Research ArticleAbdominal Fat and Sarcopenia in WomenSignificantly Alter Osteoblasts Homeostasis In Vitro bya WNT120573-Catenin Dependent Mechanism

Francesca Wannenes1 Vincenza Papa1 Emanuela A Greco2

Rachele Fornari2 Chiara Marocco2 Carlo Baldari1 Luigi Di Luigi1

Gian Pietro Emerenziani1 Eleonora Poggiogalle2 Laura Guidetti1

Lorenzo M Donini2 Andrea Lenzi2 and Silvia Migliaccio1

1 Section of Health Sciences Department of Movement Human and Health Sciences ldquoForo Italicordquo University of RomeLargo Lauro De Bosis 15 00195 Rome Italy

2 Section of Medical Pathophysiology Department of Experimental Medicine Endocrinology and NutritionldquoSapienzardquo University of Rome Italy

Correspondence should be addressed to Silvia Migliaccio silviamigliacciouniroma4it

Received 31 January 2014 Revised 14 April 2014 Accepted 29 April 2014 Published 20 May 2014

Academic Editor Małgorzata Kotula-Balak

Copyright copy 2014 Francesca Wannenes et al This is an open access article distributed under the Creative Commons AttributionLicense which permits unrestricted use distribution and reproduction in any medium provided the original work is properlycited

Obesity and sarcopenia have been associated with mineral metabolism derangement and low bone mineral density (BMD) Weinvestigated whether imbalance of serum factors in obese or obese sarcopenic patients could affect bone cell activity in vitro Toevaluate and characterize potential cellular and molecular changes of human osteoblasts cells were exposed to sera of four groupsof patients (1) affected by obesity with normal BMD (O) (2) affected by obesity with low BMD (OO) (3) affected by obesity andsarcopenia (OS) and (4) affected by obesity sarcopenia and lowBMD (OOS) as compared to subjects with normal bodyweight andnormal BMD (CTL) Patients were previously investigated and characterized for body composition biochemical and bone turnovermarkersThen sera of different groups of patients were used to incubate human osteoblasts and evaluate potential alterations in cellhomeostasis Exposure to OO OS and OOS sera significantly reduced alkaline phosphatase osteopontin and BMP4 expressioncompared to cells exposed toO andCTL indicating a detrimental effect on osteoblast differentiation Interestingly sera of all groupsof patients induced intracellular alteration in Wnt120573-catenin molecular pathway as demonstrated by the significant alteration ofspecific target genes expression and by altered 120573-catenin cellular compartmentalization andGSK3120573 phosphorylation In conclusionour results show for the first time that sera of obese subjects with low bone mineral density and sarcopenia significantly alterosteoblasts homeostasis in vitro indicating potential detrimental effects of trunk fat on bone formation and skeletal homeostasis

1 Introduction

Obesity and osteoporosis are important global health prob-lems with high prevalence and impact on both mortality andmorbidity [1 2] During the last decades both diseases havebecome a major health threat around the world with age andfemale status increasing the risk of developing both obesityand osteoporosis [1 2]

Interestingly obesity has been considered a protectionfactor against the development of bone loss and osteoporosis

likely for increased androgen aromatization to estrogens inpostmenopausal obese women [3 4] and also for a potentialrole of mechanical loading in regulating bone remodelling[5] Recently however the belief that obesity is protectiveagainst osteoporosis has been questioned Epidemiologic andclinical studies suggest that high level of fat mass might bea risk factor for osteoporosis and fragility fractures [6ndash8]Moreover adipose tissue functions as an endocrine organby releasing several adipokines which appear to modulateglucose and lipid metabolism inflammation appetite and

Hindawi Publishing CorporationInternational Journal of EndocrinologyVolume 2014 Article ID 278316 10 pageshttpdxdoiorg1011552014278316

2 International Journal of Endocrinology

insulin resistance [9ndash11] A physiological relevance of adiposetissue for skeletal health likely could reside in the role thatan excess of proinflammatory cytokines such as IL-6 andTNF-120572 might play by interfering with bone cells homeostasis[12ndash15] More recently obesity has also been associated tosarcopenia a condition characterized by progressive declineof muscle mass quality and strength [16 17] Thus thecrosstalk between fat and bone might play an important roleas homeostatic feedback system in which adipokines andmolecules secreted by bone cells represent the link of anactive and functional bone-adipose-muscle axis [18ndash20] bymechanism(s) not fully clarified yet

In addition obesity is associated with a chronic low-grade inflammation as depicted by increased plasma levelsof C-reactive protein (CRP) proinflammatory cytokinesand osteopontin [21 22] as well as lower circulating levelsof vitamin D (Vit D) [23] Nevertheless to date few andconflicting data show a correlation among abdominal fat VitD osteocalcin inflammatorymarkers [24] and bonemineraldensity alterations in morbid obese women

Since our group has recently demonstrated skeletal alter-ations in adult obese subjects and also an association ofobesity with sarcopenia [8] aim of the present study wasto investigate whether serum factors in obese and obeseosteoporotic patients andor sarcopenic patients could differ-ently affect osteoblastic cells homeostasis in vitro and likelyaltering skeletal health

2 Materials and Methods

21 Subjects Female subjects were selected in the Depart-ment of Experimental Medicine Section of Medical Patho-physiology Endocrinology and Nutrition of PoliclinicoUmberto I Sapienza University of Rome Chronic medicalconditions use of medications affecting bone metabolismhormonal and nutritional status vitaminD supplementationrecent weight loss and prior bariatric surgery interventionswere assessed as exclusion criteria Patients were investigatedfor metabolic inflammatory and bone turnover markersand their sera used for culturing osteoblasts Subjects werecharacterized byDual EnergyX-rayAbsorptiometry (DEXA)and divided into different groups upon bone mineral density(BMD) and muscle mass They were divided into differentgroups the first group included obese women (body massindex BMI gt30) with normal bone mineral density andnormal muscle mass (O) second group was formed by obesewomen with low bone mineral density for age (OO) anothergroup included obese women affected by sarcopenia (OS)the last group included women with both low BMD andsarcopenia (OOS) A control groupwas also evaluated whichincluded healthy women with normal BMI and normal 119879score (CTL) Subjectsrsquo characteristics are reported in Table 1

The research protocol was in accordance with the ethicalrequirements of the Helsinki Declaration and was approvedbyEthical Committee of PoliclinicoUmberto I SapienzaUni-versity of Rome All subjects enrolled gave written informedconsent

22 Body Composition The anthropometric measurementswere taken following the procedures described in the anthro-pometric standardization referencemanual [25] Bodyweightwas measured to an accuracy of 01 kg through a standardcolumnbody scale (SECAHamburgGermany) Body heightwas determined using a rigid stadiometer (SECA HamburgGermany) to an accuracy of 01 cm BMI was calculated asbody weight in kgbody height in m2

Body composition (fat mass (FM) and fat-free mass(FFM)) was estimated by bioelectrical impedance analy-sis (BIA) The BIA measurement was performed on theright side of the body using 800-A and 50 kHz alternat-ing sinusoidal current and a standard tetrapolar technique(Body Impedance Assessment BIA 101 Impedance AnalyzerAKERN Florence Italy) Fat-free mass index (FFMI) wascalculated as FFM in kg(body height in m2)

23 Diagnosis of Obesity and Sarcopenia Obesity in thisfemale population was diagnosed as increased fat mass by35 Sarcopenia was diagnosed according to the definition bythe EuropeanWorking Group on Sarcopenia in Older People(EWGSOP) considering the reduction of muscle mass theimpairment of muscle strength and physical performance[17] FFM was considered depleted if a patientrsquos fat-freemass (FFM) was lt90 of their ideal FFM (iFFM) IdealFFM was calculated in kg as the sum of 75 of ideal bodyweight 25 of overweight as expressed by a BMI gt25 kgm2considering that excess body weight includes not only bodyfat but also a certain amount of muscle mass [26] Abdominalfat was evaluated and characterized by DEXA as previouslydescribed elsewhere [27 28]

24 Cell Culture Human SAOS-2 osteoblastic cells werecultured in Dulbeccorsquos modified Eaglersquos medium (DMEM)supplemented with 2mM L-glutamine 100UmL peni-cillinstreptomycin 10 fetal bovine serum (FBS) at 37∘Cand 5 CO

2in a humidified incubator All buffers media

and reagents were purchased from Euroclone For patientssera treatments cells were grown up to 70 confluencestarved overnight in a medium serum-free and then incu-bated 24 hrs with medium supplemented with 20 patientserum For RNA extraction and quantitative real-time eval-uation cells were treated with serum of single patientswhereas for protein extraction andWestern blot analysis andfor immunofluorescence experiments growing media weresupplemented with a pull of sera of the same group

25 RNA Isolation and Quantitative Real-Time PCR ForRNA extraction cells were washed twice with 1X phos-phate buffer saline (PBS Euroclone) and total RNA wasimmediately isolated with Ambion RNAmini KIT (AmbionLife Technologies) according themanufacturerrsquos instructionsThe purity and integrity of total RNA were monitored byelectrophoretic analysis on denaturating agarose gel ultra-violet spectrophotometry (Biorad) was used for RNA yieldevaluation Total RNA was treated as previously described[29] Quantitative real-time PCRwas performed inAbi Prism7500 light cycler (Applied Biosystem) using Power SYBR

International Journal of Endocrinology 3

Table 1 Anthropometric data of the subjects involved in the study

CTL(10)

O(31)

OO(9)

OS(36)

OSO(15)

Mean age 434 plusmn 105 490 plusmn 100 620 plusmn 90 497 plusmn 132 620 plusmn 110BMI 233 plusmn 167 379 plusmn 592 356 plusmn 80 385 plusmn 77 342 plusmn 49CTL control group O obese subjects OO osteoporotic obese subjects OS sarcopenic obese subjects OSO sarcopenic osteoporotic obese subjects Data areexpressed as mean plusmn standard deviation

Table 2 Primers used in the experimental conditions

Gene Accession number Forward primer Reverse primerBALP NM000478 GGCTCCAGGGATAAAGCAGGT AGTGTCTCTTGCGCTTGGTCTOsteocalcin NM199173 ATGAGAGCCCTCACACTCCTCG GTCAGCCAACTCGTCACAGTCCRUNX2 NM001024630 TTCTGCCTCTGGCCTTCCAC TGGAGAAGCGGCTCTCAGTGBMP4 NM001202 GCTTGTCTCCCCGATGGGATT CTCGGGATGGCACTACGGAAOPN NM0012518301 GCAGACCTGACATCCAGTACC GATGGCCTTGTATGCACCATTCcMyc NM0024674 TTCTCTCCGTCCTCGGATTCT TTGTTCCTCCTCAGAGTCGCTAxin2 NM0046553 GACAGGTCGCAGGATGTCTG TGTGCTTTGGGCACTATGGGCyclophilin NM021130 GTCAACCCCACCGTGTTCTT CTGCTGTCTTTGGGACCTTGT

Green PCR Master Mix (Applied Biosystem) as indicatedby manufacturer All primers were optimized as previouslydescribed [29] Quantitative RT-PCR sample value was nor-malized for the expression of cyclophilin mRNAThe relativelevel for each gene was calculated using the 2minusΔΔCt method[30] and reported as arbitrary units In all experiments eachsample was analyzed in duplicate Sequences of primers aregiven in Table 2

26 Protein Extraction and Western Blot Analysis Total pro-teins were extracted as previously described [29] Twentymicrograms protein samples were separated in an SDS-polyacrylamide gel and transferred to a nitrocellulose mem-brane Transfer was verified by Ponceau S staining Themembrane was blocked 60min at room temperature with5 nonfat dry milk (Cell Signaling) in T-TBS (tris-bufferedsaline plus Tween 20 001) Primary anti-LEF-1 anti-TCF-1anti-c-myc anti 120573-catenin anti-GSK3120573 Ser9-phosphorilatedanti-totalGSK3120573 and 120573-actin antibodies diluted as indicatedby manufacturers were added overnight at 4∘C The mem-brane was washed three times with T-TBS and incubatedfor 601015840 at room temperature with HRP-labeled anti-rabbit oranti-mouse in 5 nonfat dry milk The membrane was thenwashed three times and antibodies were visualized using ECLPrime Western Blotting Detection Reagent (GE Healthcare)Quantitative analysis was performed using Imagequant TLImage analysis software (GE Healthcare) sample value wasnormalized for housekeeping gene 120573-actin and was reportedas arbitrary units All antibodies were purchased by CellSignaling

27 Immunofluorescence For immunofluorescence (IF) anal-ysis cells were rinsed twice with cold PBS fixed with 4paraformaldehyde 151015840 at room temperature rinsed threetimes with PBS permeabilized by incubation in 02 Tritonin 3 bovine serum albumin (BSA) and rinsed accurately in

PBS Cells were incubated in blocking solution (6 ngmL IgGfrom goat serum in PBS) for 301015840 at room temperature and fur-ther incubated with anti-120573-catenin (Cell Signaling) 1 200 inPBS overnight at 4∘CAfter threewashes cells were incubatedwith 1 500 anti-mouse Alexa Fluor (Molecular Probes) in thedark 451015840 at room temperature Cells were rinsed three timeswith PBS and slides were mounted with 70 glycerol in PBSImages were acquired by Nikon Eclipse 600 microscope andNikon CCD camera at 20x magnification

28 Statistical Analysis Data are expressed as means plusmn SEStatistical significance between data points was determinedusing the two-tailed Studentrsquos 119905-test A 119875 lt 005 was conven-tionally considered statistically significant

3 Results

31 Patients Characteristics Patients were characterizedfor anthropometric measurements BMD muscle mass asdescribed in Section 2 Characteristics of different groups ofsubjects are depicted in Table 1 and described elsewhere [27]Patients were similar for both age and body weight as alsodescribed elsewhere [27]

32 Bone Cell Regulatory Factors in the Sera No differenceswere found in hormones levels [27] beside a significantdecrease of Vit D levels as previously published [23 27] Toassess whether the sera of obese patients showed any alteredbalance of factors potentially affecting bone turnover wecollected sera of all subjects to culture cells and characterizemodulation induced in osteoblasts activity in vitro

33 Osteoblast Activity and Differentiation To determinepotential effects of the sera from obese patients on osteoblasthomeostasis cells were incubated with the sera of obesesubjects to assess effect on cell differentiation and activity

4 International Journal of Endocrinology

25

20

15

10

05

00

CTL O OO OS OOS

lowastlowast lowast

Rela

tive R

unx2

mRN

A le

vel

(a)

20

15

10

05

00

Rela

tive B

MP4

mRN

A le

vel

sect

sect

CTL O OO OS OOS

lowast

lowast

(b)

CTL O OO OS OOS

lowast

lowast

lowastlowast

30

25

20

15

10

05

00

Relat

ive B

ALP

mRN

A le

vel

(c)

15

10

05

00Relat

ive o

steoc

alci

n m

RNA

leve

l

CTL O OO OS OOS

lowast

(d)

20

15

10

05

00

Relat

ive o

steop

ontin

mRN

A le

vel

CTL O OO OS OOS

lowastlowastlowast

lowast

(e)

Figure 1 Expression of (a) Runx2 (b) BMP4 (c) ALP bone isoform d (d) osteocalcin (OCN) and (e) osteopontin (OPN) in osteoblasts asmeasured by quantitative real-time PCR Cells were grown in presence of sera from healthy normal body weight control individuals (CTL)obese patients (O) obese osteopenic patients (OO) obese sarcopenic patients (OS) obese sarcopenic osteopenic patients (OSO) as describedin Section 2 Differences were considered significantly different when a 119875 lt 005 was obtained lowast119875 lt 005 versus CTL sect

119875 lt 005 versus O

Osteoblasts were cultured 24 hrs in presence of the seraobtained from individuals of the different experimentalgroups after which total RNA was extracted and quantitativeRT-PCR performed to evaluate specific genes Expressionof Runx2 an essential transcription factor expressed duringbone formation and osteoblast differentiation was decreasedin all experimental group except that in the OS (119875 lt 005Figure 1(a)) while BMP4 mRNA expression was significantlydecreased in cells grown in the sera of osteopenic patients(both OO and OOS) (119875 lt 005 Figure 1(b)) The expressionof BALP mRNA was significantly decreased in cells grownwith the sera of all groups of obese patients compared to

CTL (119875 lt 005 Figure 1(c)) demonstrating an impairmentof osteoblast activity Interestingly the expression of oste-ocalcin the most important noncollagenic bone matrixprotein was significantly decreased only in cells exposedto sera of OO patients (P lt 005 Figure 1(d)) stronglysuggesting that the presence of different amount of muscleand adipose tissues can differently interfere with osteoblastbiology Finally the expression of osteopontin (OPN) ahighly phosphorylated bone matrix sialoprotein [31ndash35] wasalso significantly inhibited in osteoblasts incubated withsera of all groups of obese patients as compared to CTL(Figure 1(e) 119875 lt 005)

International Journal of Endocrinology 5

34 Wnt Targets mRNAProtein The following series ofexperiments were focused to further characterize the molec-ular mechanism(s) of action of the observed alteration ofosteoblast homeostasis The canonical Wnt120573-catenin path-way is essential for proliferation and survival of osteoblasts[36] When the canonical Wnt ligands (ie Wnt1 3a and 8)bind to the cell-surface receptors the intracellular proteindisheveled (Dvl) is phosphorylated activating a cascade ofintracellular events linked to themodulation of specific targetgenes expression [37 38]

Thus to evaluate whether canonicalWnt120573-catenin path-waywas involved in the osteoblastic gene expressionmodula-tion exerted by obese sera expressions of some specific targetgenes were evaluated by quantitative RT-PCR and Westernblot analysis Osteoblasts were grown and exposed to thehuman sera for 24 hrs as described above Expression of cMycand axin2 decreased in osteoblasts incubated in the presenceof sera of O patients compared to CTL (119875 lt 005) as shownin Figure 2 Likewise the decrease of specific target geneexpression was further confirmed by a reduction of proteinexpression of cMyc LEF CD44 and TCF1 as shown inFigures 3(a) and 3(b)

In particular Wnt pathway inhibition was most sig-nificantly induced by exposure of cells to the sera of OSpatients (CD44 inhibition almost 50) as compared to theother groups strongly indicating complex mechanism(s)underlying skeleton homeostasis in obese and sarcopenicsubjects

The expression of LEF1 protein was not significantlyaffected in cells exposed to the patients sera whereas LEF1-ΔNwas strongly inhibited in cells exposed to all obese groups(Figures 3(a) and 3(b))

To further investigate the potential mechanisms by whichpatientrsquos sera modulate the Wnt120573-catenin pathway GSK3120573a component of the 120573-catenin destruction complex andnegative regulator of the Wnt pathway was analyzed Inparticular we checked both by Western blotting analysisphosphorylation at Ser-9 which inactivates GSK3120573 [39] andby immunofluorescence 120573-catenin nuclear translocation Astrong decrease of a ratio GSK3120573-Ser9total GSK3120573 wasobserved in osteoblasts upon exposure to the sera of allobese subjects (Figures 4(a) and 4(b)) demonstrating that thecanonical 120573-catenin pathway is inactivated by the presenceof nonphosphorylated (then active) GSK3120573 and normalregulation within cells disrupted by obese subjects seraAccordingly total 120573-catenin amount is decreased showingthat protein is tagged for proteasomal degradation Sincenuclear localization of 120573-catenin is used as a marker ofenhanced Wnt signaling as expected immunofluorescenceanalysis demonstrated a cytoplasmic localization of120573-cateninin osteoblasts exposed to the sera of all obese subjects(Figure 5)

Taken together these in vitro data showing the inhibitionof canonical Wnt120573-catenin pathway indicate that this signaltransduction pathway is likely the intracellular signalinginvolved in the impairment of osteoblastic differentiation andactivity exerted by obese sera

4 Discussion

Our results demonstrate for the first time that the sera ofobese osteoporotic andor obese sarcopenic subjects caninduce significant alterations in osteoblast homeostasis dueto disruption in the Wnt120573-catenin differentiation-linkedmolecular pathway In particular sera of obese subjects bluntthe canonical Wnt120573-catenin pathway inducing a downreg-ulation of specific target genes with a consequent alteredosteoblast differentiation and activity pattern

Despite being a risk factor for cardiovascular andmetabolic disease for a long time obesity has been thoughtto protect against osteoporosis [3 4] due to stresses frommechanical loading and from metabolic effects of estrogenichormones secreted by adipocytes for testosterone aromati-zation [40] However recently our group and others havedemonstrated that increased visceral fat has negative effectson skeletal tissue health [7 17 27] indicating that furtherinvestigations were required to understand the complexinteractions between bone and adipose tissue Further recentevidences in healthy premenopausal women demonstratedthat higher trunk fat mass was associated with inferior bonequality as evidenced by markedly lower trabecular bonevolume fraction fewer and thinner trabeculae lower trabec-ular stiffness and higher cortical porosity [41] Moreover thesame study indicated that higher trunk fat mass is associatedwith higher bone marrow fat lower trabecular bone volumefraction and decreased bone formation in vivo [41] Ourresults support the role of an altered bone formation in theskeletal alterations observed in obese subjects and furtheremphasize that the mechanism(s) of action underlying theobserved alterations is likely due to a damaged pattern ofosteoblastic differentiation which impairs cell activity Inaddition muscle mass appears to play a role in the interplaybetween adipose and bone tissue likely bymechanical stimuliand also by myokines and other factors secretion [42]Indeed muscle is also source of IGF-1 known to be one ofthe factors which cooperate in the maintenance of skeletalhealth [43] In addition lower levels of IGF-1 [27 41] havebeen found in obese individuals (unpublished observation)and IGF-1 might play a pivotal role in the mechanismlinking obesity to decreased bone density and bone quality[41] by mechanism due to altered osteoblast homeostasisIndeed the recent in vivo results showing a weak increasein osteoclastogenic factors go against the hypothesis thatproduction of adipokines and inflammatory cytokines byadipose tissue lead to an increased bone resorption inducinga decrease in bone volume [28 44]

More interestingly we demonstrated that obesity inducesdetrimental effect on osteoblasts differentiation activity sug-gesting that both bone resorption and bone formation aredisrupted in obese patients In particular Runx2 whichbelongs to the RUNX family is an essential transcriptionfactor expressed during bone formation and osteoblast pro-liferation and differentiation and the blunted levels observedupon obese sera exposure further prove the osteoblast differ-entiation disruption [45]Moreover the decreased expressionof all the osteoblastogenic differentiation and activitymarkersdemonstrate the decreased osteoblast activity which further

6 International Journal of Endocrinology

CTL O OO OS OOS

lowast

lowast

lowastlowast

25

20

15

10

05

00

Relat

ive c

Myc

mRN

A le

vel

(a)

lowastlowastlowast

lowast

CTL O OO OS OOS

60

50

40

30

20

10

00

Relat

ive m

RNA

Axi

n2le

vel

(b)

Figure 2 Expression of (a) cMyc and (b) Axin2 in osteoblasts grown as described in Figure 1 Differences were considered significantlydifferent when a 119875 lt 005 was obtained lowast119875 lt 005 versus CTL sect

119875 lt 005 versus O

lowast

lowast

1201101009080706050403020100Re

lativ

e CD44

prot

ein

amou

nt

CD44

120573-Actin

CTL O OO OS OOS

CTL O OO OS OOS

(a)

lowastlowastlowast

CTL O OO OS OOS

CTL O OO OS OOS

120

100

80

60

40

20

0Rela

tive T

CF-1

prot

ein

amou

nt

TCF-1

120573-Actin

(b)

lowast

lowastlowastlowast

CTL O OO OS OOS

CTL O OO OS OOS

1201101009080706050403020100

Rela

tive L

EF-1Δ

N p

rote

in am

ount

LEF-1LEF-1 ΔN

120573-Actin

(c)

lowast

lowast

lowastlowast

CTL O OO OS OOS

CTL O OO OS OOS

Relat

ive c

Myc

pro

tein

amou

nt 1201101009080706050403020100

cMyc

120573-Actin

(d)

Figure 3Western blot analysis ofWnt target genes protein expression (a) CD44 (b) TCF-1 (c) LEF-1ΔN and (d) cMyc in Saos-2 osteoblasticcells grown as described in Figure 1 In each panel upper row is the target gene and lower panel is loading control (120573actin) Graph depictsprotein quantification from Western blot evaluation Bars represent mean plusmn SE of three different independent experiments performed induplicate lowast119875 lt 005 versus CTL sect

119875 lt 005 versus O

International Journal of Endocrinology 7

CTL O OO OS OOS

lowastlowast

lowastlowast

1201101009080706050403020100

GSK3120573-Ser9

Total GSK3120573

120573-Actin

Rela

tive G

SK3120573

Ser9

GSK3120573

tota

l pro

tein

amou

nt

(a)

lowast lowast

lowast

120573-Catenin

120573-Actin

CTL O OO OS OOS

1201101009080706050403020100

Rela

tive t

otal120573

-cat

enin

prot

ein

amou

nt

(b)

Figure 4 Western blot analysis of Wnt120573catenin pathway modulation Expression of GSK3120573Ser9 (upper panel (a)) and total (middle panel(a)) and total 120573catenin (upper panel (b)) were evaluated in osteoblasts grown as described in Figure 1 Lower panel is the loading control(120573actin) Quantifications of the data obtained from Western blot analysis are depicted in the graphs Bars represent mean plusmn SE of threedifferent independent experiments performed in duplicate lowast119875 lt 005 versus CTL sect

119875 lt 005 versus O

+Wnt3a Ctl

DAPI

120573-Catenin

O OO OS OOS

DAPI

120573-Catenin

Figure 5 Characterization of 120573-catenin localization by immunofluorescence analysis in osteoblastic cells grown as described in Figure 1 Arepresentative experiment of the three performed is shown in the figure Magnification 40x

8 International Journal of Endocrinology

support the previously observed bone formation markersalteration in obese patients in vivo [41]

Wnt signaling pathway has emerged as a critical reg-ulatory component of the control of bone formation andbone resorption [46] When the canonical Wnt ligands(ie Wnt1 3a and 8) bind to the cell-surface receptorsthe intracellular protein disheveled (Dvl) is phosphorylatedinhibiting GSK3120573 from phosphorylating 120573-catenin in thecytoplasm As result 120573-catenin is stabilized and translocatedinto the nucleuswhere it establishes a transcriptional complexwith T-cell factor (Tcf)lymphoid enhancer-binding factor(Lef) to regulate expression of target genes [37 38] Ourdata demonstrate that canonical Wnt120573-catenin pathway isone of the molecular intracellular pathways involved in thegene expression modulation disrupted in the osteoblastsexposed to obese sera Indeed GSK3120573 a key modulator of 120573-catenin activity is repressed by phosphorylation at ser-9 andconsequently 120573-catenin is slightly detectable and only in thecytoplasm As a consequence the 120573-catenin target genes aredownmodulated and osteoblast differentiation and activitydisrupted

In regards of the Wnt molecular pathway an interestingresult is linked to the evaluation and characterization ofLef1 modulation Lef1 contains two promoters that driveexpression of a full-length protein (Lef1) and anN-terminallytruncated isoform (Lef1-ΔN) Lef1 overexpression inhibitsosteoblast maturation and Runx2 activity on the osteocalcinpromoter in vitro [47 48] but Lef1ΔN had the oppositeeffect [49] Lef1-ΔN is present in mature osteoblasts anddespite the absence of the N-terminal high affinity 120573-cateninbinding domain retains the ability to weakly interact with 120573-catenin via second domain and to promote osteogenesis [50]Interestingly the sera of obese subjects can significantly bluntexpression of Lef1-ΔN strongly indicating an inhibition ofosteoblast differentiation by an alteration of such molecularintracellular pathway

MoreoverWnt interacts with other signaling pathways inthe bone cellular environment One of these signals IGF-1enhances stabilization of 120573-catenin triggering the molecularmechanism(s) leading to an increase of osteoblast differenti-ation and activity Obesity is associated with decreased GHsecretion and IGF-1 deficiency is associated with increasedabdominal adipose tissue accumulation decreased BMD [2742] and increased fracture risk as demonstrated by ours andother groups [41]

We understand that a limitation of our work is due to thefact that we have chosen a clonal osteoblastic cell line as our invitromodel system However it is well known that molecularor cellular mechanism(s) described in cellular model systemis usually confirmed in primary cell lines which we areevaluating as well

Thus our in vitro results further point out for a centralrole of IGF-1 and osteoblasts disruption in the mechanismslinking obesity to decreased bone quality

Indeed these results lead to the suggestive hypothesisthat lower levels of IGF-1 in subjects affected by an increasedabdominal adipose tissue accumulation could contribute tothe blunted levels of 120573-catenin signaling in the osteoblasts

leading to a disruption of normal differentiation pathwayFurther investigations are needed to clarify and characterizethe complex link between adipose-bone and muscle tissuesand identify other potentially involved molecules besideIGF-1 linked to the observed alteredWnt120573-catenin pathway

Conflict of Interests

The authors declare that there is no conflict of interests thatcould prejudice the impartiality of the research reportedFrancesca Wannenes was supported by an ELI Lilly grant

Authorsrsquo Contribution

Francesca Wannenes and Vincenza Papa contributed equallyin the paper Francesca Wannenes designed the studyproduced and analyzed the in vitro data contributed tothe interpretation wrote the paper and contributed to thediscussion Vincenza Papa produced and analyzed the invitro data and contributed to the discussion Emanuela AGreco Rachele Fornari Chiara Marocco and Eleonora Pog-giogalle recruited and evaluated patients and contributed tothe interpretation and discussion Gian Pietro EmerenzianiCarlo Baldari and Laura Guidetti analyzed data contributedto the interpretation and discussion and reviewed the paperLuigi Di Luigi contributed to the discussion and reviewed thepaper Lorenzo M Donini designed the study contributedto interpretation and discussion and reviewed the paperAndrea Lenzi designed the study and reviewed the paperSilvia Migliaccio designed the study recruited patients ana-lyzed the in vitro data contributed to the interpretation andwrote the paper

Acknowledgments

Research was funded by PRIN 2009-2009KENS9K 004 to LGuidetti PRIN 2011 052013 to S Migliaccio PON 01 00829to A Lenzi

References

[1] S Rossner ldquoObesity the disease of the twenty-first centuryrdquoInternational Journal ofObesity andRelatedMetabolicDisordersvol 26 supplement 4 pp S2ndashS4 2002

[2] NIH Consensus Development Panel on Osteoporosis Pre-vention Diagnosis and Therapy ldquoOsteoporosis preventiondiagnosis and therapyrdquo The Journal of the American MedicalAssociation vol 285 no 6 pp 785ndash795 2001

[3] D T Felson Y ZhangMTHannan and J J Anderson ldquoEffectsof weight and body mass index on bone mineral density inmen and women the Framingham studyrdquo Journal of Bone andMineral Research vol 8 no 5 pp 567ndash573 1993

[4] C Albala M Yanez E Devoto C Sostin L Zeballos and JL Santos ldquoObesity as a protective factor for postmenopausalosteoporosisrdquo International Journal of Obesity and RelatedMetabolic Disorders vol 20 pp 1027ndash1032 1996

[5] P J Ehrlich and L E Lanyon ldquoMechanical strain and bone cellfunction a reviewrdquo Osteoporosis International vol 13 no 9 pp688ndash700 2002

International Journal of Endocrinology 7

CTL O OO OS OOS

lowastlowast

lowastlowast

1201101009080706050403020100

GSK3120573-Ser9

Total GSK3120573

120573-Actin

Rela

tive G

SK3120573

Ser9

GSK3120573

tota

l pro

tein

amou

nt

(a)

lowast lowast

lowast

120573-Catenin

120573-Actin

CTL O OO OS OOS

1201101009080706050403020100

Rela

tive t

otal120573

-cat

enin

prot

ein

amou

nt

(b)

Figure 4 Western blot analysis of Wnt120573catenin pathway modulation Expression of GSK3120573Ser9 (upper panel (a)) and total (middle panel(a)) and total 120573catenin (upper panel (b)) were evaluated in osteoblasts grown as described in Figure 1 Lower panel is the loading control(120573actin) Quantifications of the data obtained from Western blot analysis are depicted in the graphs Bars represent mean plusmn SE of threedifferent independent experiments performed in duplicate lowast119875 lt 005 versus CTL sect

119875 lt 005 versus O

+Wnt3a Ctl

DAPI

120573-Catenin

O OO OS OOS

DAPI

120573-Catenin

Figure 5 Characterization of 120573-catenin localization by immunofluorescence analysis in osteoblastic cells grown as described in Figure 1 Arepresentative experiment of the three performed is shown in the figure Magnification 40x

8 International Journal of Endocrinology

support the previously observed bone formation markersalteration in obese patients in vivo [41]

Wnt signaling pathway has emerged as a critical reg-ulatory component of the control of bone formation andbone resorption [46] When the canonical Wnt ligands(ie Wnt1 3a and 8) bind to the cell-surface receptorsthe intracellular protein disheveled (Dvl) is phosphorylatedinhibiting GSK3120573 from phosphorylating 120573-catenin in thecytoplasm As result 120573-catenin is stabilized and translocatedinto the nucleuswhere it establishes a transcriptional complexwith T-cell factor (Tcf)lymphoid enhancer-binding factor(Lef) to regulate expression of target genes [37 38] Ourdata demonstrate that canonical Wnt120573-catenin pathway isone of the molecular intracellular pathways involved in thegene expression modulation disrupted in the osteoblastsexposed to obese sera Indeed GSK3120573 a key modulator of 120573-catenin activity is repressed by phosphorylation at ser-9 andconsequently 120573-catenin is slightly detectable and only in thecytoplasm As a consequence the 120573-catenin target genes aredownmodulated and osteoblast differentiation and activitydisrupted

In regards of the Wnt molecular pathway an interestingresult is linked to the evaluation and characterization ofLef1 modulation Lef1 contains two promoters that driveexpression of a full-length protein (Lef1) and anN-terminallytruncated isoform (Lef1-ΔN) Lef1 overexpression inhibitsosteoblast maturation and Runx2 activity on the osteocalcinpromoter in vitro [47 48] but Lef1ΔN had the oppositeeffect [49] Lef1-ΔN is present in mature osteoblasts anddespite the absence of the N-terminal high affinity 120573-cateninbinding domain retains the ability to weakly interact with 120573-catenin via second domain and to promote osteogenesis [50]Interestingly the sera of obese subjects can significantly bluntexpression of Lef1-ΔN strongly indicating an inhibition ofosteoblast differentiation by an alteration of such molecularintracellular pathway

MoreoverWnt interacts with other signaling pathways inthe bone cellular environment One of these signals IGF-1enhances stabilization of 120573-catenin triggering the molecularmechanism(s) leading to an increase of osteoblast differenti-ation and activity Obesity is associated with decreased GHsecretion and IGF-1 deficiency is associated with increasedabdominal adipose tissue accumulation decreased BMD [2742] and increased fracture risk as demonstrated by ours andother groups [41]

We understand that a limitation of our work is due to thefact that we have chosen a clonal osteoblastic cell line as our invitromodel system However it is well known that molecularor cellular mechanism(s) described in cellular model systemis usually confirmed in primary cell lines which we areevaluating as well

Thus our in vitro results further point out for a centralrole of IGF-1 and osteoblasts disruption in the mechanismslinking obesity to decreased bone quality

Indeed these results lead to the suggestive hypothesisthat lower levels of IGF-1 in subjects affected by an increasedabdominal adipose tissue accumulation could contribute tothe blunted levels of 120573-catenin signaling in the osteoblasts

leading to a disruption of normal differentiation pathwayFurther investigations are needed to clarify and characterizethe complex link between adipose-bone and muscle tissuesand identify other potentially involved molecules besideIGF-1 linked to the observed alteredWnt120573-catenin pathway

Conflict of Interests

The authors declare that there is no conflict of interests thatcould prejudice the impartiality of the research reportedFrancesca Wannenes was supported by an ELI Lilly grant

Authorsrsquo Contribution

Francesca Wannenes and Vincenza Papa contributed equallyin the paper Francesca Wannenes designed the studyproduced and analyzed the in vitro data contributed tothe interpretation wrote the paper and contributed to thediscussion Vincenza Papa produced and analyzed the invitro data and contributed to the discussion Emanuela AGreco Rachele Fornari Chiara Marocco and Eleonora Pog-giogalle recruited and evaluated patients and contributed tothe interpretation and discussion Gian Pietro EmerenzianiCarlo Baldari and Laura Guidetti analyzed data contributedto the interpretation and discussion and reviewed the paperLuigi Di Luigi contributed to the discussion and reviewed thepaper Lorenzo M Donini designed the study contributedto interpretation and discussion and reviewed the paperAndrea Lenzi designed the study and reviewed the paperSilvia Migliaccio designed the study recruited patients ana-lyzed the in vitro data contributed to the interpretation andwrote the paper

Acknowledgments

Research was funded by PRIN 2009-2009KENS9K 004 to LGuidetti PRIN 2011 052013 to S Migliaccio PON 01 00829to A Lenzi

References

[1] S Rossner ldquoObesity the disease of the twenty-first centuryrdquoInternational Journal ofObesity andRelatedMetabolicDisordersvol 26 supplement 4 pp S2ndashS4 2002

[2] NIH Consensus Development Panel on Osteoporosis Pre-vention Diagnosis and Therapy ldquoOsteoporosis preventiondiagnosis and therapyrdquo The Journal of the American MedicalAssociation vol 285 no 6 pp 785ndash795 2001

[3] D T Felson Y ZhangMTHannan and J J Anderson ldquoEffectsof weight and body mass index on bone mineral density inmen and women the Framingham studyrdquo Journal of Bone andMineral Research vol 8 no 5 pp 567ndash573 1993

[4] C Albala M Yanez E Devoto C Sostin L Zeballos and JL Santos ldquoObesity as a protective factor for postmenopausalosteoporosisrdquo International Journal of Obesity and RelatedMetabolic Disorders vol 20 pp 1027ndash1032 1996

[5] P J Ehrlich and L E Lanyon ldquoMechanical strain and bone cellfunction a reviewrdquo Osteoporosis International vol 13 no 9 pp688ndash700 2002

8 International Journal of Endocrinology

support the previously observed bone formation markersalteration in obese patients in vivo [41]

Wnt signaling pathway has emerged as a critical reg-ulatory component of the control of bone formation andbone resorption [46] When the canonical Wnt ligands(ie Wnt1 3a and 8) bind to the cell-surface receptorsthe intracellular protein disheveled (Dvl) is phosphorylatedinhibiting GSK3120573 from phosphorylating 120573-catenin in thecytoplasm As result 120573-catenin is stabilized and translocatedinto the nucleuswhere it establishes a transcriptional complexwith T-cell factor (Tcf)lymphoid enhancer-binding factor(Lef) to regulate expression of target genes [37 38] Ourdata demonstrate that canonical Wnt120573-catenin pathway isone of the molecular intracellular pathways involved in thegene expression modulation disrupted in the osteoblastsexposed to obese sera Indeed GSK3120573 a key modulator of 120573-catenin activity is repressed by phosphorylation at ser-9 andconsequently 120573-catenin is slightly detectable and only in thecytoplasm As a consequence the 120573-catenin target genes aredownmodulated and osteoblast differentiation and activitydisrupted

In regards of the Wnt molecular pathway an interestingresult is linked to the evaluation and characterization ofLef1 modulation Lef1 contains two promoters that driveexpression of a full-length protein (Lef1) and anN-terminallytruncated isoform (Lef1-ΔN) Lef1 overexpression inhibitsosteoblast maturation and Runx2 activity on the osteocalcinpromoter in vitro [47 48] but Lef1ΔN had the oppositeeffect [49] Lef1-ΔN is present in mature osteoblasts anddespite the absence of the N-terminal high affinity 120573-cateninbinding domain retains the ability to weakly interact with 120573-catenin via second domain and to promote osteogenesis [50]Interestingly the sera of obese subjects can significantly bluntexpression of Lef1-ΔN strongly indicating an inhibition ofosteoblast differentiation by an alteration of such molecularintracellular pathway

MoreoverWnt interacts with other signaling pathways inthe bone cellular environment One of these signals IGF-1enhances stabilization of 120573-catenin triggering the molecularmechanism(s) leading to an increase of osteoblast differenti-ation and activity Obesity is associated with decreased GHsecretion and IGF-1 deficiency is associated with increasedabdominal adipose tissue accumulation decreased BMD [2742] and increased fracture risk as demonstrated by ours andother groups [41]

We understand that a limitation of our work is due to thefact that we have chosen a clonal osteoblastic cell line as our invitromodel system However it is well known that molecularor cellular mechanism(s) described in cellular model systemis usually confirmed in primary cell lines which we areevaluating as well

Thus our in vitro results further point out for a centralrole of IGF-1 and osteoblasts disruption in the mechanismslinking obesity to decreased bone quality

Indeed these results lead to the suggestive hypothesisthat lower levels of IGF-1 in subjects affected by an increasedabdominal adipose tissue accumulation could contribute tothe blunted levels of 120573-catenin signaling in the osteoblasts

leading to a disruption of normal differentiation pathwayFurther investigations are needed to clarify and characterizethe complex link between adipose-bone and muscle tissuesand identify other potentially involved molecules besideIGF-1 linked to the observed alteredWnt120573-catenin pathway

Conflict of Interests

The authors declare that there is no conflict of interests thatcould prejudice the impartiality of the research reportedFrancesca Wannenes was supported by an ELI Lilly grant

Authorsrsquo Contribution

Francesca Wannenes and Vincenza Papa contributed equallyin the paper Francesca Wannenes designed the studyproduced and analyzed the in vitro data contributed tothe interpretation wrote the paper and contributed to thediscussion Vincenza Papa produced and analyzed the invitro data and contributed to the discussion Emanuela AGreco Rachele Fornari Chiara Marocco and Eleonora Pog-giogalle recruited and evaluated patients and contributed tothe interpretation and discussion Gian Pietro EmerenzianiCarlo Baldari and Laura Guidetti analyzed data contributedto the interpretation and discussion and reviewed the paperLuigi Di Luigi contributed to the discussion and reviewed thepaper Lorenzo M Donini designed the study contributedto interpretation and discussion and reviewed the paperAndrea Lenzi designed the study and reviewed the paperSilvia Migliaccio designed the study recruited patients ana-lyzed the in vitro data contributed to the interpretation andwrote the paper

Acknowledgments

Research was funded by PRIN 2009-2009KENS9K 004 to LGuidetti PRIN 2011 052013 to S Migliaccio PON 01 00829to A Lenzi

References

[1] S Rossner ldquoObesity the disease of the twenty-first centuryrdquoInternational Journal ofObesity andRelatedMetabolicDisordersvol 26 supplement 4 pp S2ndashS4 2002

[2] NIH Consensus Development Panel on Osteoporosis Pre-vention Diagnosis and Therapy ldquoOsteoporosis preventiondiagnosis and therapyrdquo The Journal of the American MedicalAssociation vol 285 no 6 pp 785ndash795 2001

[3] D T Felson Y ZhangMTHannan and J J Anderson ldquoEffectsof weight and body mass index on bone mineral density inmen and women the Framingham studyrdquo Journal of Bone andMineral Research vol 8 no 5 pp 567ndash573 1993

[4] C Albala M Yanez E Devoto C Sostin L Zeballos and JL Santos ldquoObesity as a protective factor for postmenopausalosteoporosisrdquo International Journal of Obesity and RelatedMetabolic Disorders vol 20 pp 1027ndash1032 1996

[5] P J Ehrlich and L E Lanyon ldquoMechanical strain and bone cellfunction a reviewrdquo Osteoporosis International vol 13 no 9 pp688ndash700 2002

International Journal of Endocrinology 9

[6] M O Premaor L Pilbrow C Tonkin R A Parker and JCompston ldquoObesity and fractures in postmenopausal womenrdquoJournal of Bone andMineral Research vol 25 no 2 pp 292ndash2972010

[7] E A Greco R Fornari F Rossi et al ldquoIs obesity protective forosteoporosis Evaluation of bonemineral density in individualswith high body mass indexrdquo International Journal of ClinicalPractice vol 64 no 6 pp 817ndash820 2010

[8] K-C Kim D-H Shin S-Y Lee J-A Im and D-C Lee ldquoRela-tion between obesity and bone mineral density and vertebralfractures in Korean postmenopausal womenrdquo Yonsei MedicalJournal vol 51 no 6 pp 857ndash863 2010

[9] S Cinti ldquoThe adipose organ endocrine aspects and insightsfrom transgenic modelsrdquo Eating and Weight Disorders vol 6supplement no 3 pp 4ndash8 2001

[10] A D Attie and P E Scherer ldquoAdipocyte metabolism andobesityrdquo Journal of Lipid Research vol 50 supplement ppS395ndashS399 2009

[11] J Klein N Perwitz D Kraus and M Fasshauer ldquoAdiposetissue as source and target for novel therapiesrdquo Trends inEndocrinology and Metabolism vol 17 no 1 pp 26ndash32 2006

[12] J Gomez-Ambrosi A Rodrıguez V Catalan and G FruhbeckldquoThe bone-adipose axis in obesity and weight lossrdquo ObesitySurgery vol 18 no 9 pp 1134ndash1143 2008

[13] J M Gimble S Zvonic Z E Floyd M Kassem and ME Nuttall ldquoPlaying with bone and fatrdquo Journal of CellularBiochemistry vol 98 no 2 pp 251ndash266 2006

[14] E E Kershaw and J S Flier ldquoAdipose tissue as an endocrineorganrdquo Journal of Clinical Endocrinology and Metabolism vol89 no 6 pp 2548ndash2556 2004

[15] P Magni E Dozio E Galliera M Ruscica and M M CorsildquoMolecular aspects of adipokine-bone interactionsrdquo CurrentMolecular Medicine vol 10 no 6 pp 522ndash532 2010

[16] Y Rolland S Czerwinski G A van Kan et al ldquoSarcopeniaits assessment etiology pathogenesis consequences and futureperspectivesrdquo Journal of Nutrition Health and Aging vol 12 no7 pp 433ndash450 2008

[17] A J Cruz-Jentoft J P Baeyens J M Bauer et al ldquoSarcopeniaeuropean consensus on definition and diagnosisrdquo Age andAgeing vol 39 no 4 Article ID afq034 pp 412ndash423 2010

[18] S Migliaccio E A Greco R Fornari L M Donini and ALenzi ldquoIs obesity in women protective against osteoporosisrdquoDiabetes Metabolic Syndrome and Obesity vol 4 pp 273ndash2822011

[19] M Zaidi C Buettner L Sun and J Iqbal ldquoMinireview the linkbetween fat and bone does mass beget massrdquo Endocrinologyvol 153 no 5 pp 2070ndash2075 2012

[20] V Schwetz T Pieber and B Obermayer-Pietsch ldquoTheendocrine role of the skeleton background and clinicalevidencerdquo European Journal of Endocrinology vol 166 no 6pp 959ndash967 2012

[21] S Kaptoge S Kaptoge I R White et al ldquoAssociations ofplasma fibrinogen levels with established cardiovascular diseaserisk factors inflammatory markers and other characteristicsindividual participant meta-analysis of 154211 adults in 31prospective studiesrdquoTheAmerican Journal of Epidemiology vol166 no 8 pp 867ndash879 2007

[22] FW KieferM Zeyda J Todoric et al ldquoOsteopontin expressionin human and murine obesity extensive local up-regulation inadipose tissue butminimal systemic alterationsrdquoEndocrinologyvol 149 no 3 pp 1350ndash1357 2008

[23] J Wortsman L Y Matsuoka T C Chen Z Lu and M FHolick ldquoDecreased bioavailability of vitamin D in obesityrdquoTheAmerican Journal of Clinical Nutrition vol 72 no 3 pp 690ndash693 2000

[24] C A Lamendola D Ariel D Feldman and G M ReavenldquoRelations between obesity insulin resistance and 25-hydroxyvitamin DrdquoThe American Journal of Clinical Nutritionvol 95 no 5 pp 1055ndash1059 2012

[25] G A Bray Contemporary Diagnosis and Management of Obe-sity Handbooks in Health Care Newton PA USA 1998

[26] N G Norgan and J V G A Durnin ldquoThe effect of 6 weeks ofoverfeeding on the body weight body composition and energymetabolism of young menrdquo The American Journal of ClinicalNutrition vol 33 no 5 pp 978ndash988 1980

[27] E A Greco D Francomano R Fornari C Marocco CLubrano V Papa et al ldquoNegative association between trunk fatinsuline resistance and skeleton in obesewomenrdquoWorld Journalof Diabetes vol 4 no 2 pp 31ndash39 2013

[28] S Migliaccio D Francomano R Bruzziches et al ldquoTrunk fatnegatively influences skeletal and testicular functions in obesemen clinical implications for the aging malerdquo InternationalJournal of Endocrinology vol 2013 Article ID 182753 6 pages2013

[29] F Wannenes M Caprio L Gatta A Fabbri S Boniniand C Moretti ldquoAndrogen receptor expression during C2C12skeletal muscle cell line differentiationrdquoMolecular and CellularEndocrinology vol 292 no 1-2 pp 11ndash19 2008

[30] K J Livak T D Schmittgen et al ldquoAnalysis of relative geneexpression data using real-time quantitative PCR and the 2minus998779998779119862119905methodrdquoMethods vol 25 no 4 pp 402ndash408 2001

[31] D TDenhardt andXGuo ldquoOsteopontin a proteinwith diversefunctionsrdquoTheFESAB Journal vol 7 no 15 pp 1475ndash1482 1993

[32] J Sodek J Chen T Nagata et al ldquoRegulation of osteopontinexpression in osteoblastsrdquo Annals of the New York Academy ofSciences vol 760 pp 223ndash241 1995

[33] J Sodek B Ganss and M D McKee ldquoOsteopontinrdquo CriticalReviews in Oral Biology andMedicine vol 11 no 3 pp 279ndash3032000

[34] D Fodor C Bondor A Albu S P Simon A Craciun and LMuntean ldquoThe value of osteopontin in the assessment of bonemineral density status in postmenopausal womenrdquo Journal ofInvestigative Medicine vol 61 no 1 pp 15ndash21 2013

[35] M Boudiffa N M Wade-Gueye A Guignandon et al ldquoBonesialoprotein deficiency impairs osteoclastogenesis and mineralresorption in vitrordquo Journal of Bone and Mineral Research vol25 no 12 pp 2669ndash2679 2010

[36] J J Westendorf R A Kahler and T M Schroeder ldquoWntsignaling in osteoblasts and bone diseasesrdquo Gene vol 341 no1-2 pp 19ndash39 2004

[37] T P Rao and M Kuhl ldquoAn updated overview on wnt signalingpathways a prelude formorerdquoCirculation Research vol 106 no12 pp 1798ndash1806 2010

[38] B T MacDonald K Tamai and X He ldquoWnt120573-catenin sig-naling components mechanisms and diseasesrdquoDevelopmentalCell vol 17 no 1 pp 9ndash26 2009

[39] Y Schmitz K Rateitschak and O Wolkenhauer ldquoAnalysingthe impact of nucleo-cytoplasmic shuttling of 120573-catenin and itsantagonists APC Axin andGSK3 onWnt120573-catenin signallingrdquoCell Signal vol 25 no 11 pp 2210ndash2221 2013

[40] K O Klein K A Larmore E de Lancey J M Brown R VConsidine and S G Hassink ldquoEffect of obesity on estradiol

10 International Journal of Endocrinology

level and its relationship to leptin bone maturation and bonemineral density in childrenrdquo Journal of Clinical Endocrinologyand Metabolism vol 83 no 10 pp 3469ndash3475 1998

[41] A Cohen D W Dempster R R Recker J M Lappe H ZhouA Zwahlen et al ldquoAbdominal fat is associated with lower boneformation and inferior bone quality in healthy premenopausalwomen a transiliac bone biopsy studyrdquo Journal of ClinicalEndocrinology and Metabolism vol 98 no 6 pp 2562ndash25722013

[42] S Migliaccio F Wannenes A Lenzi and L Guidetti ldquoThemolecular and cellular basis of the effects of mechanical loadon the musculoskeletal systemrdquo Journal of Sports Medicine andPhysical Fitness vol 53 no 3 supplement 1 pp 1ndash5 2013

[43] S Yakar C J Rosen W G Beamer et al ldquoCirculating levelsof IGF-1 directly regulate bone growth and densityrdquo Journal ofClinical Investigation vol 110 no 6 pp 771ndash781 2002

[44] J J Cao ldquoEffects of obesity on bone metabolismrdquo Journal ofOrthopaedic Surgery and Research vol 15 pp 6ndash30 2011

[45] T Komori ldquoSignaling networks in RUNX2-dependent bonedevelopmentrdquo Journal of Cellular Biochemistry vol 112 no 3pp 750ndash755 2011

[46] E Canalis ldquoWnt signalling in osteoporosis mechanisms andnovel therapeutic approachesrdquo Nature Reviews Endocrinologyvol 9 no 10 pp 575ndash583 2013

[47] R A Kahler and J J Westendorf ldquoLymphoid enhancer factor-1 and 120573-catenin inhibit Runx2-dependent transcriptional acti-vation of the osteocalcin promoterrdquo The Journal of BiologicalChemistry vol 278 no 14 pp 11937ndash11944 2003

[48] R A Kahler M Galindo J Lian G S Stein A J van Wijnenand J J Westendorf ldquoLymphocyte enhancer-binding factor 1(Lef1) inhibits terminal differentiation of osteoblastsrdquo Journalof Cellular Biochemistry vol 97 no 5 pp 969ndash983 2006

[49] L H Hoeppner F Secreto E D Jensen X Li R A Kahlerand J J Westendorf ldquoRunx2 and bone morphogenic protein 2regulate the expression of an alternative lef1 transcript duringosteoblast maturationrdquo Journal of Cellular Physiology vol 221no 2 pp 480ndash489 2009

[50] L H Hoeppner F J Secreto D F Razidlo T JWhitney and J JWestendorf ldquoLef1ΔN binds 120573-catenin and increases osteoblastactivity and trabecular bone massrdquo The Journal of BiologicalChemistry vol 286 no 13 pp 10950ndash10959 2011