JOURNAL OF VIROLOGY, Aug. 2009, p. 7457–7466 Vol. 83, No. 150022-538X/09/$08.00�0 doi:10.1128/JVI.00285-09Copyright © 2009, American Society for Microbiology. All Rights Reserved.

Upstream Regulatory Region Alterations Found in HumanPapillomavirus Type 16 (HPV-16) Isolates from Cervical

Carcinomas Increase Transcription, ori Function,and HPV Immortalization Capacity in Culture�

Michael J. Lace,1,2* Christina Isacson,3 James R. Anson,1 Attila T. Lorincz,4 Sharon P. Wilczynski,5Thomas H. Haugen,1,2 and Lubomır P. Turek1,2

Veterans Affairs Medical Center1 and Department of Pathology, The University of Iowa Roy J. and Lucille A. Carver College ofMedicine,2 Iowa City, Iowa 52242; Virginia Mason Medical Center, Seattle, Washington 981013; Wolfson Institute of

Preventive Medicine, London EC1M 6BQ, United Kingdom4; and City of Hope Medical Center,Duarte, California 910105

Received 9 February 2009/Accepted 12 May 2009

Human papillomavirus (HPV) DNAs isolated from cervical and head and neck carcinomas frequentlycontain nucleotide sequence alterations in the viral upstream regulatory region (URR). Our study hasaddressed the role such sequence changes may play in the efficiency of establishing HPV persistence andaltered keratinocyte growth. Genomic mapping of integrated HPV type 16 (HPV-16) genomes from 32 cervicalcancers revealed that the viral E6 and E7 oncogenes, as well as the L1 region/URR, were intact in all of them.The URR sequences from integrated and unintegrated viral DNA were found to harbor distinct sets ofnucleotide substitutions. A subset of the altered URRs increased the potential of HPV-16 to establish persis-tent, cell growth-altering viral-genome replication in the cell. This aggressive phenotype in culture was notsolely due to increased viral early gene transcription, but also to augmented initial amplification of the viralgenome. As revealed in a novel ori-dependent HPV-16 plasmid amplification assay, the altered motifs that ledto increased viral transcription from the intact genome also greatly augmented HPV-16 ori function. Thenucleotide sequence changes correlate with those previously described in the distinct geographical NorthAmerican type 1 and Asian-American variants that are associated with more aggressive disease in epidemio-logic studies and encompass, but are not limited to, alterations in previously characterized sites for thenegative regulatory protein YY1. Our results thus provide evidence that nucleotide alterations in HPV regu-latory sequences could serve as potential prognostic markers of HPV-associated carcinogenesis.

A subset of mucosal human papillomavirus (HPV) types isassociated with most, if not all, carcinomas of the uterinecervix, many anogenital cancers, and �25% of head and neckcancers (reviewed in reference 49). HPV type 16 (HPV-16) isthe most common oncogenic or “high-risk” (HR) HPV type;HPV-16 is found in �50% of cervical cancers and �90% ofHPV-associated head and neck cancer lesions. The persistenceof HPV-16, as well as of other HR HPV types, is governed bya tightly regulated expression of limiting levels of critical earlyviral gene products that support initial HPV plasmid ampli-fication and subsequent immortalization of keratinocytes(16, 25).

HPV genomes isolated from cancers often contain nucleo-tide sequence alterations in the HPV upstream regulatory re-gion (URR) that controls viral-gene transcription and containsthe viral origin of replication (ori). Numerous variants of theprototypical HPV-16 URR sequence (17) have been described(1, 10, 36, 66, 67); similar sequence variation has been ob-served in other HR and low-risk HPV types (2, 8, 9, 26, 42, 45).Some of the nucleotide changes exhibit characteristic geo-

graphic distributions and have been grouped into evolutionaryvariants: the European (E), North American 1 (NA1), andAsian-American (AA) variants. It has been reported that non-European HR HPV variants are associated with more aggres-sive clinical outcomes in epidemiologic studies (6, 41, 48, 58,61, 64, 65). Previous studies have demonstrated that some ofthe URR changes altered viral enhancer activity in assays usingheterologous reporter constructs (15, 32, 47). Non-EuropeanHPV-16 variants have also been found to elicit increased viralearly gene transcription and transient replication in culture(27). In spite of the depth of work done in examining HPV-16DNA isolated from clinical lesions, a complete understandingof how the detected sequence variations influence critical stepsin the establishment of HPV infection has remained elusive.

In this study, we examined a set of 32 HPV-16 isolates fromcervical cancer biopsy specimens, comparing the sequencesand activities of the cancer-derived URRs to those of thewild-type (wt) HPV-16 prototype. We identified multiple sin-gle-nucleotide substitutions, some, but not all, of which im-pinge upon previously characterized transcription factor bind-ing sites in several URRs. We introduced these modified URRsequences into a replicating wt HPV-16 genome to character-ize their influence on the biology of the virus. In comparison tothe prototypical wt HPV-16, the URR alterations led to in-creased E6/E7 transcription from the major early gene pro-

* Corresponding author. Mailing address: Veterans Affairs MedicalCenter, 601 Highway 6 West, Iowa City, IA 52246. Phone: (319) 338-0581, ext. 7504. Fax: (319) 339-7178. E-mail: michael-lace@uiowa.edu.

� Published ahead of print on 20 May 2009.

7457

moter, P97, and to augmented initial amplification of the re-constituted HPV-16 genomes. In further contrast to previousstudies, we also characterized, for the first time, the influenceof the URR sequence alterations on replisome activity at theviral ori and found that URR alterations can directly influencethe viral ori function. Finally, we examined the capacities of thealtered HPV-16 genomes to establish persistent infection inand to extend the life span of primary human keratinocytes,the natural host cells for HPV infection, in a quantitativecolony-forming assay. URR sequence alterations that en-hanced viral-genome amplification through increased tran-scription and ori-dependent replication were also found toincrease HPV immortalization capacity.

MATERIALS AND METHODS

Plasmid constructs. The prototypical HPV-16 wt P97 (nucleotides [nt] 6530to �153) and URR cat reporters were synthesized by standard methods (12, 29)using the following PCR primers: nt 7445 (5�-CGCAGATCTAGCTTCAACCGAATTCG) and nt 153 (5�-GCGCAAGCTTGTGCATAACTGTGGTAACTT).PCR products were cleaved with BamHI and HindIII and inserted into a pUC 18cat vector. The recombinant plasmid constructs were then isolated from twoindependently amplified bacterial colonies, and the sequences were compared toverify nucleotide substitutions within each URR sequence. Synthetic mutationsin P97 cis elements were similarly cloned into the P97 cat parent via SphI/HindIIIdigestion. Mutations were recloned into the 7.9-kb HPV-16 W12E genomefollowing digestion with Eco0109I and SphI. The HPV-16 W12E plasmid(GenBank accession no. AF125673) was a gift from Paul Lambert (20). The HPV-16E1� precursor plasmid (a gift from the zur Hausen laboratory), which containsa frameshift mutation by a deletion at position 1087 in the 3� portion of the E1open reading frame (17), was excised with NcoI and BbsI and then cloned intothe HPV-16 W12E plasmid. The HPV-16 W12 E1�, E8�, and DBD� constructswere similarly cloned as described previously (38). All PCR-generated plasmidswere verified by automated sequencing (University of Iowa DNA Core).

Clinical material, genomic mapping, cell transfections, and transcription as-says. Total DNA was phenol-chloroform extracted from cervical carcinomabiopsy specimens, and the physical status of the HPV DNA was determined bySouthern blotting in the laboratories of Attila Lorincz and Sharon Wilczynski.DNA isolates were mapped by PCR, using the following primer sets, listed asforward (F) and reverse (R): L1/URR-F (GC[A/C]CAGGG[A/T]CATAA[C/T]AATGG) and L1/URR-R (GCGCAAGCTTGTGCATAACTGTGGTAACTT);E2-F (GCGCTCTGGGGGATCTAGAACCATGGAGACTCTTTGCCAACG)and E2-R (CCGCGGATCCGTTGTGGgATGCAGTATCAAGATTTG); E1-F(CCGCGGATCCAATAGTCTATATGGTCACGTAGGTC) and E1-R (gcgctctagaACCATGGCTGATCCTGCAGGTACCAATGGG); E6/E7-F (CGGTCTAGAATG TTTCAGGACCCACAGGAG) and E6/E7-R (GCCGGATCCTTATGGTTTCTGAGAACAGAT); and L2-F (GATAGTGAATGGCAACGTGAC) and L2-R (CGTCC[A/C]A[A/G][A/G]GGA [A/T]ACTGATC).

HeLa and HaCaT (a gift from N. Fusenig) cell lines were cultured, andchloramphenicol acetyltransferase (CAT) assays were performed as describedpreviously (59). Prior to transfection, HPV-negative human squamous cell car-cinoma (SCC13) cells (50) and primary human foreskin keratinocytes (HFK)were grown on irradiated J2 fibroblast feeder cells in E medium (37, 38) andstably transfected, clonal HPV� HFK cultures were generated as describedpreviously (28, 38). The clonal HPV-16 W12E cell line was a gift from PaulLambert (30). For RNase protection assays, SCC13 cells were cotransfected with5 �g of recircularized HPV-16 W12E constructs and a simian virus 40 plasmidcontrol using Effectene (Qiagen, Valencia, CA). Total RNA was harvested 40 hposttransfection from transiently transfected SCC13 cultures or from clonalHPV� HFK cell lines, using RNAqueous kits (Ambion Inc., Austin, TX), and atotal of 10 �g per reaction was analyzed as described previously (59). Organo-typic raft cultures were constructed by seeding 2.0 � 105 subconfluent HPV�

HFK cells onto collagen inserts (Biocoat; Becton Dickenson, Bedford, MA)suspended over irradiated J2 fibroblasts in E medium and then cultured for upto 4 weeks prior to being sectioned and hematoxylin and eosin stained.

Transient plasmid DNA amplification and keratinocyte immortalization as-says. Prior to transfection, HPV-16 DNAs were cleaved from pUC vector se-quences with BamHI and religated at 5 �g/ml for 16 h. The ligated DNAs,reproducibly containing 30 to 50% of HPV sequences as single plasmid circles,were column purified (MaxiKit; Qiagen, Valencia, CA). For transient-replication

assays, 3 �g religated HPV-16 DNA was transfected into SCC13 cells withEffectene (Qiagen, Valencia, CA) in the absence of J2 feeder cells. Total DNAwas then isolated from the transfected cells (QIAamp DNA Blood Kit; Qiagen,Valencia, CA) 5 days posttransfection, and the DNA concentrations were de-termined as the optical density at 260 nm. A total of 4 �g of each DNA samplewas digested with DpnI and linearized with BamHI and XbaI before Southernblotting. The digestion of DNA samples was confirmed by visualization ofethidium bromide-stained agarose gels following electrophoresis. For colonyformation assays, 2 � 106 low-passage (8 to 10 population doublings [PDs]postexplant) primary human keratinocytes per 100-mm dish were transfectedwith 2 �g of recircularized HPV DNA and 1 �g of pRSV-neo. Control culturestransfected with pCMV-�gal showed reproducible transfection efficiencies of 15to 25%. The cells were transferred at various dilutions onto an irradiated J2fibroblast feeder 1 day later, selected in 100 to 200 �g G418/ml E medium for 5days, and allowed to grow for another 15 to 20 days without selection. Aftercolony numbers per transfection were determined, individual colonies were sub-cultured using cloning cylinders from dishes with 40 colonies. Total cellularDNA, as well as total RNA, was harvested from clonal cultures to assess theHPV DNA status and early gene transcription. Total DNA was digested withBglII (an HPV-16 “no-cutter”) or BamHI (an HPV-16 “single cutter”) beforeSouthern blotting. Growth phenotypes, expressed as population doubling (PD)times in days, of clonal HPV-16� HFK cultures were calculated from logarithmicgrowth rates determined from total cell counts spanning a defined period inculture (4 to 6 days).

Southern blotting and phylogenetic analysis. A total of 5 �g of DpnI-resistantDNA from transiently transfected SCC13 cells, or 2 �g of HPV-immortalizedHFK total DNA, was resolved on 1.0% agarose gels, depurinated in 0.25 M HCl,and blotted directly onto positively charged nylon membranes (Zeta-Probe;Bio-Rad, Hercules, CA) by alkaline transfer with 0.4 N NaOH. The blots werethen hybridized at 65°C with probes (1.5 � 106 cpm/ml hybridization buffer)containing an equimolar cocktail of PCR-amplified segments of the HPV-16genome (nt 6226 to 3873 and 4471 to 6000) and 32P labeled by random priming(HotPrime kit; GenHunter Corp., Nashville, TN) using [-32P]dATP/dCTP.Replication-defective HPV-16 plasmids included as negative blot controls alsoserved as DpnI digestion controls. DpnI-digested whole-cell DNAs from trans-fected SCC13 cultures were resolved on 1.0% agarose gels, depurinated in 0.25M HCl, and blotted directly onto positively charged nylon membranes (Hybond-XL; Amersham Biosciences Corp., Piscataway, NJ) by alkaline transfer with 0.4N NaOH. Aliquots of linearized HPV-16 DNA (1 to 30 pg) were included asquantitative Southern blotting controls and to normalize band intensities be-tween multiple autoradiograms. Sequence alignments of URR sequences wereperformed with CLUSTAL X (1.82) software (39). A rooted dendrogram wasconstructed (data not shown) by comparing the URR (nt 7478 to 7842) se-quences defined in this study with previously described HPV-16 URR sequencesto determine their phylogenetic relationships to previously defined HPV-16variants (67).

RESULTS

The E6/E7 genes, and the URRs that modulate their expres-sion, are conserved in integrated HPV-16 DNAs from cervicalcarcinomas. HPV-16 DNA isolated from a total of 32 cervicalcarcinoma biopsy specimens had previously been analyzed bySouthern blotting (data not shown) to determine the physicalstatus of the viral DNA. The genomic structures of those sam-ples that contained only integrated HPV-16 DNA were deter-mined by PCR amplification of the E1, E2, E6/E7, and L2genes and the L1/URR segments using total cell DNA, assummarized in Fig. 1. As noted in previous studies (13, 30, 54),disruptions of the E1, E2, and L2 genes were detected in theregion upstream of E6 in some integrated HPV-16 genomes,consistent with the disruption of a single circular HPV-16 ge-nome (type I integration). In contrast, the E6/E7 genes and theL1/URR (nt 6584 to �153) were found to be intact in allsamples tested. Similar genomic-disruption patterns have alsobeen detected in HPV-18-positive cervical carcinoma samples(35). However, many samples showed amplification of all earlygenes, including 16 out of 22 that displayed intact E2 coding

7458 LACE ET AL. J. VIROL.

sequences. In spite of integration of the HPV genome, anequimolar ratio of E1 to E2, as determined by hybrid capture,was present (data not shown); this result is consistent with atype 2 viral-integration pattern—a head-to-tail tandem ar-

rangement of multiple copies of the viral genome (30). AllURR segments were sequenced before their effects on viralfunctions were examined.

Some HPV-16 URRs isolated from cervical carcinomas ex-hibit increased P97 activity in vivo. HPV-16 URR sequencesderived from malignant cervical biopsy specimens were clonedinto a CAT reporter, and their P97 promoter activities weremonitored in transiently transfected HeLa cells, which do notsupport HPV replication and therefore allowed us to examinetranscription driven by cellular factors in the absence of thepotent HPV E2 trans-acting gene products (Fig. 2). Several ofthese P97 promoters (M46, W02, and M65) exhibited increasedP97 activity (two- to fourfold) compared to the wt prototype (Fig.2, clones d, e, and f), indicating that these HPV-16 URRs couldhave an increased capacity to alter keratinocyte growth via in-creased E6 and E7 expression. The observed increase in P97promoter activity was comparable to that seen with HPV-16 pro-moter sequences cloned from the established SiHa and CaSkicervical carcinoma cell lines in parallel (Fig. 2, clones b and c).SiHa and CaSki cells harbor low-copy-number and tandem mul-ticopy integrated HPV-16 genomes, respectively. In SiHa cells,the E2 region is disrupted, while CaSki cells contain multiple viruscopies (a type 2 integration pattern). As in other HPV-positivecarcinoma cell lines (19), the URR deletion (nt 7745 to 7792)within the SiHa promoter and the nucleotide substitutions foundin the CaSki URR also encompass the previously defined bindingsite for yin yang 1 (YY1), a cellular factor that downregulatesHPV transcription (43). Additional nucleotide substitutions out-side of known transcription factor binding sites were also found tobe common in URRs with increased P97 activity (Fig. 2, clones bto g).

Some of the additional single-nucleotide substitutions withinthe URR sequences also potentially affect previously definedbinding sites for YY1; these included the most frequently de-tected alteration, at nt 7520, which was shown to disrupt YY1binding (53). Four such sequence alterations potentially affect-ing known YY1 motifs were introduced into the HPV-16 wtpromoter construct to determine if they were sufficient to ac-count for the observed increase in P97 promoter activities.While mutations of each individual upstream YY1 site had noeffect on P97 activity (Fig. 2, clones ak to am), simultaneousmutations of all four upstream YY1 sites (Fig. 2, clone an), asnoted in several of the URRs displaying an aberrant majorearly promoter phenotype, were sufficient to increase P97 ac-tivity. In agreement with a previous report (43), these resultsdemonstrate that coordinated disruption of multiple YY1 sitescan derepress the HPV-16 P97 promoter.

Sequence alterations in HPV-16 URRs isolated from cervi-cal carcinomas correlate with increased P97 transcriptionfrom the intact HPV genome. While the reporter assays pro-vided a suitable method of screening URR sequences forchanges in major early gene promoter activity, as in previousstudies, these assays could not examine the effects of thesesequence alterations on the life cycle of the virus. We thereforeexamined the roles of some of the nucleotide substitutionscommon to members of this subset of viral sequences in P97transcription and initial HPV-16 plasmid amplification in thecontext of the intact viral genomes expressing biologically rel-evant levels of the full complement of viral gene products. Wesubcloned promoter segments displaying aberrant P97 tran-

FIG. 1. Structural mapping of integrated HPV-16 isolates. (A) Genomicorganization of the HPV-16 plasmid. (B) The physical status of HPV DNAdetected in clinical samples is represented as integrated (I), extrachromo-somal (E), or a mixture of integrated and extrachromosomal (I�E) DNA. Aselection of 22 of the 32 HPV DNA isolates from squamous cell carcinomas(SCCA), carcinoma in situ (CIS), or adenocarcinomas (Adeno.) of the cervix,found to be integrated by Southern blotting, were examined by PCR-basedstructural mapping of viral genes. Amplification of the E6/E7, E1, E2, L1/URR, and L2 gene segments is listed as “�” for positive and “�” fornegative. “*” indicates separate biopsy specimens from the same patientwhile, “ND” indicates that analysis was not done.

VOL. 83, 2009 HPV-16 URR ALTERATIONS ENHANCE EARLY VIRAL FUNCTIONS 7459

scription phenotypes into the transcription/replication-compe-tent HPV-16 W12E genome and transfected these constructsinto the HPV-negative squamous cell carcinoma cell lineSCC13. The functional transcription, replication, and immor-talization capacities of the HPV-16 W12E parent plasmidmade it an effective baseline with which to compare the effectsof detected nucleotide substitutions within the URR se-quences. Furthermore, the W12E URR fragment varies byonly a single nucleotide substitution from the HPV-16 proto-type sequence, which exhibited no effect on early promoteractivity (Fig. 2, clone aj). Consistent with the results from ourpromoter activity assays, steady-state P97 transcription fromthe intact HPV-16 genome was activated 2- to 3.5-fold in viralgenomes containing altered promoter segments (M46, M65,and W02) compared to the wt control in duplicate RNaseprotection assays (Fig. 3A, lanes 5 to 7 and 12 to 14). TheYY1x4 mut genome, however, exhibited P97 transcription sim-ilar to that of the wt (Fig. 3A, lanes 4 and 11). The P97transcription level displayed by the replication-defective E1�

plasmid (Fig. 3A, lanes 9 and 16) was also similar to that of thewt plasmid, confirming that the transcription phenotypes ob-served in this assay were not replication dependent.

Sequence alterations in HPV-16 P97 promoters isolatedfrom cervical carcinomas are correlated with enhanced orifunction and increased initial plasmid amplification. We alsoexamined the effects of these single-nucleotide substitutions oninitial HPV plasmid amplification in transiently transfectedSCC13 cells. Simultaneous mutation of four YY1 sites in theHPV-16 wt URR (Fig. 3B, lane 2) resulted in a twofold in-crease in initial plasmid amplification as measured by Southernblotting. Nucleotide substitutions found in at least three of theURR sequences, M46, M65, and W02, displayed 4- to 10-fold-increased amplification compared to the wt (Fig. 3B, lanes 3 to5). In contrast, nucleotide substitutions found in the earlypromoter of the W14 isolate did not fall within YY1 sitespotentially altered in the M46, W02, and M65 constructs andwere associated with a twofold increase in P97 promoter ac-tivity (Fig. 2, clone g) and no measurable effect on plasmid

FIG. 2. HPV-16 promoters isolated from cervical carcinomas exhibit increased P97 promoter activity in vivo. URR segments (nt 7445 to �153)from HPV-16 DNAs isolated from malignant cervical cancer biopsy specimens were sequenced, and the 593-nt promoter fragment was clonedupstream of the cat gene. After transfection into HeLa cells, the relative CAT activities expressed were normalized to the prototype (wt) HPV-16construct and represent an average of two to six independent experiments. Single-nucleotide substitutions are indicated in lowercase, and thosecommon to URR constructs with altered phenotypes are indicated by boxes. ori is the HPV origin of replication, and “DS” and “PS” indicate thedistal and proximal silencer cis elements, respectively. The phylogenetic relationships of these URRs to defined HPV-16 variants were determinedas E, Asian (As), AA, or NA1. HPV-16 W12 (20) refers to the URR segment of the replication-competent W12E plasmid, while additional singleor multiple mutations in YY1 binding sites introduced into the P97-cat construct are listed as nt 7763, 7785, and 7875, and YY1x4.

7460 LACE ET AL. J. VIROL.

amplification (data not shown). The deletion of nt 7793 to7902, previously described as an HPV-16 URR displaying in-creased P97 promoter activity in CAT reporter constructs (43),showed P97 transcription levels comparable to wt levels in thecontext of the intact viral genome in RNase protection assays(Fig. 3A, lanes 8 and 15) but did not exhibit increased transientreplication activity (Fig. 3B, lane 6). In fact, it amplified poorlyin comparison to the HPV-16 wt plasmid; this negative effectwas likely due to the collateral loss of E1 binding to the par-

tially deleted HPV-16 origin of replication and loss of E1expression from the recently described P14 promoter (38).

We observed in parallel studies (37, 38) that replication ofdistinct complementing species of full-length HPV-16 genomescould be examined in initial plasmid amplification assays. Weadapted this novel methodology to examine the effects of URRsequence alterations on ori function in an origin competitionassay (Fig. 4). In this assay, amplification of a replication-defective, HPV-16 wt ori genome that does not express E2 isrescued by cotransfection with a second HPV-16 genome thatexpresses the E2 gene product and harbors either a wt oraltered URR. Since the termination linker inserted into the E2DBD (E2 DBD�) (Fig. 4, lane 1), introduces a novel XbaI site,digestion of total extracted DNA with both BamHI and XbaIresults in discrete fragments generated from the two equimolarinput genomes that can be resolved by electrophoresis andquantified by Southern blotting. These experiments revealedthat when both input genomes contained wt URR sequences,they amplified to similar levels, as demonstrated by the com-parable intensities of the 7.9-kb and 5.4-kb digestion products,yielding an ori ratio of 1:1 (Fig. 4, lane 2). When genomes withaltered URRs were cotransfected with the wt ori plasmid,amplification of the altered ori-containing genomes was mark-edly increased while that of the genome with wt ori was not(Fig. 4, lanes 3 to 6). In contrast, as we reported previously(37), when expression of the HPV-16 E8ˆE2 gene product isdisrupted in our complementation assays, replication of bothwt ori plasmid species increased (Fig. 4, lane 9) due to the lossof this potent trans-acting replication and transcription repres-sor. Since the plasmid genome species used in this complemen-

FIG. 3. Single-nucleotide substitutions found in HPV-16 early pro-moters from cervical carcinomas upregulate transient P97 transcrip-tion and initial plasmid amplification. (A) The HPV-16 URR segmentsfrom cervical carcinomas were cloned into the HPV-16 W12 parentplasmid and transiently cotransfected with a simian virus 40 plasmid, asan internal control, into SCC13 cells. HPV-16 P97 transcription wasdetected by RNase protection assays using total RNA in duplicateexperiments. (B) Plasmid amplification was detected as Dpn-I-resis-tant HPV-16 DNA by Southern blotting of 5 �g of total extractedDNA from transfected SCC13 cells. The HPV-16 W12 wt and E1�

genomes served as wt positive and negative controls, respectively.Relative replication values are expressed as above or below theHPV-16 W12 wt construct. All values were determined by scanningdensitometry and represent averages of two to four independent ex-periments. The error bars indicate standard deviations.

FIG. 4. URR alterations enhance ori function. An origin competi-tion assay detected Dpn-I-resistant fragments by Southern blotting.Respective 7.9-kb and 5.4-kb fragments from BamHI/XbaI digestionwere derived from equimolar quantities of the respective HPV-16plasmid species transfected into SCC13 cells in a representative assaythat was confirmed in subsequent independent experiments. A titra-tion of linearized HPV-16 genomes (1 and 30 pg) was included as apositive blotting control. Ratios of mutant (mut) ori to wt ori activities(quantified by scanning densitometry) for each cotransfection are alsodisplayed.

VOL. 83, 2009 HPV-16 URR ALTERATIONS ENHANCE EARLY VIRAL FUNCTIONS 7461

tation assay together express the full complement of trans-acting viral products necessary and sufficient for HPV-16amplification, we conclude that the increase in replication ofthe altered URR-harboring genomes over the wt ori genome issolely due to a cis-dependent increase in ori function.

Single-nucleotide substitutions found in HPV-16 URRsfrom cervical carcinomas are correlated with increased HPV-mediated immortalization of primary human keratinocytes.Having demonstrated that the subtle nucleotide changesobserved in these URR sequences can confer increased viralearly gene expression and initial plasmid amplification intransient assays, we transfected primary HFK with theseHPV-16 genomes to determine their capacity to form im-mortalized keratinocyte cultures harboring stably replicat-ing HPV-16 plasmids.

In contrast to previous studies, we also quantified the abil-ities of these genomes to efficiently immortalize keratinocytesin a colony-forming assay. This test assesses the capacities ofHPV-16 genomes to initially form individual colonies and therelative abilities of these clonal cultures to survive subsequentexpansion. Cells containing the HPV-16 genomes M46, M65,and YY1x4 mut formed colonies three- to fivefold more effi-ciently than the HPV-16 W12 wt did (Fig. 5A); this effect wascorrelated with the increased P97 promoter activities (Fig. 2)and plasmid amplification phenotypes (Fig. 3B and 4) observedwith these constructs. The physical status of the HPV-16 DNAin each of the stably transfected mass cultures was assayed bySouthern blotting and was found to be present predominantlyas replicating extrachromosomal DNA. The replication-defec-tive HPV-16 genome harbored the 7793-to-7902 deletion butformed no surviving colonies (Fig. 5A).

Individual colonies were subsequently isolated and ex-panded to yield clonal HPV� HFK cell lines harboring inte-grated or persistently replicating extrachromosomal HPVgenomes in individual clones stemming from independent vi-rus-cell interactions. This approach allowed us to examine thecell growth phenotypes and viral copy numbers that wouldotherwise be masked in heterogeneous cell populations inmass cultures. In contrast to previous studies, these resultsindicated that these altered HPV-16 genomes can maintain apersistent copy number comparable to that of the wt (Fig. 5B

FIG. 5. Single-nucleotide substitutions found in HPV-16 URRsfrom cervical carcinomas correlate with increased HPV immortaliza-tion of primary human keratinocytes. (A) Colony formation in stable

HPV transfections of primary HFK. The gray bars represent the ratiosof the number of colonies formed with each HPV-16/URR construct tothe normalized HPV-16 wt in a representative experiment, which weresubsequently confirmed in two independent experiments using twodistinct donor HFK isolates. The black bars indicate the relative sur-vival rates of isolated colonies, while the numerical ratios indicate theactual numbers of the surviving colonies over total colonies initiallyisolated posttransfection. The error bars indicate standard deviations.(B) The viral DNA status of HPV-positive cultures (2 �g total DNA)was monitored by Southern blotting in comparison to total DNAharvested from W12E (2 �g) and CaSki (0.1 �g) cells as extrachro-mosomal and multicopy/integrated HPV-16 controls, respectively.DNA forms: L, linearized; S, supercoiled; OC, relaxed circular; C,concatameric. (C) HPV-16 P97 transcription was detected in repre-sentative clonal cultures containing stably replicating plasmid or inte-grated viral genomes by RNase protection assays in which E6-E7transcription was compared to that of GAPDH (glyceraldehyde-3-phosphate dehydrogenase) as an internal control and normalized tothe HPV-16 wt (plasmid).

7462 LACE ET AL. J. VIROL.

and Table 1) and can extend the life span of primary kerati-nocytes in culture.

To determine if alterations in early gene expression in HPV-immortalized keratinocytes were correlated with increased im-mortalization efficiencies, we examined the steady-state levelsof the E6/E7 transcripts from the P97 promoter in represen-tative clonal cultures using RNase protection assays (Fig. 5C).In clonal cultures harboring stably replicating HPV-16 ge-nomes beyond 35 PDs, no consistent increase in E6/E7 expres-sion could account for the increased immortalization efficien-cies observed with the altered URR constructs (Fig. 5C, lanes1, 3, and 5). However, the significantly increased E6/E7 expres-sion in the M65 clonal culture (Fig. 5C, lane 7), for example,could potentially be correlated with the dramatic decrease inPD time observed in subsequent assays (Table 1). Integrationof HPV genomes has been associated with increased E6/E7expression (31); however, consistent with recent observations(23), the integration of wt or mutant constructs in these assaysdid not necessarily lead to increased P97 transcription (Fig. 5C,lanes 2 and 4).

The majority of the clonal cultures contained stably repli-cating plasmids with a viral load (averaged from two to eightclones) ranging from 6 to 12 copies per cell (Table 1). Clonalcultures exhibited an increased growth rate (measured as a PDtime, expressed in days) compared to the untransfected paren-

tal primary keratinocytes. These clonal cultures have persistedin culture and retained replicating viral plasmids beyond 35PDs. Introduction of the HPV-16 wt plasmid decreased the PDtime two- to threefold compared to that of the HPV-negativeparental HFK isolates, indicating an increased capacity to alterthe growth phenotype of the host cell (Table 1).

We also examined the abilities of a subset of these clonalHPV-16/HFK cultures to stratify in organotypic rafts by hema-toxylin and eosin staining of raft sections (Fig. 6). Both theHPV-16 YY1x4/HFK and HPV-16 M65/HFK cultures gener-ated stratified epithelia similar to HFK immortalized with thewt parent plasmid, resembling a partially dysplastic phenotypecharacterized by minimal basal thickening and nearly normalmaturation (Fig. 6A to C). In contrast, rafts formed with theW12E cells (30) displayed a distinctly different phenotype,exhibiting pronounced parabasal cell atypia with loss of mat-uration (Fig. 6D).

FIG. 6. HPV-16-immortalized keratinocytes display a dysplasticphenotype in organotypic rafts. (A to C) Clonal HPV-16-immortalizedkeratinocytes derived from stable transfection of the HPV-16 W12“wt” plasmid (16) (A), the YY1x4 construct (B), and the (16)M65construct (C) were cultured on organotypic rafts and then sectionedand hematoxylin and eosin stained. (D) Clonal W12E keratinocytes,derived from an explanted HPV-positive cervical lesion, were includedas a control.

TABLE 1. Clonal HPV� HFK cultures display alteredgrowth phenotypesa

HPV-16cell line Clone No. of HPV

copies/cellNo.

analyzedAvg no. ofcopies/cell

PD time(days)

Avg PDtime

(days)

Wt 1 11.4 7 10.8 1.9 2.02 9.6 2.53 7.9 1.74 205 8.96 15.27 2.5

M46 1 18.4 8 12.1 2.2 1.72 25.5 1.13 14.34 6.75 7.86 10.47 28 10.2

M65 1 5.7 6 5.9 1.1 1.12 4.1 1.13 4.94 7.15 116 2.3

YY1x4 1 23.5 2 14.4 1.9 2.52 5.2 3.1

HFK(parentalisolate)

HFK 1 0 2 0 2.5 3.0

HFK 2 0 3.5

W12-E 1 10 2.0 2.0

a Viral copy numbers of two to eight plasmid-bearing clonal cultures weredetermined by Southern blotting and quantified by scanning densitometry incomparison to HPV-16 quantitative controls. Growth rates of at least two clonalcultures derived from each construct were measured as PD times expressed indays.

VOL. 83, 2009 HPV-16 URR ALTERATIONS ENHANCE EARLY VIRAL FUNCTIONS 7463

Taken together, these results demonstrate that some of thenucleotide changes found in the URRs from HPV-16-positivecarcinomas can derepress early viral-gene expression, as wellas directly stimulate the viral ori function. As a consequence,these alterations lead to increased plasmid amplification andmore efficient establishment of persistent infection, with a con-comitant extension of the cellular life span.

DISCUSSION

HPV DNAs isolated from cervical and head and neck car-cinomas frequently contain nucleotide sequence alterations inthe URR. Our study addressed the roles such sequencechanges may play in critical early events in the efficiency ofestablishing HPV persistence and altered keratinocyte growth.We have found that a subset of altered URR sequences froma series of HPV-16-harboring carcinomas increased the poten-tial of HPV-16 to amplify and establish persistent, cell growth-altering viral-genome replication up to fivefold. Somewhat sur-prisingly, this aggressive phenotype in culture was not solelydue to increased viral transcription: we have demonstrated thatthe altered URR motifs associated with increased viral tran-scription also significantly augment HPV-16 ori replication.The nucleotide sequence changes associated with the moreaggressive phenotype in culture correlate with those previouslydescribed in the distinct geographical NA1 and AA HPV-16variants that are associated with more aggressive disease inepidemiologic studies. Our results thus provide experimentalevidence that these sequence alterations could serve as poten-tial prognostic markers of HPV-associated carcinogenesis.

HPVs have coevolved with their human hosts over millionsof years and are relatively invariant in sequence in comparisonto rapidly replicating and rapidly evolving viruses. Neverthe-less, there are major intratypic HPV variants defined by geo-graphic distribution that differ by nucleotide substitutions fromthe prototypical wt sequences. For HPV-16, the E variant ismost common among European populations and their descen-dants, while the NA1 and AA variants are common in theAmericas and Southeast Asia (10, 11, 57, 60, 61, 64, 65). TheNA1 and AA variants have been found to be associated withincreased viral persistence and more aggressive cervical dis-ease in epidemiologic studies (61, 64–66). HPV-16 URR se-quences obtained in this study share nucleotide substitutionscharacteristic of these variants; the majority are closest to theE variant. P97 promoter activities of the E variant-type URRs,both in reporter assay screens and in the context of the auto-regulated whole HPV-16 genome, were comparable to that ofthe prototypical wt HPV-16 URR in this study. In contrast,those URR sequences that exhibited enhanced P97 promoteractivity in both assays shared characteristic nucleotide substi-tutions with URRs of the NA or AA variants, similar to re-porter assay results in a previous study (32).

HPV early gene expression initially depends on, and is mod-ulated throughout the virus life cycle by, cellular transcriptionfactors that interact with cognate cis sites in the HPV URR(12, 29, 63). Cellular transcription activators cooperatively trig-ger and maintain immediate-early viral transcription, as werecently demonstrated in the related bovine papillomavirus(24). In contrast, the cellular factor YY1, which can function aseither a positive or a negative regulator of cellular- and viral-

gene transcription (4, 21, 22, 55, 62), predominantly down-modulates HPV early gene expression. The major early genepromoters of HPV-16 (P97) (44), HPV-18 (P105) (5), andHPV-31 (P99) (33) are repressed by upstream YY1 binding inreporter assays. Furthermore, HPV-18 and HPV-16 DNAsfrom malignant clinical samples have been shown to harbornucleotide alterations or deleted YY1 binding sites in theURR (43, 46, 52, 53, 56, 60) similar to those we detectedamong our activated URR sequences. Therefore, the modifi-cation of YY1 binding to specific sites, site combinations, ornumbers is one critical determinant of the altered URRs’ tran-scription levels and has an effect on the establishment of viralpersistence and cell growth changes.

Additional host transcription factors are likely to contributeto the differential regulation of early gene transcription in thealtered HPV-16 URR sequences. Nucleotide substitutionswithin the promoter-proximal Sp1 binding site (at nt �31) inisolates W12 and W05, which effectively abolished binding ofthis transcription activator in mobility shift assays (data notshown), resulted in decreased P97 promoter activities. Thisis in contrast to single-nucleotide substitutions described inHPV-16 and HPV-18 DNA isolates, which resulted in in-creased Sp1 binding in vitro (14, 51) and were correlatedwith enhanced promoter activity in vivo. Nucleotide substi-tutions in sequences outside of previously mapped transcrip-tion factor recognition sites may represent additional, as yetundefined cellular factor-binding motifs.

It is apparent that other alterations within the HPV genomemay play important roles in its infectivity and carcinogenicpotential. Sequence alterations outside of the URR within thecoding regions of the early genes E6 (3, 40), E7 (34), E5 (7,18), and E2 (57) may influence the disease outcome; theseviral-protein coding sequences also are under diversifying se-lection (11). While we have not studied potential sequencechanges outside the URR, our results nevertheless demon-strate that regulatory sequence modifications have a profoundeffect on the disease-inducing potential of HPV-16.

While a previous study demonstrated that defined HPV-16variant reference genomes can display increased replication(27), it could not distinguish which viral functions were respon-sible for the altered replication phenotypes. Here, we utilizednovel assays to dissect the mechanism underlying the enhancedreplication phenotype (37, 38). In cotransfection assays, two wtori HPV-16 genomes replicate at equimolar copy numbers.However, amplification of the altered ori-containing HPV-16genome greatly exceeded that of the wt ori control in parallel,demonstrating that the ori function itself was augmented by thesequence alterations. While increased production of the viralreplication factor E1 and/or E2 or of other viral early geneproducts can augment plasmid amplification in trans, our re-sults demonstrate that the increased replication of the alteredURR constructs derived from cervical carcinomas is primarilydue to an increase in ori function in cis. This could be the resultof enhanced recruitment of cellular replication factors due totheir higher affinity for the altered motifs or to the abrogationof the binding of negative factors. In addition, the nucleotidechanges could affect the ori structure, permitting more efficientreplisome assembly and ori unwinding. The additional specificcontributions of these sequence alterations to the expression ofE1 and E2, as well as other viral factors critical to plasmid

7464 LACE ET AL. J. VIROL.

replication and early gene expression, will also need to beelucidated in future studies.

In summary, we have identified HPV-16 isolates from ma-lignant cervical lesions that harbor multiple sequence alter-ations in critical cis control elements in the viral URR. Severalof these altered URRs increased early viral transcription, viralori function, and plasmid amplification and exhibited an en-hanced capacity to establish viral persistence and to immortal-ize primary HFK. These features may be associated with anincreased potential to establish persistent HPV infection as theprecursor to HPV-associated malignancy. Our results suggestthat the detection of such HPV sequence alterations couldserve as a potential prognostic marker of HPV-associated car-cinogenesis.

ACKNOWLEDGMENTS

We thank K. Thorsten Jakel and Greg Thomas for assistance withplasmid subcloning and Aloysius Klingelhutz and Alice Fulton forcritical reviews of the manuscript.

L.P.T. and T.H.H. were supported by merit awards from the De-partment of Veterans Affairs.

REFERENCES

1. Alencar, T. R., D. M. Cerqueira, M. R. da Cruz, P. S. Wyant, E. D. Ramalho,and C. R. Martins. 2007. New HPV-16 European and non-European vari-ants in Central Brazil. Virus Genes 35:1–4.

2. Arias-Pulido, H., C. L. Peyton, N. Torrez-Martinez, D. N. Anderson, andC. M. Wheeler. 2005. Human papillomavirus type 18 variant lineages inUnited States populations characterized by sequence analysis of LCR-E6,E2, and L1 regions. Virology 338:22–34.

3. Asadurian, Y., H. Kurilin, H. Lichtig, A. Jackman, P. Gonen, M. Tomma-sino, I. Zehbe, and L. Sherman. 2007. Activities of human papillomavirus 16E6 natural variants in human keratinocytes. J. Med. Virol. 79:1751–1760.

4. Baritaki, S., S. Sifakis, S. Huerta-Yepez, I. K. Neonakis, G. Soufla, B.Bonavida, and D. A. Spandidos. 2007. Overexpression of VEGF andTGF-�1 mRNA in Pap smears correlates with progression of cervical intra-epithelial neoplasia to cancer: implication of YY1 in cervical tumorigenesisand HPV infection. Int. J. Oncol. 31:69–79.

5. Bauknecht, T., P. Angel, H. D. Royer, and H. zur Hausen. 1992. Identifica-tion of a negative regulatory domain in the human papillomavirus type 18promoter: interaction with the transcriptional repressor YY1. EMBO J.11:4607–4617.

6. Berumen, J., R. M. Ordonez, E. Lazcano, J. Salmeron, S. C. Galvan, R. A.Estrada, E. Yunes, A. Garcia-Carranca, G. Gonzalez-Lira, and A. Madri-gal-De La Campa. 2001. Asian-American variants of human papillomavirus16 and risk for cervical cancer: a case-control study. J. Natl. Cancer Inst.93:1325–1330.

7. Bible, J. M., C. Mant, J. M. Best, B. Kell, W. G. Starkey, K. Shanti Raju, P.Seed, C. Biswas, P. Muir, J. E. Banatvala, and J. Cason. 2000. Cervicallesions are associated with human papillomavirus type 16 intratypic variantsthat have high transcriptional activity and increased usage of common mam-malian codons. J. Gen. Virol. 81:1517–1527.

8. Calleja-Macias, I. E., L. L. Villa, J. C. Prado, M. Kalantari, B. Allan, A. L.Williamson, L. P. Chung, R. J. Collins, R. E. Zuna, S. T. Dunn, T. Y. Chu,H. A. Cubie, K. Cuschieri, M. von Knebel-Doeberitz, C. R. Martins, G. I.Sanchez, F. X. Bosch, N. Munoz, and H. U. Bernard. 2005. Worldwidegenomic diversity of the high-risk human papillomavirus types 31, 35, 52, and58, four close relatives of human papillomavirus type 16. J. Virol. 79:13630–13640.

9. Cerqueira, D. M., T. Raiol, N. M. Veras, N. von Gal Milanezi, F. A. Amaral,M. de Macedo Brigido, and C. R. Martins. 2008. New variants of humanpapillomavirus type 18 identified in central Brazil. Virus Genes 37:282–287.

10. Chan, S. Y., L. Ho, C. K. Ong, V. Chow, B. Drescher, M. Durst, J. terMeulen, L. Villa, J. Luande, H. N. Mgaya, and H. U. Bernard. 1992. Mo-lecular variants of human papillomavirus type 16 from four continents sug-gest ancient pandemic spread of the virus and its coevolution with human-kind. J. Virol. 66:2057–2066.

11. Chen, Z., M. Terai, L. Fu, R. Herrero, R. DeSalle, and R. D. Burk. 2005.Diversifying selection in human papillomavirus type 16 lineages based oncomplete genome analyses. J. Virol. 79:7014–7023.

12. Cripe, T. P., A. Alderborn, R. D. Anderson, S. Parkkinen, P. Bergman, T. H.Haugen, U. Pettersson, and L. P. Turek. 1990. Transcriptional activation ofthe human papillomavirus-16 P97 promoter by an 88-nucleotide enhancercontaining distinct cell-dependent and AP-1-responsive modules. New Biol.2:450–463.

13. Cullen, A. P., R. Reid, M. Campion, and A. T. Lorincz. 1991. Analysis of thephysical state of different human papillomavirus DNAs in intraepithelial andinvasive cervical neoplasm. J. Virol. 65:606–612.

14. Dong, X. P., and H. Pfister. 1999. Overlapping YY1- and aberrant SP1-binding sites proximal to the early promoter of human papillomavirus type16. J. Gen. Virol. 80:2097–2101.

15. Dong, X. P., F. Stubenrauch, E. Beyer-Finkler, and H. Pfister. 1994. Preva-lence of deletions of YY1-binding sites in episomal HPV 16 DNA fromcervical cancers. Int. J. Cancer 58:803–808.

16. Doorbar, J. 2005. The papillomavirus life cycle. J. Clin. Virol. 32(Suppl.):7–15.

17. Durst, M., L. Gissmann, H. Ikenberg, and H. zur Hausen. 1983. A papillo-mavirus DNA from a cervical carcinoma and its prevalence in cancer biopsysamples from different geographic regions. Proc. Natl. Acad. Sci. USA 80:3812–3815.

18. Eriksson, A., J. R. Herron, T. Yamada, and C. M. Wheeler. 1999. Humanpapillomavirus type 16 variant lineages characterized by nucleotide sequenceanalysis of the E5 coding segment and the E2 hinge region. J. Gen. Virol.80:595–600.

19. Ferris, R. L., I. Martinez, N. Sirianni, J. Wang, A. Lopez-Albaitero, S. M.Gollin, J. T. Johnson, and S. Khan. 2005. Human papillomavirus-16 associ-ated squamous cell carcinoma of the head and neck (SCCHN): a naturaldisease model provides insights into viral carcinogenesis. Eur. J. Cancer.41:807–815.

20. Flores, E. R., and P. F. Lambert. 1997. Evidence for a switch in the mode ofhuman papillomavirus type 16 DNA replication during the viral life cycle.J. Virol. 71:7167–7179.

21. Galvin, K. M., and Y. Shi. 1997. Multiple mechanisms of transcriptionalrepression by YY1. Mol. Cell. Biol. 17:3723–3732.

22. Gordon, S., G. Akopyan, H. Garban, and B. Bonavida. 2005. Transcriptionfactor YY1: structure, function, and therapeutic implications in cancer biol-ogy. Oncogene 25:1125–1142.

23. Hafner, N., C. Driesch, M. Gajda, L. Jansen, R. Kirchmayr, I. B. Runne-baum, and M. Durst. 2008. Integration of the HPV16 genome does notinvariably result in high levels of viral oncogene transcripts. Oncogene 27:1610–1617.

24. Haugen, T. H., M. J. Lace, T. Ishiji, A. Sameshima, J. R. Anson, and L. P.Turek. Cellular factors are required to activate bovine papillomavirus-1 earlygene transcription and to establish viral plasmid persistence but are notrequired for cellular transformation. Virology, in press.

25. Hebner, C. M., and L. A. Laimins. 2006. Human papillomaviruses: basicmechanisms of pathogenesis and oncogenicity. Rev. Med. Virol. 16:83–97.

26. Heinzel, P. A., S. Y. Chan, L. Ho, M. O’Connor, P. Balaram, M. S. Campo,K. Fujinaga, N. Kiviat, J. Kuypers, H. Pfister, et al. 1995. Variation ofhuman papillomavirus type 6 (HPV-6) and HPV-11 genomes sampledthroughout the world. J. Clin. Microbiol. 33:1746–1754.

27. Hubert, W. G. 2005. Variant upstream regulatory region sequences differ-entially regulate human papillomavirus type 16 DNA replication throughoutthe viral life cycle. J. Virol. 79:5914–5922.

28. Hubert, W. G., T. Kanaya, and L. A. Laimins. 1999. DNA replication ofhuman papillomavirus type 31 is modulated by elements of the upstreamregulatory region that lie 5� of the minimal origin. J. Virol. 73:1835–1845.

29. Ishiji, T., M. J. Lace, S. Parkkinen, R. D. Anderson, T. H. Haugen, T. P.Cripe, J. H. Xiao, I. Davidson, P. Chambon, and L. P. Turek. 1992. Tran-scriptional enhancer factor (TEF)-1 and its cell-specific co-activator activatehuman papillomavirus-16 E6 and E7 oncogene transcription in human ke-ratinocytes and cervical carcinoma cells. EMBO J. 11:2271–2281.

30. Jeon, S., B. L. Allen-Hoffmann, and P. F. Lambert. 1995. Integration ofhuman papillomavirus type 16 into the human genome correlates with aselective growth advantage of cells. J. Virol. 69:2989–2997.

31. Jeon, S., and P. F. Lambert. 1995. Integration of human papillomavirus type16 DNA into the human genome leads to increased stability of E6 and E7mRNAs: implications for cervical carcinogenesis. Proc. Natl. Acad. Sci. USA92:1654–1658.

32. Kammer, C., U. Warthorst, N. Torrez-Martinez, C. M. Wheeler, and H.Pfister. 2000. Sequence analysis of the long control region of human papil-lomavirus type 16 variants and functional consequences for P97 promoteractivity. J. Gen. Virol. 81:1975–1981.

33. Kanaya, T., S. Kyo, and L. A. Laimins. 1997. The 5� region of the humanpapillomavirus type 31 upstream regulatory region acts as an enhancer whichaugments viral early expression through the action of YY1. Virology 237:159–169.

34. Kim, Y. B., Y. S. Song, Y. T. Jeon, J. S. Park, S. J. Um, J. W. Kim, N. H. Park,S. B. Kang, and H. P. Lee. 2005. Sequence variation and the transcriptionalactivity of the upstream regulatory region in human papillomavirus 16 E7variants in cervical cancer of Korean women. Oncol. Rep. 14:459–464.

35. Kitagawa, K., H. Yoshikawa, T. Onda, T. Kawana, Y. Taketani, H. Yo-shikura, and A. Iwamoto. 1996. Genomic organization of human papilloma-virus type 18 in cervical cancer specimens. Jpn. J. Cancer Res. 87:263–268.

36. Kurvinen, K., M. Yliskoski, S. Saarikoski, K. Syrjanen, and S. Syrjanen.2000. Variants of the long control region of human papillomavirus type 16.Eur. J. Cancer 36:1402–1410.

VOL. 83, 2009 HPV-16 URR ALTERATIONS ENHANCE EARLY VIRAL FUNCTIONS 7465

37. Lace, M. J., J. R. Anson, G. S. Thomas, L. P. Turek, and T. H. Haugen. 2008.The E8-E2 gene product of human papillomavirus type 16 represses earlytranscription and replication but is dispensable for viral plasmid persistencein keratinocytes. J. Virol. 82:10841–10853.

38. Lace, M. J., J. R. Anson, L. P. Turek, and T. H. Haugen. 2008. Functionalmapping of the human papillomavirus type 16 E1 cistron. J. Virol. 82:10724–10734.

39. Larkin, M. A., G. Blackshields, N. P. Brown, R. Chenna, P. A. McGettigan,H. McWilliam, F. Valentin, I. M. Wallace, A. Wilm, R. Lopez, J. D. Thomp-son, T. J. Gibson, and D. G. Higgins. 2007. Clustal W and Clustal X version2.0. Bioinformatics 23:2947–2948.

40. Lichtig, H., M. Algrisi, L. E. Botzer, T. Abadi, Y. Verbitzky, A. Jackman, M.Tommasino, I. Zehbe, and L. Sherman. 2006. HPV16 E6 natural variantsexhibit different activities in functional assays relevant to the carcinogenicpotential of E6. Virology 350:216–227.

41. Lizano, M., J. Berumen, M. C. Guido, L. Casas, and A. Garcia-Carranca.1997. Association between human papillomavirus type 18 variants and his-topathology of cervical cancer. J. Natl. Cancer Inst. 89:1227–1231.

42. Lizano, M., and A. Garcia-Carranca. 1997. Molecular variants of humanpapillomaviruses types 16, 18, and 45 in tumors of the uterine cervix inMexico. Gac. Med. Mex. 133(Suppl. 1):43–48. (In Spanish.)

43. May, M., X. P. Dong, E. Beyer-Finkler, F. Stubenrauch, P. G. Fuchs, and H.Pfister. 1994. The E6/E7 promoter of extrachromosomal HPV16 DNA incervical cancers escapes from cellular repression by mutation of target se-quences for YY1. EMBO J. 13:1460–1466.

44. O’Connor, M. J., S. H. Tan, C. H. Tan, and H. U. Bernard. 1996. YY1represses human papillomavirus type 16 transcription by quenching AP-1activity. J. Virol. 70:6529–6539.

45. Ong, C. K., S. Y. Chan, M. S. Campo, K. Fujinaga, P. Mavromara-Nazos, V.Labropoulou, H. Pfister, S. K. Tay, J. ter Meulen, L. L. Villa, and H. U.Bernard. 1993. Evolution of human papillomavirus type 18: an ancient phy-logenetic root in Africa and intratype diversity reflect coevolution with hu-man ethnic groups. J. Virol. 67:6424–6431.

46. Pande, S., N. Jain, B. K. Prusty, S. Bhambhani, S. Gupta, R. Sharma, S.Batra, and B. C. Das. 2008. Human papillomavirus type 16 variant analysisof E6, E7, and L1 genes and long control region in biopsy samples fromcervical cancer patients in north India. J. Clin. Microbiol. 46:1060–1066.

47. Park, J. S., E. S. Hwang, C. J. Lee, C. J. Kim, J. G. Rha, S. J. Kim, S. E.Namkoong, and S. J. Um. 1999. Mutational and functional analysis ofHPV-16 URR derived from Korean cervical neoplasia. Gynecol. Oncol.74:23–29.

48. Pista, A., A. Oliveira, A. Barateiro, H. Costa, N. Verdasca, and M. T. Paixao.2007. Molecular variants of human papillomavirus type 16 and 18 and riskfor cervical neoplasia in Portugal. J. Med. Virol. 79:1889–1897.

49. Psyrri, A., and D. DiMaio. 2008. Human papillomavirus in cervical andhead-and-neck cancer. Nat. Clin. Pract. Oncol. 5:24–31.

50. Rheinwald, J. G., and M. A. Beckett. 1981. Tumorigenic keratinocyte linesrequiring anchorage and fibroblast support cultures from human squamouscell carcinomas. Cancer Res. 41:1657–1663.

51. Rose, B., G. Steger, X. P. Dong, C. Thompson, Y. Cossart, M. Tattersall, andH. Pfister. 1998. Point mutations in Sp1 motifs in the upstream regulatoryregion of human papillomavirus type 18 isolates from cervical cancers in-crease promoter activity. J. Gen. Virol. 79:1659–1663.

52. Rose, B. R., C. H. Thompson, J. Zhang, M. Stoeter, A. Stephen, H. Pfister,M. H. Tattersall, and Y. E. Cossart. 1997. Sequence variation in the up-

stream regulatory region of HPV 18 isolates from cervical cancers. Gynecol.Oncol. 66:282–289.

53. Schmidt, M., W. Kedzia, and A. Gozdzicka-Jozefiak. 2001. Intratype HPV16sequence variation within LCR of isolates from asymptomatic carriers andcervical cancers. J. Clin. Virol. 23:65–77.

54. Schwarz, E., U. K. Freese, L. Gissmann, W. Mayer, B. Roggenbuck, A.Stremlau, and H. zur Hausen. 1985. Structure and transcription of humanpapillomavirus sequences in cervical carcinoma cells. Nature 314:111–114.

55. Shi, Y., J. S. Lee, and K. M. Galvin. 1997. Everything you have ever wantedto know about Yin Yang 1. Biochim. Biophys. Acta 1332:F49–F66.

56. Stephen, A. L., C. H. Thompson, M. H. Tattersall, Y. E. Cossart, and B. R.Rose. 2000. Analysis of mutations in the URR and E6/E7 oncogenes of HPV16 cervical cancer isolates from central China. Int. J. Cancer 86:695–701.

57. Swan, D. C., M. Rajeevan, G. Tortolero-Luna, M. Follen, R. A. Tucker, andE. R. Unger. 2005. Human papillomavirus type 16 E2 and E6/E7 variants.Gynecol. Oncol. 96:695–700.

58. Tornesello, M. L., M. L. Duraturo, S. Losito, G. Botti, S. Pilotti, B. Stefanon,G. De Palo, A. Gallo, L. Buonaguro, and F. M. Buonaguro. 2008. Humanpapillomavirus genotypes and HPV16 variants in penile carcinoma. Int. J.Cancer 122:132–137.

59. Ushikai, M., M. J. Lace, Y. Yamakawa, M. Kono, J. Anson, T. Ishiji, S.Parkkinen, N. Wicker, M. E. Valentine, I. Davidson, L. P. Turek, and T. H.Haugen. 1994. trans activation by the full-length E2 proteins of humanpapillomavirus type 16 and bovine papillomavirus type 1 in vitro and in vivo:cooperation with activation domains of cellular transcription factors. J. Vi-rol. 68:6655–6666.

60. Veress, G., M. Murvai, K. Szarka, A. Juhasz, J. Konya, and L. Gergely. 2001.Transcriptional activity of human papillomavirus type 16 variants havingdeletions in the long control region. Eur. J. Cancer. 37:1946–1952.

61. Villa, L. L., L. Sichero, P. Rahal, O. Caballero, A. Ferenczy, T. Rohan, andE. L. Franco. 2000. Molecular variants of human papillomavirus types 16 and18 preferentially associated with cervical neoplasia. J. Gen. Virol. 81:2959–2968.

62. Weill, L., E. Shestakova, and E. Bonnefoy. 2003. Transcription factor YY1binds to the murine beta interferon promoter and regulates its transcrip-tional capacity with a dual activator/repressor role. J. Virol. 77:2903–2914.

63. Wooldridge, T. R., and L. A. Laimins. 2008. Regulation of human papillo-mavirus type 31 gene expression during the differentiation-dependent lifecycle through histone modifications and transcription factor binding. Virol-ogy 374:371–380.

64. Xi, L. F., N. B. Kiviat, A. Hildesheim, D. A. Galloway, C. M. Wheeler, J. Ho,and L. A. Koutsky. 2006. Human papillomavirus type 16 and 18 variants:race-related distribution and persistence. J. Natl. Cancer Inst. 98:1045–1052.

65. Xi, L. F., L. A. Koutsky, A. Hildesheim, D. A. Galloway, C. M. Wheeler, R. L.Winer, J. Ho, and N. B. Kiviat. 2007. Risk for high-grade cervical intraepi-thelial neoplasia associated with variants of human papillomavirus types 16and 18. Cancer Epidemiol. Biomarkers Prev. 16:4–10.

66. Yamada, T., M. M. Manos, J. Peto, C. E. Greer, N. Munoz, F. X. Bosch, andC. M. Wheeler. 1997. Human papillomavirus type 16 sequence variation incervical cancers: a worldwide perspective. J. Virol. 71:2463–2472.

67. Yamada, T., C. M. Wheeler, A. L. Halpern, A. C. Stewart, A. Hildesheim, andS. A. Jenison. 1995. Human papillomavirus type 16 variant lineages in UnitedStates populations characterized by nucleotide sequence analysis of the E6,L2, and L1 coding segments. J. Virol. 69:7743–7753.

7466 LACE ET AL. J. VIROL.