at SciVerse ScienceDirect

Biochimie 94 (2012) 2498e2507

Contents lists available

Biochimie

journal homepage: www.elsevier .com/locate/b iochi

Research paper

A pyrophosphatase activity associated with purified HIV-1 particles

Céline Ducloux a, Marylène Mougel b, Valérie Goldschmidt a, Ludovic Didierlaurent b, Roland Marquet a,Catherine Isel a,*aArchitecture et Réactivité de l’ARN, Université de Strasbourg, CNRS, IBMC, 15 Rue René Descartes, 67084 Strasbourg, FrancebUMR 5236 CNRS, UMI&II, CPBS, 1919 Rte de Mende, Montpellier, France

a r t i c l e i n f o

Article history:Received 3 April 2012Accepted 22 June 2012Available online 3 July 2012

This paper is dedicated to the memory ofValérie Goldschmidt, who was tragicallytaken away from all her loved ones and issadly missed.

Keywords:RetrovirusReverse transcriptionResistanceExcisionPyrophosphorolysis

Abbreviations: HIV-1, human immunodeficiency vscriptase; AZT, 30-azido-30-deoxythymidine, zidovudindideoxythymidine; TAM, thymidine-associated resis(�) strong-stop DNA; NNRTI, non-nucleoside reverse tnucleoside/nucleotide reverse transcriptase inhibitopyrophosphorolysis; AZTRRT, AZT-resistant revepyrophosphatase.* Corresponding author. Tel.: þ33 3 88 41 70 40; fa

E-mail addresses: celine.ducloux@gmail.com (C. Dcpbs.cnrs.fr (M. Mougel), ludodidierlaurent@yaR.Marquet@ibmc-cnrs.unistra.fr (R. Marquet), C.Isel@i

0300-9084/$ e see front matter � 2012 Elsevier Mashttp://dx.doi.org/10.1016/j.biochi.2012.06.025

a b s t r a c t

Treatment of HIV-1 with nucleoside reverse transcription inhibitors leads to the emergence of resistancemutations in the reverse transcriptase (RT) gene. Resistance to 30-azido-30-deoxythymidine (AZT) and toa lesser extent to 20-30-didehydro-20-30-dideoxythymidine is mediated by phosphorolytic excision of thechain terminator. Wild-type RT excises AZT by pyrophosphorolysis, while thymidine-associated resis-tance mutations in RT (TAMs) favour ATP as the donor substrate. However, in vitro, resistant RT still usespyrophosphate more efficiently than ATP. We performed in vitro (�) strong-stop DNA synthesis exper-iments, with wild-type and AZT-resistant HIV-1 RTs, in the presence of physiologically relevant pyro-phosphate and/or ATP concentrations and found that in the presence of pyrophosphate, ATP and AZTTP,TAMs do not enhance in vitro (�) strong-stop DNA synthesis. We hypothesized that utilisation of ATPin vivo is driven by intrinsic low pyrophosphate concentrations within the reverse transcription complex,which could be explained by the packaging of a cellular pyrophosphatase. We showed that over-expressed flagged-pyrophosphatase was associated with HIV-1 viral-like particles. In addition, wedemonstrated that when HIV-1 particles were purified in order to avoid cellular microvesicle contami-nation, a pyrophosphatase activity was specifically associated to them. The presence of a pyrophospha-tase activity in close proximity to the reverse transcription complex is most likely advantageous to thevirus, even in the absence of any drug pressure.

� 2012 Elsevier Masson SAS. All rights reserved.

1. Introduction

Human immunodeficiency virus type 1 (HIV-1) belongs to theretroviridae family characterised by an obligatory reverse tran-scription step that converts the single stranded RNA genome intodouble-stranded DNA capable of integrating into the host cellchromosomes. Reverse transcription is catalysed by the virallyencoded reverse transcriptase (RT) bearing RNA- and DNA-dependent DNA polymerase, as well as RNase H activities [1].

irus type 1; RT, reverse tran-e; d4T, 20-30-didehydro-20-30-tance mutations; (�) ssDNA,ranscriptase inhibitors; NRTI,rs; WT, wild-type; PPi-lysis,rse transcriptase; PPase,

x: þ33 3 88 60 22 18.ucloux), Marylene.Mougel@hoo.fr (L. Didierlaurent),bmc-cnrs.unistra.fr (C. Isel).

son SAS. All rights reserved.

The reverse transcription step was the first to be targeted by theanti-retroviral compound AZT (zidovudine) [2], approved by theFood and Drug Administration for the treatment of AIDS patients in1987 [3]. After three decades of research and development ofantivirals against HIV-1, RT still remains a major drug target. The 12clinically approved anti-RT compounds are key backbone compo-nents of the current Highly Active Anti-Retroviral Therapies(HAART) that are administered to patients [4]. They are divided intothe two broad classes of Non-Nucleoside (NNRTIs) and Nucleoside/Nucleotide (NRTIs) RT Inhibitors. After intracellular phosphoryla-tion, all approved NRTIs are competitive analogues of the naturaldNTP substrates of RT and act as chain terminators once incorpo-rated into the elongating DNA chain (for reviews, see Refs. [5,6]).

The efficacy of anti-HIV-1 drug-therapy is limited by theunavoidable emergence of mutations that confer resistance to anyof the currently available drugs. In the case of NRTIs, resistancemechanisms fall into two categories (for reviews, see Refs. [5e8]): i)enhanced discrimination of the NRTI as compared to its naturalcounterpart, due to decreased incorporation efficiency of thenucleoside analogue. This can either be attributed to decreasedbinding of the NRTI and/or to a diminished rate of incorporation; ii)

C. Ducloux et al. / Biochimie 94 (2012) 2498e2507 2499

improved removal efficiency of the nucleoside analogue that is posi-tioned at the 30 end of the elongating DNA chain. Phosphorolyticexcision of the chain terminator is the reverse reaction to poly-merisation performed by HIV-1 RT (Fig. 1). It primarily concernsAZT and to a lesser extent d4T and other NRTIs [9]. The ability ofHIV-1 RT to perform excision is mainly linked to a set of up to 6mutations (M41L, D67N, K70R, L210W, T215F/Y and K219E/Q)within HIV-1 RT, the so-called TAMs. Insertions at position 69, inthe fingers subdomain, together or not with the TAMs and incombination with a T69S mutation, also increase the unblockingactivity of RT [9e14].

The first clues to understand the TAM-associated resistancemechanism came from in vitro biochemical experiments showingthat, despite its lack of exonuclease proof-reading activity, wild-type (WT) HIV-1 RT was capable of pyrophosphorolysis (PPi-lysis)[15,16]. Even though this data remains somewhat contradictory[17,18], increased excision with PPi as a donor substrate was re-ported, in vitro [19e21], for AZT-resistant RT (AZTRRT). A generalconsensus has been reachednowon the fact that AZTRRT is capable ofenhanced excision of AZT from the growing DNA chain [18,21e24].Although all nucleoside triphosphates can potentially be used asdonor substrates in vivo [24], ATP, for which the concentration isgreater than all other potential substrates in cells, is most likely thebiologically relevant one [24,25]. The reaction, similar to PPi-lysisand thus named ATP-lysis (Fig. 1), generates a dinucleoside tetra-phosphate, Ap4AZT [23]. Noticeably, the products generated byboth the PPi- and the ATP-dependent excision reactions, AZTTP[17,20,26,27] and Ap4AZT [28] can be re-incorporated in vitro byWT[29] or AZTRRTs [27,28] and act as efficient chain terminators.

The influence of the physiological environment, which changeswith the activation state of the cells for example, is crucial. Indeed,even though all NRTIs are potentially excised by AZTRRT, high dNTPconcentrations and in particular high concentrations of the nextnucleotide to be incorporated, almost completely abolish, in vitro,excision of all analogues except AZT and Abacavir [18,22,30,31].This phenomenon has been explained by the formation of a so-called “dead-end” primer/template/RT/NRTI/dNTP complex that isless stable when AZT is the terminating analogue [18,22,30,32].Recently, the comparison of the crystal structures of WT and AZT-resistant RTs, in complex with various primer/template substratesand in the presence or not of Ap4AZT [33] (i) confirmed that AZT-resistance mutations have no effect on AZT binding or incorpora-tion, and (ii) revealed that ATP binds differently to WT and AZT-

AZTTP

meT/Td-irP meT/TZA-irP

ATP

PPi

Pri/Tem

dTTP

PPi PPi

dNTP

Pri-dT-dN/Tem

PPi

AZTTP

Ap AZT 4

ATP

Ap AZT 4

1

2

Fig. 1. AZTTP incorporation and phosphorolytic excision. Template and primer areabbreviated by Tem and Pri respectively. After addition of AZTTP to the 30-end ofa primer (Pri-AZT/Tem), unblocking can occur in two ways: pyrophosphorolysis usingPPi as a donor substrate (Reaction 1) or ATP-lysis using ATP as a donor substrate(Reaction 2), respectively generating AZTTP and Ap4AZT as well as an unblockedprimer-terminus (Pri/Tem) that can resume DNA synthesis. Note that Ap4AZT is alsoa substrate for HIV-1 RT. Molecules that are involved in inhibition of DNA synthesis(AZTTP) and in the release of this inhibition in vivo (ATP) are in red. The products thatare generated by the reversal reaction to polymerisation, PPi-lysis or ATP-lysis, AZTTPand Ap4AZT, respectively, are in blue. (For interpretation of the references to colour inthis figure legend, the reader is referred to the web version of this article.)

resistant RTs, the resistance mutations, in particular K70R andT215Y, creating a new binding site for ATP.

Although the evidence listed above is compelling, mechanistic[34,35] and biochemical [36] and modelling [37] data accumulatedover the years continue to challenge a model that infers higheraffinity of the AZTRRT for ATP compared to WT RT. Indeed, pre-steady state kinetics performed by the group of K. Anderson [35]and by us (Rigourd & Marquet, unpublished data) show that PPi-lysis always remains, in vitro, more efficient than ATP-lysis, forboth WT RT and AZTRRT. This was further confirmed by intracellularmeasurements of the levels of pyrophosphorolysis donors fromcells in different metabolic states, revealing that PPi levels arehigher in extracts from activated T cells as compared to those inquiescent cells [24]. In vitro experiments at PPi and ATP concen-trations matching those found in activated T cells show that PPi-lysis predominates and that AZT-resistant and WT HIV-1 RTs haveoverall similar excision activities [24]. In addition, no difference inATP binding in the presence or absence of AZT resistance mutationshas been reported [35,38,39], although these results are stillcontroversial [26,40] and challenged by the fact that Ap4AZT, theexcision product of ATP-dependent AZT removal, has higher affinityfor AZTRRT than AZT [28]. These findings raise the question as towhyATP-lysis, rather than PPi-lysis, is the resistance mechanismselected by AZTRRTs. The explanation which we favour and has alsobeen put forward by others [24], is that low PPi concentrationwithin the reverse transcription complex (RTC) would drive for theuse of another abundant donor, i.e. ATP, for the excision reaction tooccur. Such low PPi concentration could be the consequence of thepresence, within the contained RTC, of a cellular pyrophosphatase(PPase) that would be packaged into the viral particles.

2. Results

2.1. AZT-resistance mutations do not improve (�) ssDNA synthesisin the presence of AZTTP and under physiological PPi and ATPconditions

In order to test the potential benefits of the AZT-resistancemutations for DNA synthesis in the presence of AZTTP, wecompared the efficacy of in vitro (�) ssDNA synthesis by either WTRT or AZTRRT, in the absence and presence of AZTTP and in theabsence and presence of physiological concentrations of PPi(150 mM) [41] and/or ATP (3.5 mM) [42,43]. A viral RNA corre-sponding to the first 311 nucleotides of the HIV-1 MAL isolate wasused as a template and a labelled DNA oligonucleotide comple-mentary to the primer binding site (PBS) sequence, was used asa primer. Utilisation of a labelled primer allowed direct quantifi-cation of the extended products as well as identification of AZTTPincorporation and AZTMP excision sites. Importantly, AZTTP, ATPand dNTP solutions were treated, prior to their usage, with purifiedcommercially available PPase in order to avoid any artefacts thatcould potentially arise from PPi contamination.

In addition to the intermediate products and the full-length (�)ssDNA, longer products which are due to self-priming and aredetected only with RNAse H(þ) RT [44], were observed. Compar-ison of panels a of Figs. 2 and 3 as well as quantification of the finalamount of (�) ssDNA and self-priming products that are synthe-sized (Table 1) revealed that both WT and AZT-resistant enzymes,bearing RNase H activity, behave very similarly, in the absence ofAZTTP, during the first step of retroviral cDNA synthesis. Addition of3 mM of AZTTP to the reverse transcription assay inhibited DNAsynthesis by over 90% (Table 1), for both WT and AZTRRT, due to theincorporation of AZTTP at different positions during (�) ssDNAsynthesis (Figs. 2 and 3, panels b). The AZTTP incorporation sitesand inhibition patterns were also very similar for both enzymes

+16

+36

+16

+36

+16

+36

Unextendedprimer (ODN)

+16

+36

A-rich tract

(-) strong-stop

DNA (+178)

+16

+36

AZTTP

time

AZTTP/PPi

time

AZTTP/ATP

time

AZTTP/PPi/ATP

timetime

a b c d e

Fig. 2. Incorporation and excision kinetics of AZTMP by wild-type HIV-1 RT during (�) ssDNA synthesis. Ten nM of ODN/1-311 RNA complex were pre-incubated with 25 nM of WTHIV-1 RT. Reactions were initiated by the addition of 50 mM of each dNTP in the absence (a) or in the presence of 3 mM of AZTTP (b, c, d and e) and in the presence of 150 mM of PPi(c and e) and/or 3.5 mM of ATP (d and e). Reactions were stopped at 1, 5, 20, 40, 60, 90 and 120 min. Orange stars: examples of AZTMP incorporation sites. Green stars: examples ofAZTMP excision sites. Red stars: examples of sites where AZTMP excision and extension is lower than its incorporation. Burgundy line: A-rich sequence upstream of the PBS.(For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

C. Ducloux et al. / Biochimie 94 (2012) 2498e25072500

(Figs. 2 and 3, panels b) in agreement with previously publishedresults [45]. We then performed (�) ssDNA synthesis in the pres-ence of AZTTP and PPi. In the presence of PPi and AZTTP, recovery ofDNA synthesis compared to the conditions where AZTTP only ispresent was quite dramatic (Figs. 2 and 3, panels c), reaching 42 and33% of the levels obtained in the absence of AZTTP, for WTand AZT-resistant RTs, respectively (Table 1). Rescue of DNA synthesis due toexcision of AZTMP did not seem to vary, in the presence of PPi,whether WT or AZRRRT was used. As expected, in the presence ofAZTTP and 3.5 mM of ATP, rescue of DNA synthesis was moreefficient for AZTRRT compared to the WT enzyme (Figs. 2 and 3,panels d): the final (�) ssDNA product reached 11% of the total DNAproducts with AZTRRT whereas it only reached 3% with WT RT,corresponding to rescue rates of 25 and 6%, respectively. This was inagreement with previously published data that highlighted the factthat only the AZT-resistant enzyme is capable of efficient AZTremoval in the presence of ATP as the donor substrate [18,21e23].

We then studied rescue of (�) ssDNA synthesis in the presenceof both donor substrates at physiological concentrations (Figs. 2and 3, panels e). Remarkably, the percentage of (�) ssDNAsynthesized in the presence of both PPi and ATP reached 23 and 29%for WT and AZT-resistant RTs respectively, with correspondingrescue rates of 71 and 75% (Table 1), much higher than those ob-tained in the presence of PPi only. This result was rather unex-pected for WT HIV-1 RT. It does not sustain NRTI excision byATP-lysis and highlights a cooperative effect between both pyro-phosphates donors, PPi and ATP, to activate the repair reaction.

Notably, the efficiency of excision varied considerably depend-ing on the AZTTP incorporation site and on the nature of the donor

substrate(s) present in the assay (Figs. 1 and 2, green stars e effi-cient AZTMP excision sites e versus red stars e AZTTP incorpora-tion sites with no excision), but there was hardly any differencebetween WT and AZT-resistant RTs. As an example, in the A-richtract upstream of the PBS sequence (burgundy line), repair ofAZTMP was observed for the first 3 sites (green stars) in the pres-ence of PPi as a donor, the first 2 only when ATP is the donorsubstrate and 4 out of the 5 sites when both donors are used. Theseresults are in agreement with previously published data indicatingthat efficiency of ATP-lysis is dependent on the template sequence[46]. Incidentally, these results also highlight the difficulty inobtaining kinetic data for excision that will be representative of theglobal phenomenon, since the behaviour greatly varies dependingon the incorporation site.

In conclusion, our experiments clearly revealed that the so-called TAM-resistance mutations did not confer, in vitro, anyobvious advantages to AZTRRT during (�) ssDNA synthesis, andmostlikely full-length retroviral cDNA synthesis, when both ATP and PPiwere present. Yet the mutations are selected in vivo for the usage ofthe most abundant substrate, ATP, to perform AZT excision. Ourhypothesis to reconcile in vitro and in vivo data is that the drive forthe virus to select ATP rather than PPi as a donor substrate is due tolow PPi concentrations within the RTC. Such low PPi concentrationcould be due to the presence of a cellular PPase in the vicinity of theRTC. Since (�) ssDNA synthesis is initiated inside the viral particles[47,48] and DNA synthesis is completed after infection [49], insidethe RTC that is generated by viral particle uncoating [50], wesearched for the presence of PPase and PPase activity within HIV-1virions.

+36+36

+36

+16 +16+16

Unextendedprimer (ODN)

+36

+16

(-) strong-stop

DNA (+178)

+36

+16

a b c d e

AZTTP/ATP AZTTP/PPi/ATP AZTTP AZTTP/PPi

time time time time time

A-rich tract

Fig. 3. Incorporation and excision kinetics of AZTMP by the AZT-resistant HIV-1 RT during (�) ssDNA synthesis. Ten nM of ODN/1-311 RNA complex were pre-incubated with 25 nMof AZT-resistant HIV-1 RT. Reactions were initiated by the addition of 50 mM of each dNTP in the absence (a) or in the presence of 3 mM of AZTTP (b, c, d and e) and in the presence of150 mM of PPi (c and e) and/or 3.5 mM of ATP (d and e). Reactions were stopped at 1, 5, 20, 40, 60, 90 and 120 min. Orange stars: examples of AZTMP incorporation sites. Green stars:examples of AZTMP excision sites. Red stars: examples of sites where AZTMP excision and extension is lower than its incorporation. Burgundy line: A-rich sequence upstream of thePBS. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

C. Ducloux et al. / Biochimie 94 (2012) 2498e2507 2501

2.2. Flagged-pyrophosphatase is associated with viral-like particles

Sequence analysis of the human database (Genbank) revealedthe existence of two different PPases, a cytoplasmic enzyme, PPA1

Table 1Comparison between (�) ssDNA synthesized by WT or AZTRRT, in the presence orabsence of AZTTP, ATP and PPi.

Reaction mix % Finalproduct

% Increaseof final productdue to PPiand/or ATP

% Finalproductrescue

WT RT dNTPs 32dNTPs þ AZTTP 1dNTPs þ AZTTP þ PPi 14 13 42dNTPs þ AZTTP þ ATP 3 2 6dNTPs þ AZTTP þ ATP þ PPi 23 22 71

AZTRRT dNTPs 38dNTPs þ AZTTP 2dNTPs þ AZTTP þ PPi 14 12 33dNTPs þ AZTTP þ ATP 11 9 25dNTPs þ AZTTP þ ATP þ PPi 29 27 75

Utilization of a labelled primer allows quantification, at the 120 min time point, of allthe reverse transcription products, as well as the non-elongated primer. Final productincludes the (�) ssDNA as well as the self-priming product produced by HIV-1 RTbearing RNase H activity. The percentage of final product ((�) ssDNA þ self primingproduct) is the amount of final product formed after 120min incubation expressed aspercentof the total amountof elongatedandnon-elongatedproducts. The% increaseoffinal product due to PPi and/or ATP is the difference between the % final product withAZTTP alone and the % final product when AZTTP is present together with PPi and/orATP. The percentage of final product rescue was calculated as follows.

%ð�Þfinal product rescue ¼ %ð�Þfinal product due to PPi and=or ATPð%ð�Þfinal productþ dNTPsÞ � ð%final productþ AZTTPÞ

(NM_021129.3), and 5 different isoforms of a mitochondrial one,PPA2 (NM_176869.2, NM006903.4, NM_176866.2, NM_176867.3,NM_001034191.1). To date, only PPA1 and isoform 1 of PPA2 havebeen cloned and characterised [51,52].

To analyse expression, at the mRNA level, of PPases in the celllines used throughout the work for HIV-1 production, we carriedout RT-PCR reactions on total cellular RNA extracts. Sequencing ofthe amplification products revealed that PPA1 and isoform 1 ofPPA2 mRNAs are present in the cell lines tested, whereas the otherPPA2 isoforms were not detected (data not shown).

In order to detect the packaged PPAse(s) inside HIV-1 viral-likeparticles (VLPs), we co-transfected 293T cells with a plasmidexpressing either the N-terminal Flag-tagged PPA1 or theN-terminalFlag-tagged PPA2 (isoform 1) together with the pNL4-3Denvconstruct. In parallel, cells were transfected with an empty plasmid(pUC18) alone or with one of the Flag-PPase vectors, as controls.Efficient expression of the Flag-taggedPPases in 293Twasmonitoredindependently bywestern blotting, using an anti-Flag antibody (datanot shown and Fig. 4a and b, “CELL” lanes 3e8). Co-transfectionswere done using three different molar ratios (1:0, 1:3, 1:5 and1:11) between the viral clone and the flagged-PPase vector. Controlco-transfections with the pUC18 and the flagged-PPase plasmidswere performed at the same ratios as indicated above.

Cell lysates were prepared and 100 mg of total proteins (quan-tified using a Bradford assay) were separated on SDS-PAGE gels.Western blots using an anti-Flag antibody revealed expression ofboth N-terminally Flag-tagged PPases (Fig. 4a and b, panels I) withincreasing expression of the flagged enzymes when increasingamounts of DNA were used for transfection. Noticeably, expressionof the flagged-PPases wasmore efficient when pNL4-3Denvwas co-

C. Ducloux et al. / Biochimie 94 (2012) 2498e25072502

transfected rather than the empty pUC18 vector (Fig. 4a and b,compare lanes 3&6, 4&7 and 5&8). Interestingly, no Flag-taggedPPases were detected in pelleted supernatant, i.e. microvesicles,obtained from cells transfected with the Flag-PPase alone (Fig. 4aand b, panels V, lanes 3e5). Western-blotting using an anti-p24antibody revealed efficient production of HIV-1 unprocessedPr55Gag and mature p24 capsid protein, in cell lysates (Fig. 4a andb, panels II, lanes 1, 6, 7 and 8) and in pelleted supernatants fromtransfections (containing a mixture of VLPs and microvesicles)performed with the pNL4-3Denv plasmid (Fig. 4a and b, panels IV,lanes 1, 6, 7 and 8). Interestingly, the dose-dependent increase offlag-tagged-PPA1 following the increase in the amount of trans-fected PPase DNA (Fig. 4a, panel I, lanes 3e5 and 6e8) is also foundin the pelleted VLPs (Fig. 4a, panel V, lanes 6, 7 and 8). In contrast,Flag-PPA2 was hardly detected in pelleted VLPs (Fig. 4b, panel V,lanes 6, 7 and 8), indicating that overexpression of Flag-PPA2 incells is not sufficient for an efficient incorporation into viral parti-cles. Altogether, these results strongly suggest the presence ofmainly one PPase, PPA1, associated with HIV-1 VLPs.

2.3. A pyrophosphatase activity is associated with OptiPrep�-purified HIV-1 virions

Studying the presence of cellular proteins in HIV-1 virions andtheir role in the replication cycle has been long hampered by thefact that viral particle preparations were contaminated by cellularproteins. This is mainly due to the fact that HIV-1 virion formationand release utilize, at least partly, some intracellular pathwaysinvolved in cellular vesicle trafficking [53e55]. Therefore, in orderto remove cellular microvesicles, that also share similar physico-chemical properties with virions [56,57] from HIV-1-containingsupernatants, we decided to use OptiPrep� gradients to purifyviral particles [58]. OptiPrep� is made of iodixanol, which allowsmigration of particles in iso-osmotic conditions in order to avoidany change of volume and to preserve their density.

In order to detect the PPase enzymatic activity within purifiedHIV-1 particles, purification of high amounts of virus, uncontami-nated by cellular material, is also required. To obtain such largeamounts of HIV-1 virions, 293T cells were transfected with pNL4-3plasmid and the supernatant produced during 48 h was used toinfect permissive 42CD4 cells. The supernatants of infected cells

Fig. 4. Detection of Flag-tagged PPases in cells and viral-like particles. Cells were transfecteand Puc18) at different molar ratios. Three mg of the pNL4-3Denv plasmid were used with incNter or PPA2-Flag-Nter plasmids. Cell lysates (CELL) were prepared and tested for the preseb-actin (a & b, III) using anti-flag (panels I), anti-p24 capsid (panels II) and anti-actin (pacontaining microvesicles only (lanes 2, 3, 4 and 5) or microvesicles þ viral-like particles (laneof the viral p24 capsid protein (a, IV and b, IV) and Flag-tagged PPA1 (a, V) or Flag-tagged(panels V) antibodies, respectively. M: molecular weight marker.

were collected during 6 days and pooled. Viral particles were thenpelleted on 20% sucrose cushions by ultracentrifugation. Resus-pended pellets were loaded on OptiPrep� gradients to purify viralparticles [58]. As a control, supernatants of mock infected cells thatwere not infected by the virus (“mock.”) were treated in the sameway as samples obtained from HIV-1 producing cells (“HIV-1.”). Asindicated on Fig. 5a, the density distribution for the gradient loadedwith HIV-1 supernatant (“HIV-1”, red symbols) was very similar tothe one run with the mock sample (“mock”, blue symbols). Thisallowed direct comparison of the fractions collected from bothgradients. A p24 Elisa test, performed on each fraction of the “HIV-1” gradient, indicated the presence of a p24 peak around aniodixanol concentration of 15% corresponding to the 11th fraction(Fig. 5a, black curve). This was confirmed by western blottingexperiments that showed an enrichment of the same fraction 11 inboth viral p24 and RT proteins (Fig. 5b and c). This result isconsistent with previously published data [58]. A PPase activity testwas then performed on all fractions of both the “HIV-1” and “mock”gradients. In the case of the “mock” gradient, a peak of PPaseactivity (Fig. 5a, blue curve) appeared in fraction 9, correspondingto an iodixanol concentration of 10%. According to previouslypublished results [58], this matches the migration zone of cellularmicrovesicles, which, according to our result, contain a PPaseactivity. In the case of the “HIV-1” gradient (Fig. 5a, red curve), onemain peak emerged at fraction 11, together with the virus(see above), with a shoulder that most likely corresponded to thepreviously identified cellular microvesicles (fraction 9 of the“mock” gradient). Hence we conclude that PPase activity is asso-ciated with purified HIV-1 particles.

3. Discussion

In order to gain a better understanding of the AZT-resistancemechanism that is mediated by phosphorolytic excision of thechain-terminating nucleoside analogues, reverse transcriptionassays were performed in the presence of AZTTP and of both donorsubstrates, PPi and ATP, at physiologically relevant concentrations,either alone or combined together.

Repairof AZT-terminatedDNAchainswasmuchmore efficient forWT RT in the presence of PPi (42%, Table 1) than for AZTRRT in thepresence of ATP (25%, Table 1), confirming that PPi-lysis is more

d with a combination of vectors (Flagged-PPA1 or PPA2 (isoform1), HIV-1 pNL4-3DEnvreasing molar ratios (pNL4-3Denv/PPase-Flag-Nter: 1:3, 1:5 and 1:11) of the PPA1-Flag-nce of flag-tagged PPA1 (a, I) or PPA2 (isoform 1) (b, I), p24 viral capsid (a & b, II) andnels III) antibodies, respectively. The supernatants (SUPERNATANT) of cultured cells,s 1, 6, 7 and 8) were sedimented through a sucrose cushion and tested for the presencePPA2 (isoform1) (b, V) by western blot using anti p24-capsid (panels IV) and anti-Flag

Fig. 5. Purification of HIV-1 virions on a 1e40% OptiPrep� gradient. (a) Samples ob-tained from virally infected (“HIV-1”) and mock infected cells (“mock”) were analysedfor their density (blue and red symbols, respectively), amount of p24 (black curve) andPPase activity (red and blue curves, for “HIV-1” and “mock” samples respectively). p24amounts were obtained by Elisa, density was calculated from the refraction index andPPi hydrolysis percentages were obtained by Phosphorimager quantification of enzy-matic PPase activity tests. Each fraction of the gradient loaded with HIV-1 supernatant(“HIV-1”) was also analysed by western blot. Antibodies specific for the HIV-1 capsidp24 (b) and the heterodimeric p66/p51 HIV-1 RT (c) were used. (For interpretation ofthe references to colour in this figure legend, the reader is referred to the web versionof this article.)

C. Ducloux et al. / Biochimie 94 (2012) 2498e2507 2503

efficient than ATP-lysis [18,26,40]. Rescue of DNA synthesis was alsostudied in the presence of both donor substrates and to our knowl-edge this is the first time such an experiment has been performed.Since it was measured [18,26,40] that both WT and AZTRRT share thesame affinity for ATP, one could imagine that both donor substratescompete for binding to the catalytic site. ForWT RT, which is unableto use ATP for the excision reaction [18,35], thiswould imply that therescue rate in the presence of both PPi and ATPwould be lower thanthe one obtainedwith PPi alone. A diminished rescue ratewould alsobe expected for AZTRRT, since ATP-lysis is less efficient than PPi-lysis[35]. Despite this, and rather unexpectedly, the percentage of (�)ssDNA (23% and29% forWTand AZTRRT, respectively, Table 1) and therescue rates (71% and 75% % forWTand AZTRRT, respectively, Table 1)

in the presence of both PPi and ATP are significantly higher in thepresence of both donor substrates compared to PPi alone. Sucha result could be explained by a cooperative effect between bothdonors to activate the repair reaction, rather than a competition.Recently, ATP was presented as an allosteric regulator of WT ormutantHIV-1 RTs,whichwould result in an increase of the affinity ofthe enzyme for the dNTPs and of the inhibition constants of NRTIs[39]. The explanationwe favour is somewhat different. Indeed, in thepresence of 3.5 mM of ATP, the effective Mg2þ concentration in ourassay drops from 6mM to 2.6 mM, due to the chelation of Mg2þionsbyATP. Under such condition, according to our published results [59],the polymerase activity is increased whereas both RNase H activityand AZTTP discrimination are decreased. The same effects have beenobserved when EDTA or EGTA, well-known magnesium ion chela-tors, were added, instead of ATP, to the reaction mixture containing6mMofMgCl2 [59]. Hence, the high rescue rate thatwas observed inthe presence of PPi and ATP with WT RT (71%) would be due to thecumulative effects ofMg2þ chelation by ATP and efficient excision byPPi-lysis. With AZTRRT, the similar level of rescue rate (75%) suggeststhat PPi-lysis is still the predominantmechanism in this case. The factthat HIV-1 RT has evolved to acquire TAM resistance mutations canthus only be explained if we assume that PPi-lysis is low, in vivo.

Low levels of PPi in the vicinity of the RTC could be achieved bythe selective packaging, inside the viral particles, of a cellular PPase.Two families of soluble PPases, that do not share any sequencessimilarities [60], are known to date: Family I which includesprokaryotic, plant and animal/fungal PPases and Family II, which ismuch smaller and includes Bacillus subtilis and putative PPasesfrom other bacterial strains. Inorganic PPases catalyse the intra-cellular hydrolysis of PPi into orthophosphate. PPi is a byproduct ofmany biological reactions such as RNA, DNA, oligosaccharide, cAMPand cGMP synthesis and tRNA charging reactions. Thus, in order toensure correct levels of all these biomolecules, cells must maintaina strict control over the PPi concentration, which has to be with-drawn from the equilibrium. This function is taken over by thePPases, which therefore belong to the essential family of house-keeping enzymes. Human cytosolic PPA1 [52] as well as mito-chondrial PPA2 [51] have been cloned and share the conservedDNDPID catalytic site. As expected, both enzymes are ubiquitouslyexpressed in human tissues.

To look for the possible presence of cellular PPase(s) inside HIV-1 VLPs, we co-transfected 293T cells with increasing amounts of N-terminally flag-tagged PPA1 or PPA2 (isoform 1) in combination ornot with the HIV-1 pNL4-3Denv molecular clone (Fig. 4). Eventhough Flag-tagged PPA1 was undetectable in cellular micro-vesicles (Fig. 4a, panel V, lanes 3e5), it became clearly visible whenmicrovesicles were copelleted with HIV VLPs (Fig. 4a, panel V, lanes6e8). Finally, since Flag-PPA2 remained undetectable in cell culturesupernatants containing microvesicles and HIV-1 VLPs, weconcluded that PPA1 is the main candidate for encapsidation intoHIV-1 particles.

To study the involvement of a protein of cellular origin in theHIV-1 replication process, the absence of cellular protein contam-ination fromviral particle preparation is crucial. The main source ofthis contamination is from microvesicles or exosomes that sharesimilar physical properties with virions. In order to separate viralparticles from microvesicles of cellular origin, we thus performed,according to a recently published procedure [58], OptiPrep�gradient purification of high amounts of wild-type infectious viralparticles produced by HIV-1 infected cells (Fig. 5). An enzymaticassay performed on all fractions of the gradient revealed PPaseactivity overlapping with the presence of virions, at an iodixanolconcentration of 15% (Fig. 5). The most obvious interpretation isthat this co-elution is due to the presence of a PPase inside the viralparticle, but we can of course not completely exclude that the

C. Ducloux et al. / Biochimie 94 (2012) 2498e25072504

enzyme is only loosely attached to the virion or adsorbed at itsexternal surface. Microvesicles, that purify around 10% iodixanol[58], also carry PPase activity, as evidenced by the shoulder in themain PPase peak obtained when infectious supernatants wereloaded on the OptiPrep� gradient and by the PPase peak obtainedfor the mock control, at the same iodixanol concentration (Fig. 5a).It is not clear to us why microvesicles carry PPase activity while thepresence of Flag-PPA1 and Flag-PPA2 proteins is not detected inmicrovesicles (Fig. 4), but we believe it could be due to the fact thatthe PPase enzymatic test is much more sensitive than westernblotting analysis.

The implication of cellular proteins during the replication cycleis an integral feature of the HIV-1 life cycle: the virus hijackscellular proteins andmachinery for its ownpurposes. Knowledge inthe field of virusehost interactions has considerably expanded inthe past few years mainly due to the large scale genomic andproteomic screens (for a recent review, see Ref. [61]) that have beenperformed. Surprisingly, the results generated by the differentscreens, performed under different conditions, display only verylittle overlap [62] despite the large number of cellular proteinsidentified as partners of viral replication. Although these screensprovide an important working basis, they are not exhaustive andmore specific studies are still needed. No cellular PPase has beenidentified so far in any of the screens published nor has it beendirectly implicated in reverse transcription by specific biochemicalexperiments. This does not necessarily imply that PPase is notinvolved in reverse transcription nor packaged into the viralparticles. Indeed, some host proteins that have been identified byother means as crucial for viral replication, such as LEDGF/75 [63]or APOBEC proteins [64,65], have not been identified at all, oronly in one of the screens (in the case of TSG101 and CRM1). In thespecific case of reverse transcription, the involvement of cellularproteins such as AKAP14 [66], the DNA topoisomerase I [67], RNAhelicase A [68], APOBEC 3G and 3F (for a review, see Ref. [64]), INI1[69] and Hur [66,70], has been documented.

Pyrophosphate, just like other small molecules such as dNTPs,likely readily enters the RTC and reaches, in close proximity to thereverse transcription reaction, a concentration that is similar to thecytoplasmic one. In standard reverse transcription conditions, inthe absence of inhibitor, when the polymerization rate is muchfaster than the excision rate, the presence of a PPase would mostlikely not provide any outstanding advantage. Indeed, we showedthat in the absence of AZTTP, the presence or not of PPi did notaffect the pausing profile nor the amount of final product during(�) ssDNA synthesis [71]. However, we showed that in the presenceof saturating substrate concentrations, DNA synthesis on a non-structured template is only 100 times faster than its reverse reac-tion, PPi-lysis [71]. Therefore, maintaining a low PPi concentrationwhere synthesis of the viral DNA is strongly delayed, as can be thecase when RT encounters a stable secondary structure within thetemplate, or during strand displacement taking place during LTR[72] or central flap DNA [73] synthesis would be beneficial, andpossibly essential for viral survival, even in the absence of anyselection pressure. In that line, it would be of great interest to studythe packagingmechanism of the cellular PPase(s) and subsequentlyto inhibit that packaging and further study the evolution of theresistance mechanisms of viruses that are deprived of PPase(s).

4. Materials and methods

4.1. Plasmids constructs

The pNL4-3Denv plasmid contains the pNL4-3 isolatesequence deleted of 580 nucleotides between positions 724 and1304 of the env gene. For the expression of N-terminal Flag-

tagged PPases, the sequences of PPA1 and isoform 1 of PPA2(kind gifts of Dr G. Patejunas, Stony Brook University, N.Y. andProf. M. Johansson, Karolinska Institute, Stockholm, respectively)were PCR-amplified and cloned between the HindIII andBamHI restriction sites of the p3XFLAG-CMV-7.1 vector whichcontains the CMV promoter and a 3XFLAG sequence. For PPA1and isoform 1 of PPA2, the PCR primers used were as follows:PPA1-Flag-Nter-Fwd : 50GTACAAGCTTAGCGGCTTCAGCACC30;PPA1-Flag-Nter-Rev: 50GATCGGATCCTTAGTTTTTCTGGTGATGG30;PPA2-Flag-Nter-Fwd: 50GATCAAGCTTGCCCTGTACCACAC30; PPA2-Flag-Nter-Rev: 50GATCGGATCCTTACTTGCCAAGGAAG30.

4.2. In vitro reverse transcription assay

Wild-type RNA template corresponding to the first 311 nucleo-tides of the HIV-1MAL isolate was produced by in vitro transcriptionusing the RNA polymerase of phage T7 according to previouslypublished procedures [74]. The 18-mer DNA primer (ODN)complementary to the Primer Binding Site (PBS) was chemicallysynthesised. One hundred pmoles of ODNwere 50 end-labelledwith100 mCi of [g-32P]ATP (3000 Ci/mmole, Perkin Elmer) and poly-nucleotide kinase from phage T4 (Fermentas). For in vitro reversetranscription experiments, the RNA templatewas hybridised to ODNat a 3:1 molar ratio, according to Ref. [74]. Primer/Template (P/T)duplex (10 nM final concentration) was pre-incubated with 25 nM(final concentration) of WT RT or AZT-resistant RT (bearing theD67N, K70R, T215F and K219Q mutations), both kindly provided bythe laboratory of Dr. M.A. Parniak (University of Pittsburgh School ofMedicine, Pittsburgh, USA) at 37 �C for 4min, in 50mMTriseHCl pH8.3 (37 �C), 50 mM KCl, 6 mM MgCl2 and 1 mM DTT. Reverse tran-scription was initiated by the addition of 50 mM of each of the fourdNTPs in the presence or not of AZTTP (3 mM), ATP (3.5 mM) and/orPPi (150 mM). Reaction was stopped at 1, 5, 15, 30 and 60 min by theaddition of formamide and reaction products were analysed on an8% denaturing polyacrylamide gel. The final products of reversetranscription ((�) strong-stop DNA and self priming products) werequantified using a Fuji FLA-5100 phosphorimager. To ensure thatdNTPs, AZTTP and ATPwere not contaminated with PPi, stocks weresystematically treatedwith commercially available PPasewhichwassubsequently removed by filtration through centricon.

4.3. Cell lines and viral production

293T (purchased from ATCC, reference number: CRL-1573�)and 42CD4 [75] cells were maintained in DMEM media supple-mented with 10% newborn calf serum (Eurobio), penicillin (100 U/ml) and streptomycin (100 mg/ml) at 37 �C in 5% CO2. Non-infectious viral stocks were obtained by transfecting 293T cellswith the pNL4-3Denv proviral plasmid (bearing a deletion betweennucleotides 7030 and 7611 of the viral genome) using Fugene HDtransfection reagent (Roche) as per manufacturer’s instructions.48 h post-transfection, pNL4-3Denv viral-like particles containingmedium was clarified by centrifugation for 10 min at 3000 rpmfollowed by filtration using 0.45 mm filters. Wild-type pNL4-3 viralstocks were made by transfecting 293T cells with calcium phos-phate using a mixture of pNL4-3 vector (20 mg/ml final concen-tration), HBS 1X (140 mM NaCl, 5 mM KCl, 0.7 mM Na2HPO4,5.6 mM dextrose, 20 mM HEPES (pH 7.5) and 125 mM CaCl2). Thevirus produced was harvested 48 h post-infection and amplified byinfecting 42CD4 cells, which are HEK-293 cells that stably coex-press the CD4/CXCR4 HIV-1 receptor/co-receptor [76,77]. From day6 to day 9 after infection, wild-type viruses were collected each dayfollowing the same procedure: medium was harvested, clarifiedand filtered as described above and new medium was added untilthe next day.

C. Ducloux et al. / Biochimie 94 (2012) 2498e2507 2505

4.4. Search for the presence of a PPase in cells and viral-likeparticles

293T cells (7.5 � 106) were co-transfected with the pNL4-3Denvplasmid and the PPA1-Flag-Nter or PPA2-Flag-Nter plasmid, usingFugene HD (Roche) according to the manufacturer’s protocol. Threemg of the pNL4-3Denv plasmid were used with increasing molarratios (pNL4-3Denv/PPase-Flag-Nter: 1:3, 1:5 and 1:11) of thePPA1-Flag-Nter or PPA2-Flag-Nter plasmids. As a control, 293T cellswere also co-transfected with pUC18 and the PPA1-Flag-Nter orPPA2-Flag-Nter plasmids using the same molar ratios. pUC18 andpNL4-3Denv were also transfected on their own. Two days aftertransfection, the supernatants of cultured cells were clarified bycentrifugation for 10 min at 3000 rpm followed by filtration using0.45 mM PES filters. These stocks containing viral-like particles andmicrovesicles were then sedimented by centrifugation througha 20% sucrose cushion in a SW32.1 Ti rotor at 30 K for 1 h 3o min at4 �C and the pellets were resuspended in 40 mM TriseHCl pH 8(37 �C), 10 mM MgCl2, 6 mM KCl, 2 mM DTT and Triton X-100. Thesamples were analysed by western blot using anti-p24 capsid andFlag antibodies (see SDS-PAGE and immunoblot analysis below). Atthe same time, cells were treated with RIPA 1X (8 mM Na2HPO4,2 mM NaH2PO4, 100 mM NaCl, 1% NP40, 0.5% desoxycholate, 0.05%SDS) with antiprotease (Thermo Scientific) and the protein contentin lysates was determined using the Bio-Rad Bradford assay kit. Thecell lysates were also analysed by western-blot using anti Flag, p24capsid and actin antibodies (see SDS-PAGE and immunoblot anal-ysis below).

4.5. Purification of virions on OptiPrep� gradients

Wild-type viral stocks were sedimented by centrifugationthrough a 20% sucrose cushion in a SW32 Ti rotor at 25 K for 2 h30 min, at 4 �C. The pellet was resuspended in PBS (8 mMNa2HPO4,2 mM NaH2PO4, 100 mM NaCl), loaded onto a 1e40% OptiPrep�gradient prepared in 1X PBS and ultracentrifuged at 31 K for 3 hat 4 �C using a SW32.1 Ti rotor. After centrifugation, 1 mlfractions were collected and spun down in a TLA 100.2 rotor at95 K for 10 min at 4 �C. Pellets were resuspended into a bufferadapted to the PPase activity test (see below). For each pelletedfractions, the refraction index was measured and thecorresponding density calculated, the amount of p24 protein wasquantified by Elisa (Elisa anti-p24 HIV, Beckman Coulter), the p24and RT proteins searched for by western Blot using p24 and RTspecific antibodies (see SDSPAGE and immunoblot analysis below)and an enzymatic PPase activity test was performed. In parallel tothe treatment of viral suspension, supernatants obtained from non-infected 42CD4 cells were treated similarly.

4.6. SDS-PAGE and immunoblot analysis

For SDS-Page analysis, the purified virus- and microvesicles-containing samples obtained following OptiPrep� gradient weremixed with a loading buffer containing 62.5 mM TriseHCl pH 6.8(20 �C), 2% SDS, 0.1% bromophenol blue, 10% glycerol, 20 mM DTTand 5% b-mercaptoethanol. After heating, the proteins were sepa-rated on a 12% SDS-polyacrylamide gel. The cell lysates and virusesor microvesicles preparations obtained following transfection ofa Flag-tagged-PPase were mixed with loading buffer containing50 mM TriseHCl pH 6.8 (20 �C), 2% SDS, 0.1% bromophenol blue,10% glycerol, 100 mM DTT. After heating of the samples theproteins were separated on a 4e12% pre-cast SDS-polyacrylamidegel (Invitrogen). Proteins were then transferred onto a PVDFmembrane (Amersham) using a liquid transfer system. Standardwestern-blotting procedures were used. The following reagent was

obtained through the AIDS Research and Reference ReagentProgram, Division of AIDS, NIAID, NIH: anti-p24 (1/8000) fromDr Michael H. Malim. Other primary mouse monoclonalantibody used were anti-RT (1/500) (BTI Research Reagents), anti-b-actin (1/10,000) (Sigma), anti-Flag (1/1000) (Sigma) andanti-CD45 (1/1000) (BD Transduction laboratories, San Diego,Calif.). Secondary antibody used was a horseradish peroxydase-conjugated anti-mouse (1/3000) (Bio-Rad). When necessary,stripping of the PVDF membrane was carried out by incubating themembrane in 100 mM b-mercaptoethanol, 2% SDS, 62.5 mMTriseHCl pH 6.7 (27 �C) at 50 �C for 30 min, followed by two 5 minwashes in TNT (150 mM NaCl, 50 mM TriseHCl pH 7 (20 �C), 0.1%Triton). The blots were then blocked for 1 h and used with immunereagents as described above.

4.7. PPase activity test

PPase hydrolyses PPi into two orthophosphate (Pi) molecules.This reaction can be detected by the addition of radiolabelled [32-P]PPi (PerkineElmer) to the samples. Generally, virions- and vesicles-containing samples were resuspended in a buffer adapted to thePPase activity test, i.e. 40 mM TriseHCl pH 8 (37 �C), 10 mM MgCl2,6 mM KCl, 2 mM DTT and Triton X-100. In the case of samplesobtained from OptiPrep� gradients, 0.2% Triton X-100 was used. Todetect PPase activity, [32-P]PPi was added and samples were incu-bated at 37 �C for various times, ranging from 5 to 60min. PPi and Pimolecules were extracted by phenolechloroform extraction andseparated on thin-layer chromatography using a mixture of iso-propanol/ammonia/H2O (50%/35%/15%). The radioactive signal wasrevealed by autoradiography using a Fuji FLA-5100 phosphor-imager and quantified. To avoid saturation of the signal, the amountof [32-P]PPi and the incubation time were adjusted for eachexperiment. Hydrolysis of PPi by a PPase purified from yeast(Roche) was used as a positive control.

Acknowledgements

This work was supported by Sidaction (grant to C.I. andfellowship to C.D) and the French “Agence Nationale de Recherchescontre le SIDA” (fellowships to C.D. and L.D.). We thank the NIHAIDS Research and Reference Reagent Program for providingreagents. WT HIV-1 RT and AZTRRT were a gift from Dr M. Parniak(University of Pittsburg). We also wish to thank Dr G. Patejunas(Stony Brook University, N.Y.) and Prof. M. Johansson (KarolinskaInstitute, Stockholm) for providing the clones of PPA1 and isoform 1of PPA2, respectively.

References

[1] A.M. Skalka, S.P. Goff (Eds.), Reverse Transcriptase, Cold Spring Harbor Labo-ratory Press, N.Y., 1993.

[2] H. Mitsuya, K.J. Weinhold, P.A. Furman, M.H. St Clair, S.N. Lehrman, R.C. Gallo,D. Bolognesi, D.W. Barry, S. Broder, 30-Azido-30-deoxythymidine (BW A509U):an antiviral agent that inhibits the infectivity and cytopathic effect of humanT-lymphotropic virus type III/lymphadenopathy-associated virus in vitro,Proc. Natl. Acad. Sci. U. S. A. 82 (1985) 7096e7100.

[3] M.A. Fischl, D.D. Richman, M.H. Grieco, M.S. Gottlieb, P.A. Volberding,O.L. Laskin, J.M. Leedom, J.E. Groopman, D. Mildvan, R.T. Schooley, et al., Theefficacy of azidothymidine (AZT) in the treatment of patients with AIDS andAIDS-related complex. A double-blind, placebo-controlled trial, N. Engl. J.Med. 317 (1987) 185e191.

[4] C. Flexner, HIV drug development: the next 25 years, Nat. Rev. Drug Discov. 6(2007) 959e966.

[5] S.G. Sarafianos, B. Marchand, K. Das, D.M. Himmel, M.A. Parniak, S.H. Hughes,E. Arnold, Structure and function of HIV-1 reverse transcriptase: molecularmechanisms of polymerization and inhibition, J. Mol. Biol. 385 (2009)693e713.

[6] V. Vivet-Boudou, J. Didierjean, C. Isel, R. Marquet, Nucleoside and nucleotideinhibitors of HIV-1 replication, Cell Mol. Life Sci. 63 (2006) 163e186.

C. Ducloux et al. / Biochimie 94 (2012) 2498e25072506

[7] A.J. Acosta-Hoyos, W.A. Scott, The role of nucleotide excision by reversetranscriptase in HIV drug resistance, Viruses 2 (2010) 372e394.

[8] L. Menendez-Arias, Mechanisms of resistance to nucleoside analogue inhibi-tors of HIV-1 reverse transcriptase, Virus Res. 134 (2008) 124e146.

[9] V. Goldschmidt, R. Marquet, Primer unblocking by HIV-1 reverse transcriptaseand resistance to nucleoside RT inhibitors (NRTIs), Int. J. Biochem. Cell Biol. 36(2004) 1687e1705.

[10] P.L. Boyer, S.G. Sarafianos, E. Arnold, S.H. Hughes, Nucleoside analog resistancecaused by insertions in the fingers of human immunodeficiency virus type 1reverse transcriptase involves ATP-mediated excision, J. Virol. 76 (2002)9143e9151.

[11] A. Mas, M. Parera, C. Briones, V. Soriano, M.A. Martinez, E. Domingo,L. Menendez-Arias, Role of a dipeptide insertion between codons 69 and 70 ofHIV-1 reverse transcriptase in the mechanism of AZT resistance, EMBO J. 19(2000) 5752e5761.

[12] L. Menendez-Arias, T. Matamoros, C.E. Cases-Gonzalez, Insertions and dele-tions in HIV-1 reverse transcriptase: consequences for drug resistance andviral fitness, Curr. Pharm. Des. 12 (2006) 1811e1825.

[13] P.R. Meyer, J. Lennerstrand, S.E. Matsuura, B.A. Larder, W.A. Scott, Effects ofdipeptide insertions between codons 69 and 70 of human immunodeficiencyvirus type 1 reverse transcriptase on primer unblocking, deoxynucleosidetriphosphate inhibition, and DNA chain elongation, J. Virol. 77 (2003)3871e3877.

[14] K.L. White, J.M. Chen, N.A. Margot, T. Wrin, C.J. Petropoulos, L.K. Naeger,S. Swaminathan, M.D. Miller, Molecular mechanisms of tenofovir resistanceconferred by human immunodeficiency virus type 1 reverse transcriptasecontaining a diserine insertion after residue 69 and multiple thymidineanalog-associated mutations, Antimicrob. Agents Chemother. 48 (2004)992e1003.

[15] J.C. Hsieh, S. Zinnen, P. Modrich, Kinetic mechanism of the DNA-dependentDNA polymerase activity of human immunodeficiency virus reverse tran-scriptase, J. Biol. Chem. 268 (1993) 24607e24613.

[16] J.E. Reardon, Human immunodeficiency virus reverse transcriptase. A kineticanalysis of RNA-dependent and DNA-dependent DNA polymerization, J. Biol.Chem. 268 (1993) 8743e8751.

[17] S.S. Carroll, J. Geib, D.B. Olsen, M. Stahlhut, J.A. Shafer, L.C. Kuo, Sensitivity ofHIV-1 reverse transcriptase and its mutants to inhibition by azidothymidinetriphosphate, Biochemistry 33 (1994) 2113e2120.

[18] P.R. Meyer, S.E. Matsuura, A.M. Mian, A.G. So, W.A. Scott, A mechanism of AZTresistance: an increase in nucleotide-dependent primer unblocking by mutantHIV-1 reverse transcriptase, Mol. Cell 4 (1999) 35e43.

[19] D. Arion, N. Kaushik, S. McCormick, G. Borkow, M.A. Parniak, Phenotypicmechanism of HIV-1 resistance to 30-azido-30-deoxythymidine (AZT):increased polymerization processivity and enhanced sensitivity to pyro-phosphate of the mutant viral reverse transcriptase, Biochemistry 37 (1998)15908e15917.

[20] D. Arion, N. Sluis-Cremer, M.A. Parniak, Mechanism by which phosphono-formic acid resistance mutations restore 30-azido-30-deoxythymidine (AZT)sensitivity to AZT-resistant HIV-1 reverse transcriptase, J. Biol. Chem. 275(2000) 9251e9255.

[21] M. Gotte, D. Arion, M.A. Parniak, M.A. Wainberg, The M184V mutation in thereverse transcriptase of human immunodeficiency virus type 1 impairs rescueof chain-terminated DNA synthesis, J. Virol. 74 (2000) 3579e3585.

[22] P.R. Meyer, S.E. Matsuura, R.F. Schinazi, A.G. So, W.A. Scott, Differentialremoval of thymidine nucleotide analogues from blocked DNA chains byhuman immunodeficiency virus reverse transcriptase in the presence ofphysiological concentrations of 20-deoxynucleoside triphosphates, Anti-microb. Agents Chemother. 44 (2000) 3465e3472.

[23] P.R. Meyer, S.E. Matsuura, A.G. So, W.A. Scott, Unblocking of chain-terminatedprimer by HIV-1 reverse transcriptase through a nucleotide-dependentmechanism, Proc. Natl. Acad. Sci. U. S. A. 95 (1998) 13471e13476.

[24] A.J. Smith, P.R. Meyer, D. Asthana, M.R. Ashman, W.A. Scott, Intracellularsubstrates for the primer-unblocking reaction by human immunodeficiencyvirus type 1 reverse transcriptase: detection and quantitation in extracts fromquiescent- and activated-lymphocyte subpopulations, Antimicrob. AgentsChemother. 49 (2005) 1761e1769.

[25] A.J. Smith, W.A. Scott, The influence of natural substrates and inhibitors on thenucleotide-dependent excision activity of HIV-1 reverse transcriptase in theinfected cell, Curr. Pharm. Des. 12 (2006) 1827e1841.

[26] P.L. Boyer, S.G. Sarafianos, E. Arnold, S.H. Hughes, Selective excision of AZTMPby drug-resistant human immunodeficiency virus reverse transcriptase,J. Virol. 75 (2001) 4832e4842.

[27] P.R. Meyer, A.J. Smith, S.E. Matsuura, W.A. Scott, Chain-terminating dinu-cleoside tetraphosphates are substrates for DNA polymerization by humanimmunodeficiency virus type 1 reverse transcriptase with increased activityagainst thymidine analogue-resistant mutants, Antimicrob. Agents Chemo-ther. 50 (2006) 3607e3614.

[28] S. Dharmasena, Z. Pongracz, E. Arnold, S.G. Sarafianos, M.A. Parniak, 30-Azido-30-deoxythymidine-(50)-tetraphospho-(50)-adenosine, the product ofATP-mediated excision of chain-terminating AZTMP, is a potent chain-terminating substrate for HIV-1 reverse transcriptase, Biochemistry 46(2007) 828e836.

[29] L.S. Victorova, D.G. Semizarov, E.A. Shirokova, L.A. Alexandrova,A.A. Arzumanov, M.V. Jasko, A.A. Krayevsky, Human DNA polymerases and

retroviral reverse transcriptases: selectivity in respect to dNTPs modified attriphosphate residues, Nucleosides Nucleotides 18 (1999) 1031e1032.

[30] C. Isel, C. Ehresmann, P. Walter, B. Ehresmann, R. Marquet, The emergence ofdifferent resistance mechanisms toward nucleoside inhibitors is explained bythe properties of the wild type HIV-1 reverse transcriptase, J. Biol. Chem. 276(2001) 48725e48732.

[31] L.K. Naeger, N.A. Margot, M.D. Miller, ATP-dependent removal of nucleosidereverse transcriptase inhibitors by human immunodeficiency virus type 1reverse transcriptase, Antimicrob. Agents Chemother. 46 (2002) 2179e2184.

[32] W. Tong, C.D. Lu, S.K. Sharma, S. Matsuura, A.G. So, W.A. Scott, Nucleotide-induced stable complex formation by HIV-1 reverse transcriptase, Biochem-istry 36 (1997) 5749e5757.

[33] X. Tu, K. Das, Q. Han, J.D. Bauman, A.D. Clark Jr., X. Hou, Y.V. Frenkel,B.L. Gaffney, R.A. Jones, P.L. Boyer, S.H. Hughes, S.G. Sarafianos, E. Arnold,Structural basis of HIV-1 resistance to AZT by excision, Nat. Struct. Mol. Biol.17 (2010) 1202e1209.

[34] T. Matamoros, S. Franco, B.M. Vazquez-Alvarez, A. Mas, M.A. Martinez,L. Menendez-Arias, Molecular determinants of multi-nucleoside analogueresistance in HIV-1 reverse transcriptases containing a dipeptide insertion inthe fingers subdomain: effect of mutations D67N and T215Y on removal ofthymidine nucleotide analogues from blocked DNA primers, J. Biol. Chem. 279(2004) 24569e24577.

[35] A.S. Ray, E. Murakami, A. Basavapathruni, J.A. Vaccaro, D. Ulrich, C.K. Chu,R.F. Schinazi, K.S. Anderson, Probing the molecular mechanisms of AZT drugresistance mediated by HIV-1 reverse transcriptase using a transient kineticanalysis, Biochemistry 42 (2003) 8831e8841.

[36] P.P. Chamberlain, J. Ren, C.E. Nichols, L. Douglas, J. Lennerstrand, B.A. Larder,D.I. Stuart, D.K. Stammers, Crystal structures of zidovudine- or lamivudine-resistant human immunodeficiency virus type 1 reverse transcriptases con-taining mutations at codons 41, 184, and 215, J. Virol. 76 (2002)10015e10019.

[37] M. von Kleist, P. Metzner, R. Marquet, C. Schutte, HIV-1 polymerase inhibitionby nucleoside analogs: cellular- and kinetic parameters of efficacy, suscepti-bility and resistance selection, PLoS Comput. Biol. 8 (2012) e1002359.

[38] B. Marchand, K.L. White, J.K. Ly, N.A. Margot, R. Wang, M. McDermott,M.D. Miller, M. Gotte, Effects of the translocation status of human immuno-deficiency virus type 1 reverse transcriptase on the efficiency of excision oftenofovir, Antimicrob. Agents Chemother. 51 (2007) 2911e2919.

[39] M. Yokoyama, H. Mori, H. Sato, Allosteric regulation of HIV-1 reverse tran-scriptase by ATP for nucleotide selection, PLoS One 5 (2010) e8867.

[40] B. Selmi, J. Deval, K. Alvarez, J. Boretto, S. Sarfati, C. Guerreiro, B. Canard, TheY181C substitution in AZT-resistant human immunodeficiency virus type 1reverse transcriptase suppresses the ATP-mediated repair of the AZTMP-terminated primer, J. Biol. Chem. 278 (2003) 40464e40472.

[41] B.A. Barshop, D.T. Adamson, D.C. Vellom, F. Rosen, B.L. Epstein, J.E. Seegmiller,Luminescent immobilized enzyme test systems for inorganic pyrophosphate:assays using firefly luciferase and nicotinamide- mononucleotide adenylyltransferase or adenosine-50-triphosphate sulfurylase, Anal. Biochem. 197(1991) 266e272.

[42] A. Gamberucci, B. Innocenti, R. Fulceri, G. Banhegyi, R. Giunti, T. Pozzan,A. Benedetti, Modulation of Ca2þ influx dependent on store depletion byintracellular adenine-guanine nucleotide levels, J. Biol. Chem. 269 (1994)23597e23602.

[43] P.V. Hauschka, Analysis of nucleotide pools in animal cells, Methods Cell Biol.7 (1973) 361e462.

[44] M.P. Golinelli, S.H. Hughes, Self-priming of retroviral minus-strand strong-stop DNAs, Virology 285 (2001) 278e290.

[45] R. Krebs, U. Immendorfer, S.H. Thrall, B.M. Wohrl, R.S. Goody, Single-stepkinetics of HIV-1 reverse transcriptase mutants responsible for virus resis-tance to nucleoside inhibitors zidovudine and 3-TC, Biochemistry 36 (1997)10292e10300.

[46] B. Marchand, M. Gotte, Site-specific footprinting reveals differences in thetranslocation status of HIV-1 reverse transcriptase: implications for poly-merase translocation and drug resistance, J. Biol. Chem. 278 (2003)35362e35372.

[47] L. Houzet, Z. Morichaud, M. Mougel, Fully-spliced HIV-1 RNAs are reversetranscribed with similar efficiencies as the genomic RNA in virions and cells,but more efficiently in AZT-treated cells, Retrovirology 4 (2007) 30.

[48] Y. Huang, J. Wang, A. Shalom, Z. Li, A. Khorchid, M.A. Wainberg, L. Kleiman,Primer tRNA3Lys on the viral genome exists in unextended and two-baseextended forms within mature human immunodeficiency virus type 1,J. Virol. 71 (1997) 726e728.

[49] M. Mougel, L. Houzet, J.L. Darlix, When is it time for reverse transcription tostart and go? Retrovirology 6 (2009) 24.

[50] N.J. Arhel, S. Souquere-Besse, S. Munier, P. Souque, S. Guadagnini,S. Rutherford, M.C. Prevost, T.D. Allen, P. Charneau, HIV-1 DNA Flap formationpromotes uncoating of the pre-integration complex at the nuclear pore, EMBOJ. 26 (2007) 3025e3037.

[51] S. Curbo, C. Lagier-Tourenne, R. Carrozzo, L. Palenzuela, S. Lucioli, M. Hirano,F. Santorelli, J. Arenas, A. Karlsson, M. Johansson, Human mitochondrialpyrophosphatase: cDNA cloning and analysis of the gene in patients withmtDNA depletion syndromes, Genomics 87 (2006) 410e416.

[52] T.A. Fairchild, G. Patejunas, Cloning and expression profile of human inorganicpyrophosphatase, Biochim. Biophys. Acta 1447 (1999) 133e136.

C. Ducloux et al. / Biochimie 94 (2012) 2498e2507 2507

[53] A. Goff, L.S. Ehrlich, S.N. Cohen, C.A. Carter, Tsg101 control of human immu-nodeficiency virus type 1 Gag trafficking and release, J. Virol. 77 (2003)9173e9182.

[54] S.J. Gould, A.M. Booth, J.E. Hildreth, The Trojan exosome hypothesis, Proc. Natl.Acad. Sci. U. S. A. 100 (2003) 10592e10597.

[55] A. Joshi, S.D. Ablan, F. Soheilian, K. Nagashima, E.O. Freed, Evidence thatproductive human immunodeficiency virus type 1 assembly can occur in anintracellular compartment, J. Virol. 83 (2009) 5375e5387.

[56] J.W. Bess Jr., R.J. Gorelick, W.J. Bosche, L.E. Henderson, L.O. Arthur, Micro-vesicles are a source of contaminating cellular proteins found in purifiedHIV-1 preparations, Virology 230 (1997) 134e144.

[57] P. Gluschankof, I. Mondor, H.R. Gelderblom, Q.J. Sattentau, Cell membranevesicles are a major contaminant of gradient-enriched human immunodefi-ciency virus type-1 preparations, Virology 230 (1997) 125e133.

[58] R. Cantin, J. Diou, D. Belanger, A.M. Tremblay, C. Gilbert, Discriminationbetween exosomes and HIV-1: purification of both vesicles from cell-freesupernatants, J. Immunol. Methods 338 (2008) 21e30.

[59] V. Goldschmidt, J. Didierjean, B. Ehresmann, C. Ehresmann, C. Isel, R. Marquet,Mg2þ dependency of HIV-1 reverse transcription, inhibition by nucleosideanalogues and resistance, Nucleic Acids Res. 34 (2006) 42e52.

[60] T.W. Young, N.J. Kuhn, A. Wadeson, S. Ward, D. Burges, G.D. Cooke, Bacillussubtilis ORF yybQ encodes a manganese-dependent inorganic pyrophospha-tase with distinctive properties: the first of a new class of soluble pyro-phosphatase? Microbiology 144 (Pt 9) (1998) 2563e2571.

[61] A.M. Lever, K.T. Jeang, Insights into cellular factors that regulate HIV-1 repli-cation in human cells, Biochemistry 50 (2011) 920e931.

[62] F.D. Bushman, N. Malani, J. Fernandes, I. D’Orso, G. Cagney, T.L. Diamond,H. Zhou, D.J. Hazuda, A.S. Espeseth, R. Konig, S. Bandyopadhyay, T. Ideker,S.P. Goff, N.J. Krogan, A.D. Frankel, J.A. Young, S.K. Chanda, Host cell factors inHIV replication: meta-analysis of genome-wide studies, PLoS Pathog. 5 (2009)e1000437.

[63] M. Llano, J. Morrison, E.M. Poeschla, Virological and cellular roles of thetranscriptional coactivator LEDGF/p75, Curr. Top. Microbiol. Immunol. 339(2009) 125e146.

[64] S. Henriet, G. Mercenne, S. Bernacchi, J.C. Paillart, R. Marquet, Tumultuousrelationship between the human immunodeficiency virus type 1 viral infec-tivity factor (Vif) and the human APOBEC-3G and APOBEC-3F restrictionfactors, Microbiol. Mol. Biol. Rev. 73 (2009) 211e232.

[65] B. Romani, S. Engelbrecht, R.H. Glashoff, Antiviral roles of APOBEC proteinsagainst HIV-1 and suppression by Vif, Arch. Virol. 154 (2009) 1579e1588.

[66] J. Lemay, P. Maidou-Peindara, T. Bader, E. Ennifar, J.C. Rain, R. Benarous,L.X. Liu, HuR interacts with human immunodeficiency virus type 1 reverse

transcriptase, and modulates reverse transcription in infected cells, Retro-virology 5 (2008) 47.

[67] D. Jardine, G. Tachedjian, S. Locarnini, C. Birch, Cellular topoisomerase Iactivity associated with HIV-1, AIDS Res. Hum. Retrovir. 9 (1993) 1245e1250.

[68] K.T. Jeang, V. Yedavalli, Role of RNA helicases in HIV-1 replication, NucleicAcids Res. 34 (2006) 4198e4205.

[69] M. Sorin, J. Cano, S. Das, S. Mathew, X. Wu, K.P. Davies, X. Shi, S.W. Cheng,D. Ott, G.V. Kalpana, Recruitment of a SAP18-HDAC1 complex into HIV-1virions and its requirement for viral replication, PLoS Pathog. 5 (2009)e1000463.

[70] J. Ahn, I.J. Byeon, S. Dharmasena, K. Huber, J. Concel, A.M. Gronenborn,N. Sluis-Cremer, The RNA binding protein HuR does not interact directly withHIV-1 reverse transcriptase and does not affect reverse transcription in vitro,Retrovirology 7 (2010) 40.

[71] M. Rigourd, J.M. Lanchy, S.F. Le Grice, B. Ehresmann, C. Ehresmann,R. Marquet, Inhibition of the initiation of HIV-1 reverse transcription by 30-azido-30-deoxythymidine. Comparison with elongation, J. Biol. Chem. 275(2000) 26944e26951.

[72] G.M. Fuentes, C. Palaniappan, P.J. Fay, R.A. Bambara, Strand displacementsynthesis in the central polypurine tract region of HIV-1 promotes DNA toDNA strand transfer recombination, J. Biol. Chem. 271 (1996) 29605e29611.

[73] L. Hameau, J. Jeusset, S. Lafosse, D. Coulaud, E. Delain, T. Unge, T. Restle, E. LeCam, G. Mirambeau, Human immunodeficiency virus type 1 central DNA flap:dynamic terminal product of plus-strand displacement dna synthesis cata-lyzed by reverse transcriptase assisted by nucleocapsid protein, J. Virol. 75(2001) 3301e3313.

[74] C. Isel, R. Marquet, G. Keith, C. Ehresmann, B. Ehresmann, Modified nucleo-tides of transfer-RNA3

Lys modulate primer/template loop-loop interaction inthe initiation complex of HIV-1 reverse transcription, J. Biol. Chem. 268 (1993)25269e25272.

[75] M. Biard-Piechaczyk, V. Robert-Hebmann, V. Richard, J. Roland, R.A. Hipskind,C. Devaux, Caspase-dependent apoptosis of cells expressing the chemokinereceptor CXCR4 is induced by cell membrane-associated human immunode-ficiency virus type 1 envelope glycoprotein (gp120), Virology 268 (2000)329e344.

[76] L. Espert, M. Denizot, M. Grimaldi, V. Robert-Hebmann, B. Gay, M. Varbanov,P. Codogno, M. Biard-Piechaczyk, Autophagy is involved in T cell death afterbinding of HIV-1 envelope proteins to CXCR4, J. Clin. Invest. 116 (2006)2161e2172.

[77] L. Houzet, Z. Morichaud, L. Didierlaurent, D. Muriaux, J.L. Darlix, M. Mougel,Nucleocapsid mutations turn HIV-1 into a DNA-containing virus, NucleicAcids Res. 36 (2008) 2311e2319.