Characterization of the Gene for dbpA, a Family Member of the Nucleic-Acid-Binding Proteins...

Eur. J. Biochem. 231, 72-82 (1995) 0 FEBS 1995

Characterization of the gene for dbpA, a family member of the nucleic-acid-binding proteins containing a cold-shock domain Shinichi KUDO ', Marie-Genevieve MATTEI* and Minoru FUKUDA'

' La Jolla Cancer Research Foundation, USA Institut National de la Sante et de la Recherche Medicale U.242 Centre de Genetique Medicale Hopital d'Enfants de la Timone, Marseille, France

(Received 6 March124 April 1995) - EJB 95 0355/2

Human DNA-binding proteins, dbpA and dbpB (YB-1), are members of a protein family containing a cold-shock domain, and are regarded as transcriptional regulators. Here, we isolated genomic fragments of these genes and characterized their transcriptional regulation. Analysis of 2 phage genomic clones revealed that the dbpA gene consists of 10 exons spanning a 24-kb genomic region. The cold-shock domain, composed of about 70 amino acid residues, is encoded separately by exons 2-5. The exon 6, encoding 69 amino acid residues, was found to be an alternative exon. Northern-blot analysis showed that both genes were highly expressed in skeletal muscle and heart compared with in other tissues. The dbpA gene contains no typical TATA box or CAAT box at the immediate 5' region, but a sequence similar to an initiator consensus sequence was revealed at a major transcription-start site. A transient expression assay using the chloramphenicol acetyltransferase reporter gene revealed that the sequence located at positions -17 to +70 relative to the major transcription-start site was critical for promoter function. Within this region, the consensus sequence for serum-response element, CC(A/T),GG, is present at positions -13 to -4 in addition to the initiator sequence. Immunofluorescence showed the cellular localization of dbpA to be both in the cytoplasm and nucleus, particularly at the perinuclear region. In situ hybridization demonstrated the localization of the dbpA gene on chromosome 12 band p13.1, whereas dbpB-(YB-1)-related genes were dispersed on many chromosomes with strongest hybridization signals on chromosome 1. All 16 dbpB (YB-1) clones, isolated from the same genomic library used for dbpA genomic cloning, were processed genes because of their intronless stuctures and multiple mutations. One of these processed genes possesses an open reading frame, which encodes most of the amino acid residues of dbpB (YB-1). These results indicate that dbpA and dbpB (YB-1) genes evolved in different fashions after deviation from a common ancestral gene.

Keywords. DNA-binding proteins; genomic structure; transcriptional regulation ; gene evolution.

Human DNA-binding proteins, dbpA and dbpB (YB-I), are members of the protein family containing a highly conserved domain called the cold-shock domain [l]. The cDNAs encoding DNA-binding proteins, dbpA and dbpB, were first isolated from a human placental cDNA library using 2 phage expression cloning with affinity to sequences from the epidermal growth factor receptor enhancer and the c-erb-2 gene promoter [2]. The cDNA encoding YB-1, which is identical to dbpB, was isolated by a similar expression screening with the promoter sequence of the HLA-DRB gene [3]. Although the isolation of these cDNAs and characterization of their binding activities to specific sequences has been reported by several groups [4-71, the function of these molecules as trancriptional regulators has only recently been demonstrated. Kashanchi et al. [8] reported that dbpB (YB-1) is involved in the transactivation of human T-cell lymphotropic virus type I-gene. dbpB (YB-1) is also reported to play a role as

Correspondence to M. Fukuda, La Jolla Cancer Research Founda-

Far: + I 619 450 2101. Abbreviation. CAT, chloramphenicol acetyltransferase. Note. The nucleotide sequences reported in this paper have been

submitted to the GenBankTM/EMBL Data Bank and are available under accession numbers L29064-L29073 and L37.516.

tion, 10901 North Torrey Pines Road, La Jolla, CA 92037, USA

a repressor of interferon-y-induced transcription of class-I1 major histocompatibility complex genes [9].

Homologues of dbpB (YB-1) in other species are known to possess biological functions other than that of a transcriptional factor. The mouse homologue has been demonstrated to be involved in masking transcripts during spermatogenesis [ 101. In addition, the Xenopus homologue, FRGY2, has been shown to regulate the translation of maternal mRNAs, protecting them in the Xenopus oocyte until embryogenesis [ l l ] . A unique feature of this protein family is a highly conserved stretch of about 100 amino acids containing 70 residues homologous to the cold- shock protein in bacteria [12]. This protein is thought to have dual functions in transcription and translation [13].

In the course of screening a 2 phage expression library with a DNA probe containing the human leukosialin (CD43) promoter sequence [14], we isolated two clones identical to dbpA and dbpB (YB-1) cDNA [Z, 31. Although these proteins bind to the leukosialin promoter, the expression patterns of these genes do not reflect the tissue-specific expression of leukosialin, which is present only in hematopoietic cells. Since these related proteins are expressed in such a broad range of species, fundamen- tal biological functions of these proteins are expected. For better understanding of these molecules in conjunction with the struc-

Kudo et al. ( E m J. Biochem. 231) 73

pActln

Fig.1. High expression of dbpA and dbpB in skeletal muscle and heart. A human multiple tissue blot containing poly(A)-rich RNA from the indicated tissues was hybridized with a clone 83 dbpA cDNA probe (A) or with clone 33 dbpB (YB-1) cDNA (B). After hybridization and washing, the film was exposed for 1 h in each case. Positions of the RNA size markers (kilobases) are indicated on the left. As an internal control, p-actin transcripts were detected in the rehybridized blot exposed for 5 h.

tural aspects of the genes, we undertook the investigation of the genomic DNAs.

MATERIALS AND METHODS

Screening of the cDNA library. A Jurkat i g t l l cDNA library was obtained from Clontech laboratory and screened by the expression cloning method described by Singh et al. [15]. A concatemer of double-stranded oligomer containing the leukosialin promoter sequence (S-GGTGGGTGGGGTGGGTGGAG- CCAGGG-3’) was end-labeled with [y-32P]ATP by T4 kinase and used as a probe. The phage DNAs were prepared as described previously [16]. The cDNA inserts were subcloned into Bluescript plasmid vector (Stratagene). Since these isolated cDNAs were truncated at the 3’ region downstream from the internal EcoRI site, a K562 cDNA library was constructed in Agt22A phage vector as described previously [17] and screened by DNA hybridization using obtained cDNAs as probes.

Isolation of genomic DNA clones. A human placental genomic DNA library in EMBL3 SP6/T7 phage vector (Clontech Laboratory) was screened using cDNA inserts as probes. The isolated phage were propagated, and phage DNAs prepared as described previously [18]. Restriction enzyme sites of genomic inserts were determined by method described previously [16].

1 kb Y E 7 E8E9 El0 E l E 2 E 3 E 4 ES €6

R I X x m R I R I R I R I R I R I

I I GAP6

E l E 2 E 3 E l E5 €6 E7 E8E9 €10

Fig. 2. Genomic organization and splicing pattern of the dbpA gene. (A) The dbpA gene was covered with two genomic phage clones, GAP6 and GAP2, which are depicted by open boxes. An exon is denoted by a vertical bar, and the 5‘-flanking and 3’-flanking regions and introns are denoted by horizontal lines. EcoRI (RI) and XhoI (X) cleavage sites are indicated. (B) The splicing pattern of dbpA transcipts is shown. Exons are denoted by vertical bars. Alternative splicing, which skips exon 6, is shown by the dashed-broken line.

DNA fragments of interest were subcloned into Bluescript (Stra- tagene) and subjected to DNA sequencing.

Northern-blot hybridization. A multiple tissue blot containing poly(A)-rich RNAs from different human tissues was obtained from Clontech, and probed with cDNA inserts. The hybridization reaction was performed as described previously [19]. The relative amount of poly(A)-rich RNA in each lane was examined by rehybridization of the blot with a /3-actin probe.

DNA sequencing. Nucleotide sequences were determined by the dideoxy-chain-termination method [20] using alkaline-dena- tured plasmid DNAs as templates. T3 and T7 primers and synthetic oligonucleotides prepared on an Applied Biosystems DNA synthesizer were used as primers. Obtained sequence data were compiled and analysed on an Apple Macintosh computer with a DNAsis program (Hitachi software).

Primer-extension analysis. 10 pg poly(A)-rich RNA from Jurkat cells was annealed with a dbpA-specific primer. Oligo- nucleotide OR1 (5‘-G2TGGTCGGCGGTTAGCGCGGCT-3’), whose sequence started 42-bp upstream from the translation-initiation codon, was labelled at the 5’ end with [y-32P]ATP and T4 kinase [16]. The extension reaction was carried out with Molo- ney murine leukemia virus reverse transcriptase (GibcoBRL) as described previously [14]. The resulting products were separated on an 8% polyacrylamide sequencing gel and the sequencing ladders of M13mp18 were used as size makers.

Transient expression assay with the chloramphenicol acetyltransferase (CAT) gene. DNA fragments containing various 5‘ regions of the dbpA gene were synthesized by PCR [21] using synthetic oligonucleotides designed on the basis of the genomic sequence. The 3‘ primer (5’-TTTGTCGACTCGCGCTGGCG- GAGGCGGCT-3’) contained the sequence from positions + 70 to +51 relative to the major transcription start site attached to a SulI recognition sequence and three thymine residues. The 5‘ primers contained sequences derived from various 5’ flanking and untranslated sequences, preceded by three thymine residues and a SphI recognition sequence. A dbpA genomic DNA clone, GAP6, was used as a template for PCR amplification. Synthe- sized DNA fragments were cloned into the SphI and Sum sites of pCAT-Basic vector (Promega) and the sequences of inserts

-intro

. atactaatttatctgcttaatcctattttag/CCACCAAAGTCCT

.... ct

. ttttgaggccatctttttattttcttctcag/GGTGCAG~GCTG

... ca

... cc

... at

ctgatttatggctttgttttgcattttag/GCC~GGCAGGTG

207 98

Kudo et al. (Eul: J. Biochem. 231) 75

Fig. 3. Transcription-start sites defined by primer-extension analysis. Poly(A)-rich RNAs (10 pg) from Jurkat cells were transcribed by priming with the oligonucleotide OM, whose sequence starts 42-bp upstream from the translation-initiation codon (shown in Fig. 5) . The synthesized products were separated by a sequencing gel with the M13mp18 sequencing ladder. Detected bands are indicated by arrows with the dis- tance from the priming site. nt, nucleotides.

were confirmed by DNA sequencing. As a positive control plasmid, pcDNACAT was constructed by inserting the CAT gene block (Pharmacia) in pcDNAI (Invitrogen), which possesses the cytomegalovirus promoter/enhancer [17]. These CAT constructs (an amount equivalent to 10 pg pCAT-Basic) were transfected into Jurkat cells by the CaPO, method [22] and, 48 h later, the CAT activity was assayed according to the method of Gormanet al. [23] with a slight modification. The transfection efficiency was normalized by cotransfection of Lk4lac (1 pg), a P-galactosidase expression vector.

Production of polyclonal anti-dbpA IgG. A fusion protein was produced using the glutathione S-transferase gene system [24]. Clone 83 dbpA and clone DB12 dbpB (YB-1) cDNA inserts were cloned into the EcoRI site of pGEX1AT (Pharmacia) in-frame. The recombinant plasmid was transfected into Esche- richza coli strain XL1 Blue (Stratagene). A fusion protein was prepared from the bacterial lysate after induction with isopropyl thiogalactoside (Sigma), and purified by glutathione-Sepharose 4B column (Pharmacia) chromatography [24]. A rabbit was im- munized three times with 250 pg fusion protein in Freund’s complete adjuvant and polyclonal antibodies were purified on protein-A-agarose (GibcoBRL).

Immunofluorescence staining. Hela cells grown on cover- slips were fixed with ice-cold acetone for 10 min. Fixed cells were treated with 8.1 mM Na,HPO,, 1.5 mM KH2P04, 2.7 mM KC1, 137 mM NaC1, pH 7.4 (NaCVP,) containing 4 mg/ml BSA for 10 min at room temperature, then incubated with anti-dbpA in a 1 : l O O dilution for 1 h at room temperature. After several washings with NaCVP,, the cells were incubated with fluores- cein-conjugated goat-anti-rabbit IgG (Sigma) for 1 h at room temperature. The antibodies were diluted in NaCl/Pi containing

4 mg/ml BSA. The cells were washed, mounted on slides and observed under a Zeiss Axioplan fluorescence microscope and photographed with Kodak TMAX film.

In situ chromosomal hybridization. The cDNA inserts from clones 83 dbpA and DB12 dbpB (YB-1) were labeled by nick translation with [3H]thymidine and used as probes. Hybrid- ization was carried out on a chromosome preparation obtained from phytohemagglutinin-stimulated human lymphocytes, as described previously [25]. After coating with nuclear track emul- sion, the slides were exposed for 2 weeks at 4°C. Chromosome spreads were first stained with a buffered Giemsa solution and metaphases photographed. R-banding was then performed by the fluorochrome-photolysis-Giemsa method and metaphases re- photographed.

Gel-mobility-shift assay with RNA probe. Gel-mobility- shift assays were performed essentially as described by Singh et al. [26], except that the probe used was end-labeled RNA.

CACU-3’) was prepared by an Applied Biosystem synthesizer and labeled with [y-32P]ATP and T4 kinase. The RNA probe (2x10, cpm) was incubated with 10 ng fusion protein in a 2 0 4 reaction of 1OmM TrisMCl, pH7.5, 50 mM NaCl, 5 mM MgC12, 1 mM dithiothreitol, 1 mM EDTA, 5% glycerol and 40 units RNase inhibitor (Boehringer Mannheim) for 20 min at room temperature. The resultant reaction mixtures were separated on a 4% polyacrylamide gel. Fusion proteins, pGEX83 (dbpA) and pGEXDB12 (dbpB), were prepared as described above.

RPGS-RNA (5’-UGGGUGGGG-UGGGUGGAGCCAGGGCC-

RESULTS

Isolation of full-length cDNAs for dbpA and dbpB (YB-1). Previously, we studied the transcriptional regulation of the human leukosialin (CD43) gene and showed that the sequence at positions -40 to -53 relative to the transcription-start site is involved in the promoter activity [14]. This regulatory region was found to be functional in both leukosialin-expressing and non-expressing cells. Recently, we showed that this promoter is the binding site for the Spl transcription factor and that transcription is positively reguiated by Spl [27]. We have also at- tempted to identify the factors involved in tissue-specific expression of leukosialin. For this purpose, we used an expression screening method described by Singh et al. [15]. By affinity screening of the Jurkat expression library with a leukosialin (CD43) promoter DNA fragment, we obtained 55 positive clones from lo6 recombinant phage. Clones were divided into two groups based on restriction enzyme digestions and cross- hybridization of inserts. One representative clone from each group (clone 33 and clone 83) was chosen and sequenced. A computer search of the Genbank revealed that the sequences of clone 83 and clone 33 were identical to the cDNA sequences of DNA-binding proteins dbpA and dbpB (YB-l), respectively. These cDNAs were originally isolated by affinity screening using the epidermal growth factor receptor promoter and enhancer [2]. In our screen, out of 55 clones isolated, 50 clones corresponded to dbpB (YB-1) transcripts and five clones corresponded to dbpA transcripts. Specific binding of these fusion proteins to the leukosialin promoter sequence was tested in a filter- binding assay, showing strong binding to the probe (data not shown). Transcriptional levels of the dbpA and dbpB (YB-1) genes in various human tissues were examined by Northern-blot hybridization (Fig. 1). The result revealed an extremely high level of dbpA transcription in the skeletal muscle. A high level of transcription was also observed in heart compared with the other tissues. The dbpA transcript was not detected in the brain

76 Kudo et al. ( E m J. Biochem. 231)

Fig. 4. Sequence features of the transcriptional regulatory region. The nucleotide sequence of the 5'-region of the dbpA gene is presented starting from the EcoRI site of the genomic clone GAP6. The oligonucleotide (ORI) used for the primer-extension analysis is indicated by a horizontal arrow. Transcription-start sites determined by primer-extension analysis (Fig. 3) are indicated by dots. The nucleotide position is numbered from the major transcription-start site, shown by + 1. Sequences for transcription-factor-binding motifs are boxed. SRE, serum-response element. The translation-initiation codon is indicated by MET.

even after long exposure times. When dbpB (YB-1) cDNA was used for hybridization to the same blot, a high level of transcription was similarly detected in the skeletal muscle and heart. In addition, transcription was detected in the lung, kidney and liver, and marginally in the brain (Fig. 1). Full-length cDNAs for these transcripts were isolated as described in Materials and Methods. The largest inserts of each kind of cDNA, DA7 for dbpA and DB12 for dbpB (YB-l), were excised and cloned into a Bluescript plasmid vector. The sequence analysis indicated that these cDNAs contained dbpA and dbpB cDNAs, including the 3' untranslated region and polyadenylation signals with poly(A) stretches.

Structural organization of DNA-binding protein A gene. In order to understand the structures and transcriptional regulation of dbpA and dbpB (YB-1) genes, we then isolated genomic DNA clones. A total of lo6 phage of a human placental genomic library were screened with DA7 and DB12 cDNAs as probes. Two overlapping dbpA genomic clones, GDA 2 and GDA6, were isolated (see Fig. 2) . EcoRI or EcoRI-XhoI fragments of the genomic inserts in GDA2 and GDA6 were subcloned into the Bluescript vector and nucleotide sequences were determined. These results showed that the dbpA gene consists of 10 exons spanning 24 kb. All exon-intron junction sequences (Fig. 2) con- form to the GT/AG rule [28] and splicing branch points [29] are

present at the intron sequences close to the 3' splicing sites (see Table 1). The DNA-binding domain, whose amino acid sequence was highly conserved among homologues identified in higher eukaryotes, was encoded at exons 1-5. Within this region, the cold-shock domain, which is highly conserved from bacteria to human and contains about 70 amino acid residues, was encoded in exons 2-5. It was found that exon 6, which encodes 69 amino acids, is alternatively spliced, since the sequence was missing in some cDNAs. All dbpB (YB-1) genes isolated were pseudogenes possessing an intronless structure and multiple substitu- tions.

Transcriptional regulation of the dbpA gene. To understand the transcriptional regulation of the dbpA gene, we first determined the transcription-start sites by primer-extension analysis using Jurkat poly(A)-rich RNAs. One major start site, 171-bp upstream from the priming site, and several minor start sites up to 201-bp upstream were detected (Fig. 3). We define the major transcription-start site at an adenine residue as nucleotide position + I . The region immediately upstream from this site does not contain a canonical TATA or CAAT box, but the sequence of a major transcription-start site is similar to the consensus sequence of the initiator (pypyANA/Tpypy), which can provide a basal transcriptional level and define a transcriptional start site [30]. In addition, the transcription-factor-binding motifs for

Kudo et al. (Em J. Biochern. 231) 77

Fig.5. Effect of a serial deletion in the 5’ region on transcriptional activity of the dbpA gene. Various DNA fragments of the 5’ region were amplified by PCR and were cloned into the pCAT-Basic vector as described in Materials and Methods. These CAT constructs were cotransfected into Jurkat cells with a p-galactosidase expression vector (Lk4lac), which was utilized for normalization of transfection efficiency. CAT activities are expressed relative to that of pcDNACAT, which harbors the cytomegalovirus prornoter/enhancer. Data are presented as the mean and standard deviation of three separate experiments.

serum-response element, Spl, Oct-4 and the E-box were identified (Fig. 4). To localize the transcriptional regulatory region, a transient expression assay with the CAT gene was conducted using Jurkat cells (Fig. 5). The DNA fragments containing the various 5‘ flanking regions were amplified by PCR and cloned into the promoterless pCAT-Basic vector as described in Ma- terials and Methods. The pcDNACAT, which contains the cytomegalovirus promoter/enhancer was used as a standard for the CAT activity. Shortening the 5’ flanking region from -1354 to - 157 nucleotides increased CAT activity. Maximal activity was obtained with the - 157-nucleotide construct, which showed seven-times higher CAT activity compared with that of pDA1- CAT (- 1354/+70). Further proximal deletions gradually de- creased transcriptional activity. A significant decrease in CAT activity was demonstrated between pDA6CAT (- 17/+70) and pDA7CAT (+1/+70) with 92% and 30% the activity of pcDNACAT, respectively (Fig. 5) . Therefore, the critical 5’ boundary of the promoter appears to be between nucleotides - 17 and + 1. Located in this region is the initiator sequence and a sequence similar to the consensus motif for the serum-response element [31], CCATTTTTGG (Fig. 4). In the region immediately upstream of this regulatory region, there were two Spl- binding sequences, CCGCCC [32] and CCACCC [33], at nucleotides -58 and -75, respectively. The octamer-binding transcription factor-4 (Oct-4) recognition sequence ATGCTAAT [34] was present at nucleotide -117. Deletion of this region in CAT constructs led to a twofold decrease in transcriptional activity when the activity of pDA4CAT( - 157/+70) was compared to that of pDA5CAT(-36/+70). There are multiple E- boxes of the sequence CANNTG [35] (Fig. 4), which may play a role in the high transcriptional level observed in skeletal muscle and heart.

Cellular localization of dbpA. Hela cells, which express high levels of dbpA transcripts (unpublished data) were used to examine the subcellular localization of this gene product. To analyze nuclear and cytoplasmic staining, cells were fixed in cold acetone. Polyclonal anti-dbpA showed strong cytoplasmic staining, particularly at the perinuclear region (Fig. 6A) Nuclear staining is also apparent in comparison to the preimmune control (Fig. 6B). Although we could not produce an antibody specific to dbpB (YB-l), it has been reported that dbpB (YB-1) is detected in the nuclear fraction rather than in the cytoplasm [6]. The difference in the staining patterns of dbpA and dbpB (YB-1)

Fig. 6. Immunofluorescence staining of Hela cells with anti-dbph polyclonal serum. Hela cells were reacted with anti-dbpA polyclonal serum (A) or preimmune serum (B), and stained by fluorescence-conjugated goat anti-rabbit IgG.

suggests that, despite their similar structures, these proteins probably serve different functions.

Chromosome localization of dbpA and dbpB (YB-1) genes. In order to determine the chromosomal locations of dbpA and dbpB (YB-1) genes, in situ hybridization was performed as described in Materials and Methods. For localization of the dbpA gene, 100 metaphase cells were examined. There were 355 silver

Kudo et al. ( E m J. Biochern. 231)

'...... I......

12 Fig. 7. Distribution of labeled sites on chromosome 12, probed by dbpA cDNA. (A) Human metaphases showing the specific site of hybridization on chromosome 12. Left panel, the arrowhead indicates silver grains on Giemsa-stained chromosomes, after autoradiography. Right panel, chromosomes with silver grains were subsequently identified by R-banding. Chromosome 12 is indicated by an arrow. (B) The peak of hybridization occurs on band p13.1 of chromosome 12.

grains associated with chromosomes; 64 of these (18%) were located on chromosome 12 (Fig. 7A). 73.4% mapped to the p12.3 to p13.3 regions of the short arm of chromosome 12, with a maximum in the p13.1 band (Fig. 7B). The dbpB (YB-I) gene was localized to multiple chromosomes with strong peaks on chromosomes I , 14, and 15 (Fig. 8A). In the 200 metaphase cells examined, there were 465 silver grains associated with chromosomes, 67 of these (14.4%) located on chromosome 1 (Fig. 8B). 67.1% mapped to the p33-p34 region of the short arm of chromosome 1, with maximum grains in the p34 band (Fig. 8C). This result is consistent with our observation of dbpB (YB-1) genomic clones. Atotal of 19 dbpB (YB-1)-related genomic clones were obtained; these genes were determined to be processed pseudogenes because they contained no introns, had multiple substituted nucleotides, and also a poly(A) stretch which might reflect the poly(A) tail of mRNA. Seven different pseudogenes were identified by sequencing these related genes. One of the processed genes (Fig. 9) is flanked by a perfect direct repeat sequence comprised of 19 bp, which may be produced by a mechanism similar to retroposon insertion [36]. This processed gene contains an open reading frame encoding most of the same amino acid residues of dbpB (YB-1) in-frame. This gene also contains TATA-like and CAAT-like sequences and putative transcription-factor-binding motifs in the 5' region (Fig. 9), raising the possibility that the gene is transcribed. These results indicate that dbpA and dbpB (YB-1) genes are derived from a

Chmrnmama N u m b

Fig. 8. Histogram showing grain distribution in 200 metaphases obtained by dbpB (YB-1) cDNA. (A) The abscissa represents the relative size of the chromosome and the ordinate shows the number of silver grains. (B) Human metaphases showing one site of hybridization on chromosomal 1. Left panel, arrowhead indicates silver grains on Giemsa- stained chromosomes after autoradiography. Right panel, chromosomes with silver grains were subsequently identified by R-banding. Chromo- some 1 is indicated by an arrow. (C) The peak of hybridization occurs on band p33-34 of chromosome 1.

common ancestral gene that evolved in a different fashion after deviation.

DISCUSSION

In this report, we isolated cDNAs for dbpA and dbpB (YB-1) that bind to the promoter sequence of leukosialin. We then isolated genomic clones encoding these transcripts. From analyses of its genomic structure, dbpA was found to be encoded on separate exons. The DNA-binding domain is encoded on exons 1-5 (Fig. 10). Recently, crystallographic studies showed that the cold-shock protein from Bacillus subtilis has a structure of an antiparallel five-stranded @ barrel [37, 381. It is assumed that dbpA contains a structure similar to this cold-shock protein in its DNA-binding domain. A ribonucleoprotein-I-binding motif [ GA] - [FY 1- [GA] - [FYI - [IVA], preserved in this protein family [39], is present in the 3' end of exon 2. We found that exon 6, which encodes the 69 amino acid residues adjacent to the DNA- binding domain, is alternatively spliced. The function of this region is not clear, but the DNA-binding affinity of protein lack- ing this region was shown to be less than that of the intact protein in filter-binding assays (data not shown).

In this study, the 5' region of the dbpA gene was used for analysis of transcriptional regulation. An initiator consensus sequence was found at a major transcription-start site of the dbpA

Kudo et al. (Eul: J. Biochem. 231) 79

Fig. 9. Sequence of dbpB (YB-1) processed gene containing an open reading frame. The nucleotide sequence of the dbpB-(YB-1)-related genomic clone (NAR12) is presented with the predicted amino acid sequences. Nucleotides and amino acids differing from those of dbpB (YB-1) [2, 31 are shown below and above each sequence. Deletions are denoted by dashes. Perfect direct repeat elements flanking the processed gene are underlined. Transcription-factor-binding motifs predicted by comparison with consensus sequences are boxed. The 5' end of the dbpB cDNA sequence is indicated by an arrow. The polyadenylation signal is indicated by double underlines and a polyadenine stretch is shaded.

gene, which might account for a basal transcriptional level. A transient expression assay using the 5' region of this gene sug- gested that the short DNA segment, including the initiator sequence and the sequence motif for the serum-response element, was critical for promoter function. Upstream cis-acting elements, determined to be consensus sequences for Spl and Oct4 binding, may also play a role in the activation of transcription. Extremely high expression in skeletal muscle could be explained by the multiple E-box, CANNTG, in the 5' flanking region up to position -1350 (Fig. 4). MyoDl, which binds to the E-box,

is also known to regulate a gene expressed in both skeletal muscle and heart. For example, the a-cardiac actin gene is regulated by the cooperative actions between serum-response factor, MyoDl and Spl transcription factor [40, 421. These consensus sequences, noticed in this study, may play a role in the high expression in the heart. Further studies are necessary to determine whether or not these factors bind to the dbpA promoter.

In situ hybridization demonstrated that the dbpA gene is located at a single locus on chromosome 12. dbpB (YB-1) genes

80 Kudo et al. (Eur J. Biochem. 231)

E l E 2 E3 E4 E 5 E6 E7 EB 88 109120 150 191 260 293

............... .............. ............... .............. ............... .............. ............... .............. 1 I(? RNP-1 191 260 342 - - -

Cold S W Protein N-terminal Alternative C-terminal

Domain DNA Binding Domain Domain Domain

6 ? d a

3 ? a o l o - C S ~ B ~ E K ~ - E O P D ~ S A I ~ ~ Q F - K ~ L - - - E ~ ~ S C ~ ~ ~ ~ 1-67

abpA -QYQPINRvmrrmWPYR A I X K N N P ~ S V Q I X 3 E ~ P D V V E m D 90-161 . *.*.* . *.* ..*** ** ..............

9 0 100 -1110 1 2 r 130 1 4 0 7 160

E 2 € 3 € 4 E 5

Fig. 10. Domain structure of dbpA. (A) The DNA-binding domain is coded in separate exons. The domain coded in an alternative exon, exon 6, is less similar to the other members of this family. The ribonucleoprotein-1-binding motif shown by a filled box is located on exon 2. (B) Amino acid sequence comparison between cold-shock protein of B. subtilus [50] and dbpA. Identical amino acid residues are indicated by asterisks. Residues forming the P-barrel structure [37, 381 are boxed. Exon boundaries are indicated by arrows.

were detected as high background levels with strong peaks on chromosomes 1, 14, and 15. The locations of dbpB were different from those predicted by the mouse interspecific backcross analysis [6], namely on chromosomes 4, 11, 16 and 19. dbpB (YB-1) pseudogenes appeared to be dispersed on many chromosomes and strong hybridization peaks may represent repeated dbpB (YB-1) genes clustered on those loci. We obtained 19 dbpB-(YB-1)-related genomic clones on the first screening of the human placenta genomic library, a screen which yielded only two dbpA genomic clones. It is noteworthy that rat, cow and mouse also possess multiple copies of dbpB (YB-1) pseudogenes, and at least 15 copies were predicted in mouse [42- 441. There is some diversity in the dbpB cDNA sequences from different isolations [45]. We also found that the 5' end of the dbpB (YB-1) cDNA had a large degree of heterogeneity (data not shown). It is possible that some processed dbpB (YB-1) genes are also transcribed from promoters flanking the integ- ration sites. If this is the case, it is possible that the processed gene might encode a protein similar to dbpB (YB-l), as shown in the open reading frame of one gene studied here. In summary, dbpA and dbpB (YB-1) genes appear to have evolved differently after duplication of a common ancestral gene.

In addition to these members of the cold-shock protein family, there is a related gene known as the unr gene, located immediately upstream of the N-ras proto-oncogene [46]. The open reading frame of this gene encodes nine repeats of the cold- shock domain. A partial sequence of the 3' end of the guinea pig unr gene showed that the last unit of the cold-shock domain is encoded in a single exon [47]. In addition, this unit lacks the first 10 amino acid residues of the cold-shock domain. Thus, it is assumed that this gene deviated earlier from the common ancestral gene of both dbpA and dbpB (YB-1) genes. This gene locus on chromosome I p23 is apparently different from that of dbpB (YB-1) detected on chromosome 1 p34. The function of the unr gene product is unknown, however, as for dbpA and dbpB (YB-l), it is highly expressed in skeletal muscle [48]. It

is possible that these genes are controlled by regulatory regions containing similar cis-acting elements.

At present it is not clear how dbpA and dbpB (YB-1) regulate leukosialin gene expression. McCormick et al. [49] reported that the replication origin of the herpes simplex virus type 1 has a GTGGGTGGG sequence, which is contained in the leukosialin promoter DNA we used as a probe. McCormick et al. 1491 found that proteins could bind to single-stranded or double-stranded DNA or RNA with this nucleotide sequence. Our preliminary studies showed that dbpA and dbpB fusion proteins could bind to RNA as well as DNA (data not shown). It is possible that the protein observed by McCormick et al. [49] was dbpA or dbpB (YB-1). Further studies are required to understand the regulatory function of dbpA and dbpB.

We thank Dr Wanda Reynolds for helpful discussion, Anthony Sher for excellent technical assistance and Ms Bobbi Laubhan for secretarial assistance. This work was supported by grant ROlCA33895 awarded by the National Cancer Institute.

REFERENCES 1 . Wolffe, A. P., Tafuri, S., Ranjan, M. & Familari, M. (1992) The

Y-box factors: family of nucleic acid binding proteins conserved from Escherichiu coli to man, New Bid. 4, 290-298.

2. Sakura, H., Maekawa, T., Imamoto, F., Yasuda, K. & Ishii, S. (1988) Two human genes isolated by a novel method encode DNA-binding proteins containing a common region of homology, Gene (Amst.) 73, 499-507.

3. Didier, D. K., Schiffenbauer, J., Woulfe, S. L., Zacheis, M. & Schwartz, B. D. (1988) Characterization of the cDNA encoding a protein to the major histocompatibility complex class I1 Y box, Proc. Nut1 Acad. Sci. USA 85, 7322-7326.

4. Hasegawa, S. L., Doetsch, P. W., Hamiltom, K. K., Martin, A. M., Okenquist, S. A,, Lenz, J. & Boss, J. M. (1991) DNA binding properties of YB-I and dbpA: binding to double-stranded, single-

Kudo et al. (Eur: J. Biochem. 231) 81

stranded, and abasic site containing DNAs, Nucleic Acids Res.

5. Yan, C. & T a m , I. (1991) Molecular cloning and characterization of interferon alp response element binding factors of the murine (2'-5') oligoadenylate synthetase ME-1 2 gene, Proc. Natl Acad. Sci. USA 88, 144-148.

6. Spitkovsky, D. D., Royer-Pokora, B., Delius, H., Kisselijov, F., Jenkins, N. A., Gilbert, D. J., Copeland, N. G. & Royer, H.-D. (1992) Tissue restricted expression and chromosomal localization of the YB-1 geneencoding a 42 kD nuclear CCAAT binding protein, Nucleic Acids Res. 20, 797-803.

7. Kolluri, R., Torrey, T. A. & Kinniburgh, A. (1992) A CT promoter element binding protein: definition of a double-strand and a novel single-strand DNA binding motif, Nucleic Acids Res. 20, 111- 116.

8. Kashanchi, F., Duvall, J. F., Dittmer, J., Mireskandari, A., Reid, R. L., Gitlin, S. D. & Brady, J. N. (1994) Involvement of transcrption factor YB-1 in human T-cell lymphotropic virus type I basal gene expression, J. virol. 68, 561 -565.

9. Ting, J. P.-Y., Painter, A., Zeleznik-Le, N. J., MacDonald, G., Moore, T. M., Brown, A. & Schwartz, B. D. (1994) YB-1 DNA- binding protein represses interferon y activation of class I1 major histocompatibility complex gene, J. Exp. Med. 179, 1605- 1611.

10. Tafuri, S . R., Familari, M. & Wolffe, A. P. (1993) A mouse Y box protein, MSY, is associated with paternal mRNA in spermato- cytes, J. Biol. Chem. 268, 12213-12220.

11. Murray, M. T., Schiller, D. L. & Franke, W. W. (1992) Sequence analysis of cytoplasmic mRNA-binding proteins of Xenopus oocytes identifies a family of RNA-binding proteins, Proc. Natl Acad. Sci. USA 89, 11-15.

12. Wistow, G. (1990) Cold shock and DNA binding, Nature 344, 823- 824.

13. Jones, P. G. & Inouye, M. (1994) The cold-shock response- a hot topic, Mol. Microbiol. 11, 811-818.

14. Kudo, S. & Fukuda, M. (1991) A short novel promoter sequence confers the expression of human leukosialin, a major sialoglyco- protein on leukocytes, J. Biol. Chern. 266, 8483-8489.

15. Singh, H. R., Clerc, R. G. & LeBowitz, J. H. (1989) Molecular cloning of sequence specific DNA binding proteins using recognition site probes, Biotechnology 7, 252-261.

16. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989) Molecular cloning: a laboratory manual, 2nd edn, Cold Spring Harbor Labora- tory, Cold Spring Harbor, NY.

17. Kudo, S . , Onda, M. & Fukuda, M. (1994) Characterization of glycophorin A transcripts : control by the common erythroid-specific promoter and alternative usage of different polyadenylation signals, 1. Biochem. (Tokyo) 116, 183-192.

18. Kudo, S. & Fukuda, M. (1989) Structural organization of glycophorin A and B genes: glycophorin B gene evolved by homologous recombination at Alu repeat sequences, Proc. Natl Acad. Sci. USA

19. Kudo, S. & Fukuda, M. (1990) Identification of a novel human glycophorin, glycophorin E, by isolation of genomic clones and com- plementary DNA clones utilizing polymerase chain reaction, J. Biol. Chem. 265, 1102-1110.

20. Sanger, F., Nicklen, S. & Coulson, A. R. (1977) DNA sequencing with chain-terminating inhibitor, Proc. Natl Acad. Sci. USA 74,

21. Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi. R., Horn, G. T., Mullis, K. B. & Erlich, H. A. (1988) Primer-directed enzymatic amplication of DNA with a thermostable DNA polymerase, Science 239, 487 -491.

22. Graham, F. L. & van der Eb, A. J. (1973) A new technique for the assay of infectivity of human adenovirus 5 DNA, Virology 52, 456 - 457.

23. Gorman, C. M., Moffat, L. F. & Howard, B. H. (1982) Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells, Mol. Cell. Biol. 2 , 1044-1051.

24. Smith, D. B. & Johnson, K. S . (1988) Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S-transferase, Gene (Amst.) 67, 31 -40.

25. Nguyen, C., Mattei, M.-G., Mattei, I.-F., Santoni, M.-J., Goridis, C. & Jordan, B. R. (1986) Localization of the human NCAM gene

I9,4915 -4920.

86, 4619-4623.

5463 -5467.

to band q23 of chromosome 11 : the third gene coding for a cell interaction molecule mapped to the distal portion of the long arm of chromosome 11, J. Cell B id . 102,711-715.

26. Singh, H. R., Sen, D., Baltimore, D. & Sharp, P. A. (1986) A nuclear factor that binds to a conserved sequence motif in transcriptional control elements of immunoglobulin genes, Nature 319, 154- 158.

27. Kudo, S. & Fukuda, M. (1994) Transcriptional activation of human leukosialin (CD43) gene by Spl through binding to a GGGTGG motif, Eur: J. Biochem. 223, 319-327.

28. Breathnach, R. & Chambon, P. (1981) Organization and expression of eukaryotic split genes coding for proteins, Annu. Rev. Biochem.

29. Ruskin, B., Krainer, A. R., Maniatis, T. &.Green, M. R. (1984) Excision of an intact intron as a nobel lariat structure during pre- mRNA splicing in vitro, Cell 38, 317-331.

30. Smale, S. T., Schmidt, M. C., Berk, A. J. & Baltimore, D. (1990) Transcriptional activation by Spl as directed through TATA or initiator: specific requirement for mammalian transcription factor IID, Proc. Natl Acad. Sci. USA 87, 4509-4513.

31. Treisman, R. (1990) The SRE: a growth factor responsive transcriptional regulator, Sem. Cancer Biol. I , 47-58.

32. Kadonaga, J. T., Jones, K. A. & Tjian, R. (1986) Promoter-specific activation of RNA polymerase I1 transcription by Spl, Trends Biochem. Sci. 11, 20-23.

33. Thiesen, H.-J. & Bach, C. (1990) Target detection assay (TDA): a versatile procedure to determine DNA binding sites as demonstrated on Spl protein, Nucleic Acids Res. 18, 3203-3209.

34. Scholer, H. R., Ruppert, S., Suzuki, N., Chowdhury, K. & Gruss, P. (1990) New type of POU domain in germ line-specific protein Oct-4, Nature 344, 435-439.

35. Blackwell, T. K. & Weintraub, H. (1990) Differences and simi- larities in DNA-binding preferences of MyoD and E2A protein complexes revealed by binding site selection, Science 250, 1104- 1110.

36. Weiner, A. M., Deininger, P. L. & Efstratiadis, E. (1986) Nonviral retroposones : genes, pseudogenes, and transposable elements generated by the reverse flow of genetic information, Annu. Rev. Biochem. 55, 631-661.

37. Schindelin, H., Marahiel, M. A. & Heinemann, U. (1993) Universal nucleic acid-binding domain revealed by crystal structure of the B. subtilis major cold-shock protein, Nature 364, 164- 168.

38. Schnuchel, A., Wiltscheck, R., Czisch, M., Herrler, M., Willimsky, G., Graumann, P., Marahiel, M. A. & Holak, T. A. (1993) Struc- ture in solution of the major cold-shock protein from Bacillus subtilis, Nature 364, 169-171.

39. Landsman, D. (1992) RNP-1, an RNP-binding motif is conserved in the DNA-binding cold shock domain, Nucleic Acids Res. 20,

40. Minty, A. & Kedes, L. (1986) Upstream regions of the human cardiac actin gene that modulate its transcription in muscle cells: presence of an evolutionarily conserved repeated motif, Mol. Cell. Biol. 6, 2125-2136.

41. Sartorelli, V., Webster, K. A. & Kedes, L. (1990) Muscle-specific expression of the cardiac a-actin gene requires MyoDl, CArG- box binding factor, and Spl, Genes & Dev. 4, 1811 -1822.

42. Ozer, J., Chalkley, R. & Sealy, L. (1993) Isolation of the CCAAT transcription factor subunit EFIA cDNA and a potentially functional EFIA processed pseudogene from Bos taurus:insights into the evolution of the EFIAldbpBNB-1 gene family, Gene (Amst.) 124, 223-230.

43. Ozer, J., Chalkley, R. & Sealy, L. (1993) Characterization of rat psudogenes for enhancer factor I subunit A: ripping provides clues to the evolution of the EFINdbpBNB-1 multigene family, Gene (Arnst.) 133, 187-195.

44. Familari, M., Almouzni, G. & Wolffe, A. P. (1994) Isolation of a potentially functional Y-box prtein (MSY-1) processed pseudogene from mouse: evolutionary relationships within the EFIJ dbpBNB-1 gene family, Gene (Amst.) 141, 255-259.

45. Kolluri, R. & Kinniburgh, A. J. (1991) Full length cDNA sequence encoding a nuclease-sensitve element DNA binding protein, Nucleic Acids Res. 19, 4771.

40, 349-383.

2861 -2864.

82 Kudo et al. (Eul: J. Biochem. 231)

46. Doniger, J. & Dipaolo, J. A. (1988) Coordinate N-ras mRNA upreg- ulation with mutational activation in tumorigenic guinea pig cells, Nucleic Acids Res. 16, 969-980.

47. Doniger, J., Landsman, D., Gonda, M. A. & Wistow, G. (1992) The Product of unr, the highly conserved gene upstream of N-rW contains multiple repeats similar to the cold-shock domain (CSD), a putative DNA-binding motif, New Bid . 4, 389-395.

48. Nicolaiew, N., Triqueneaux, G. & Dautry, F. (1991) Organization of the human N-ras locus: characterization of a gene located immediately upstream of N-ras, Oncogene 6, 721 -730.

49. McCormick, L., Roller, R. J. & Roizman, B. (1992) Characterization of a herpes simplex virus sequence which binds a cellular protein as either a single-stranded or double-stranded DNA or RNA, J. Virol. 66, 3435-3447.

50. Willimsky, G., Bang, H., Fischer, G. & Marahiel, M. A. (1992) Characterization of cspB, a Bacillus subtilis inducible cold shock gene affecting cell viability at low temperatures, J. Bacteriol. 174, 6326 - 6335.

Characterization of the Gene for dbpA, a Family Member of the Nucleic-Acid-Binding Proteins...

Documents

Transcript of Characterization of the Gene for dbpA, a Family Member of the Nucleic-Acid-Binding Proteins...

Life Member List.pdf - YCIS Satara

MLA Member List - IAF

Nucleic Acids Research - NCBI

SHOCK FINAL

SN Member Name (English) Member Name (Nepali) Mobile No ...

Raising - valued member!

Hemodynamic Disorders, Thromboembolism, and Shock

Shock interaction computations on unstructured, two-dimensional grids using a shock-fitting technique

Nomenclature for Incompletely Specified Bases in Nucleic ...

MEMBER REPORT - Typhoon Committee

Member Handbook - CalSTRS.com

demolay new member guide book

Detection of human papillomavirus by nucleic acid ...

Novel Biochip Platform for Nucleic Acid Analysis

TENSION MEMBER - Annamalai University

Vietnam - the 150th WTO-Member

Member Portal - Help Content

ASPECTS REGARDING SHOCK WAVE MITIGATION ...

Dengue Shock Sindrome

Isotachophoresis Improves Nucleic Acid Extraction and ...