these the frog Xenopus laevis, in,spite of its imprac- ticability for the genetic approach, has proved to be very useful, partly due to the possibility of studying

182

the regulation of ribosome synthesis during oogenesis when it is extremely high, and during embryogenesis when it resumes after a period of inactivity, and partly because of the possibility of interfering with the normal situation by microinjection of DNA, RNA, proteins, antibodies etc., into oocytes and fertilized eggs. The availability of anucleolate mutants represents another advantage of this systetn. These homozygous mutants (O-nu), which lack the rRNA gene cluster, can sur- vive up to the tadpole stage utilizing maternal ribo- somes (Elsdale, Fischberg & Smith, 1958; Brown & Gurdon, 1964; Wallace & Birnstiel, 1966); thus they provide a unique opportunity to study the synthesis oft- proteins in the absence of rRNA production. Although the Xenopus embryo represents a convenient natural situation for the study of ribosome synthesis, it also presents practical limits to some experimentation, for instance that involving administration of drugs or in vivo labeling with radioactive precursors, or attempts to modify cell growth conditions. For this reason we also use a cultured cell system, the Xenopus laevis kidney cell line B 3.2, which allows experiments not possible in the developing embryos.

Structure and regulation of r-protein genes

Organization and structure Unlike the genes for rRNA and for 5S RNA which are present in hundreds or thousands of copies in the eukaryotic genomes, the genes for r-proteins are not reiterated; they are present in general in one or two copies per haploid genome. In the specific case of Xenopus laevis, there are two gene copies for most of the studied r-proteins, namely L1, L14, $8, $1 (Loreni et al., 1985; Beccari et al., 1986; Mariottini et al., 1988; Di Cristina, Menard & Pierandrei-Amaldi, 1991). This duplication is not functionally relevant, but due to a duplication of the whole genome which occurred in this species about 30 million years ago (Bisbee et al., 1977); this notion is supported by the observation that the majority of the genes studied are present in two copies in Xenopus Iaevis, and that the same genes are present in single copy in Xenopus tropi- calis, a species which did not undergo genome duplica- tion. In the case of other r-proteins, L32 and S 19, only one type of mRNA has been found (Bagni et al., 1990; Mariottini & Amaldi, 1990), suggesting that after the mentioned genome duplication, one of the two gene copies has been deleted or at least inactivated by muta-

tion. Considering other eukaryotes, ribosomal protein genes are p~cesent in single copies in Dictyostelium, in Tetrahymena and in Drosophila, while for some unknown reason the majority of them are present in two copies in the yeast Saccharomyces cerevisiae (for references see Planta & Rau~, 1988; Mager, 1988). In the case of mammals there is only one active gene for each r-protein, but also some ten/twenty processed pseudogenes (Wager & Perry, 1985). The presence of so many pseudogenes in mammals, and their absence in the frog which is also a vertebrate, is probably a consequence of the fact that processed pseudogenes are the result of mRNA reverse-transcription and rein- tegration mediated by retroviruses whose occurrence is frequent in warmblooded vertebrates.

At variance with E. coli, where many genes for different r-proteins are adjacent to each other being organized in operons (Nomura, 1990), in Xenopus and in the other eukaryotes studied the genes for the various r-proteins are not clustered but rather dispersed in the genome.

As shown in Figure 1, the comparison of the Y ends of different Xenopus r-protein genes (Loreni et al., 1985, Beccari & Mazzetti, 1987; Mariottini & Amal- di, 1990; Mariottini et al., 1993) reveals a common architecture which reflects the fact that they belong to a class of genes sharing common regulations at the transcriptional and translational level (see below). The transcription start site is located always within a 15-20 pyrimidine stretch flanked by short C + G rich sequences and in general is preceded by a non canoni- cal TATA box. The first exon, corresponding exactly or almost exactly to the YUTR of the mRNA, is always short, between 20 and 50 nucleotides, and has sequence similarities among different r-protein genes (Mariottini et al., !988). Similarities are also observed in the one hundred nucleotide upstream, and in the one hundred nucleotide downstream in the first intron. This type of Y end has been described also in mammalian r-protein genes (Hariharan, Kelley & Perry, 1989), but not in lower eukaryotes, and can be considered typical of all vertebrate r-protein genes.

Finally, the presence of introns in the genes for r- proteins appears to be also a relevant feature: in fact r-protein gene introns have important regulatory roles, as we will describe below for Xenopus, and as also sug- gested by the observation that in yeast, where introns are rare, most r-protein genes have one (Planta et al., 1986). The most remarkable property of the introns of some r-protein genes is the presence of evolutionary conserved sequences, often repeated in more introns of

183

kl A GTA G GC GTA GGCTTATAGCTGA G GAACG.C..G.G.CTC CTCCTI~CCTTTTCTCTFCGT .GGCSGCTGTG GA GAAGCA GCGA G GA ~ CG GTCA6 CAT@ I intron-

L14 CA GGTGTTC CCATAA GC CTGTTC.GCCGCGC.CTGTCTCTTF@I-FFC CTC C CCGAGAA GCCG.C.TG CTGCTA CA G C C G CCAT~- I intron-

$I CG C GCTCTAG GTATATA GTCGCATCCGCCG.G.AA GIG GCCG ~CCTrTccTrCCAG.C.GGCGC.R-A GCGA(~C G G CG CA GATCTCCAA GAA G CG GAA @ I intron-

S8 TGGC CTCCG CC GA GATCTGG GTCGCTCTC.G.C..G.GGG]TFCG~CCTCTTCCTA GG, CC.GTCA CTGAGAAA GGA C @ I intron~AAGGC~AGCACAAG...

S19 TCA G CI-FCTGTGATATGATTTGTCGA GG.GC.G.G.G.CATTC C~CCTFFC CTFCGTCACCGT.GA GA GATAGC CGGCAA~ I intron-

Fig. 1. Sequences surr•undingthe transcripti•n st•rt sites •f Xen••us laevis genes f•r r•pr•teins. Transcripti•n initiati•n (arr•ws) •ccurs in the middle of pyrimidine tracts (thick underlined) flanked by GC rich sequences (dot underlined), and preceded by non canonical TATA boxes (thin underlined). Exons and the initiation ATG codons are boxed. References for sequences are: L1 (Loreni et al., 1985), L14 (Beccari & Mazzetti, 1987), S1 (PeUizzoni, Crosio & Pierandrei-Amaldi, manuscript in preparation); $8 (Mariottini et aL, 1993) and S19 (Mariottini & Amaldi, 1990).

the same gene, which code for small nucleolar RNAs (snoRNAs). For instance, Bozzoni and collaborators have shown that the gene for r-protein L1 of Xenopus

laevis contains in its third intron a 106 nt sequence, very well conserved in the corresponding human gene, which codes for U16 RNA (Fragapane et al., 1993). Moreover, the same Xenopus laevis r-protein L1 gene has a 60 nt sequence repeated in introns 2, 4, 7 and 8 (Loreni et al., 1985; Cutruzzol5, Loreni & Boz- zoni, 1986) which codes for U18 RNA (Prislei et al., 1993). We have found that all the six introns of the

"Xenopus gene for r-protein $8 contain a 220 nt repeat- ed sequence coding for U17 RNA (Mariottini et al., 1993; Cecconi et al., 1994). Similarly, U15 RNA has been shown to be encoded in the first intron of human r-protein $3 gene (Tycowski, Shu & Steitz, 1993), and in the last of the six introns of Xenopus S 1 gene (corresponding to $3 of mammals) (Pellizzoni, Cro- sio & Pierandrei-Amaldi, manuscript in preparation). Other snoRNA are encoded in the introns of genes for proteins which, although not part of the ribosome structure, still have something to do with the ribosome synthesis or function: thus U14 RNA is encoded in three introns of the mouse gene for the cognate hsc70 heat shock protein which is nucleolar (Liu & Maxwell, 1990; Leverette, Andrews & Maxwell, 1992), and U20 RNA is encoded in one intron of the vertebrate gene for nucleolin (Caizergues-Ferrer, personal communi- cation). Curious is the case of U17 RNA which, as mentioned, is encoded in the gene for r-protein $8 in Xenopus but is found in the introns of a different gene, RCC1, in mammals (Kiss & Filipowicz, 1993). For most of the mentioned cases it has been demonstrat- ed that the snoRNAs are not produced by independent

transcription but by processing of the intron sequences of the large ribosomal (or nucleolar) protein primary transcripts. Although the precise functional role has not been determined for any one of these snoRNAs, it seems reasonable to think that they are involved in some step of rRNA processing and/or ribosome assem- bling. These examples are numerous enough to permit the assumption that the localization of snoRNAs cod- ing sequences within the introns of genes coding for ribosomal or nucleolar proteins is not coincidental but must have an important functional relevance.

The synthesis o f ribosomes during oogenesis and embryogenesis

During oogenesis each of the thousands of oocytes present in a Xenopus ovary accumulates, together with many other components which will be utilized for embryogenesis after fertilization, about 10 I2 ribo- somes which will be sufficient at the end of embryoge- nesis for the needs of about one million somatic cells. In order to carry out this enormous synthesis of ribo- somes, the genes for rRNA in the young oocytes before the start of ribosome accumulation undergo the well known process of 'amplification', which results in the production of about two million copies of these gene, already present in multiple copies (about 500) in the somatic genome (Brown & Dawid, 1968; Gall, 1968). Also 5S RNA needs to be produced at a very high rate; this is attained by the activation of all the 25,000 gene copies present in this genome, versus the small subset of 400 copies normally active in somatic cells (Wormington, Schlissel & Brown, 1983). After fertil- ization, during the first hours of embryo development, no transcription can be detected while the cleaving

184

cells undergo very fast division cycles. Transcription of many genes resumes only when the cell cycles slow down at the stage of blastula (for references see David- son, 1986). At this point the genes for rRNA and 5S RNA also show some transcriptional activity, but a real accumulation of new ribosomes begins only about 24 h later at the tailbud stage.

The synthesis of r-proteins has been studied in this developmental system by following the activity of r-protein genes at the various levels of transcrip- tion, transcript stability, translation and protein stabil- ity (Pierandrei-Amaldi et al., 1982, 1985a; Baum & Wormington, 1985). Besides providing the first infor- mation, this work has been also preliminary to a more informative approach, consisting of the analysis of the response to the interference with the normal pattern of expression of r-protein genes by microinjection in oocytes and in embryos of various components such as cloned r-protein genes, r-protein transcripts, purified r-pr0teins, antibodies versus r-proteins and ribosomes (Bozzoni etal., 1984; Pierandrei-Amaldietal., 1985b, 1988; Wormington, 1986). Very useful information has also been obtained by the analysis at the various level of r-protein synthesis in the absence of rRNA synthe- sis, as it occurs in the Xenopus anucleolate embryos (Pierandrei-Amaldi et al. 1982, 1985).

Different levels of regulation of r-protein synthesis The results obtained by all these approaches in the Xenopus system, together with those obtained for mammals, allow one to conclude that in vertebrates r- protein production is controlled at various levels from transcription to protein stability, as schematically rep- resented in Figure 2:

1) The genes for r-proteins are transcriptionally con- stitutive. In fact these genes have always been found transcriptionally active, even if ribosome synthesis is not required as in early embryogen- esis when transcription is resumed, or in condi- tions where ribosomes cannot be synthesized, as in anucleolate embryos. However, a modulation of transcription activity is necessary to adjust the pro- duction of ribosomes to the different growth and differentiation states of the cell. This transcription modulation, which would represent the strategic long term regulation of r-protein gene activity, is under the control of promoters that, as mentioned, share a common architecture, and that are recog- nized by transcription factors active on these and other housekeeping genes (arrow 1 in Fig. 2) (Hari-

haran, Kelley & Perry, 1989; Carnevali et af., 1989; Hariharan & Perry, 1990; Marchioni et al., 1993; and references therein).

2) A post-transcriptional regulation controls the level of r-protein mRNA in the cell through a modu- lation of transcript stability (Pierandrei-Amaldi et al., 1985a). The mechanism of this control has been studied for r-protein L1 (Bozzoni et al., 1984; Caffarelli et al., 1987; Fragapane et al., 1992); in this case it involved the control of a specific step of the splicing of the third intron of the L1 transcript (the same intron that, as mentioned above, codes for the snoRNA U16). It has been proposed that the effectors of this post-transcriptional regulation are the r-proteins themselves that, after synthesis, enter into the nucleus to be assembled into ribo- somes and, if made in excess with respect to the other ribosomal components, would bind to their own transcripts, affecting their processing and/or stability. Thus, this post-transcriptional regulation of r-protein synthesis provides a feedback regula- tion which guarantees the production of equimolar amounts of the various r-proteins (arrow 2 in Fig. 2).

3) A translational regulation is also operating which controls the partition ofrp-mRNA between mRNPs and polysomes (Amaldi & Pierandrei-Amaldi, 1990; Perry & Meyuhas, 1990). This regulation, which represents a very fast response to changing amounts of available unutilized ribosomes, repre- sents the main interest of the authors' laboratories and will be considered in more detail in the remain- ing part of this paper.

4) Under certain conditions r-proteins can be synthe- sized in excess of the amount needed for ribo- some assembly; in these cases they are degraded (Pierandrei-Amaldi et al., 1985a; Baum, Hyman & Wormington, 1988).

The translational control of r-protein synthesis

Evidence of the translational regulation In Xenopus the first evidence of a translational reg- ulation of r-protein synthesis has been obtained by studying the events that, after fe~ilization, lead to the onset of the synthesis of new ribosomes in the embryo (Pierandrei-Amaldi et al., 1982, 1985a; Baum & Wormington, 1985; Wormington, 1989). In fact, as shown in Figure 3, new mRNA specific for r-proteins

185

Fig. 2. Schematic representation of different levels of regulation of r-protein synthesis in vertebrates. The regulatory interactions involved in the synthesis of a representative r-protein are indicated by the thick arrows: 1) transcriptional regulation; 2) processing and stability of the transcript; and 3) translational regulation. See text for explanations and references.

(rp-mRNA) starts to be accumulated in the embryo after the so called 'mid-blastula transition' (stage 8) as it occurs for many other mRNAs (for references see Davidson, 1986). For a while, however, the new- ly transcribed rp-mRNA is poorly translated, being mostly kept in light cytoplasmic RNPs and only 20- 30% loaded on polysomes. Only after stage 26, some 20 h later, the fraction of rp-mRNAs associated with polysomes increases to about 65-80%, and apprecia- ble amounts of new r-proteins start to be synthesized and accumulated.

An uncoupling between the synthesis of rp-mRNA and its utilization has also been observed during Xeno- pus oogenesis (Cardinali, Campioni & Pierandrei- Amaldi, 1987; Baum & Wormington, 1985). Here the rp-mRNA is already accumulated at its highest level by early stage II; at this stage its utilization, that is its recruitment on polysomes, is rather low but it becomes more and more efficient during the following oocyte growth when the ribosome store is built up. In situ hybridization has shown that the rp-mRNA accumulat- ed in the oocytes is evenly distributed in the cytoplasm (Cardinali, Campioni & Pierandrei-Amaldi, 1987). Hormone induction of oocyte maturation results, in spite of a twofold increase in overall protein synthesis, in the cessation of r-protein synthesis due to the dis- sociation of rp-mRNA from polysomes accompanied

by the deadenylation of these transcripts (Hyman & Wormington, 1988).

As already mentioned the Xenopus developmental systems, although very useful, present some limits to experimentation. For this reason we set up a Xenopus cultured cell system, using the Xenopus laevis kid- ney cell line B 3.2 where, as previously shown for mouse cells (Geyer et al., 1982), the translational reg- ulation of r-protein synthesis can be profitably studied (Lorelli & Amaldi, 1992). After being transferred in serum free medium, these cells rapidly decrease DNA, RNA, and protein synthesis while addition of serum to the culture after a few hours of deprivation causes a rapid recovery. During these growth rate changes a shift of rp-mRNA distribution between polysomes and mRNPs is observed. Its percent on polysomes changes from 70-80 during rapid growth to 25-35 during the downshift and back to 70-80 after the upshift.

Similar translation regulation of r-protein synthesis has been described in several eukaryotic systems such as mouse, chicken, Drosophila and Dictyostelium (for references see Perry & Meyuhas, 1990; Amaldi & Pierandrei-Amaldi, 1990).

The translational regulation is specific for rp-mRNAs It is important to mention that control hybridization with probes for unrelated mRNAs showed that, both

186

Fig. 3. Synthesis of ribosomal proteins during Xenopus embryogenesis, a) rp-mRNA: typical pattern of accumulation of a rp-mRNA; values obtained by quantitation of Northern blots have been normalized to the number of cells per embryo at the various stages, and expressed relatively to the highest point; r-proteins: pattern of synthesis of r-proteins as determined by 35 S-methionine labeling and 2D gel electrophoresis analysis, values were normalized as above, b) and c) Polysome/mRNP distribution of rp-mRNA in Xenopus embryos at stages 16 and 32 respectively. Cytoplasmic extracts were fracfionated on sucrose gradients and the RNA extracted from gradient fractions were analyzed by Northern blot hybridization. The figure shows the polysomal patterns (optical density profiles) and the hybridization autoradiograms. This figure shows typical data obtained for several r-proteins (Amaldi & Pierandrei-Amaldi, 1990).

during development and in cultured cells, the above described translational patterns are specific for rp- mRNA. In general other mRNAs behave very differ- ently, most of them being always completely recruited on polysomes. It is interesting that some other mRNAs for non ribosomal proteins, which however have some functional relationship with ribosomes, are regulated as rp-mRNAs. This is the case for nucleolin mRNA (Caizergues-Ferrer et al., 1989) and for translation elongation factor EF- 1 a mRNA (Loreni, Francesconi & Amaldi, 1993) that from this point of view can be included in the 'regulatory' group of rp-mRNAs.

Indeed this translational behaviour is so specific that we could use it as a criterion to isolate many new cDNA clones for other r-proteins (Loreni etal., 1992). For this purpose we hybridized clones from a cDNA bank with four probes prepared respectively by reverse

transcription of mRNAs extracted t) from polysomes and 2) from RNPs of stage 16 embryos (when rp- mRNA is mostly in the light RNP fraction), and 3) from polysomes and 4) from RNPs of stage 35 embryos (when rp-mRNA is mostly loaded on polysomes). The success of this screening strategy proves that the trans- lational control we described in Xenopus embryos is very specific for this class of mRNA, and not a gen- eral inefficient utilization of mRNAs at these embryo stages.

Although the different rp-mRNAs have a similar translation behaviour, there are differences in the per- cent of rp-mRNA associated with polysomes (Bagni et al., 1992). For instance, between embryo stages 16 and 32, the L14 mRNA loaded on polysomes increases from 29% to 62%, the S19 mRNA from 44% to 76%.

187

Some individual variability among different animals has also been observed.

Translational regulation of rp-mRNA does not involve feedback inhibition by r-proteins When translational regulation of r-protein synthesis was observed in eukaryotic systems, it seemed possible that, similarly to E. coli, it might involve a feedback inhibition .by r-proteins themselves. On the contrary, this possibility is ruled out by a number of observa- tions. Purified individual r-proteins or small groups of them, when microinjected into the cytoplasm of Xenopus oocytes or added in an in vitro translation system programmed with a Xenopus mRNA, had no inhibitory effect on the synthesis of new r-proteins (Pierandrei-Amaldi et al., 1985b), thus indicating that r-proteins do not feedback-inhibit the translation of their own mRNA. A similar conclusion was reached for r-protein L1 (Baum, Hyman & Wormington, 1988) whose increase, obtained in oocytes by microinjec- tion of the corresponding mRNA, indicated that dosage compensation does not occur at the translational level.

Further evidence in vivo came from the analysis of anucleolate Xenopus mutants. In these O-nu mutants, in spite of the absence of rRNA synthesis, the rp- mRNA is normally synthesized and, after stage 26, translated as well as in controls. The unutilized r- proteins, which do not find rRNA to assemble with, are degraded with a half-life of about one hour, but do not interfere with further translation of their own mRNAs (Pierandrei-Amaldi et al., 1985a). A simi- lar result has been obtained by manual enucleation of oocytes (Pierand, rei-Amaldi et al., 1987) where also, in spite of the absence of rRNA synthesis, rp-mRNA translation is still normal 24 h after enucleation.

All these data demonstrate that the presence of excess r-proteins, both in vivo and in vitro, has no effect on the translation of their own mRNA, as shown also for a mammal system (Bowman, 1987).

Relocation of rp-mRNA between polysomes and mRNPs is reversible and very fast It has been shown that the rp-mRNA loaded on polysomes and the one stored in light mRNPs, once extracted, can equally direct the synthesis of r-proteins in a cell free system, indicating that they are not struc- turally different (Pierandrei-Amaldi & Beccari, 1981; Weiss, Vaslet & Rosbash, 1981; Baum & Wormington, 1985).

Moreover, we could demonstrate that in cultured cells, even in the presence of the transcription inhibitor actinomycin D, the rp-mRNA level remains constant during the nutritional down- and upshifts, while its loading on polysomes changes (Loreni & Amaldi, 1992). This result indicates that the change from the rapid growth mRNA distribution to the downshift one, and back to the upshift one, involves a real mobiliza- tion of about 50% of the rp-mRNA from polysomes to mRNPs and back without any modification that would irreversibly alter its function.

The analysis of the kinetics of rp-mRNA distribu- tion changes during nutritionaldownshifts and upshifts of cultured cells showed that the rp-mRNA relocaliza- tion is very fast (Loreni & Amaldi, 1992). In fact, as shown in Figure 4, it is already appreciable after a few minutes after the downshift, and is somewhat slower after an upshift. During these nutritional shifts one also observes changes in the amount of rp-mRNA, which decreases during a downshift and increases during the upshift, but this is a much slower phenomenon, being appreciable only after several hours. These observa- tions indicate that translational regulation of r-protein synthesis represents a short term response to the request for ribosome synthesis changes, and it is also partic- ularly suitable to guarantee the homeostatic mainte- nance of the level of available ribosomes in the cell. On the other hand, the rp-gene transcription modula- tion very slowly affects the rp-mRNA amount in the cell, providing a long term response to internal or exter- nal signals.

Another conclusion, suggested by the very short time required for rp-mRNA relocation upon nutritional shifts, is that the translational regulation mechanism cannot involve the de novo synthesis of any regulatory factor, which would take much longer, but it could rather be based on rapid modification(s), as for instance phosphorylation, of pre-existing factor(s).

Translational regulation of rp-mRNA involves a nega- tive control of specific factor(s) It has been observed, both in mammals (Meyuhas, Thompson & Perry, ~1987) and in Xenopus (Amal-

�9 , . , i . ~ , . ,

d l & Plerandrel-Amaldl, 1990), that the distribu- tion pattern of rp-mRNA along polysome gradients is bimodaL with the recruited fraction of rp-mRNA fully loaded with about one ribosome every one hun- dred nucleotides of its translated region. Thus, each molecule of the rp-mRNAAs either translationally inac- tive or fully active. This observation indicates that the

188

A

o [] Z < .5 " 50

~ E E 0 U

I I I I 1 = 1 1 to 20 ao 4 0

E E

.{ Z

100

B

-3 O ~ -

, 0

I I I I I I I I

10 20 30 40

Time (min)

Fig. 4. Kinetics of changes of the amount of rp-mRNA and of its distribution between potysomes and mRNPs during nutritional downshift (A) and upshift (B), induced in cultured Xenopus B 3.2 cells by deprivation and addition of calf serum to the growing medi- um. At different times after the nutriti'onal shifts, cells were collected and lysed: the amount of rp-mRNA was measured by quantitation of hybridization signals obtained in Northern blots of total cytoplasmic RNA. To measure the distribution of rp-mRNA between polysomes and mRNPs the cytoplasmic extracts were fractionated on sucrose gradient, theRNA extracted from polysomal and subpolysomal frac- tions and analyzed by Northern blot hybridization. This figure shows data relative to r-protein L14, as representative of analogous results obtained also for other r-proteins (Loreni & Amaldi, 1992).

translational regulation of r-protein synthesis depends on the activity of some specific, negative or positive, factor(s) interacting with mRNA sequences, and not to a differential utilization of different mRNAs due to competition of the messengers for a limiting com- ponent of the translation apparatus, as for instance in the case of the model for a general translational con- trol mechanism proposed for other situations (Lodish, 1974; Ray et al., 1983). In fact, in the case of a com- petition based mechanism we would have observed, during the downshift, a decrease of the polysome size as has been described in other examples of translational control (White et al., 1990).

Moreover, the success of the r-protein cDNA screening strategy (Loreni et al., 1992) proves that the translational control we described in Xenopus embryos is very specific for this class of mRNA, and not a gen-

eral inefficient utilization of mRNAs at these embryo stages, and thus suggest s the involvement of specif- ic regulatory factors in the translational control of r- protein synthesis.

Finally the finding of some variability in the percent of rp-mRNA associated with polysomes when con- sidering different r-proteins, and also the described individual variability among different animals, can be interpreted as reflecting genetic variations of the reg- ulatory cis- and trans-acting elements responsible for the translational regulation (Bagni et al., 1992).

That the specific regulatory factor(s) operate(s) a negative control, rather than a positive one, is indicated by experiments of gene dosage alteration. When the amount of L1 mRNA in the embryo was increased up to tenfold by injection of the cloned L1 gene in fertilized eggs, its percent distribution between polysomes and mRNPs at stage 18 was the same as in controls (Pierandrei-Amaldi, Bozzoni & Cardinali, 1988). On the contrary, when a fifty-fold mRNA increase in oocytes was obtained by injection of the L14 gene, the percent of the L14 mRNA load- ed on polysomes increased substantially (Cardinali & Pierandrei-Amaldi, unpublished). This result suggests translation repression by a negative factor. This would be present in a limited, easily titrable amount in large oocytes where rp-mRNA translation is derepressed, and in larger amounts in stage 18 embryos where in fact rp-mRNA translation is repressed. Notice that these overdose levels are not very high if the factor is common to many different rp-mRNAs.

The amount of available ribosomes affects the rp- mRNA translation W~th the unique exception of the oocyte, that has developed special mechanisms to accumulate the large sto~e of ribosomes, in all other situations one can observe an inverse relationship between the amount of free ribosomes and translation efficiency of rp- mRNA. For instance, during embryogenesis the uti- lization of rp-mRNA is inefficient in the early stages when the maternal store of ribosomes is not yet ful- ly utilized; only after stage 26, when the ribosome recruitment on polysomes reaches its normal value of about 70-80%, the rp-mRNA starts being trans- lated efficiently (Pierandrei-Amaldi et al., 1985a). Moreover, in the particular situation of the anucleo- late mutant embryos, 100% of the rp-mRNA becomes associated with polysomes at late stages, when they suffer a critical shortage of ribosomes (Pierandrei-

189

Amaldi et al., 1985a). To experimentally test this observation, the amount of maternal free ribosomes in developing Xenopus embryos has been experimen- tally modified (Pierandrei-Amaldi, Campioni & Car- dinali, 1991); an increase was obtained by microin- jection of purified ribosomes into fertilized eggs, and a decrease was induced by treatment of embryos with low doses of cycloheximide which causes a build up of polysomes and thus a reduction of the pool of free subunits and monosomes. By analysing the effect of these manipulations on the translation of rp-mRNA it was observed that when ribosomes available for trans- lation are in excess, the loading of rp-mRNA onto polysomes decreases. Conversely, when ribosomes are scarce, polysome loading of rp-mRNA increases.

Also the comparison of the kinetics of changes of the amount of monomers in parallel with the rp-mRNA redistribution in the cultured cell system points to a relationship between the two phenomena (Loreni & Amaldi, 1992). We have observed that, while during the nutritional downshift the monomer increase and the rp-mRNA polysome association decrease appear to be almost contemporary, during the upshift the monomer reduction precedes the recruitment of rp- mRNA on polysomes. This could mean that, during the upshift, there is an mRNA population (other than rp-mRNAs) that quickly recruits ribosomes. The con- sequent decrease of free monomers would cause the loading of rp-mRNAs. Therefore this observation is consistent with the notion that the amount of free non translating ribosomes can regulate r-protein synthesis: an excess of free monomer would inhibit rp-mRNA translation while a decrease of available ribosomes would activate it. This would create a feedback mech- anism able to maintain a level of ribosomes adequate to cellular requirements.

How the amount of free ribosomes can affect the translation of rp-mRNA is not known; however, it cannot be a simple and direct way. In fact the unutilized rp-mRNAs sediment as 15-30 S mRNPs (Cardinali, Di Cristina & Pierandrei-Amaldi, 1993), slightly faster than the naked mRNAs, thus not bound to ribosome monomers or ribosome subunits.

The 5 ~ UTR of rp-mRNA as cis-acting elements of the translational control To understand the molecular mechanism involved in the translational regulation it is important to identi- fy the cis-acting elements and the trans-acting factors which, analogously to the better understood transcrip-

tion control mechanisms, are responsible for this spe- cific control. We had a number of reasons to think that the 5 ~ untranslated region (5~UTR) of rp-mRNAs might contain the cis-acting elements, that is the sequence(s) or structure(s) which could differentiate these from oth- er mRNAs and confer to them the typical translational behaviour. In fact, as shown in Figure 5, the 5~UTR of the mRNAs for the different r-proteins in Xenopus andin other vertebrates are quite typical: always short, starting with a run of 8-12 pyrimidines and containing other similarities (Mariottini et al., 1988; Amaldi & Pieraqdrei-Amaldi, 1990; Hariharan, Kelley & Perry, 1989). Also the observation that all rp-genes have afirst intron localized exactly at, or very close to, the initi- ation ATG codon supports the idea that these untrans- lated sequences might have some important role in regulation of translation. To verify this hypothesis we have microinjected into Xenopus fertilized eggs a gene construct in which the upstream sequences (promot- er) and the 5~UTR (first exon) of the gene coding for Xenopus r-protein S19 had been joined to the cod- ing portion of a reporter gene deprived of its own 5 ~ UTR (Mariottini & Amaldi, 1990). The analysis of the expression of this fused gene during embryogenesis has demonstrated that the S19 5~UTR has conferred to the fused mRNA the translation behaviour typical of rp-mRNAs. That the 5 ~ UTR of rp-mRNAs has a role in its translational control has been shown with analo- gous experiments, also in other systems, such as mouse (Levy et al., 1991; Hammond, Merrick ~ Bowman, 1991) and Dictyostelium (Steel & Jacobson, 1991).

In the case of mouse one more step has been accom- plished: site directed mutagenesis of the pyrimidine sequence at the very 5 ~ end of the mRNA has shown that it is important, although probably not sufficient, for translational regulation (Levy et al., 1991). Similar experiments carried out in Xenopus remained inconclu- sive; in fact, to obtain information about its possible role, we have introduced by site-directed mutagene- sis one or more purines at various positions within the polypyrimidine tract present at the 5 ~ end of the gene coding for ribosomal protein S19 of Xenopus (Chen et al., 1992). The effect of these mutations on tran- scription and translation of a reporter coding sequence has been evaluated by DNA microinjection in Xeno- pus oocytes. We showed that an uninterrupted stretch of pyrimidines is not necessary for efficient transcrip- tion and translation of the reporter gene in the Xenopus oocyte. However this finding does not exclude the pos- sibility that this sequence is involved in transcription and/or translation regulation in some developmental

190

L i CCUUUUCUCUUCGUGGCCGCUGUGGAGAAGCAGCGAGGAG~...

L 14 C CUUUC CUCCCCGA GAA GCA GCUGCU GCUA CA G..C.C..G..C.C..~ UC~] . . .

L22 C CU C U U U U C U C U U C CA C..C.G..C..C.G.A(~--O"~...

L3~2 CCUUUUCCUCCAUCUUGGAUA CCA GUG.C..G.G.U..C.CUGCCUG CAUCUGGACAUUA..G.G.A..G.A..G CAA(~...

$1 C CUUUCCUG CCA .GC.G.GC.G.CUUA GC,A ,AA..G~...

~8 CCU CUUCUA.G..GC..Cw CU G, A .G,AA.A. GGA C GAAA GGCC~.,,

$II c CGUUUUCCC~CCA.G.C..A.G..G..CA. AA~...

S19 c c u u u c c uu c G U CA C C G U .G,A, ~A. ,G..A.UA mG.C..C..G.G..C.AA G~. �9 �9

Fig. 5. Sequence similarities in the 5JUTRs of mRNAs (cDNAs) for different Xenopus laevis r-proteins. Sequences are shown from the cap site (+1 nt) to the initiation AUG codon. The typical pyrimidine run, the G + C rich sequence and the G + A rich sequence are differently underlined. References for sequences are: L1 (Loreni et al., 1985), L14 (Beccari et al., 1986), L22 (Loreni, unpublished), L32 (Bagni et al., 1990); S1 (Di Cristina et al., 1991); $8 (Mariottini et al., 1988); S11 (Mariottini, unpublished), S19 Mariottini & Amaldi, 1990).

situations different from oogenesis, which is known to represent a very special case.

Proteins which bind the 5'UTR o f rp-mRNA as puta-

tive trans-acting elements responsible f o r translational

regulation In order to find out if RNA/protein interactions are involved in the rp-mRNA translational control mech- anism, we have characterized the particles contain- ing the translationally repressed rp-mRNA in vivo and we have searched for possible factors that specifical- ly interact in vitro with the 5'UTR typical of these mRNAs (Cardinali, Di Cristina & Pierandrei-Amaldi, 1993). The studies were mostly carried out for rp-L1 mRNA. By sedimentation analysis and isopycnic cen- trifugation it was found that the repressed rp-mRNAs in the embryo are assembled in slow sedimenting com- plexes, where the RNA is prevalent over the protein with a ratio of 2.3 to 1. The same composition is main- tained also when the particle is reconstituted in vitro by incubating L1 mRNA with a cytoplasmic extract. A detailed analysis of in vitro RNA/protein complex formation was carried out by focusing our attention on the 5' UTR. In vitro binding experiments followed by gel shift assay and UV crosslinking have shown a spe- cific interaction of the L1 rp-mRNA with four proteins (Cardinali, Di Cristina & Pierandrei-Amaldi, 1993). As schematically shown in Figure 6 the binding site for two of them, A (57 kD) and B (48 kD), is in the typical pyrimidine sequence at the 5' end and it is posi- tion dependent. Binding of two other proteins, C (31 kD) and D (24 kD), in the downstream region was also observed and seems to be affected by alternative con-

formation of the RNA. It is possible that the mRNA, according to its functional state, can assume alternative conformations maintained by specific proteins. How- ever, at the moment, there is no proof that the described proteins themselves act as translational repressors; in fact it is also possible that they are always associat- ed with the 5'UTR of.rp-mRNA to form a peculiar 5' end structure sensitive to translational control by some other factor(s). A protein of 56 kD, probably homolo- gous to our protein A, has been described to bind the pyrimidine tract of murine L32 mRNA (Kaspar et al.,

1992).

Concluding remarks

It appears that most r-protein genes, possibly all, form a class of genes th'at share some characteristic struc- tures, particularly in the region of the 5' end, that are involved in the coordinated regulation of gene activ- ity at the levels of transcription, transcript matura- tion/stability and translation. These types of controls are characterized, for obvious intrinsic reasons, by dif- ferent response times, from hours to minutes. 1) The transcriptional regulation, that can lead to a manyfold change of the level of rp-mRNA, takes hours to attain it. Thus it is suitable to participate in the unfolding of the cell growth programs accompanying the various developmental and differentiation situations, and to play a role in the long term response to unprogrammed growth condition changes. 2) The transcript matu- ration/stability control mechanism can be somewhat faster and, as it seems to be autogenously regulated by

191

[DI ICCUUUUCUCUUCGUGGCCGCUGUGGAGAAGCACGA~UGpCGGUCAGCAUGGCCUGCGC... 11101]

I C ] Fig. 6. Schematic representation of the localization within the rp L1RNA 51UTR region of the binding sites for four patients (A-D) (Cardinali et al., 1993).

a feedback effect of exceeding r-proteins on their own transcripts, it can guarantee an equimolar production of the various r-proteins and in amounts not in excess with respect to the RNA components of the ribosome. 3) The translational regulation allows at most a 2-3

fold change in the amount of r-proteins produced, but it attains this in a few minutes. Thus it can provide a fast response, eventually followed by the slower transcrip- tional activity changes, to incoming signals from out- side the cell (stimulation by growth factors, hormones, etc.), but it can also act as supervisor for the continuous

modulation of the r-protein synthesis rate necessary for the homeostatic maintenance of an appropriate amount

of available ribosomes. Accordingly, a negative effect of the amount of available ribosomes on the transla-

tion efficiency of the rp-mRNA has been observed and provides a regulatory loop highly significant for the

physiology of the cell, falling into a classic scheme of feedback regulation. How the available ribosomes exert their effect remains an open question; certainly

not directly, as the untranslated rp-mRNA is not bound

to ribosomal monomers or subunits in the cell. What we know is that translational regulation operates by chang- ing the partition of rp-mRNA between polysomes and inactive mRNPs and depends on the 5 'UTR of the

rp-mRNAs, particularly on the presence of a pyrimi- dine sequence at the very 5' end that acts as cis-acting element of the control. As for the trans-acting effec- tor(s), some proteins which have been found to bind specifically to this 5 'UTR represent clearly good can- didates. The purification of these rp-mRNA binding proteins, which represents the next obvious step in this research, will allow us to define their effective func-

tional role and to enter into the molecular mechanisms of the translational control.

Acknowledgements

Research in the authors' laboratories was carried out under contract SC1"-0259-C of the Science Pro- gramme of the Commission of the European Commu- nities and was partially supported by grants from 'Pro-.

getto Finalizzato Biotecnologie' and 'Progetto Final- izzato Ingegneria Genetica' of 'Consiglio Nazionale

delle Ricerche', and from 'Ministero Universit~t e Ricerca Scientifica e Tecnologica'.

References

Amaldi, E, I. Bozzoni, E. Beccari & R Pierandrei-Amaldi, 1989. Expression of ribosomal protein genes and regulation of ribo- some biosynthesis in Xenopus development. Trends Biochem. Sci. 14: 175-178.

Amaldi, E & Pierandrei-Amaldi, 1990. Translational regulation of the expression of ribosomal protein genes in Xenopus laevis. Enzyme 44: 93-105.

Bagni, C., P. Mariottini, E Annesi & E Amaldi, 1990. Structure of Xenopus laevis ribosomal protein L32 and its expression during development. Nucl. Acids Res. 18: 4423-4426.

Bagni, C., R Mariottini, L. Terrenato & E Amaldi, 1992. Individual variability in the translational regulation of ribosomal protein synthesis in Xenopus. Mol. Gen. Genet. 234: 60-64.

Baum, E.Z., L.E. Hyman & W.M. Wormington, 1988. Post- translational control of ribosomal protein L1 accumulation in Xenopus oocytes. Dev. Biol. 126: 141-146.

Baum, E.Z. & W.M. Wormington, 1985. Coorainate expression of r-protein genes during Xenopus development. Dev. Biol. 1111: 488-498.

Beccari, E. & P. Mazzetti, 1987. The nucleotide sequence of the ribosomal protein L14 gene of Xenopus laevis. Nucl. Acids Res. 15: 1870-1872.

Beccari, E., P. Mazzetti, A.M. Mileo, I. Bozzoni, E Pierandrei- Amaldi & F. Amaldi, 1986. Sequences coding for the ribosomal protein L14 in Xenopus laevis and Xenopus tropicalis: homolo- gies in the 5~ non translated region are shared with other r-protein mRNAs. Nucl. Acids Res. 14: 7633-7646.

Bisbee, C.A., M.A. Baker, A.C. Wilson, I. Hadji-Azimi & M. Fish- berg, 1977. Albumin phylogeny for clawed frogs (Xenopus). Science 195: 785-787.

Bowman, L.H., 1987. The synthesis of ribosomal proteins S 16 and L32 is not autogenously regulated during mouse myoblast dif- ferentiation. Mol Cell Biol 7:4464-4471.

Bozzoni, I., P. Fragapane, E Annesi, P. Pierandrei-Amaldi, E Amaldi & E. Beccari, 1984. Expression of two Xenopus laevis ribosomal protein genes in injected frog oocytes. A specific splicing block interferes with the L1 RNA maturation. J. Mol. Biol. 180: 987- 1005.

Brown, D.D. & 1.B. Dawid, 1968. Specific gene amplification in oocytes. Science 160: 272-280.

Brown, D.D. & J,B. Gurdon, 1964. Absence of rRNA synthesis in the anucleolate mutant ofXenopus laevis. Proc. Natl. Acad. Sci. USA 51: 139-146.

192

Caffarelli, E., E Fragapane, C. Gehring & I. Bozzoni, 1987. The accumulation of mature RNA for the Xenopus laevis ribosomal protein L1 is controlled at the level of splicing and turnover of the precursor RNA. EMBO J. 6: 3493-3498.

Caizergues-Ferrer, M., E Mariottini, C. Curie, B. Lapeyre, N. Gas, E Amalric & E Amaldi, 1989. Nucleolin from Xenopus laevis: cDNA cloning and expression during development. Genes Dev. 3: 324-333.

Cardinali, B., N. Campioni & E Pierandrei-Amaldi, 1987. Ribo- somal protein, histone and calmodulin mRNAs are differently regulated at the translational level during oogenesis of Xenopus laevis. Exp. Cell Res. 169: 432441.

Cardinali, B., M. Di Cristina & P. Pierandrei-Amaldi, 1993. Inter- action of proteins with the mRNA for ribosomal protein L1 in Xenopus: structural characterization of in vivo complexes and identification of proteins that bind in vitro to its 51UTR. Nuel. Acids Res. 21:2301-2308.

Carnevali, E, C. La Porta, V. Ilardi & E. Beccari, 1989. Nuclear factors specifically bind to upstream sequences of a Xenopus laevis ribosomal protein gene promoter. Nucl. Acids Res. 17: 8171-8184.

Cecconi, E, P. Mariottini, E Loreni, P. Pierandrei-Amaldi, N. Cam- pioni & E Amaldi, 1994. U17 XS8, a small nucleolax RNA with a 12 nt complementarity to 18S rRNA and coded by a sequence repeated in the six introns ofXenopus laevis ribosomal protein $8 gene. Nuel. Acids Res. in press.

Chen, Q.-M., P. Mariottini, C. Bagni & E Amaldi, 1992. The pyrim- idine sequence encompassing the transcription start point of Xenopus laevis ribosomal-protein-encoding genes it not obliga- tory for activity in oocytes. Gene 119: 283-286.

Cutruzzolh, E, E Loreni & I. Bozzoni, 1986. Complementarity of conserved sequence elements present in 28S ribosomal RNA and in ribosomal protein genes of Xenopus laevis and Xenopus tropicalis. Gene 49: 371-376.

Davidson, E.H., 1986. Gene activity in early development, Academ- ic Press, Orlando.

Di Cristina, M., R. Menard & P. Pierandrei-Amaldi, 1991. Xenopus laevis ribosomal protein Sla cDNA sequence. Nucl. Acids Res. 19: 1943.

Elsdale, T.R., M. Fischberg & S. Smith, 1958. A mutation that reduces nucleolar number in Xenopus laevis. Exp. Cell Res. 14: 642-643.

Fragapane, P., E. Caffarelli, M. Lener, S. Prislei, B. Santoro & I. Bozzoni, 1992. Identification of the sequences responsible for the splicing phenotype of the regulatory intron of the L1 ribosomal protein gene of Xenopus laevis. Mol. Cell. Biol. 12: 1117-1125.

Fragapane, P., S. Prislei, A. Michienzi, E. Caffarelli & I. Bozzoni, 1993. A novel small nucleolar RNA (U16) is encoded inside a ribosomal protein intron and originates by processing of the pre-mRNA. EMBO J. 12: 2921-2928.

Gall, J.G., 1968. Differential synthesis of the genes for ribosomal RNA during amphibian oogenesis. Proc. Natl. Acad. Sci. USA 60: 553-560.

Geyer, P.K., O. Meyuhas, R.P. Perry & L.E Johnson, 1982. Reg- ulation of ribosomal protein mRNA content and translation in growth-stimulated mouse fibroblasts. Mol. Cell. Biol. 2: 685- 693.

Hammond, M.L., W. Merrick & L.H. Bowman, 1991. Sequences mediating the translation of mouse S16 ribosomal protein mRNA during myoblast differentiation and in vitro and pos- sible control points for the in vitro translation. Genes Dev. 5: 1723-1736.

Hariharan, M., D. Kelley & R.E Perry, 1989. Equipotent mouse ribosomal protein promoters have a similar architecture that includes internal sequence elements. Genes Dev. 3: 1789-1800.

Hariharan, M.D. & R.E Perry, 1990. Functional dissection of a mouse ribosomal protein promoter: significance of the polypyrimidine initiator and an element in the TATA-box region. Proc. Natl. Acad. Sci. USA 87: 1526-1530.

Hyman, L.E. & W.M. Wormington, 1988. Translational inactivation of ribosomal protein rnRNAs during Xenopus oocyte matura- tion. Genes Dev. 2: 598-605.

Kaspar, R.L., K. Tomohito, H. Cranston, D.R. Morris & M.W. White, 1992. A regulatory cis element and a specific binding factor involved in the mitogenic control of murine ribosomal protein L32 translation. J. Biol. Chem. 267:508-514.

Kiss, T. & W. Filipowicz, 1993. Small nucleolar RNAs encoded by introns of the human cell cycle regulatory gene RCC1. EMBO J. 12: 2913-2920.

Leverette, R.D., M.T. Andrews & E.S. Maxwell, 1992. Mouse U14 snRNA is a processed intron of the cognate hsc70 heat shock pre-messengerRNA. Cell 71: 1215-1221.

Levy, S., D. Avni, M. Hariharan, R.P. Perry & O. Meyuhas, 1991. Oligopyrimidine tract at the 5' end of mammalian ribosomal protein mRNAs is required for their translational control. Proc. Natl. Acad. Sci. USA 88: 3319-3323.

Liu, J. & E.S. Maxwell, 1990. Mouse U14 snRNA is encoded in an intron of the mouse cognate hsc70 heat shock gene. Nucl. Acids Res. 18: 6565-6571.

Lodish, H.E, 1974. Model for the regulation of mRNA translation applied to haemoglobin synthesis. Nature 251 : 385-388.

Loreni, E & E Amaldi, 1992. Translational regulation of ribosomal protein synthesis in Xenopus cultured cells: mRNA relocation between polysomes and RNP during nutritional shifts. Eur. J. Biochem. 105: 1027-1032.

Loreni, E, A. Francesconi & E Amaldi, 1993. Coordinate trans- lational regulation in the syntheses of elongation factor l a and ribosomal proteins in Xenopus laevis. Nucl. Acids Res. 21: 4721-4725.

Loreni, E, A Francesconi, R. Jappelli & E Amaldi, 1992. Analysis of mRNAs under translational control during Xenopus embryo- genesis: isolation of new ribosomaI protein clones. Nucl. Acids Res. 20: 1859-1863.

Loreni, F., I. Ruberti, I. Bozzoni, P. Pierandrei-Amaldi & E Amaldi, 1985. Nucleotide sequence of the L1 ribosomal protein gene of Xenopus laevis: remarkable sequence homology among introns. EMBO J. 4: 3483-3488.

Mager, W.H., 1988. Review: Control of ribosomal protein gene expression. Biochim. Biophy s. Acta 949: 1-15.

Marchioni, M., S. Morabito, A.L. Salvati, E. Beccari & E Carnevali, 1993. XrpF1, an amphibian transcription factor composed of multiple polypeptides immunologically related to the GA bind- ing protein a and/3 subunits, is differentially expressed during Xenopus laevis development. Mol. Cell. Biol. 13: 6479-6489.

Mariottini, P., E Amaldi, 1990. The 5' untranslated region of mRNA for ribosomal protein S19 is involved in its translation during Xenopus development. Mol. Cell. Biol. 10:816-822.

Mariottini, P., C. Bagni, E Annesi & E Amaldi, 1988. Isolation and nucleotide sequences of cDNAs for Xenopus laevis ribosomal protein $8: similarities in the 51 and 31 untranslated regions of mRNAs for different r-proteins. Gene 67: 69-74.

Mariottini, E, C. Bagni, A. Francesconi, E Cecconi, M.J. Serra, Q.-M. Chen, E Loreni, E Annesi & E Amaldi, 1993. Sequence of the gene coding for ribosomal protein $8 ofXenopus laevis. Gene 132: 255-260.

Meyuhas, O., E.A. Thompson & R.P. Perry, 1987. Glucocorticoid selectively inhibit translation of ribosomal protein mRNAs in P1798 lymphosarcoma cells. Mol. Cell. Biol. 7:2691-2699.

Nomura, M., 1990. History of ribosome research: a personal account, pp. 3-55 in The Ribosome: Structure, Function and Evolution, edited by W. HiU et aL, Amer. Soc. Microbiol., Washington.

Perry, R.P. & O. Meyuhas, 1990. Translational control of ribosomal protein production in mammalian cells. Enzyme 44: 83-92.

Pierandrei-Amaldi, P., E Amaldi, I. Bozzoni & P. Eragapane, 1987. Regulation of ribosomal protein genes during Xenopus develop- ment, pp 267-278 in Molecular Approaches to Developmental Biology: UCLA Symposia on Molecular and Cellular Biology. vol 51, edited by R.A. Firtel and E.H. Davidson, Alan R. Liss, New York.

Pierandrei-Amaldi, E & E. Beccari, 1981. Messenger RNA for ribo- somal proteins in Xenopus laevis oocytes. Eur. J. Biochem. 106: 603-611.

Pierandrei-Amaldi, E, E. Beccari, I. Bozzoni & E Amaldi, 1985a. Ribosomal protein production in normal and anucleolate Xeno- pus embryos: regulation at the posttranscriptional and transla- tional levels. Cell 42: 317-323.

Pierandrei-Amaldi, E, L Bozzoni & B. Cardinali, 1988. Expression of the gene for ribosomal protein L1 in Xenopusembryos: alter- ation of gene dosage by microinjection. Genes Dev. 2:23-31.

Pierandrei-Amaldi, E, N. Campioni, E. Beccari, I. Bozzni & E Amaldi, 1982. Expression of ribosomal protein genes in Xeno- pus laevis development. Cell 30: 163-171.

Pierandrei-Amaldi, P., N. Campioni & B. Cardinali, 1991. Experi- mental changes in the amount of maternally stored ribosomes affect the translation efficiency of ribosomal protein mRNA in Xenopus embryo. Cell. Mol. Biol. 37: 227-238.

Pierandrei-Amaldi, E, N. Campioni, P. Gallinari, E. Beccari, I. Bozzoni & E Amaldi, 1985b. Ribosomal protein synthesis is not autogenouslyregulated at the translational level in Xenopus laevis. Dev. Biol. 167: 281-289.

Planta, R.J., W.H. Mager, R.J. Leer, L.E Wouldt, H.A. Rau6 & T.T.A.L. EI-Baradi, 1986. Structure and expression of ribosomal protein genes in yeast, pp. 699-718 in Structure, Function and Genetics of Ribosomes, edited by B. Hardesty and G. Kramer. Springer Verlag, New York.

Planta, R.J. & H.A. Rau6, 1988. Control of ribosome biogenesis in yeat. Trends Genet. 4: 64~58.

Prislei, S., A. Michienzi, C. Presutti, P. Fragapane & I. Boz- zoni, 1993. Two different snoRNAs are encoded in introns of

193

amphibian and human L1 ribosomal protein genes. Nucl. Acids Res. 21: 5824-5830.

Ray, B.K., T.G. Brendler, S. Adya, S. Daniels-McQueen, J.K. Miller, J.W.B. Hershey, J.A. Grifo, W.C. Merrick & R.E. Thach, 1983. Role of mRNA competition in regulatory translation: Fur- ther characterization of mRNA discriminatory initiation factors. Proc. Natl. Acad. Sci. USA 80: 663-667.

Steel, L.E & A. Jacobson, 1991. Sequence elements that affect mRNA translation activity in developing Dictyostelium cells. Dev. Genetics 12: 98-103.

Tycowski, K.T., M.-D. Shu & J.A. Steitz, 1993. A small nucleolar RNA is processed from an intron of the human gene encoding ribosomal protein $3. Genes & Dev 7:1176-1190.

Wagner, M. & R.P. Perry, 1985. Characterization of the multigene family encoding the mouse S 16 ribosomal protein: strategy for distinguishing an expressed gene from its processed pseudogene counterparts by an analysis of total genomic DNA. Mol. Cell. Biol. 5: 3560-3576.

Wallace, H.R. & M.L. Birnstiel, 1966. Ribosomal cistrons and the nucleolar organizer. Biochim. Biophys. Acta 114:296-310.

Warner, J.R., D.M. Baronas-Lowell, EJ. Eng, S.P. Johnson, Q. Ju & B.E. Morrow, 1990. Genetic approaches to ribosome biosynthe- sis in the yeast Saccharomyces cerevisiae, pp. 699-718 in The Ribosome: Structure, Function and Evolution, edited by W.E. Hill, A. Dahlberg, R.A. Garrett, P.B. Moore, D. Schlessinger & J.R. Warner. American Society for microbiology, Washington, D.C.

Weiss, Y.C., C.A. Vaslet & M. Roshash, 1981. Ribosomal protein mRNAs increase dramatically during Xenopus development. Dev. Biol. 87: 330-339.

White, M.W., C. Degnin, J. Hill & D.R. Morris, 1990. Specific regulation by endogenous polyamines of translational initiation of S-adenosylmethionine decarboxylase mRNA in swiss 3T3 fibroblasts. Biochem. J. 268: 657-660.

Wormington, W.M., 1986. Stable repression of ribosomal protein L1 synthesis in Xenopus oocytes by microinjection of antisense RNA. Proc. Natl. Acad. Sci. USA 83: 8639-8643.

Wormington, M.W, 1989. Developmental expression and 5S bind- ing activity of Xenopus ribosomal protein L5. Mol. Cell. Biol. 9: 5281-5288.

Wormington, WM., Schlissel & D.D. Brown, 1983. Developmen- tal regulation of Xenopus 5S RNA genes. Cold Spring Harbor Symp. Quant. Biol. 47: 879-884.