CECAV-UTAD Publications Institutional Repository of the

University of Trás-os-Montes and Alto Douro Found at: http://repositorio.utad.pt/

This is an author produced version of a paper published in Animal Reproduction Science

This paper has been peer-reviewed but does not include the final publisher proof-corrections or journal pagination.

Citation for the published paper: Payan-Carreira R, Pires MA, Quaresma M, Chaves R,

Adega F, Guedes Pinto H, Colaço B, Villar V. A complex intersex condition in a Holstein calf. Anim Reprod Sci. 2008

Jan 15;103(1-2):154-63.

Published in final form at: http://dx.doi.org/10.1016/j.anireprosci.2007.04.013 Copyright: Elsevier Ltd.

Access to the published version may require subscription.

1

RUDIMENTAR EXTERNAL GENITALIA ASSOCIATED WITH GONADAL DYSPLASIA IN A HOLSTEIN 1

CALF 2

3

4

5

R Payan-Carreiraa*, MA Piresa, M Quaresmab, ML Pintoa, R Horosc, R Chavesc, F Adegac, H. 6

Guedes Pintoc, B Colaçod, V Villare, J M Villare 7

8

9

10

a CECAV, University of Trás-os-Montes and Alto Douro, P.O. Box 1013, 5001-801 Vila Real, 11

Portugal. 12

b Veterinary Sciences Dept., University of Trás-os-Montes and Alto Douro, P.O. Box 1013, 13

5001-801 Vila Real, Portugal. 14

c Centre of Genetics and Biotechnology, University of Trás-os-Montes and Alto Douro, P.O. 15

Box 1013, 5001-801 Vila Real, Portugal. 16

d Zootecnia Dept., University of Trás-os-Montes and Alto Douro, P.O. Box 1013, 5001-801 17

Vila Real, Portugal. 18

e Dept. Cellular Biology and Anatomy, Facultad de Veterinaria, Leon, Spain. 19

20

21

22

* Corresponding author: Rita Payan-Carreira, CECAV, Zootecnia Dept., University of Trás-23

os-Montes and Alto Douro; Vila Real, Portugal; Fax: +351.259350482. 24

E-mail address: ritapay@utad.pt 25

26

2

Abstract 1

2

A case of disrupted embryonic development of the genital tract in a newborn Holstein calf is 3

described. The physical examination of the calf evidenced several abnormalities, as atresia 4

ani, rudimentary external genitalia and caudal vertebral agenesis. On necropsy, the excised 5

genitalia consisted of bilateral streak gonads, apparently normal uterine tubes, a fluid-filled 6

uterus, a long vagina and a very narrow clitoris-like structure covered with a discrete skin fold. 7

The urinary tract seemed normal and the urethra was opening at the vestibule-vaginal junction. 8

A cytogenetic analysis was requested. Karyotype revealed the existence of Y-chromosome 9

material in the two X-chromosomes. However, the search for the sex determining region Y 10

(SRY) gene showed that this gene was apparently absent. The histological examination of the 11

gonads revealed the existence of ovarian dysplasia. Uterine sections evidenced the absence of 12

the uterine epithelium, with only sporadic caruncules. Under microscopic examination, the 13

structure of uterine tubes and vagina was normal. The external genitalia sections revealed the 14

existence of a skin fold covering an erectile structure surrounding the urethra, a structure rather 15

similar to a penis than to a clitoris. 16

This is an unusual situation of gonadal dysplasia associated with genital tract anomalies in 17

cattle probably associated to the genetic defect. 18

19

20

21

Key words: Ovarian dysplasia; genital ambiguity; intersexuality; congenital anomalies; cattle 22

23

3

1. Introduction 1

2

Anomalous development of genitalia has been recognized for long time and frequently 3

described in pigs. Most often, these malformations concern the female and most anomalies fit 4

in the denomination of intersex [1,2]. 5

Abnormal development of the reproductive organs occurs with different incidence in several 6

species. Gonadal dysgenesis in a XY-animal results from failure of testicular determination. It 7

can be present in a complete or in a partial way. In this last situation, some testicular structures 8

develop, and generally the individuals exhibit ambiguous genitalia. In the former condition, 9

there is a complete absence of testis formation, and animals usually develop a completely 10

female phenotype [1,3,4]. Female XY individuals with gonadal dysgenesis have been reported 11

in humans [3,5], rats and pigs [1,6], and can be related to the absence of the SRY gene or to 12

inability of SRY transcription [2,7]. In cattle, the freemartin syndrome is the most frequent 13

intersex condition reported [8]. Recently, a report was published concerning a female 14

phseudohermaphrodite heifer with gonadal mosaicism [9]. 15

In mammals, all genital structures develop from bipotential embryologic tissues. Male or 16

female phenotype develops through a cascade of processes that initiate with gonad 17

differentiation, which in turn is dependent from the existence of a Y-chromosome. 18

Differentiation of the testis occurs early and more rapidly than that of the ovary [1,10,11]. 19

In mammals, the internal genital tract derives from the urogenital tract structures, which 20

initially are identical in male and female embryos. At indifferent stage, male and female 21

embryos display two identical sets of paired ducts: the Müllerian (paramesonephric) ducts and 22

the Wolffian (mesonephric) ducts. Once a testis is formed, androgens produced by Leydig cells 23

induce the differentiation of the male genital tract from the Wolffian ducts (vesicular glands, 24

epididymis and vas deferens) and external genitalia (scrotum, penis and prepuce), while the 25

4

anti-Müllerian hormone (AMH), produced by Sertoli cells inhibits the development of 1

Müllerian ducts [1,10,11,12]. In the absence of trophic influences, Wolffian ducts regress and 2

when inhibitory influences fail, the female internal genitalia develop, forming the uterine 3

tubes, uterus and cranial vagina. 4

In the genital eminence, three structures are recognized: the genital tubercle, the genital folds 5

and the genital swellings. Early in fetal life, under the influence of dihydrotestosterone 6

produced by the testes, the genital tubercle further elongates to form the primordial phallus, 7

and the genital swellings enlarge to form the scrotum. As this growth occurs, penile urethra 8

takes form [1,10,11]. In females, the pattern of external genitalia is similar to that of the 9

undifferentiated stage. The genital tubercle differentiates, but its outgrowth is early stopped. It 10

will develop into the clitoris. The genital swellings develop into vulvar labia. The genital sinus 11

remains open as the vestibule, into which both urethra and vagina open [10,11]. 12

Generally, gonadal abnormalities in a XY-animal result from failure on testicular 13

determination. Internal and external genital organs develop from an indeterminate stage under 14

the influence of the fetal gonads. Hormonal production of differentiated gonads is relevant for 15

differentiation of the internal and external genitalia during fetal life [1,10,11]. The 16

inappropriate differentiation of the embryonic gonad may compromise the subsequent 17

development and differentiation of the internal and the genital tract organs. 18

Atresia ani is a common birth defect in cattle, and is often accompanied by other congenital 19

defects of the digestive or the urogenital tracts [13,14]. In case of atresia ani, survival appears 20

to depend mainly on early diagnosis, anatomic site affected, and successful surgical 21

establishment of a patent intestinal tract. 22

In the case reported here, the authors describe a case of abnormal genital development in a 23

newborn Holstein calf that evidenced rudimentary and undifferentiated external genitalia, 24

5

internal female genital ducts and streak gonads that do not fit either in the freemartin syndrome 1

or in the sex reversal condition. 2

The cytogenetic analysis of this individual demonstrated the existence of Y-chromosome 3

material in the X-chromosomes, which could explain some of the malformations observed. 4

5

2. Case history and evaluation 6

One-day-old Holstein intersex calf, born co-twin with an apparently normal female calf, was 7

presented at the Large Animal Surgery Service at the Veterinary Medical Teaching Hospital of 8

UTAD (Portugal) due to atresia ani. At admission, clinical examination of the calf revealed a 9

complete absence of the tail, agenesis of the anus and rudimentary external genitalia, 10

consisting of a small clitoris-like structure (Fig. 1), covered with a skin fold. No vulvar labia or 11

prepuce were detected. The external genitalia rudiment was positioned in a scrotal position, 12

caudal to the mammary glands, and at a distance to the site at which the anus should be located 13

considerably lower than usually in the normal female. X-ray revealed a partial agenesis of 14

sacral vertebrae and the caudal vetebral agenesis that led to the suspicion of atresia recti (Fig. 15

2). A cytogenetic analysis was requested. 16

During surgery to establish the patency of the anus, agenesis of the rectum and hydrometra 17

(Fig. 3A) were detected, and the calf was euthanized. 18

3. Cytogenetic analysis 19

Chromosome preparations of the calf were made from short-term lymphocyte cultures of 20

whole blood samples using standard protocols [15]. After G-banding procedures for 21

chromosomes identification, the karyotype of the calf under analysis was organized according 22

the recommendations from the ISCNDB [16], very briefly it presented a karyotype of 2n=60, 23

with 29 acrocentric autosome pairs, and two sex X chromosomes (medium submetacentrics), 24

which is representative of a female individual. 25

6

A Y chromosome-specific probe was prepared by degenerate oligonucleotide primed PCR 1

(DOP-PCR) from the flow-sorted Y chromosome, using 6MW PCR primers and amplification 2

conditions as previously described [17]. 3

The other probe was constructed with a DOP-PCR using genomic DNA of the calf in analysis, 4

and simultaneously another PCR amplification and labeling was made with genomic DNA 5

from a normal male Holstein (for control). After labeling, both probes were blocked with 6

unlabelled genomic DNA from the normal male individual and hybridized in metaphase 7

preparations from the normal male. 8

In situ hybridization of the probes to the calf metaphase spreads was as previously described 9

[18]. Fluorescent in situ hybridization results of the normal individual probe revealed no signal 10

on the chromosomes of the normal male, as expected since we blocked all his sequences; but a 11

prominent painting of the Y chromosome was observed when using the calf probe, revealing 12

the extra amount of Y material in the calf genome. 13

SRY and Amelogenin genes amplification 14

PCR specific primers for the SRY and Amelogenin (AMEL) genes were designed, namely 15

SRY A (5’ TCGTGAACGAAGACGAAAGGGGGC 3’), SRY B (5’ 16

GCACAAGAAAGTCCAGGCTCTAAG 3’), AMEL A (5’ CAGCCAAACCTCCCTCTGC 17

3’) and AMEL B (5’ CCCGCTTGGTCTTGTCTGTTGC 3’), and the reactions were 18

performed according to Phua et al. [19] and Sullivan et al. [20], respectively, to search for the 19

presence of these genes in the calf genome under investigation and simultaneously from the 20

genomes of a male and female Holstein individuals, for control. PCR analysis revealed an 21

apparent absence of the SRY gene from the genome of the calf and also negative for the 22

female control, contrary to the expected PCR band observed in the male control. Amelogenin 23

gene amplification results were opposite to the later, with a clear band observed in the calf and 24

female control and two clear bands in the male control. 25

26

7

4. Post mortem examination of the genitalia 1

4.1 – Necropsy findings 2

Post mortem gross evaluation of the digestive tract confirmed the partial large bowel agenesis. 3

The urinary tract seemed normally developed, the urethra extending from the urinary bladder 4

to the vestibule-vaginal junction. The caudal branches of the mesenteric vessels were missing. 5

At necropsy, the female genital tract was removed for evaluation and subsequently fixed in 6

10% buffered formalin for histological studies. 7

Gross examination of the entire genitalia showed that gonads were reduced to a fibrous, ovary-8

like rudiment (Fig. 3B). Uterine tubes were apparently normal. The uterus and uterine horns 9

were larger than usual to that age and distended with a watery fluid (Fig. 3A). The internal 10

folding relief of the uterus and uterine horns were absent, and the internal face of the organ 11

was smooth (Fig. 3C). Detailed evaluation revealed that cervical circular folds were reduced to 12

very low crest and that cranial vaginal cavity appeared as being incorporated into the uterine 13

cavity (Fig. 3D). No folding was noticed in the vaginal cavity. The vestibule seemed longer 14

than the normal to the age, with the urethral opening near the vestibule-vaginal transition. In 15

the vestibule two portions were found: a smaller cranial portion, with the normal cavitary 16

vestibular morphology, and a longer tubular portion, that continued from the former and ends 17

at the narrow external opening. No mucus was present at the vagina or the vestibular cavity. 18

Analysis of the uterine fluid (density, pH, protein and glucosis content and sediment 19

evaluation) showed its compatibility with young calf urine. 20

External genital structures were very rudimentar and located lower than usual, in a scrotal 21

position. It consisted on a small clitoris-like structure, covered with a skin fold, lacking vulvar 22

or prepucial appearance. 23

On a schematic representation (Fig. 4) it is possible to compare the genital malformations 24

found in this animal with the normal genitalia of a calf of the same age, which was also used to 25

8

compare genital tract measurements (length x width x height). In the normal female, ovaries 1

measured 1.5x0.5x0.5cm, the uterine horns 4x1cm, the uterine body 4x0.8cm, the vagina 2

7x4.5cm and the vestibule 4x1.8cm. In the diseased calf, ovaries measured 1.5x0.2x0.1cm, the 3

uterine horns 17x8cm, the uterine body together with the vagina were 5x10cm and the 4

vestibule measured 3x1.2cm. The phallic structure measured 10x0.2cm. In the normal 5

genitalia, the distance from the upper vagina to the vulvar opening measured 11cm, while in 6

the abnormal genitalia the distance from the vestibular-vaginal transition to the external 7

opening was 13cm. 8

9

4.2 – Histologic evaluation of the genital structures 10

The histological examination of the fibrous gonadal structure revealed the existence of ovarian 11

dysplasia. The morphologic boundary between cortex and inner medulla was poorly defined 12

(Fig. 5A). In these rudimentar ovaries, few primordial follicular structures were scattered 13

within the cortex and seemed to be degenerate (Fig. 5B). Uterine tubes showed a normal 14

histologic structure. On uterine sections, miometrium was normally developed, however, the 15

endometrial glands and the uterine epithelium were absent and only sporadic caruncules could 16

be found near the apex of the uterine horns (Fig. 5C). Cranial vagina and vestibule evidenced 17

normal structure and they bare stratified epithelium. 18

Histologic evaluation of the external genitalia did not confirm the existence of a clitoris-like 19

structure, as suspected during gross evaluation of the excised genitalia. Instead, it revealed a 20

phalic configuration (Fig. 5D). The outer layer of this structure was composed of connective 21

tissue, nervous corpuscules, and two irregularly organized layers of smooth muscle; the inner 22

layer was composed of fusocellular connective tissue with blood vessels, some of them 23

arranged in cavernous structures, resembling a corpus spongiosum. In the center of this 24

9

structure the urethra was found. This penis-like structure lay inside a cutaneous pouch 1

externally covered by haired skin and internally bordered by stratified epithelium. 2

3

5. Discussion 4

The case reported herein is complex in morphology and rare in occurrence due to the multiple 5

malformations coexisting in the same animal. This article focuses on the genital tract, digestive 6

tract and skeletal anomalies exhibited by the affected calf. 7

The genital abnormalities observed do not fit either the freemartinism syndrome or in the XY 8

sex reversal classically described [6,8,21]. Not even totally fit in other syndromes descriptions 9

commonly associated to external genital dysmorfogenesis as reported for other species, like the 10

urorectal septum malformation or the human hand-foot-genital syndrome [22,23]. In the male, 11

the presence of the SRY gene on the Y-chromosome is required to initiate testicular 12

differentiation pathways and to inhibit female-specific pathways [5,24,25,26]. Expression of 13

this gene in the gonad leads to the differentiation of the somatic supporting cell precursors as 14

Sertoli cells [27,28]. Through the expression of Amh and Sox9 genes, these cells direct the 15

other elements of the gonad into their respective lineages [7,25,28,29]. 16

In the case here reported, the classical cytogenetic studies of the calf revealed a karyotype of 17

60, XX. The results obtained for the AMEL gene were similar to the observed in a female 18

condition. Molecular cytogenetic analysis of this individual revealed the existence of Y 19

chromosome material in the two X chromosomes. Despite the existence of Y-chromosome 20

material in the two X chromosomes revealed by the molecular cytogenetic analysis, PCR 21

molecular search for the SRY gene was unsuccessful. If SRY expression fails to occurs, or if 22

its expressed after the permissive window for induction of the male pathway, as it is proposed 23

to occur in XY-female, gonadal somatic cells will not differentiate into Sertoli cells, and 24

10

gonadal morphogenesis is impaired [2,30]. Consistently with SRY gene absence, seminiferous 1

tubular structures were not observed. 2

In the female embryo, an X-linked gene is required for ovarian development and an autosomal 3

gene appears to be involved in ovarian organogenesis [31,32]. In the absence of the SRY gene, 4

Dax-1 and Wnt-4 gene expression directs gonadal differentiation toward ovary [26,29]. In the 5

female, viable germ cells are essential for ovarian formation [29]. When testicular 6

differentiation is not achieved, germ cells are not prevented to enter meiosis. Meiotic entrance 7

is an intrinsic clock-programmed event [26,29] and once germ cells enter meiosis the 8

developing gonad losses its plasticity [26], cellular proliferation is impaired [7] and follicular 9

structures develop [29]. 10

In this case, a limited differentiation of ovarian structures was confirmed by histological 11

evaluation, which revealed loss of the cortical dominance and a decrease in the number of 12

follicular structures. A similar depletion in germ cells or follicular structures was reported by 13

Pailhoux et al. [6] and by Vilain et al. [3] in certain sex reversed pigs and in humans, 14

respectively. Pailhoux et al. [6] as Brennan and Capel [29] defend that a critical threshold of 15

germ cells is needed for adequate ovarian differentiation to occur. In human monosomy X, as 16

in our case, the gonads are reduced to a fibrous streak, located in the position usually assumed 17

by normal ovaries. Histological examination of such gonads shows decreased germ cell 18

number and a rich fibrous ovarian-like stroma [31]. The reduction of follicular structures could 19

possibly be explained by failure of the transcription of an X-linked differentiation factor that 20

would interfere with germ cell survival [29,33,34]. As the karyotype of the calf here analyzed 21

demonstrated a derived X/Y chromosome, one can hypothesize that the rearrangement could 22

be the reason for a failure in an X-linked differentiation factor. 23

In the male fetus, genital tubercle differentiation seems to be influenced by a complex 24

regulatory network of transcriptional and growth factor genes. Among these, Hox 13 and Shh 25

11

genes are proposed to perform an essential influence on the outgrowth and differentiation of 1

the genital tubercle [35,36]. Some Hox 13 mutations disturb the normal development of the 2

distal portion of the hindgut and genital tubercle [37], while its heterozygosity causes phallic 3

malformations [22]. 4

In the case here reported, due to the absence of virilization signals and the lack of anti-5

Müllerian hormone (AMH), Müllerian ducts were allowed to develop. This animal presented 6

normal uterine tubes, a bipartite uterus and a patent cervix; also the cranial vagina was 7

normally developed. Diverging from the normality, the vestibule of this calf seemed to be 8

arranged in two parts: one was cavitary, alike the normal female vestibule, with longitudinal 9

mucosal folds and the urethral ostium opening near the vaginal transition. The other part 10

presented a tubular arrangement, with a very narrow caliber, running caudally and ending at 11

the rudimentary external penis-like structure. The fluid content of in the uterus, or hydrometra, 12

seemed to correspond to the urine of the calf that was kept up-stream to this part due to the 13

huge pressure needed to pass this barrier. According to the histological features, this structure 14

corresponded to a rudimentary penis. The development of a phallic structure, caudal to the 15

vestibule, is not easily explainable. In male embryo, morphogenesis of the penis depends on 16

the penile urethral differentiation and elongation. Initially, in the genital tubercle area, a solid 17

urethral plate canalizes and extends distally, along with the urethral groove, and promotes the 18

differentiation of neighboring tissues, thus originating the penis [36]. In the female embryo, 19

penile tubular urethra is not formed. Without further studies it is not possible to explain what 20

induced in this case the proliferation of the urethral groove to form this short tubular structure 21

in an apparently female embryo, and in the seemingly absence of virilization signals. 22

In the individual here described accompanying the genital abnormalities, digestive tract 23

anomalies (atresia of the rectum and anus) and skeletal malformations (partial agenesis of 24

sacral vertebrae and caudal vertebral agenesis) were observed. The atresia of the rectum 25

12

outcomes from an imperfect canalization of the gut and atresia ani is consequence of the non-1

perforation of the anal membrane. In 1993, Saperstein sustained that in calves both defects are 2

frequently associated with other malformations, like lack of tail and urogenital defects [38]. 3

The underlined causes for these anomalies remain obscure, but it could be genetic, 4

environmental or both. Similar situations occurring in different species have lately received 5

attention in an attempt to clarify its ontogeny [22,23,37,39,40]. Tail or its related structures 6

(coccyx and sacral vertebrae), terminal gut and caudal genitalia comes from a common 7

posterior segment (the caudal intestinal portal), which give raise to the hindgut, the cloacae 8

and the tail. Severe and complex caudal malformations arise from abnormal development of 9

the cloacae [10,11]. Caudal gut, the tail and the external genitalia are known to share common 10

transcriptional factors that direct its morphogenesis, like the Hox 13 and Shh genes, regardless 11

of the different functions of these structures. Sonic hedghogs are important morphogens that 12

integrate a regulator pathway that includes Hox genes [11]. Shh participates in the cloacae 13

folding and vertebra development. Hox proteins regulate morphogenesis through the control of 14

cell adhesion, division, migration and shape and also by regulating cell death [41]. Cross-15

expression between Shh and Hox 13 has been referred, and therefore misexpression of the first 16

would disrupt the expression of the later. Loss of function of Hox 13 can result from mutation 17

or deletion of either Hox 13 genes or Shh genes, and the defects it induces is gene dosage-18

dependent [23]. Mutations in Hoxa-13 and in Hoxd-13 genes cause several caudal 19

malformations in both human and mice. However, the manner in which those gene mutations 20

lead to these malformations remains unknown. Mice with Hox 13 mutations present abnormal 21

external genitalia development, deficient genital duct morphogenesis, severe anomalies in the 22

urinary tract development and rectal abnormities [22,39]. Shh genetic mutations or disrupted 23

expression also are associated to vertebral, gut and urogenital defects. Could an inadequate 24

expression of Hox 13 genes or sonic hedghoh genes, apart from their deletion, explain the 25

13

elongation of the genital tubercle and the proliferation of the urethral groove that would 1

promote the penis formation? On the other hand, the altered activity of the Hox 13 genes could 2

explain the intestinal malformations observed in this animal? 3

In the male embryo, virilization of the external genitalia begins shortly after testicular 4

differentiation with a rapid increase of the ano-genital distance [1,10,11]. In this case, the lack 5

of androgens could explain the absence of penis elongation and preputial formation, leading to 6

rudimentary external genitalia in a scrotal position. 7

The case reported here is a fascinating occurrence of a complex series of congenital defects 8

coexisting in a female calf, which female co-twin was normal. Albeit gonadal dysplasia 9

probably results from defects in sex chromosomes, additional studies are needed to completely 10

elucidate the mechanism responsible for the occurrence of all these malformations. 11

12

Acknowledgements 13

The authors thank the contribution of Mrs Mecia Mourão for her administrative assistance in 14

the preparation of the manuscript and Mrs Lígia Bento for technical assistance. We are in 15

debted to Professor Joaquin Camón-Urgel for his comments on the manuscript. 16

17

References 18

[1] Hunter, RHF. Sex determination, differentiation and intersexuality in placental mammals. 19

Cambridge University Press, N.Y., 1995. 20

[2] Veitia RA, Salas-Cortes L, Ottolenghi C, Pailhoux E, Cotinot C, Fellous M. Testis 21

determination in mammals: more questions than answers. Mol Cell Endocrinol. 2001; 179(1-22

2):3-16. 23

14

[3] Vilain E, Jaubert F, Fellous M, McElreavey K. Pathology of 46,XY pure gonadal 1

dysgenesis: absence of testis differentiation associated with mutations in the testis-determining 2

factor. Differentiation. 1993; 52(2):151-9. 3

[4] Ahmed SF, Hughes IA. The genetics of male undermasculinization. Clin Endocrinol 4

(Oxf). 2002; 56(1):1-18. 5

[5] Ravel C, Chantot-Bastaraud S, Siffroi JP. [Molecular mechanisms in sex determination: 6

from gene regulation to pathology] Gynecol Obstet Fertil. 2004; 32(7-8):584-94. [In French]. 7

[6] Pailhoux E, Parma P, Sundstrom J, Vigier B, Servel N, Kuopio T, Locatelli A, Pelliniemi 8

LJ, Cotinot C. Time course of female-to-male sex reversal in 38,XX fetal and postnatal pigs. 9

Dev Dyn. 2001; 222(3):328-40. 10

[7] Schmahl J, Capel B. Cell proliferation is necessary for the determination of male fate in the 11

gonad. Dev Biol. 2003; 258(2):264-76. 12

[8] Padula AM. The freemartin syndrome: an update. Anim Reprod Sci. 2005; 87(1-2):93-109. 13

[9] Takagi M, Yamagishi N, Oboshi K, Kageyama S, Hirayama H, Minamihashi A, Sasaki M, 14

Wijayagunawardane MP. A female pseudohermaphrodite Holstein heifer with gonadal 15

mosaicism. Theriogenology. 2005; 63(1):60-71. 16

[10] Moore KL, Persaud, TVN. The urogenital system. In: The developing human - A 17

clinically oriented embryology. 7th Ed. Saunders, 2003, pp 287 – 328. 18

[11] Carlson, BM. Urogenital system. In: Human embryology and developmental biology. 3rd 19

Ed. Mosby, 2004, pp 393 – 427. 20

[12] Yin Y, Ma L. Development of the Mammalian Female Reproductive Tract. J Biochem 21

2005; 137(6):677-683 22

[13] Ghanem M, Yoshida C, Isobe N, Nakao T, Yamashiro H, Kubota H, Miyake Y, Nakada 23

K. Atresia ani with diphallus and separate scrota in a calf: a case report. Theriogenology. 2004; 24

61(7-8):1205-13. 25

15

[14] Ghanem ME, Yoshida C, Nishibori M, Nakao T, Yamashiro H. A case of freemartin with 1

atresia recti and ani in Japanese Black calf. Anim Reprod Sci. 2005; 85(3-4):193-9. 2

[15] Chaves R, Adega F, Santos S, Heslop-Harrison JS, Guedes-Pinto H. In situ hybridization 3

and chromosome banding in mammalian species. Cytogenet Genome Res. 2002; 96:113-116. 4

[16] ISCNDB, 2000. International System for Chromosome Nomenclature of Domestic 5

Bovids. Di Berardino D, Di Meo GP, Gallagher DS, Hayes H, Iannuzzi L (coordinator) (eds). 6

Cytogenet Cell Genet. 2001; 92:283-299. 7

[17] Rabbits P, Impey H, Heppell-Parton A, Langford C, Tease C, Lowe N, Bailey D, 8

Ferguson-Smith M, Carter N. Chromosome specific paints from a high resolution flow 9

karyotype of the mouse. Nat Genet. 1995; 9: 369–375. 10

[18] Wienberg J, Stanyon R, Nash WG. Conservation of human vs. feline genome organisation 11

revealed by reciprocal chromosome painting. Cytogenet Cell Genet. 1997; 77: 211-217. 12

[19] Phua ACY, Abdullah RB, Mohamed Z. A PCR-based sex determination method for 13

possible aplication in caprime gender selection by simultaneous amplification of the Sry and 14

Aml-X genes. J Reprod Dev. 2003; 49(4):307-311. 15

[20] Sullivan KM, Mannucci A, Kimpton CP, Gill P. A rapid and quantitative DNA sex test: 16

fluorescence- based PCR analysis of XY homologous gene amelogenin. Biotechniques. 1993: 17

15:636-641. 18

[21] Pailhoux E, Vigier B, Vaiman D, Servel N, Chaffaux S, Cribiu EP, Cotinot C. 19

Ontogenesis of female-to-male sex-reversal in XX polled goats. Dev Dyn. 2002; 224(1):39-50. 20

[22] Warot X, Fromental-Ramain C, Fraulob V, Chambon P, Dolle P. Gene dosage-dependent 21

effects of the Hoxa-13 and Hoxd-13 mutations on morphogenesis of the terminal parts of the 22

digestive and urogenital tracts. Development. 1997; 124(23):4781-91. 23

[23] Mauch TJ, Albertine KH. Urorectal septum malformation sequence: insights into 24

pathogenesis. Anat Rec. 2002; 268:405-10. 25

16

[24] Capel B, Albrecht KH, Washburn LL, Eicher EM. Migration of mesonephric cells into the 1

mammalian gonad depends on Sry. Mech Dev. 1999; 84(1-2):127-31. 2

[25] Capel B. The battle of the sexes. Mech Dev. 2000; 92(1):89-103. 3

[26] Yao HH. The pathway to femaleness: current knowledge on embryonic development of 4

the ovary. Mol Cell Endocrinol. 2005; 230(1-2):87-93. 5

[27] Karl J, Capel B. Sertoli cells of the mouse testis originate from the coelomic epithelium. 6

Dev Biol. 1998; 203(2):323-33. 7

[28] Tilmann C, Capel B. Cellular and molecular pathways regulating mammalian sex 8

determination. Recent Prog Horm Res. 2002; 57:1-18. 9

[29] Brennan J, Capel B. One tissue, two fates: molecular genetic events that underlie testis 10

versus ovary development. Nat Rev Genet. 2004; 5(7):509-21. 11

[30] Albrecht KH, Capel B, Washburn LL, Eicher EM. Defective mesonephric cell migration 12

is associated with abnormal testis cord development in C57BL/6J XY (Mus domesticus) mice. 13

Dev Biol. 2000; 225(1):26-36. 14

[31] Simpson JL, Rajkovic A. Ovarian differentiation and gonadal failure. Am J Med Genet. 15

1999; 89(4):186-200. 16

[32] Zinn AR. The X chromosome and the ovary. J Soc Gynecol Investig. 2001; 8(1 Suppl 17

Proceedings):S34-6. 18

[33] Fleming A, Vilain E. The endless quest for sex determination genes. Clin Genet. 2005; 19

67(1):15-25. 20

[34] Ross AJ, Capel B. Signaling at the crossroads of gonad development. Trends Endocrinol 21

Metab. 2005; 16(1):19-25. 22

[35] Haraguchi R, Mo R, Hui C, Motoyama J, Makino S, Shiroishi T, Gaffield W, Yamada G. 23

Unique functions of Sonic hedgehog signaling during external genitalia development. 24

Development. 2001; 128(21):4241-50. 25

17

[36] Yamada G, Suzuki K, Haraguchi R, Miyagawa S, Satoh Y, Kamimura M, Nakagata N, 1

Kataoka H, Kuroiwa A, Chen Y. Molecular genetic cascades for external genitalia formation: 2

An emerging organogenesis program. Dev Dyn. 2006 Apr 5; [Epub ahead of print] 3

[37] Kondo T, Dolle P, Zakany J, Duboule D. Function of posterior HoxD genes in the 4

morphogenesis of the anal sphincter. Development. 1996; 122(9):2651-9. 5

[38] Saperstein G. Congenital abnormalities of internal organs and body cavities. Vet. Clin. 6

North Am. (Food Anim. Pract.) 1993; 9: 115–125. 7

[39] de Santa Barbara P, Roberts DJ. Tail gut endoderm and gut/genitourinary/tail 8

development: a new tissue-specific role for Hoxa13. Development. 2002; 129(3):551-61. 9

[40] de Santa Barbara P, van den Brink GR, Roberts DJ. Molecular etiology of gut 10

malformations and diseases. Am J Med Genet. 2002; 115(4):221-30. 11

[41] Pearson JC, Lemons D, McGinnis W. Modulating Hox gene functions during animal body 12

patterning. Nature Reviews Genetics. 2005; 6: 893-904. 13

14

15

18

Figure captions: 1

Figure 1 – Rudimentar external genitalia. Note the underdifferentiation of the external 2

genitalia, which is reduced to a skin fold surrounding an erectile structure and assumes an 3

excentric position. 4

5

Figure 2 – Radiographic imaging of the caudal abdomen. Agenesis of last sacral and caudal 6

vertebra and atresia rectii can be observed. 7

8

Figure 3 – Macroscopic appearance of the calf genital tract. A: The fluid-filled uterus at the 9

surgery. B: Ovary and uterine tube. At gross evaluation, a streak gonad was observed near the 10

19

normally developed uterine tube (UT). C: Internal aspect of the genital tract showing the 1

uterus, vagina and vestibule. The morphological evaluation of the uterus evidenced a smooth 2

internal surface. To assess the urethral development, an urinary catheter was inserted throught 3

the urethra, from the urinary bladder (UB) to the vestibular-vaginal transition. D: On a closer 4

inspection, cervical remnants (arrows) were detected. 5

6

Figure 4 – Schematic representation of both normal bovine genitalia (left) and the excised 7

genitalia from the case reported here (right). The uterine tubes were not depicted in these 8

diagrams. 9

10

20

Figure 5 – Histological features. A: Ovary (longitudinal section). On lower magnification, the 1

loss of the cortical dominance relatively to the medulla is evident (HE; scale bar= 200µm 2

[small mu, Greek, m]). B: Ovary. On a higher magnification a scarce number of degenerated 3

primordial follicles are observed (HE; scale bar= 50µm [small mu, Greek, m]). C: Uterus. 4

Most of the uterine epithelium is missing from the uterus possibly due to fluid compression of 5

the mucosa. Furthermore, caruncular structures were sporadic in occurrence (HE; scale bar= 6

100µm [small mu, Greek, m]). D: Penis. The tubular structure that lies between the vestibule 7

and the external genital rudiment shows a structure compatible with a phallus. It is evident the 8

corpus spongiosum (CS) surrounding the urethral mucosa and the corpus cavernosum (CC) 9

covering the dorso-lateral aspects of the urethra (U). (HE; scale bar= 500µm [small mu, Greek, 10

m]) 11

12