Liggett and David F. WieczorekBoivin, Dalia Urboniene, Grace M. Arteaga, Beata M. Wolska, R. John Solaro, Stephen B.

Sudarsan Rajan, Rafeeq P.H. Ahmed, Ganapathy Jagatheesan, Natalia Petrashevskaya, Greg P.Significantly Decreased Fractional Shortening and Myofilament Calcium Sensitivity

Dilated Cardiomyopathy Mutant Tropomyosin Mice Develop Cardiac Dysfunction With

Print ISSN: 0009-7330. Online ISSN: 1524-4571 Copyright © 2007 American Heart Association, Inc. All rights reserved.is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231Circulation Research

doi: 10.1161/CIRCRESAHA.107.1483792007;101:205-214; originally published online June 7, 2007;Circ Res. 

http://circres.ahajournals.org/content/101/2/205World Wide Web at:

The online version of this article, along with updated information and services, is located on the

http://circres.ahajournals.org/content/101/6/e80.full.pdfAn erratum has been published regarding this article. Please see the attached page for: 

http://circres.ahajournals.org/content/suppl/2007/06/07/CIRCRESAHA.107.148379.DC1.htmlData Supplement (unedited) at:

  http://circres.ahajournals.org//subscriptions/

is online at: Circulation Research Information about subscribing to Subscriptions: 

http://www.lww.com/reprints Information about reprints can be found online at: Reprints:

  document. Permissions and Rights Question and Answer about this process is available in the

located, click Request Permissions in the middle column of the Web page under Services. Further informationEditorial Office. Once the online version of the published article for which permission is being requested is

can be obtained via RightsLink, a service of the Copyright Clearance Center, not theCirculation Researchin Requests for permissions to reproduce figures, tables, or portions of articles originally publishedPermissions:

by guest on January 16, 2014http://circres.ahajournals.org/Downloaded from by guest on January 16, 2014http://circres.ahajournals.org/Downloaded from by guest on January 16, 2014http://circres.ahajournals.org/Downloaded from by guest on January 16, 2014http://circres.ahajournals.org/Downloaded from by guest on January 16, 2014http://circres.ahajournals.org/Downloaded from by guest on January 16, 2014http://circres.ahajournals.org/Downloaded from by guest on January 16, 2014http://circres.ahajournals.org/Downloaded from by guest on January 16, 2014http://circres.ahajournals.org/Downloaded from by guest on January 16, 2014http://circres.ahajournals.org/Downloaded from by guest on January 16, 2014http://circres.ahajournals.org/Downloaded from by guest on January 16, 2014http://circres.ahajournals.org/Downloaded from by guest on January 16, 2014http://circres.ahajournals.org/Downloaded from by guest on January 16, 2014http://circres.ahajournals.org/Downloaded from by guest on January 16, 2014http://circres.ahajournals.org/Downloaded from by guest on January 16, 2014http://circres.ahajournals.org/Downloaded from

Dilated Cardiomyopathy Mutant Tropomyosin Mice DevelopCardiac Dysfunction With Significantly Decreased

Fractional Shortening and Myofilament Calcium SensitivitySudarsan Rajan,* Rafeeq P.H. Ahmed,* Ganapathy Jagatheesan, Natalia Petrashevskaya,Greg P. Boivin, Dalia Urboniene, Grace M. Arteaga, Beata M. Wolska, R. John Solaro,

Stephen B. Liggett, David F. Wieczorek

Abstract—Mutations in striated muscle �-tropomyosin (�-TM), an essential thin filament protein, cause both dilatedcardiomyopathy (DCM) and familial hypertrophic cardiomyopathy. Two distinct point mutations within �-tropomyosinare associated with the development of DCM in humans: Glu40Lys and Glu54Lys. To investigate the functionalconsequences of �-TM mutations associated with DCM, we generated transgenic mice that express mutant �-TM(Glu54Lys) in the adult heart. Results showed that an increase in transgenic protein expression led to a reciprocaldecrease in endogenous �-TM levels, with total myofilament TM protein levels remaining unaltered. Histological andmorphological analyses revealed development of DCM with progression to heart failure and frequently death by 6months. Echocardiographic analyses confirmed the dilated phenotype of the heart with a significant decrease in the leftventricular fractional shortening. Work-performing heart analyses showed significantly impaired systolic, and diastolicfunctions and the force measurements of cardiac myofibers revealed that the myofilaments had significantly decreasedCa2� sensitivity and tension generation. Real-time RT-PCR quantification demonstrated an increased expression of�-myosin heavy chain, brain natriuretic peptide, and skeletal actin and a decreased expression of the Ca2� handlingproteins sarcoplasmic reticulum Ca2�-ATPase and ryanodine receptor. Furthermore, our study also indicates that the�-TM54 mutation decreases tropomyosin flexibility, which may influence actin binding and myofilament Ca2�

sensitivity. The pathological and physiological phenotypes exhibited by these mice are consistent with those seen inhuman DCM and heart failure. As such, this is the first mouse model in which a mutation in a sarcomeric thin filamentprotein, specifically TM, leads to DCM. (Circ Res. 2007;101:205-214.)

Key Words: mouse model � transgenic � myocardial contractility � thin filament

Tropomyosin (TM) is an � helical coiled-coil fibrousprotein that binds actin filaments providing structural

stability and modulation of filament function. In striatedmuscle, TM along with the troponin complex regulatesCa2�-mediated actin–myosin crossbridges. Numerous muta-tions in many of the contractile proteins of the cardiacsarcomere have been associated with dilated and hypertrophiccardiomyopathy, where the myocardial performance is com-promised. In humans, 2 dilated cardiomyopathy (DCM)-associated mutations (Glu54Lys and Glu40Lys) have beenidentified in �-tropomyosin (�-TM) (or TPM1),1 in contrastto the 8 distinct mutations in the same gene that are associatedwith familial hypertrophic cardiomyopathy (FHC).2 TheDCM mutations in �-TM are located in a region (amino acids40 to 100) where half of the reported human FHC mutations

occur (Glu62Gln, Ala63Val, Lys70Thr, Val95Ala); this re-gion does not interact with troponin (Tn)T.

Protein-modeling studies on the TM filaments harboringGlu54Lys and Glu40Lys substitutions show that both of themcreate a strong local increase in the positive charge in anotherwise negatively charged region of the molecule.1 The2-Å crystal structure of TM indicates that Glu54 is linked toLys49 and Glu40 is linked to Arg35.3 The substitution ofglutamic acid for lysine would abolish this interaction andthus destabilize localized TM structure.4 Furthermore, thismutation occurs in the fifth (or e) position of a highlyconserved heptad motif of repeating 7 amino acid units(a-b-c-d-e-f-g). Structural and molecular modeling studiessuggest that the fifth and seventh position (e and g) aminoacid side chains, which are typically of opposite charge, can

Original received January 10, 2007; revision received May 22, 2007; accepted May 24, 2007.From the Department of Molecular Genetics, Biochemistry, and Microbiology (S.R., R.P.H.A., G.J., D.F.W.), University of Cincinnati Medical Center,

Cincinnati, Ohio; Department of Pathology and Laboratory Medicine (G.P.B.), University of Cincinnati Medical Center, Ohio; Department of Physiologyand Biophysics (D.U., G.M.A., B.M.W., R.J.S.), University of Illinois, Chicago College of Medicine; and Department of Medicine (N.P., S.B.L.),University of Maryland, Baltimore.

*Both authors contributed equally to this study.Correspondence to David F. Wieczorek, Department of Molecular Genetics, Biochemistry, and Microbiology, University of Cincinnati Medical Center,

Cincinnati, OH 45267-0524. E-mail David.Wieczorek@uc.edu© 2007 American Heart Association, Inc.

Circulation Research is available at http://circres.ahajournals.org DOI: 10.1161/CIRCRESAHA.107.148379

205 by guest on January 16, 2014http://circres.ahajournals.org/Downloaded from

contribute to the stability of the coiled-coil through formationof a salt bridge.1 Disruption of one salt bridging interactionthrough charge reversal of an amino acid might cause a localchange in TM conformation or lability. Whether the primaryeffect of a single amino acid substitution is to alter proteinstability or surface electrostatic charge characteristics, theintegrity of the thin filament is likely to be compromised, andhence a defective force transmission has been attributed to bethe cause of DCM.1 Two independent studies of the DCM-causing TM mutations involving an in vitro approach havedemonstrated a decreased calcium sensitivity of myofilaments.4,5

In our previous studies using a transgenic (TG) mousemodel approach, we extensively analyzed the functionalconsequences of FHC causing �-TM mutations.2,6–8 In thecurrent study, we adopted a similar transgenic approach toaddress the effect of the DCM Glu54Lys �-TM mutation oncardiac development and function. We established 5 distinctTG lines that use a cardiac-specific �-myosin heavy chain(MHC) promoter to express the �-TM54 mutant protein inthe heart. Western blotting and quantitative analyses demon-strated that, in all TG lines, an increase in transgenic proteinled to reciprocal decreases in endogenous �-TM levels, andthe total myofilament TM protein level remained unchanged.

Echocardiographic analyses of these mice showed that theyexhibited a significant DCM phenotype with a markeddecrease in the left ventricular (LV) fractional shortening.Histopathological and morphological analyses also revealed aslow progression from DCM to heart failure, with lethalityfrequently occurring within 6 months. Work-performing heartanalyses showed significantly impaired systolic and diastolicfunctions concomitant with increased time to peak pressureand half-time to relaxation. Interestingly, with high concen-trations of �-adrenergic stimulation (isoproterenol), a suddensteep increase in the performance is observed, restoringnormal cardiac function. The force measurements of skinnedmyofiber preparations exhibit a significantly decreased Ca2�

sensitivity and tension generation with no alteration in sar-comere length dependence of activation. This mouse modelprovides an opportunity to delineate the pathophysiologicalmechanisms of the sarcomeric DCM mutation and to explorethe relationship between TM mutations inducing DCM andFHC signal transduction pathways.

Materials and MethodsAn expanded Materials and Methods section can be found in theonline data supplement at http://circres.ahajournals.org.

Figure 1. A, DCM �-TM54 construct.The �-TM54 construct used the �-MHCcardiac-specific promoter, the striatedmuscle �-TM cDNA with an encodedsubstitution at amino acid 54 (Glu54Lys),and the human growth hormone (HGH)termination and polyadenylation cassetteat the 3� end. B, Genomic Southern blotof transgenic mouse lines. Mouse tailgenomic DNA was digested with EcoRI,Southern blotted, and hybridized to 32P-radiolabeled probe from striated muscle�-TM 3� untranslated region. The endog-enous 1.7-kb band and 3.4-kb transgeneconstruct band are designated. C, RNAexpression in transgenic mice. Cardiactotal RNA (10 �g) was electrophoresed,transferred to nylon membrane, andprobed with 32P-radiolabeled �-MHC 1 to2 exons to detect transgene mRNA,�-TM 5� UTR for endogenous �-TMmRNA, or GAPDH in Northern blot analy-ses. D, One-dimensional isoelectricfocusing (IEF) and Western blot analysisof �-TM54 TG cardiac proteins. Myofi-brillar TM subunit composition (i) andcytosolic fractions of �-TM54 transgeniclines (ii) were analyzed using isoelectricfocusing gel electrophoresis. TM wasdetected using a TM-specific monoclonalantibody as described in Materials andMethods. Positions of the transgenic�-TM54 protein and endogenous �-TMare marked. E, Quantification of myofila-ment TM content in the hearts of�-TM54 TG mice. The signal intensity ofthe TM was quantified with ImageQuantversion 5.1 and normalized to striatedmuscle actin levels. The TM level foundin NTG hearts was set at 100%.

206 Circulation Research July 20, 2007

by guest on January 16, 2014http://circres.ahajournals.org/Downloaded from

Generation of DCM Mutant �-TM54Transgenic MiceCardiac-restricted DCM mutant �-TM54 transgenic mice weregenerated using vectors containing the mouse �-MHC promoter and�-TM cDNA sequences, as described in the online data supplement.Experimental procedures describing the histologic, morphological,and molecular characterizations of those TG mice are also describedin the online data supplement. The Institutional Animal Care and UseCommittee approved the handling and maintenance of animals.

Cardiac FunctionThe cardiac performance of the DCM mutant �-TM54 TG mice wasassessed by physiological studies, including echocardiography,work-performing heart model, and skinned fiber preparations, all ofwhich are described in detail in the online data supplement. In thesephysiological experiments, the high expression mice refer to line 30.Initial studies found no functional differences in the results from themoderate expression mice (lines 67, 71, and 95); for this reason, thesubsequent extensive studies concentrated on line 67.

Real-Time RT-PCR Analysis, BacterialRecombinant Protein Expression, and CircularDichroism MeasurementsFor details regarding the methods used, see the expanded Materialsand Methods section in the online data supplement.

ResultsGeneration of DCM Mutant �-TM54 TG MiceThe transgene construct used to generate the �-TM54 TGmice is shown in Figure 1A. Because there is 100% aminoacid identity between the striated muscle �-TM proteins ofthe mouse and humans, the designed DCM mutation isreflective of the change found in human DCM. Work fromour laboratory shows that overexpression of wild-type �-TMcDNA (WT-TG) using a similar construct in the heart doesnot lead to pathological changes nor functional alterations incardiac or myofiber performance.7,9 Five different transgeniclines were established and genomic Southern blot analysisshows hybridizing bands at 1.7 kb and 3.4 kb (Figure 1B); the1.7-kb band represents the endogenous �-TM gene (TPM1),which has a signal intensity that corresponds to a gene copynumber of 2, whereas the 3.4-kb band indicates the incorpo-rated transgene construct. Along with the nontransgenic(NTG) mice, 2 lines of WT-TG with varied copy number ofwild-type transgene (29 and 35 copies) were included ascontrols. Quantification of the transgene by normalizing it tothe 2-copy endogenous gene demonstrates that copy numbersof the transgene-overexpressing mutant �-TM54 proteinrange from 1 to multiple copies: line 67, 22 copies; line 71, 10copies; line 76, 1 copy; line 95, 9 copies; and line 30, �174copies. To negate the possibility that a deletion of the DCM�-TM54 DNA sequences occurred during transgenesis, weconducted nucleotide sequencing of TG mouse genomicDNA using construct specific primers. Results verified thepresence of the designed mutation and indicated no additionalchanges in �-TM sequence. To further confirm the absence ofany potential novel mutations in the transgene, cDNA syn-thesized from the total heart RNA of 2 TG lines (lines 67 and30) that were used in the present study were PCR cloned withminimum cycle amplification (15 cycles). Direct forward andreverse sequencing of 15 independent clones from each lineshowed the presence of only the �-TM54 mutation.

Cardiac �-TM54 Mutant Transcript and ProteinExpression in TG MiceMessage levels of control and transgene transcripts wereassayed by Northern blot hybridization using a radiolabeled�-TM 5� untranslated region probe and an �-MHC 1- to2-exon probe, respectively, that were normalized to GAPDHexpression. The expression levels of the endogenous �-TMtranscript remain constant in all of the �-TM54 TG mouselines, whereas the transgene expression levels correlate withtheir corresponding transgene copy numbers (Figure 1C).There is a slight decrease in endogenous �-TM mRNA levelsin the WT-TG hearts.

To quantify mutant �-TM54 protein expression, myofibrillarproteins from the hearts of NTG and TG mice were subjected to1D isoelectric focusing, followed by immunoblotting with astriated muscle-specific TM antibody. On a very narrow pHgradient (pI 4.2 to 4.9), the mutant �-TM54 protein focused at ahigher pI when compared with the endogenous �-TM, whichcorrelates with the theoretical pI values of endogenous �-TMprotein (4.60) and mutant �-TM54 protein (4.65). Results showthere are varying degrees of expression of the mutant TM proteinin the hearts of the different lines of �-TM54 TG mice, which iscoupled with a concomitant downregulation of endogenous�-TM (Figure 1D). Also, the ratio of the mutant �-TM54 toendogenous �-TM protein (Figure 1E) correlates with theircorresponding transcript levels with the exception of TG line 30,which has a very high transgene copy number and mRNAexpression but a low incorporation of mutant protein in themyofilaments. Further analysis of the cytosolic fraction of theTG mouse hearts revealed that only in TG line 30 was a majoramount of mutant �-TM54 protein found in the cytoplasm(Figure 1D). (Transgenic expression of chimeric TMs or mutanttransgenes does not lead to cytoplasmic accumulation of theexogenous protein.10) The significant accumulation of �-TM54protein in the cytoplasm in TG line 30 was further confirmed byimmunohistochemical analyses of TG heart sections using aTM-specific antibody (Figure 2A). Additional quantitative anal-ysis shows that the amount of total striated muscle �-TM(generated from both endogenous and transgene sources) in totalcell lysate remains unchanged when normalized to �-tubulin inthe NTG, WT-TG, and �-TM54 TG hearts with the exception of�-TM54 TG line 30 (Figure IA in the online data supplement).The total amount of myofilament-incorporated striated muscleTM remains unchanged when normalized to striated muscleactin levels in the NTG, WT-TG and �-TM54 TG heartsincluding TG line 30 (supplemental Figure IB). Also, experi-ments demonstrated that there were no quantitative changes inthe other non-TM cardiac contractile proteins in the TG hearts(data not shown).

Cardiac Morphology of DCM Mutant �-TM54TG MiceCardiac structure was characterized in the transgenic mice atvarious time intervals from 1 to 8 months after birth. Resultsshow that the high-copy TG mouse hearts develop a severeDCM phenotype by 2 weeks, and the dilation is seen in boththe ventricles (Figure 2B, panels vi and viii). Morphologicalanalyses of the ventricular wall show moderate myocytehypertrophy with severe diffuse hyalinization of the myocyte

Rajan et al �-Tropomyosin Mutation–Induced DCM 207

by guest on January 16, 2014http://circres.ahajournals.org/Downloaded from

cytoplasm. The cytoplasmic changes are characterized by lossof striation and a homogenous, ground-glass appearance. By1 month, the high-copy TG animals had a significant increasein the heart weight-to-body weight ratio (Figure 3A) withmost mice dying within 1.5 months (Figure 3B). In contrast,the moderate-copy mice show a tendency of developingDCM after two months of age with hearts showing mildmyocyte hypertrophy and disorganization at the base of leftventricle and very mild interstitial fibrosis. By five months,they develop significant dilation of both ventricles (Figure2B, panels ii and iv) with mild disorganization of the myocytesat the base of the ventricles. A moderate diffuse peribronchiolarneutrophil cuffing was seen in the lungs. Interestingly, the bodyweight of these TG mice show an increase of �50% (NTG,24.83�1.8 g, n�8 and TG L67, 36.1�1.8 g, n�8); this increasein weight could be attributable to peripheral edema which wasobserved in these animals. These findings present a clinicalfeature associated with heart failure, but surprisingly the lungweight is normal and there was no ascites formation. In spite ofthe increase in body weight, they still show an increase in heartweight to body weight ratio (Figure 3A). The mice from all 3moderate-expression lines start dying by 4 to 6 months of age(Figure 3B), and the survival data show that by 8 months, 38%of mice died in line 67, 18% in line 71, and 15% in line 95. Themice that survived beyond 8 months also showed an increasedheart weight to body weight ratio and develop a DCMphenotype.

Cardiac Function of DCM Mutant �-TM54TG MiceTo assess whether any functional changes in cardiac perfor-mance occur in the DCM mutant �-TM54 TG mice, weconducted several physiological studies by use of echocardi-ography, the work-performing heart model, and skinned fiberpreparations. An in vivo physiologic assessment of cardiacfunction was conducted on 5-month-old moderate-copy mice,1-month-old high-copy mice, and control littermate mice byDoppler echocardiographic analyses. In both moderate- andhigh-copy TG mice, the hearts demonstrated increased LVdiastolic and systolic diameter as well as significant reductionin the LV fractional shortening (Figure 4A, Table 1, andsupplemental Table I). The cardiac output was also signifi-cantly reduced, but the heart rate was not affected. In total,the echocardiographic results demonstrate the developmentof a DCM phenotype that can lead to heart failure.

Work-Performing Heart ModelThe work-performing heart model was used to obtain an exvivo assessment of cardiac performance. These measure-ments were conducted in moderate-copy TG (3 month-old)and high-copy TG (1-month-old) mouse hearts. As seen inTable 2 and supplemental Table II, the rates of relaxation andcontraction were significantly reduced concomitant with in-creased time to peak pressure and half-time to relaxation.End-diastolic and diastolic pressures were significantly in-creased, whereas the systolic pressure was significantly

Figure 2. A, Immunohistochemistry ofDCM �-TM54 hearts. Ventricular sectionsof moderate- and high-copy �-TM54 TGmice were stained with a TM-specific anti-body. i, Note the mild and severe myocytedisorganization in the moderate- andhigh-copy mice, respectively. Also, notethe loss of striations in the high-copymice. ii, Ventricular sections after TM anti-body staining clearly show the cytosolicaccumulation of TM in the high-copymice. B, Histopathology of DCM �-TM54hearts. Masson trichrome staining ofwhole-heart longitudinal sections (i and ii)and cross sections (iii and iv) from5-month-old NTG and moderate-copymice; longitudinal sections (v and vi) andcross sections (vii and viii) from 1-month-old NTG and high-copy mice. Note thesevere dilation of right and left ventriclesin both the moderate and high-copy mice.Images in i through viii are all enlarged atthe same magnification.

208 Circulation Research July 20, 2007

by guest on January 16, 2014http://circres.ahajournals.org/Downloaded from

decreased documenting their systolic and diastolic dysfunc-tion. Previous work has demonstrated that transgenic micethat overexpress wild-type �-TM show no significant alter-ations in cardiac function.7,9

We also determined responses to isoproterenol to ascertainif the observed systolic and diastolic dysfunction was asso-ciated with impaired �-adrenergic responses. The reducedinotropic and lusitropic performance by hearts was assessedduring stimulation with isoproterenol, a �-adrenergic agonistthat augments muscle contraction and relaxation by cAMP/protein kinase A–dependent kinase. Interestingly, in themoderate-copy TG mouse hearts, whereas a blunted responsewas observed at lower concentrations of isoproterenol (10�11

to 10�8 mol/L), a sudden steep increase in the performancewas observed at higher concentrations of isoproterenol(�10�8 mol/L), restoring normal cardiac function (Figure4B). In contrast, in the high-copy TG mouse hearts, there wasa blunting of �-adrenergic stimulation at all concentrations ofisoproterenol (data not shown).

Ca2�–Force Measurements in SkinnedFiber BundlesTo examine the correlation between physiological resultsfrom the whole-heart and mutant �-TM54 expression at thesarcomere level, a series of experiments was conducted usingdetergent-extracted (skinned) fiber bundles. These experi-ments were conducted to compare the relation between Ca2�

and tension developed by myofilaments obtained from con-trol versus mutant �-TM54 left ventricular fiber bundles of 5month-old moderate-copy TG mice and 1 month-old high-copy TG mice. In the first set of experiments, we comparedthe pCa–tension relations for fiber bundles obtained fromNTG (n�8) and TG (moderate-copy numbers; n�10) heartsat a sarcomeric length of 2.3 �m. As illustrated in Table 3 andsupplemental Figure II, there is a significant reduction inmaximum tension and pCa50 (�log of free [Ca2�]) in TGmice fiber bundles compared with NTG controls, with nosignificant differences in the Hill n values. Similar sets of

Figure 3. A, Ratio of heart weight to body weight in DCM �-TM54 TG mice. Bar graph representation of percentage heart weight/bodyweight ratio (mg/g �100). Results demonstrate significant increases in cardiac size of TG hearts. B, Survival curve of DCM �-TM54 TGmice. Results show that high-copy TG mice die within 1.5 months (100%), whereas moderate-copy mice start dying by 4 to 6 monthsof age and the mortality ranges from 18% to 38% over a period of 9 months.

Rajan et al �-Tropomyosin Mutation–Induced DCM 209

by guest on January 16, 2014http://circres.ahajournals.org/Downloaded from

Figure 4. A, Representative M-mode echocardiographic images of the left ventricle in NTG and moderate-copy �-TM54 TG mice.The moderate-copy TG mouse heart shows a LV internal diastolic dimension of 5.37 mm vs NTG, 3.7 mm; LV internal systolicdimension of 4.4 mm (TG) vs 2.0 mm (NTG); LV fractional shortening of 18% (TG) vs 46% (NTG); heart rate of 472 (TG) vs 442(NTG) beats per minute. B, Isoproterenol dose-response curves in moderate-copy �-TM54 TG and NTG mouse hearts at 3months of age. Hearts from NTG and TG mice were subjected to isolated heart analyses with increasing concentrations of isopro-terenol (10�11 to 10�7mol/L). Note that at a high concentration of isoproterenol (�10�8 mol/L), the �-TM54 cardiac function param-eters recover to near normal levels.

210 Circulation Research July 20, 2007

by guest on January 16, 2014http://circres.ahajournals.org/Downloaded from

experiments were completed with fiber bundles from the1-month-old high-copy TG (n�8) hearts and their littermateNTG (n�8) hearts. Compared with fibers with a moderate-copy number, a more severely depressed maximum tension inthe high-copy TG fibers was observed. There is also asignificant reduction in the pCa50 in TG fibers comparedwith NTG and no significant difference between Hill nvalues. Furthermore, all the experiments when repeated at asarcomere length of 1.9 �m presented a similar pattern,except that the DCM �-TM54 mutation had no effect on thelength-dependent activation of tension development (supple-mental Figure II).

Gene Expression Associated With CardiomyopathyAltered gene expression, a recognized feature of DCM,11 wasexamined in the �-TM54 moderate-copy TG mouse hearts at5 months of age, a time point when the cardiomyopathy isalready apparent. Real-time RT-PCR analysis of the RNAisolated from the ventricular tissue revealed that there was asignificant upregulation of molecular markers of cardiomy-

opathy namely, �-MHC, brain natriuretic peptide, and skel-etal actin (Figure 5A). To determine whether genes thatregulate myocyte Ca2� cycling were altered in the TGmyocardium, we also measured mRNA levels of sarcoplas-mic reticulum Ca2�-ATPase, ryanodine receptor, calseques-trin, L-type Ca2� channel, and phospholamban. We observedsignificant downregulation only in the levels of sarcoplasmicreticulum Ca2�-ATPase and ryanodine receptor transcripts.All of these RNA levels were normalized to GAPDH values.

Effect of Glu54Lys Mutation on TropomyosinThermal StabilityTropomyosin structure is weakened by FHC mutations,namely, Glu180Gly, Asp175Asn, Lys70Thr, and Ala63Val.12

Therefore, to investigate the effect of Glu54Lys mutation onTM structure, circular dichroism was used and thermalstability measurements were made by following the ellipticity(�) of TM at 222 nm as a function of temperature. Atintermediate temperatures, the mutation significantly altered� 222, a measure of �-helical content. Results showed that thethermal denaturation curve of the mutant protein shiftedtoward the right when compared with the wild-type curve(Figure 5B), implying an increased stability conferred by themutation. This change in amino acid causes a decrease inflexibility, which can influence actin binding13 as well asmyofilament Ca2� sensitivity.12

DiscussionTwo missense mutations (Glu54Lys and Glu40Lys) that alterthe highly conserved residues of �-TM have been linked toDCM. The phenotypic severity associated with the sarco-meric mutations in human DCM patients and the alteredsarcomeric function associated with the mutations is not wellestablished. The family pedigree associated with the DCM�-TM54 mutation appears to be quite severe; these individ-uals all died at relatively early ages (26, 27, and 49 years).1

Cardiac phenotypic measurements of the proband are inagreement with those findings from both moderate andhigh-copy TM mice, namely increased LV internal diastolicdimension and LV internal systolic dimension, and decreasedfractional shortening percentage (Table 1 and supplementalTable I). Because TM protein measurements were not con-ducted on the proband, the relative ratio of wild type: mutantTM is unknown. Nevertheless, the �-TM54 TG mice appearto be a good model system for studying DCM.

TABLE 3. Parameters Describing Ca2�-Dependent Activation ofTension in Skinned Fiber Bundles From NTG and �-TM54TG Hearts

Group pCa50 n H

Force(mN/mm2) n

NTG (5 months old) 5.75�0.02 3.38�0.40 37.50�4.04 8

Moderate copy TG 5.67�0.01* 3.77�0.21 25.41�1.67* 10

NTG (1 month old) 5.93�0.03 3.74�0.23 46.09�7.22 8

High copy TG, 1.9 5.82�0.03* 3.78�0.15 22.35�1.48* 8

nH indicates Hill coefficient. *P0.05, NTG vs TG.

TABLE 1. Cardiac Function of NTG and Moderate Copy�-TM54 TG Mice at Five Months of Age, As Assessed byM-Mode Echocardiography

Parameters NTG (n�7) TG (n�7)

LVIDd, M-mode, mm 3.65 4.42**

LVISd, M-mode, mm 1.91 3.42***

LV fractional shortening, M-mode, % 47.83 22.9***

IVSD, M-mode, mm 0.8 1.04***

LVPWD, M-mode, mm 0.71 0.86*

Vcf, M-mode, Doppler(circumference�sec)

9.83 4.26***

Cardiac output, (Doppler) ml/min 15.44 10.82**

Heart rate, bpm 416 417

LV Isovolumic relaxation time(Doppler), msec

16.14 27.33***

LVIDd indicates LV internal diastolic dimension; LVISd, LV internal systolicdimension; IVSD, interventricular septum in diastole; LVPWD, LV posterior wallin diastole; Vcf, LV circumferential fiber shortening. *P0.05, **P0.01,***P0.001 NTG vs TG.

TABLE 2. Cardiovascular and Contractile Parameters of NTGand Moderate Copy �-TM54 TG Mouse Hearts in the IsolatedWork-Performing Heart Preparations at Three Months of Age

Parameters NTG (n�7) TG, n�5

Systolic pressure, mm Hg 149.8�5.8 74.5�5.3***

Diastolic pressure, mm Hg �7.4�2.6 13.5�2.9***

End diastolic pressure, mm Hg 7.9�2.1 18.4�2.1**

�dP/dt, mm Hg/sec 3846�204 1522�320***

�dP/dt, mm Hg/sec 3511�186 1516�363***

RT1/2, ms/mm Hg 0.44�0.06 0.62�0.08*

TPP, ms/mm Hg 0.53�0.05 0.76�0.07***

Heart rate, bpm 311�8.9 245�28*

�dP/dt indicates maximal rate of pressure development; �dP/dt, maximalrate of pressure decline; RT1/2, half time to relaxation; TPP, time to peakpressure. *P0.05, **P0.01, ***P0.001 NTG vs TG.

Rajan et al �-Tropomyosin Mutation–Induced DCM 211

by guest on January 16, 2014http://circres.ahajournals.org/Downloaded from

The results of this study show that expression of �-TMencoding an amino acid change of glutamic acid (negativeside chain) to lysine (positive side chain) at codon 54 inducesDCM. Physiological alterations include impairment in bothcardiac contractile and relaxation functions, with heartsexhibiting a significantly reduced LV fractional shorteningand a decrease in myofilament Ca2� sensitivity. This is thefirst demonstration that exogenous expression of a sarcomericthin filament protein encoding a known human DCM muta-tion in the mouse heart results in pathological and physiolog-ical defects associated with DCM and thus provides anexcellent opportunity to understand the disease pathology.There has been a recent report of a DCM mouse model for asarcomeric thick filament mutation in �-MHC that also exhibitsthe cardiomyopathic phenotype.14 Other reported murine mod-els of sarcomeric DCM have not yet been shown to be relatedto human DCM, including cardiac overexpression of tropo-modulin15 and homozygous expression in mice of a mutantform of the sarcomeric myosin-binding protein C.16

The altered cardiac structure and function of the DCM�-TM54 mutation are thought to be a consequence of

impairment in actin-binding capability by TM coupled with adecreased Ca2� sensitivity of the myofilaments.17 This hy-pothesis is reinforced by the results from measurements withskinned fiber preparations of the �-TM54 TG mouse hearts.As summarized in Table 3, at 5 months of age, compared withmatched controls, moderate-copy TG myofilaments demon-strate significant desensitization to Ca2� as well as a depres-sion in maximum tension. Higher-copy TG myofilaments, at1 month of age, also demonstrate a more severely depressedmaximum tension and reduced Ca2� sensitivity when com-pared with age-matched controls. Moreover, the reducedmyofilament sensitivity to Ca2� and depressed tension corre-lates with our finding of depressed cardiac function asdetermined by echocardiography and/or by studies in isolatedworking hearts. Studies using the in vitro motility assay alsoagree that alterations in the TM function and decreasedmyofilament Ca2� sensitivity are associated with theGlu54Lys amino acid substitution.4,5

The altered expression of the Ca2� handling proteins asobserved by real-time RT-PCR quantification may contributeto a depressed Ca2� transient, leading to impaired excitation–

Figure 5. A, Real-time RT-PCR quantifi-cation of the cardiac gene expression.Analysis of mRNA expression shows thatcardiomyopathy-associated genes aresignificantly upregulated, whereas thecalcium-handling proteins are downregu-lated. The amounts of target mRNAswere normalized to GAPDH levels. B,Thermal denaturation of recombinantwild-type �-TM and mutant �-TM54 pro-tein monitored by circular dichroismmeasurements. The curves show thepercentage folding vs temperature. Frac-tion unfolded was calculated based onthe ellipticity at a wavelength of 222 nm.Note the mutant protein shows a right-ward shift of the curve, indicating aslower rate of unfolding and hence anincreased thermal stability.

212 Circulation Research July 20, 2007

by guest on January 16, 2014http://circres.ahajournals.org/Downloaded from

contraction coupling. The rescue of cardiac function, afterhigh doses of isoproterenol, from the impaired adrenergicresponsiveness in the work performing hearts of moderate-copy TG mice at 3 months of age indicates that they are in theearly stages of heart failure. Furthermore, the result alsosuggests that apart from the altered expression of the Ca2�

handling proteins, there could also be an altered phosphory-lation status of the Ca2� handling proteins such as phospho-lamban, which is a key determinant of �-adrenergic stimula-tion in the heart.18 The blunted response of the high-copy TGmice would indicate that their hearts are in too severe of apathological state to respond to isoproterenol.

Despite a low incorporation of the mutant protein in thehigh-copy TG myofilaments, we see a severe phenotypeculminating in early death. This could be attributed to anovertly high transgene copy number in these mice and/or theexcessive cytosolic presence of the mutant protein, whichmay interfere with cytoskeletal structures leading to a defec-tive force transmission. The precise reason for significantcytosolic accumulation of mutant �-TM54 protein with de-creased incorporation in the myofilaments is unclear but is aninteresting area for future investigation. Interestingly, themuscle LIM protein associated with actin cytoskeleton at theZ-disc has been correlated to DCM in muscle LIM protein–null mice,19 and it has been proposed that defects in thecytoskeleton are primarily responsible for many human formsof DCM.20,21 Another possible mechanism of cardiac diseaseis the aggregate/amyloid formation by unfolded or misfoldedproteins which has been reported in heart failure patients andalso in desmin-related cardiomyopathic mice overexpressingmutant �-B-crystallin.22 This pathogenic process may be thecause of an early phenotype and death in the high-copy�-TM54 TG mice. Although we could not detect the cytosolicaccumulation of the transgenic protein in the moderateexpression lines, DCM still developed. This indicates that the�-TM54 mutation could be the primary cause for the devel-opment of DCM.

Circular dichroism titrations at 222 nm showed the tem-perature stability of the �-TM � helix with a Glu54Lys aminoacid substitution is greater than wild-type �-TM. In contrast,all FHC-associated tropomyosin mutations (Glu180Gly,Asp175Asn, Lys70Thr, and Ala63Val) are reported to de-crease the temperature stability of the � helical coiled-coil.Most FHC thin filament mutations lead to a variety offunctional abnormalities in the sarcomere that include in-creased myofilament Ca2� sensitivity.5,6,8,12 However, theDCM �-TM54 mutation is shown to decrease the myofila-ment Ca2� sensitivity. These findings help to correlate FHCmutations with increased Ca2� sensitivity and a destabilized�-TM helix, and DCM mutations with decreased myofila-ment Ca2� sensitivity and a stabilized �-TM helix. It isinteresting to consider whether these 2 properties are consis-tent with other TM mutations and whether they are linked tothe disease causing pathways of FHC and DCM. Our dataindicate that �-TM54 mutation in mice results in significantlydecreased myofilament calcium sensitivity and significantlyimpaired systolic and diastolic functions. This observation,together with the absence of length dependent activation oftension development and the thermal stability data of the

mutant �-TM54 protein favoring the defective actin bindingcapability, supports the notion that defects in force transmis-sion rather than force generation may cause the observedDCM phenotype.1

AcknowledgmentsWe thank Maureen Bender for care of the animals. We acknowledgeDr Evangelia Kranias for critical reading of the manuscript.

Sources of FundingThis study was supported by National Heart, Lung, and BloodInstitute grants HL-71952 (to D.F.W.), HL-79032 (to B.M.W.), K01HL-67709-4 (to G.M.A.), HL-22231 (to R.J.S.), and HL-062426 (toR.J.S.).

DisclosuresNone.

References1. Olson TM, Kishimoto NY, Whitby FG, Michels VV. Mutations that alter

the surface charge of alpha-tropomyosin are associated with dilated car-diomyopathy. J Mol Cell Cardiol. 2001;33:723–732.

2. Rajan S, Williams SS, Jagatheesan G, Ahmed RP, Fuller-Bicer G,Schwartz A, Aronow BJ, Wieczorek DF. Microarray analysis of geneexpression during early stages of mild and severe cardiac hypertrophy.Physiol Genomics. 2006;27:309–317.

3. Brown JH, Kim KH, Jun G, Greenfield NJ, Dominguez R, Volkmann N,Hitchcock-DeGregori SE, Cohen C. Deciphering the design of the tropo-myosin molecule. Proc Natl Acad Sci U S A. 2001;98:8496–8501.

4. Mirza M, Marston S, Willott R, Ashley C, Mogensen J, McKenna W,Robinson P, Redwood C, Watkins H. Dilated cardiomyopathy mutationsin three thin filament regulatory proteins result in a common functionalphenotype. J Biol Chem. 2005;280:28498–28506.

5. Chang AN, Harada K, Ackerman MJ, Potter JD. Functional consequencesof hypertrophic and dilated cardiomyopathy-causing mutations in alpha-tropomyosin. J Biol Chem. 2005;280:34343–34349.

6. Muthuchamy M, Pieples K, Rethinasamy P, Hoit B, Grupp IL, BoivinGP, Wolska B, Evans C, Solaro RJ, Wieczorek DF. Mouse model of afamilial hypertrophic cardiomyopathy mutation in alpha-tropomyosinmanifests cardiac dysfunction. Circ Res. 1999;85:47–56.

7. Prabhakar R, Boivin GP, Grupp IL, Hoit B, Arteaga G, Solaro JR,Wieczorek DF. A familial hypertrophic cardiomyopathy alpha-tropomyosin mutation causes severe cardiac hypertrophy and death inmice. J Mol Cell Cardiol. 2001;33:1815–1828.

8. Prabhakar R, Petrashevskaya N, Schwartz A, Aronow B, Boivin GP,Molkentin JD, Wieczorek DF. A mouse model of familial hypertrophiccardiomyopathy caused by a alpha-tropomyosin mutation. Mol CellBiochem. 2003;251:33–42.

9. Wolska BM, Keller RS, Evans CC, Palmiter KA, Phillips RM, Muth-uchamy M, Oehlenschlager J, Wieczorek DF, de Tombe PP, Solaro RJ.Correlation between myofilament response to Ca2� and altered dynamicsof contraction and relaxation in transgenic cardiac cells that expressbeta-tropomyosin. Circ Res. 1999;84:745–751.

10. Jagatheesan G, Rajan S, Petrashevskaya N, Schwartz A, Boivin GP,Arteaga GM, Solaro RJ, Liggett SB, Wieczorek DF. Rescue oftropomyosin-induced familial hypertrophic cardiomyopathy mice bytransgenesis. Am J Physiol Heart Circ Physiol. In press.

11. Vikstrom KL, Bohlmeyer T, Factor SM, Leinwand LA. Hypertrophy,pathology, and molecular markers of cardiac pathogenesis. Circ Res.1998;82:773–778.

12. Heller MJ, Nili M, Homsher E, Tobacman LS. Cardiomyopathic tropo-myosin mutations that increase thin filament Ca2� sensitivity and tropo-myosin N-domain flexibility. J Biol Chem. 2003;278:41742–41748.

13. Singh A, Hitchcock-DeGregori SE. Local destabilization of the tropo-myosin coiled coil gives the molecular flexibility required for actinbinding. Biochemistry. 2003;42:14114–14121.

14. Schmitt JP, Debold EP, Ahmad F, Armstrong A, Frederico A, ConnerDA, Mende U, Lohse MJ, Warshaw D, Seidman CE, Seidman JG.Cardiac myosin missense mutations cause dilated cardiomyopathy inmouse models and depress molecular motor function. Proc Natl Acad SciU S A. 2006;103:14525–14530.

Rajan et al �-Tropomyosin Mutation–Induced DCM 213

by guest on January 16, 2014http://circres.ahajournals.org/Downloaded from

15. Sussman MA, Welch S, Cambon N, Klevitsky R, Hewett TE, Price R,Witt SA, Kimball TR. Myofibril degeneration caused by tropomodulinoverexpression leads to dilated cardiomyopathy in juvenile mice. J ClinInvest. 1998;101:51–61.

16. McConnell BK, Jones KA, Fatkin D, Arroyo LH, Lee RT, Aristizabal O,Turnbull DH, Georgakopoulos D, Kass D, Bond M, Niimura H, SchoenFJ, Conner D, Fischman DA, Seidman CE, Seidman JG. Dilated cardio-myopathy in homozygous myosin-binding protein-C mutant mice. J ClinInvest. 1999;104:1235–1244.

17. Mirza M, Robinson P, Kremneva E, Copeland O, Nikolaeva O, WatkinsH, Levitsky D, Redwood C, El-Mezgueldi M, Marston S. The effect ofmutations in alpha tropomyosin (E40K and E54K), that cause familialdilated cardiomyopathy, on the regulatory mechanism of cardiac musclethin filaments. J Biol Chem. 2007;282:13487–13497.

18. MacLennan DH, Kranias EG. Phospholamban: a crucial regulator ofcardiac contractility. Nat Rev Mol Cell Biol. 2003;4:566–577.

19. Arber S, Hunter JJ, Ross J Jr, Hongo M, Sansig G, Borg J, Perriard JC,Chien KR, Caroni P. MLP-deficient mice exhibit a disruption of cardiaccytoarchitectural organization, dilated cardiomyopathy, and heart failure.Cell. 1997;88:393–403.

20. Chen J, Chien KR. Complexity in simplicity: monogenic disorders andcomplex cardiomyopathies. J Clin Invest. 1999;103:1483–1485.

21. Marian AJ. On genetics of dilated cardiomyopathy and transgenicmodels: all is not crystal clear in myopathic hearts. Circ Res. 2001;89:3–5.

22. Sanbe A, Osinska H, Saffitz JE, Glabe CG, Kayed R, Maloyan A,Robbins J. Desmin-related cardiomyopathy in transgenic mice: a cardiacamyloidosis. Proc Natl Acad Sci U S A. 2004;101:10132–10136.

214 Circulation Research July 20, 2007

by guest on January 16, 2014http://circres.ahajournals.org/Downloaded from

In an article by Rajan et al. (Circ Res. 2007;101:205–214), Figure 2 was printed incorrectly. Thecorrect figure appears below, as the authors intended. The corrected article is now available athttp://circres.ahajournals.org. The Publisher regrets this error.

(Circ Res. 2007;101:e80.)© 2007 American Heart Association, Inc.

Circulation Research is available at http://circres.ahajournals.org DOI: 10.1161/CIRCRESAHA.107.101182

e80

Correction

Online Supplement Rajan et al. Dilated Cardiomyopathy Mutant Tropomyosin Mice…

Materials and Methods

Generation of DCM Mutant α-TM54 Transgenic Mice

The mouse α-TM striated muscle specific cDNA (1.1 kb) (accession number: X64831) was cloned into

the pBluescript vector. The single nucleotide change (GAA>AAA) corresponding to an amino acid

substitution at codon 54 (Glu54Lys) was carried out using the QuikChange site-directed mutagenesis kit

[Stratagene]. The sequence was verified by automated DNA sequencing at the University of Cincinnati

and Children’s Hospital DNA core facility and compared with published sequence. The α-TM54 mutant

cDNA was cloned into a vector,1 which contains the cardiac-specific α-MHC promoter and the human

growth hormone (HGH) poly(A) signal sequence. The transgene construct was purified to generate

transgenic mice as described.2 Transgenic mice were generated at the University of Cincinnati using the

FVB/N strain. Founder mice were identified by PCR and five lines of TG mice with varied copy numbers

of the transgene were confirmed by Southern blot analysis. The mutation in the transgenic lines was

verified by nucleotide sequencing of TG mouse genomic DNA.

Genotyping

DNA samples were extracted from tail clips of 10 day-old mice and PCR was employed for genotyping

the α-TM54 transgene: The following primers were used: α-MHC forward (5’- GCC CAC ACC AGA

AAT GAC AGA -3’); α-TM reverse (5’- TCC AGT TCA TCT TCA GTG CCC-3’); GAPDH forward

(5’- AGC GAG CTC AGG ACA TTC TGG -3’) and GAPDH reverse (5’- CTC CTA ACC ACG CTC

CTA GCA -3’). GAPDH amplification was used as an internal control.

Ms # CIRCRESAHA/2007/148379 / R2

2

Histopathological Analyses

Mouse hearts at different ages (2 month-old, 3 month-old, 6 month-old) and both the sexes were

analyzed. Heart weight-to-body weight ratios were measured to determine if cardiac hypertrophy had

occurred. For histological analyses, hearts were fixed in 10% neutral buffered formalin for 48 hrs. The

hearts were dehydrated through a gradient of alcohols and xylene, followed by embedding in paraffin.

Step-serial sections (5 µm) were taken from the hearts and stained with hematoxylin/eosin or Masson’s

trichrome. An expert who was blinded to genotype evaluated the presence of necrosis, fibrosis, myocyte

disarray and calcification. Immunohistochemical analyses were performed in paraffin-embedded tissue

sections by indirect immunostaining using the CH1 antibody diluted at 1:250 and incubating at 37oC for 1

hr.

Northern Analyses

Total RNA (10 µg) from transgenic and control ventricles was purified, separated by electrophoresis, and

transferred to nylon membrane. Hybridization was conducted with 32P-radiolabeled cDNA fragments

from the α-MHC 1-2 exons to assess transgene expression, and α-TM 5’UTR to determine endogenous

α-TM message levels. After exposure, blots were stripped and re-probed with a radiolabeled murine

GAPDH cDNA fragment for normalization of RNA levels.

Myofibrillar Protein Analyses

Myofibrillar proteins were prepared from ventricular myocardium as described.2 One-dimensional

isoelectric focusing (IEF) using slab gel electrophoresis was performed on myofibrillar protein

preparations as described 3 with some modifications. In brief, 15 cm IEF slab gels were used containing

5% Duracryl [Genomic Solutions], 9.1 mol/L urea, 2% (v/v) Triton X-100, and 0.05x of Pharmalyte 4.2-

4.9 [GE Healthcare], with the catalysts ammonium persulfate, and N,N,N,N,-tetramethylethylenediamine

(TEMED) added separately. Total myofibrillar protein was dephosphorylated and loaded in a buffer

Ms # CIRCRESAHA/2007/148379 / R2

3

containing 9.2 mol/L urea, 0.02x of Pharmalyte 4.2-4.9, and 2% Triton X-100 with 0.025% bromophenol

blue. The cathode buffer consisted of 0.040 mol/L lysine, and the anode buffer consisted of 0.007 mol/L

phosphoric acid. The running conditions for a 150 mm slab gel were 1 W for 16 hours and 2 W for 1

hour. The transfer took place in 0.7% acetic acid (pH 3), at 200 mA for 12-14 hours at 4°C by placing the

nitrocellulose membrane towards the anode. Western blot analysis using the striated muscle TM specific

CH1 antibody [SIGMA] was conducted using a 1:5000 dilution.4 The intensity of the bands was

quantified by using ImageQuant 5.1 software and the results are presented in ± S.D.

Echocardiographic Measurements

Transthoracic 2D-targeted M-mode and pulsed Doppler echocardiography (ECHO) were performed with

a 15-MHz linear array transducer [Acuson Sequoia C256 system]. The transducer was placed on a layer

of acoustic coupling gel that was applied to the left hemithorax; adequate contact was maintained while

avoiding excessive pressure on the chest. Mice were imaged in a shallow left lateral decubitus position.

M-mode images of the left ventricle were obtained from the parasternal short axis view at the level of the

papillary muscles. Interventricular septal and LV posterior wall thicknesses and LV internal dimensions at

the end of diastole and systole were measured by the American Society of Echocardiography leading-

edge method on the M-mode tracings.5 Fractional shortening of the left ventricle, a measure of LV

systolic function, was calculated from digital images as: LV fractional shortening (FS) (%) = (LVIDd–

LVISd)/LVIDd x 100, where LVIDd is the internal diastolic dimension of the LV, and LVISd is the

internal systolic dimension of the LV.6 The mean velocity of circumferential fiber shortening (Vcf) was

calculated as Vcf = FS/ET, where ET is the ejection time through the aortic valve.7

Diastolic transmitral inflow recordings were acquired from apical four-chamber views using 7 MHz

pulsed Doppler ECHO. The probe was positioned substernally at the xyphoid applying minimal pressure.

The Doppler range gate depth was set at 4 mm to obtain optimal signals from the LV inflow and outflow

tracts. The sample volume was positioned along the long axis in the middle of the mitral ring at the tips of

Ms # CIRCRESAHA/2007/148379 / R2

4

the opened cusps of the mitral valve. Three parameters of the LV diastolic function were evaluated: (1)

E/A ratio–ratio of the maximal velocity of E (early LV filling) and A (atrial contraction) waves; (2) E-

wave deceleration time (DT)–the time from the peak of the E wave to the intersection of the deceleration

slope of the E wave with the baseline; and (3) LV isovolumic relaxation time (IVRT), which was

measured from the aortic valve closure to the mitral valve opening.6, 8 The M-mode and Doppler tracings

were conducted with a paper speed of 200 mm/sec.

Isolated Anterograde Perfused Heart Preparation

Control and transgenic (moderate copy, L67 and high copy, L30) mice were anesthetized intraperitoneally

with 100 mg/kg sodium nembutal and 1.5U heparin to prevent intracoronary micro thrombi. Anterograde

work-performing perfusion was initiated at a workload of 250 mmHg mL/min as described.4 Heart rate

(HR), left ventricular pressure (LVP), and the mean coronary perfusion pressure were continuously

monitored. The pressure curve was used to calculate the rate of pressure development (+dP/dt) and

decline (-dP/dt), time to peak pressure (TPP) and time to half relaxation (RT1/2) using the software

“Origin” [Ver. 4.0, Microcal Software, Inc].

Skinned Fiber Bundle Preparation and Force Measurements

Tension developed by bundles of detergent-extracted fibers dissected from papillary muscle was

measured at two sarcomere lengths as previously described.9, 10 Isometric tension was plotted as a

function of pCa and fitted to the Hill equation by applying non-linear least squares regression analysis

using Prism software [GraphPad Ver. 2.0]. Half-maximally activating pCa values (pCa50) were computed

from individual Hill fits of each pCa-tension relation and then averaged.

Ms # CIRCRESAHA/2007/148379 / R2

5

Real-time RT-PCR Analyses

Ventricular tissue RNA from 5 month-old mice hearts was isolated using TRIZOL Reagent [Invitrogen],

followed by RNA cleanup using RNeasy Mini Kit [QIAGEN]. The first strand cDNA was synthesized for

50 min at 50°C in a 20-µl reaction containing 1x First-Strand Buffer, 5 µg total RNA, 50 ng of random

hexamers, 2 µmol/L dNTPs, 40 units RNase inhibitor, and 200 units Superscript III reverse transcriptase

(RT) [Invitrogen]. Real-time PCR was performed in a 20-µl reaction, 96-well format (0.2 µl cDNA; 250

nmol/L of forward and reverse primer; 1x DyNAmo HS SYBR Green Master mix [Finnzymes]) using an

Opticon 2 real time PCR machine [MJ Research]. Three samples were measured in each experimental

group in triplicate, with a minimum of two independent experiments. The relative amount of target

mRNA normalized to GAPDH was calculated according to the method described by Pfaffl.11 Specific

primers that were used for the real-time PCR amplification included:

GAPDH Forward: 5’- TGA CCA CAG TCC ATG CCA TC -3’; GAPDH Reverse: 5’- GAC GGA CAC ATT GGG GGT AG -3’; β-MHC Forward: 5’ - TTC ATC CGA ATC CAT TTT GGG G -3’ β-MHC Reverse: 5’- GCA TAA TCG TAG GGG TTG TTG G -3’ BNP Forward: 5’- GAG GTC ACT CCT ATC CTC TGG -3’ BNP Reverse: 5’- GCC ATT TCC TCC GAC TTT TCT C -3’ Skeletal Actin Forward: 5’- GTGAGATTGTGCGCGACATC -3’ Skeletal Actin Reverse: 5’- GGCAACGGAAACGCTCATT -3’ SERCA2a Forward: 5’- CAT TTG CAT TGC AGT CTG GAT -3’ SERCA2a Reverse: 5’- CTT TGC CAT CCT ACG AGT TCC -3’ Calsequestrin Forward: 5’- AGA GCC TAT GAC CAT CCC AGA -3’ Calsequestrin Reverse: 5’- AAT GTG GAT TCC ATC CAG GTC -3’ RyR2 Forward: 5’- TCA AAC CAC GAA CAC ATT GAG G -3’ RyR2 Reverse: 5’- AGG CGG TAA AAC ATG ATG TCA G -3’ L-Type Ca2+ Channel Forward: 5’- ATGAAAACACGAGGATGTACGTT -3’ L-Type Ca2+ Channel Reverse: 5’- ACTGACGGTAGAGATGGTTGC -3’ Phospholamban Forward: 5’- AAGTGCAATACCTCACTCG -3’ Phospholamban Reverse: 5’- GATCAGCAGCAGACATATC -3’

Ms # CIRCRESAHA/2007/148379 / R2

6

Bacterial Recombinant Protein Expression

Both wild type and mutant α-TM54 cDNA constructs were designed to include an N-terminal Ala-Ser

dipeptide, added to functionally compensate for lack of acetylation of bacterially expressed

tropomyosin.12 The recombinant tropomyosin was expressed and purified using the Champion pET

SUMO Expression System [Invitrogen]. In brief, the cDNA constructs were cloned into pET SUMO

vector and transformed into chemically competent Mach1-T1R E. coli according to the manufacturer's

specifications. The coding sequences of the expression plasmids were confirmed by automated DNA

sequencing. The plasmid DNA construct was then transformed into BL21 (DE3) One Shot E. coli and

induced by IPTG. The recombinant tropomyosin was then purified using the ProBond resin precharged

with Ni2+ ions. The N-terminal peptide containing the 6-His tag and SUMO fusion protein was removed

employing SUMO Protease.

Circular Dichroism Measurements

Thermal stability measurements were made by following the ellipticity (θ) of TM at 222 nm as a function

of temperature, beginning at 5°C in 0.5 mol/L NaCl, 10-mmol/L sodium phosphate pH 7.5, 1 mmol/L

EDTA, and 0.5 mmol/L DTT using an Aviv model 215 spectropolarimeter. Data were obtained at 2°C

intervals with a protein concentration of 3 µmol/L. The apparent melting temperature and the

thermodynamic parameters for TM unfolding were calculated based on the assumption that the unfolding

could be fit by up to three independent helix-coil transitions with dissociation accompanying the helix-

coil transition at the highest temperature, as previously described.13

Ms # CIRCRESAHA/2007/148379 / R2

7

Supplemental Figure 1A. Western blot analysis of total TM protein expression in NTG, WT-TG

and mutant TG hearts. Whole cell homogenate (5 µg) was run on 10% SDS-PAGE gel. Blots were

probed with the striated TM-specific antibody and α-tubulin monoclonal antibody. The signal intensity of

the bands was quantified with ImageQuant version 5.1. The TM level found in NTG hearts was set at

100%. α-Tubulin was used as loading control.

Supplemental Figure 1B. Western blot analysis of myofilament incorporated TM protein in

NTG, WT-TG and mutant TG hearts. Myofibrilar protein preparations (5 µg) were run on 10% SDS-

PAGE gel. Blots were probed with the striated TM-specific antibody and α-actin (sarcomeric)

monoclonal antibody. The 10% SDS PAGE was unable to separate the wild type and the mutant TM

proteins in the TG mice and hence the TM band observed includes both the endogenous and transgenic

protein. The signal intensity of the bands was quantified with ImageQuant version 5.1. The TM level

found in NTG hearts was set at 100%. Actin was used as loading control.

WT-TG 1

NTG L67 L71 L76 L95 L30 WT-TG

1 WT-TG

2

α-TM

α- Actin (Sarcomeric )

α-TM

NTG L67 L71 L76 L95 L30 WT-TG

2

α-Tubulin

Ms # CIRCRESAHA/2007/148379 / R2

8

Supplemental Figure 2. pCa-force relation of skinned fiber preparations obtained from NTG and

DCM α-TM54 mice. i) NTG vs. moderate copy TG mice and ii) NTG vs. high copy TG mice. There

were significant decreases in tension development and pCa50 in skinned fiber bundles in both moderate

and high copy TG mice when compared to matched controls. Note there is no length dependent

activation of tension development in both moderate copy and high copy TG mice.

### P<0.001 between NTG 2.3 and TG 2.3

i. Moderate copy TG

ii. High copy TG

4.55.05.56.0 6.5 0

10

20

30

40

50

**

pCa

Forc

e (m

N/m

m2 )

NTG SL 1.9µm TG SL 1.9µm NTG SL 2.3µm

TG SL 2.3µm

5.05.56.06.5 0

10

20

30

40

50

pCa

Forc

e (m

N/m

m2 )

##

* P<0.05 between NTG 2.3 and TG 2.3; ** P<0.05 between NTG 1.9 and TG 1.9;

Ms # CIRCRESAHA/2007/148379 / R2

9

Supplemental Table 1: Cardiac Function of NTG and high copy TG mice at one month of age, assessed by M-mode Echocardiography

n, no. of mice, *P<0.05, ** P<0.01 *** P<0.001 NTG vs.TG

Parameters NTG, n=5 TG, L30 n=3 LVIDd, Left ventricular (LV) internal diastolic dimension (M-mode), mm 3.14 4.23*

LVISd, LV internal systolic dimension (M-mode), mm 1.55 3.52* FS%, LV fractional shortening (M-mode) 50.88 17.47*** IVSD, Interventricular septum in diastole (M-mode), mm 0.64 0.79* LVPWD, LV posterior wall in diastole (M-mode), mm 0.58 0.55 Vcf, LV circumferential fiber shortening (M-mode, Doppler) (circ.sec) 11.09 3.77***

CO, Cardiac output, (Doppler) ml/min 12.29 9.37 HR, Heart Rate, bpm 502.4 470.3 LV Isovolumic relaxation time (Doppler), msec 15.6 21.33

Ms # CIRCRESAHA/2007/148379 / R2

10

Supplemental Table 2: Cardiovascular and contractile parameters of NTG and high copy TG mouse hearts in the isolated work-performing heart preparations at one month of age

n, no. of mice, *P<0.05, ** P<0.01 *** P<0.001 NTG vs.TG

Parameters NTG, n=7 TG, L30 n=5

Systolic pressure, mmHg 149.8 ± 7.6 95.5 ± 8.9***

Diastolic pressure, mmHg -8.4 ± 3.6 7.1 ± 3.1***

End diastolic pressure, mmHg 7.7 ± 2.8 17.6 ± 3.3** Maximal rate of pressure development (+dP/dt) mmHg/s 3947 ± 252 2129 ± 227***

Maximal rate of pressure decline (-dP/dt) mmHg/s 3635 ± 233 1832 ± 379**

Half time to relaxation, (RT½), ms/mmHg 0.44 ± 0.013 0.58 ± 0.04**

Time to peak pressure (TPP), ms/mmHg 0.51 ± 0.06 0.74 ± 0.1*

Heart rate, beats/min 314 ± 11 245 ± 19**

Ms # CIRCRESAHA/2007/148379 / R2

11

References

1. Subramaniam A, Jones WK, Gulick J, Wert S, Neumann J, Robbins J. Tissue-specific regulation of

the alpha-myosin heavy chain gene promoter in transgenic mice. J Biol Chem. 1991;266:24613-

24620.

2. Muthuchamy M, Grupp IL, Grupp G, O'Toole BA, Kier AB, Boivin GP, Neumann J, Wieczorek DF.

Molecular and physiological effects of overexpressing striated muscle beta-tropomyosin in the adult

murine heart. J Biol Chem. 1995;270:30593-30603.

3. Neefjes JJ, Breur-Vriesendorp BS, van Seventer GA, Ivanyi P, Ploegh HL. An improved

biochemical method for the analysis of HLA-class I antigens. Definition of new HLA-class I

subtypes. Hum Immunol. 1986;16:169-181.

4. Jagatheesan G, Rajan S, Petrashevskaya N, Schwartz A, Boivin G, Vahebi S, DeTombe P, Solaro RJ,

Labitzke E, Hilliard G, Wieczorek DF. Functional importance of the carboxyl-terminal region of

striated muscle tropomyosin. J Biol Chem. 2003;278:23204-23211.

5. Sahn DJ, DeMaria A, Kisslo J, Weyman A. Recommendations regarding quantitation in M-mode

echocardiography: results of a survey of echocardiographic measurements. Circulation.

1978;58:1072-1083.

6. Feigenbaum H, Armstrong WF, Ryan T. Evaluation of systolic and diastolic function of the left

ventricle. In: Feigenbaum H, Armstrong WF, Ryan T, eds. Feigenbaum ’s Echocardiography. 6th ed.

Baltimore, MD: Lippincott Williams & Wilkins; 2005:138 –180.

7. Hoit BD. Echocardiographic assessment of mouse heart and aorta. In: Hoit BD, Walsh RA, eds.

Cardiovascular physiology in the genetically engineered mouse. 2nd ed: Kluwer Academic

Publishers; 2002:177-190.

8. Schmidt AG, Gerst M, Zhai J, Carr AN, Pater L, Kranias EG, Hoit BD. Evaluation of left ventricular

diastolic function from spectral and color M-mode Doppler in genetically altered mice. J Am Soc

Echocardiogr. 2002;15:1065-1073.

Ms # CIRCRESAHA/2007/148379 / R2

12

9. Muthuchamy M, Pieples K, Rethinasamy P, Hoit B, Grupp IL, Boivin GP, Wolska B, Evans C,

Solaro RJ, Wieczorek DF. Mouse model of a familial hypertrophic cardiomyopathy mutation in

alpha-tropomyosin manifests cardiac dysfunction. Circ Res. 1999;85:47-56.

10. Wolska BM, Keller RS, Evans CC, Palmiter KA, Phillips RM, Muthuchamy M, Oehlenschlager J,

Wieczorek DF, de Tombe PP, Solaro RJ. Correlation between myofilament response to Ca2+ and

altered dynamics of contraction and relaxation in transgenic cardiac cells that express beta-

tropomyosin. Circ Res. 1999;84:745-751.

11. Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic

Acids Res. 2001;29:e45.

12. Monteiro PB, Lataro RC, Ferro JA, Reinach Fde C. Functional alpha-tropomyosin produced in

Escherichia coli. A dipeptide extension can substitute the amino-terminal acetyl group. J Biol Chem.

1994;269:10461-10466.

13. Conway JF, Parry DA. Structural features in the heptad substructure and longer range repeats of two-

stranded alpha-fibrous proteins. Int J Biol Macromol. 1990;12:328-334.