Transcriptional regulation of aquaporins in accessionsof Arabidopsis in response to drought stress

Erik Alexandersson1,†,‡, Jonas A.H. Danielson1,‡, Johan Rade2, Vamsi K. Moparthi1, Magnus Fontes2, Per Kjellbom1 and

Urban Johanson1,*

1Department of Biochemistry, Center for Molecular Protein Science, Lund University, PO Box 124, SE-221 00, Lund, Sweden, and2Centre for Mathematical Sciences, Lund University, SE-221 00 Lund, Sweden

Received 28 April 2009; revised 28 October 2009; accepted 12 November 2009; published online 4 January 2010.*For correspondence (fax +46 462224116; e-mail urban.johanson@biochemistry.lu.se).†Present address: Institute for Wine Biotechnology, Faculty of AgriSciences Stellenbosch University, Private Bag X1, 7602 Matieland, South Africa.‡These authors contributed equally to this work.

SUMMARY

Aquaporins facilitate water transport over cellular membranes, and are therefore believed to play an important

role in water homeostasis. In higher plants aquaporin-like proteins, also called major intrinsic proteins (MIPs),

are divided into five subfamilies. We have previously shown that MIP transcription in Arabidopsis thaliana is

generally downregulated in leaves upon drought stress, apart from two members of the plasma membrane

intrinsic protein (PIP) subfamily, AtPIP1;4 and AtPIP2;5, which are upregulated. In order to assess whether this

regulation is general or accession-specific we monitored the gene expression of all PIPs in five Arabidopsis

accessions. The overall drought regulation of PIPs was well conserved for all five accessions tested, suggesting

a general and fundamental physiological role of this drought response. In addition, significant differences

among accessions were identified for transcripts of three PIP genes. Principal component analysis showed that

most of the PIP transcriptional variation during drought stress could be explained by one variable linked to leaf

water content. Promoter-GUS constructs of AtPIP1;4, AtPIP2;5 and also AtPIP2;6, which is unresponsive to

drought stress, had distinct expression patterns concentrated in the base of the leaf petioles and parts of the

flowers. The presence of drought stress response elements within the 1.6-kb promoter regions of AtPIP1;4 and

AtPIP2;5 was demonstrated by comparing transcription of the promoter reporter construct and the

endogenous gene upon drought stress. Analysis by ATTED-II and other web-based bioinformatical tools

showed that several of the MIPs downregulated upon drought are strongly co-expressed, whereas AtPIP1;4,

AtPIP2;5 and AtPIP2;6 are not co-expressed.

Keywords: aquaporins, major intrinsic proteins, drought stress response, natural variation, ecotypes,

Arabidopsis.

INTRODUCTION

In plants, aquaporin (AQP) homologs, also called major

intrinsic proteins (MIPs), form a large protein family, with

35 identified members in Arabidopsis (Johanson et al.,

2001), and 33 in maize (Zea mays) and rice (Oryza sativa)

(Chaumont et al., 2001; Sakurai et al., 2005). Based on

sequence comparison, higher plant MIPs are divided into

five subfamilies: plasma membrane intrinsic proteins

(PIPs), tonoplast intrinsic proteins (TIPs), NOD26-like

intrinsic proteins (NIPs), small basic intrinsic proteins

(SIPs) and the recently identified uncharacterized intrinsic

proteins (XIPs) (Danielson and Johanson, 2008). Members

of the PIP and TIP subfamilies, which are abundant in the

plasma membrane and in the vacuolar membrane, where

they reside as tetramers, have been shown to be active

water channels in Xenopus oocytes (e.g. Maurel et al.,

1993; Johansson et al., 1998). The PIP subfamily can be

further divided into the PIP1 and PIP2 groups, based on

sequence similarity. Several PIP2 isoforms have been

reported to function as water channels when expressed in

Xenopus oocytes (AtPIP2;1, AtPIP2;2, AtPIP2;3, AtPIP2;7;

Daniels et al., 1994; Kammerloher et al., 1994; Weig et al.,

1997), and because of the high degree of sequence

650 ª 2010 The AuthorsJournal compilation ª 2010 Blackwell Publishing Ltd

The Plant Journal (2010) 61, 650–660 doi: 10.1111/j.1365-313X.2009.04087.x

conservation (‡84% identity) it is reasonable to assume

that all the AtPIP2s have the same specificity. PIP1 iso-

forms generally have much lower or no water channel

activity (Kammerloher et al., 1994; Yamada et al., 1995;

Biela et al., 1999; Chaumont et al., 2000; Moshelion et al.,

2002). However, Fetter et al. (2004) showed that

co-expression of ZmPIP1;2 and different maize PIP2

isoforms led to increased water permeability, dependent on

the quantity of ZmPIP1;2 cRNA injected into Xenopus

oocytes. Further transient co-expression of PIP genes in

maize protoplasts demonstrated that the localization of

PIP1s to the plasma membrane seems to be dependent on

the simultaneous expression of PIP2 isoforms (Zelazny

et al., 2007). This suggests that PIP1 isoforms have a role in

water permeability, possibly interacting with PIP2 isoforms

either in heterotetramers or between homotetramers.

Aquaporins (AQPs) have been shown to affect plant water

homeostasis. For example, downregulation of certain PIP

isoforms through antisense RNA leads to a decrease in

osmotic water permeability of protoplasts, an increased size

of the root system, and/or a higher susceptibility to drought

and osmotic stress (Kaldenhoff et al., 1998; Martre et al.,

2002; Siefritz et al., 2002). Accordingly, overexpression of

PIP isoforms has, among other effects, been shown to give

an increase in root osmotic hydraulic conductivity, transpi-

ration and shoot to root ratio (Aharon et al., 2003; Katsuhara

et al., 2003; Lian et al., 2004). Still, the benefits of AQP

overexpression in stress conditions are uncertain, and some

studies have shown a decreased resistance to salt or

drought stress in comparison with wild-type plants (Aharon

et al., 2003; Katsuhara et al., 2003).

A key question in the study of the MIP family in plants is

why the plant requires so many MIP genes. One explanation

is that although many PIP2 and several TIP isoforms have

been shown to be permeable to water, MIPs can also be

channels for a number of other small solutes. Consequently,

the substrate specificity can differ between individual

isoforms. PIP1 members have been proposed to be perme-

able to e.g. glycerol (Biela et al., 1999; Moshelion et al.,

2002), boric acid (Dordas et al., 2000), urea (Gaspar et al.,

2003) and carbon dioxide (Uehlein et al., 2003), even though

the physiological importance of MIPs as facilitators of some

of these solutes remains unclear. A number of TIP isoforms

have been shown to be permeable to glycerol, urea and

hydrogen peroxide (Gerbeau et al., 1999; Klebl et al., 2003;

Liu et al., 2003; Bienert et al., 2007), and in wheat

(Triticum aestivum) and Arabidopsis, TIP isoforms have

been recognized to be permeable to NH4+/NH3 and urea

(Jahn et al., 2004; Loque et al., 2005).

Another reason for the redundancy of MIPs is the

specific spatial expression pattern, limited to certain

organs or cell types, or developmental stages, as shown

for some of the MIPs (e.g. see review by Fraysse et al.,

2005; Maurel et al., 2002). We previously monitored the

expression of MIPs in roots, leaves and flowers (Alexan-

dersson et al., 2005). The transcription of MIPs are also

affected by environmental cues, e.g. in drought-stressed

plants grown on soil the expression of MIPs are generally

downregulated, with the exception of AtPIP1;4 and

AtPIP2;5, which are instead upregulated, and AtPIP2;6,

which is unaffected (Alexandersson et al., 2005). There

have been previous reports of upregulation of MIPs upon

osmotic stress in plants (Jang et al., 2004; Lian et al.,

2004; Guo et al., 2006). Upon drought the PIP1, Trg-31,

was shown to be rapidly upregulated in pea (Pisum

sativum) (Guerrero et al., 1990), and, like AtPIP1;4, Trg-31

was shown to be weakly expressed in roots (Guerrero and

Crossland, 1993).

Lately, several studies have estimated the variation in

transcription between different Arabidopsis accessions

(Chen et al., 2005; Vuylsteke et al., 2005; Kliebenstein

et al., 2006). These studies show that phenotypic variation

between accessions can be assigned to transcriptional

differences, and that there is an over-representation of

differently regulated genes involved in signaling and

stress responses (Chen et al., 2005), and also in transport

(Kliebenstein et al., 2006). Furthermore, differences in

transcriptional regulation of MIPs between plant varieties

have been shown to occur. Lian et al. (2004, 2006)

showed, for example, that upon osmotic stress OsPIP1;3

was upregulated in highland rice that has better drought

avoidance in comparison with lowland rice, in which

OsPIP1;3 did not show a change in expression, leading to

the conclusion that OsPIP1;3 must have a role in the

difference in drought avoidance between the two rice

varieties. Recently, it has also been shown that VvPIP1;1 in

grapevine (Vitis vinifera) roots are expressed in a cultivar-

specific manner in response to drought stress, reflecting

the differences in hydraulic conductivity observed

(Vandeleur et al., 2009).

In this study, we further investigate PIP expression and

regulation upon drought stress in five Arabidopsis acces-

sions. Importantly, the use of several accessions with

varying water use efficiency (WUE) and different geograph-

ical origin (Nienhuis et al., 1994) enabled us to show that the

PIP expression generally conforms to the pattern previously

observed in the Col-0 background, at the same time it

allowed us to detect some minor but significant differences

in the expression of three PIP genes.

In addition, we generated promoter-GUS constructs for

the AtPIP1;4, AtPIP2;5 and AtPIP2;6 isoforms to monitor

expression patterns. With the help of the Arabidopsis

thaliana trans-factor and cis-element prediction database

(ATTED-II), and other publicly available microarray data

and bioinformatics tools, we show that several of the

MIPs downregulated upon drought stress are strongly

co-expressed, whereas AtPIP1;4, AtPIP2;5 and AtPIP2;6 do

not co-express with this group.

Conserved drought regulation of aquaporin genes 651

ª 2010 The AuthorsJournal compilation ª 2010 Blackwell Publishing Ltd, The Plant Journal, (2010), 61, 650–660

RESULTS

PIP expression in different accessions upon drought stress

and analysis of variation in expression

In Figure 1 the expression ratio (log2 scale) of control and

drought-stressed plants of all 13 Arabidopsis PIP genes

for the five accessions tested can been seen as mean

values of the three biological replicates. The relatively

large standard deviations observed for some genes are

mainly the result of variation between biological repli-

cates, rather than between technical replicates (Figure S1).

In general the expression pattern of PIPs was conserved

between accessions. AtPIP1;4 and AtPIP2;5 were upregu-

lated for all five accessions, whereas the remaining PIP

genes, with the exception of AtPIP2;6, showed a general

downregulation. For three genes, small but significant

differences in drought responses among accessions were

recorded. In the accession Edi-0, AtPIP2;4 and AtPIP2;6

were upregulated compared with Lip-0, and for AtPIP2;4,

also relative to Kas-1. The upregulation of AtPIP2;5 was

significantly higher, about four-fold, in Kas-1 compared

with Col-0, Ler-0 and Lip-0. There were also differences in

the normalized unstressed expression levels of specific

PIP transcripts between accessions (Table S2). Most

notably, the expression of AtPIP2;8 appears to be seven-

fold higher in Lip-0 compared with Col-0, whereas differ-

ences in expression for the other PIP transcripts were

within a twofold change, and no major differences in

expression intensity between accessions can be seen for

AtPIP1;4, AtPIP2;5 and AtPIP2;6.

As differences in expression ratio can arise from differ-

ences in the level of drought stress between accessions and/

or experimental replicates, drought stress was assessed by

measuring the water content in sampled leaf tissue. Further

examination employing principle component analysis (PCA)

of the regulation of PIP expression during drought showed

that 90% of the total variation in the dataset is described by

the first principle component (PC1; Figure 2a). The contri-

bution of the individual variables (PIP genes) to PC1 and PC2

is depicted in Figure 2b. There is no clear subclustering of

the different ecotypes in the PCA plots (data not shown).

However, when the samples are colored for leaf water

content, a correlation of leaf water content and variation in

PIP expression can be seen (Figure 2a). In Figure 3, PC1 is

shown as a function of leaf water content, displaying a weak

linear correlation (r2 = 0.7).

To extend the expression analysis of PIP genes to also

include other conditions than drought stress, as well as

other genes, expression profiles were investigated in silico.

Figure 4 shows a gene co-expression network of all AtPIPs

and the most highly expressed AtTIP genes based on data

retrieved from ATTED-II and visualized in CYTOSCAPE 2.2

(http://www.cytoscape.org). In ATTED-II the correlation coef-

ficients were calculated from Affymetrix data corresponding

to 58 different experimental conditions, which covered

various stress treatments and developmental stages. Many

AtPIPs and AtTIPs are highly co-expressed, whereas

AtPIP1;4, AtPIP2;4, AtPIP2;5 and AtPIP2;6 are co-expressed

with other AtPIPs and AtTIPs to a much lesser extent. A list of

the most highly co-expressed genes to AtPIP1;4, AtPIP2;5

and PIP2;6 reveals a correlation of AtPIP2;6 with photosyn-

thetic genes (Table S3). The cluster of co-expressing AtPIPs

and AtTIPs is also confirmed by co-correlation plots using

Arabidopsis co-expression tool (ACT; University of Leeds,

UK; Figure S2). In particular, the gene pairs AtPIP1;2 and

AtPIP2;1, AtTIP1;2 and AtTIP2;1, and AtPIP1;3 and AtPIP2;7/

2;8, which are among the most co-expressed MIPs (Fig-

ure 4), show very similar patterns of correlations with

the expression of other genes (Figure S2). These high

co-correlations (r2 ‡ 0.85) are contrasted by a comparison

of PIP1;2 and PIP1;4 (r2 = 0.30), for example, where the latter

is not part of the cluster in Figure 4.

Figure 1. Drought regulation of AtPIP expres-

sion in five Arabidopsis accessions.

Ratios (log2) of mRNA levels in drought-stressed

and control plants for all 13 plasma membrane

intrinsic protein (PIP) genes in five accessions of

Arabidopsis, as measured with RT-qPCR. The

bars show means � SDs (error bars) from three

replicates of the drought stress experiment.

Accession-specific differences in mRNA regula-

tion, as measured by ANOVA (P < 0.05), were

found for PIP2;4, PIP2;5 and PIP2;6. Dashed lines

show which accessions the difference was found

between (ad hoc test with non-overlapping 95%

confidence intervals).

652 Erik Alexandersson et al.

ª 2010 The AuthorsJournal compilation ª 2010 Blackwell Publishing Ltd, The Plant Journal, (2010), 61, 650–660

Expression analysis of AtPIP1;4, AtPIP2;5 and AtPIP2;6

promoter-GUS constructs

The GUS expression patterns regulated by the 1.6-kb long

AtPIP1;4, AtPIP2;5 and AtPIP2;6 promoters of the respective

gene showed a concentration in the base of the petioles for

all three constructs (Figure 5). No major differences were

seen in leaf expression patterns between plants grown on

soil and MS agar. GUS expression was also seen in petiole

vascular tissues, and to a somewhat lesser extent in leaf

vascular tissues (Figure 5a–c, e–g). There was also a differ-

ence in the expression between individual leaves in single

plants, with the highest expression located in younger

leaves. This expression difference was not as clear for GUS

regulated by the 1.6-kb AtPIP2;6 promoter, which had a

distinct expression pattern restricted to the mid-nerve and

hydathodes in leaves (Figure 5i–k). All three constructs were

expressed in flower tissue, centered to the sepal and petal

abscission zone, and just below the stigma (Figure 5d,h

and l). However, only the AtPIP2;6 promoter-GUS construct

showed expression in stamens. In roots, GUS expression

regulated by the AtPIP1;4 promoter was restricted to the root

tips, whereas GUS expression regulated by the AtPIP2;5

promoter was foremost detected in lateral roots, but not in

root tips (not shown). GUS expression regulated by the

AtPIP2;6 promoter showed weak expression in the middle

of the main root (not shown).

Comparison of GUS transcription regulated by MIP

promoters and transcription of endogenous MIP genes

in response to drought stress

In order to assess if all necessary drought-responsive ele-

ments were present within the respective 1.6-kb promoter-

GUS construct, lines carrying the AtPIP1;4, AtPIP2;5 or

AtPIP2;6 promoter-GUS construct were drought stressed on

soil. Drought regulation of uid (GUS) and the endogenous

AtPIP1;4, AtPIP2;5 or AtPIP2;6 genes, under control of their

complete regulatory region, were then analyzed in leaves of

each line. In Figure 6 the ratios of the drought regulation of

GUS transcripts and the corresponding endogenous gene in

the same line are compared for three independent lines for

each construct. For AtPIP1;4, AtPIP2;5 and AtPIP2;6 there is

Figure 2. Principle component analysis (PCA) of AtPIP expression in drought-

stressed accessions.

PCA was performed with in-house computer software. The PIP expression

regulation of Figure 1 was used as input data for the PCA.

(a) Projections of the 15 samples (five accessions and three drought stress

experiments) along PC1 and PC2. The samples are colored for leaf water

content (red, low leaf water content; green, high leaf water content).

(b) The loading of the 13 variables (PIP gene expression ratios) used in the

analysis. The positions of the 13 variables reflect their relative contribution to

the variables PC1 and PC2. The axes PC1 and PC2 show the directions of the

main variation, accounting for 90 and 4%, respectively, of the total variation.

The lengths of the axes represent one arbitrary unit. Note that the relative

positions of the variables and samples have a well-defined interpretation, i.e.

the rightmost samples have the highest values of the rightmost variables,

and the lowest values of the leftmost variables, and vice versa. For example,

for the samples to the left, the expression ratios of PIP2;2 and PIP1;5 are high,

whereas the expression ratios of PIP2;5 and PIP1;4 are low.

Figure 3. Principal component 1 (PC1) and leaf water content for all 15

drought stress experiments.

The values of PC1 (from the principle component analysis, PCA) plotted

against leaf water content for samples from 15 drought stress experiments

(five accessions and three replicates). The control sample point is the mean of

the leaf water content of all 15 controls.

Conserved drought regulation of aquaporin genes 653

ª 2010 The AuthorsJournal compilation ª 2010 Blackwell Publishing Ltd, The Plant Journal, (2010), 61, 650–660

no significant difference in the regulation of the GUS con-

struct compared with the endogenous gene, as log2(GUS

response/PIP response) is close to zero in at least two out of

three independent lines, suggesting that the main drought

regulatory cis-elements are contained within the 1.6 kb

upstream of the translational start codon. However, for

Figure 4. Co-expression analysis of all AtPIPs

and four AtTIPs.

Co-expressed gene network generated in CYTO-

SCAPE 2.2 by Pearson’s coefficients of all plasma

membrane intrinsic proteins (PIPs) and the four

most highly expressed tonoplast intrinsic pro-

teins (TIPs) retrieved from the Arabidopsis thali-

ana trans-factor and cis-element prediction

database (ATTED-II). Correlation coefficients

below 0.6 are colored gray for visibility reasons.

Note that there are no specific probes for

AtPIP2;2 and AtPIP2;3, and for AtPIP2;7 and

AtPIP2;8, on the Affymetrix ATH1 chip, because

of the high level of sequence identity between

these two PIP pairs.

Figure 5. Expression pattern from 1.6-kb pro-

moter::GUS constructs of AtPIP1;4, AtPIP2;5

and AtPIP2;6.

Plants transformed by the AtPIP1;4 promoter-

GUS construct grown for 2 weeks on agar plates

(a), 2 weeks on soil (b) and 3 weeks on soil (c),

and flowers (d). Plants transformed by the

AtPIP2;5 promoter-GUS construct grown for

2 weeks on agar plates (e), 2 weeks on soil (f)

and 3 weeks on soil (g), and flower (h). Plants

transformed by the AtPIP2;6 promoter-GUS con-

struct grown for 2 weeks on agar plates (i),

2 weeks on soil (j) and 3 weeks on soil (k), and

flowers (l).

654 Erik Alexandersson et al.

ª 2010 The AuthorsJournal compilation ª 2010 Blackwell Publishing Ltd, The Plant Journal, (2010), 61, 650–660

PIP2;5, the marginally but consistently lower drought

induction of the GUS transcript might indicate that the 1.6-kb

promoter-GUS construct is not sufficient to completely

mimic the drought regulation of AtPIP2;5.

DISCUSSION

Regulation of PIP expression upon drought in different

accessions

To monitor possible differences in the regulation of PIP

expression during drought stress, five different accessions

were chosen based on geographical origin and WUE, as

determined by Nienhuis et al. (1994). By testing the variation

of WUE, defined as accumulated biomass per volume of

water used, in 31 Arabidopsis accessions, Nienhuis et al.

(1994) found that Lip-0 had the highest WUE and Edi-0 had

the the lowest (2.40 and 1.86 mg plant dry weight/g H2O,

respectively). In addition, Col-0 (2.24 mg plant dry weight/g

H2O; Nienhuis et al., 1994) and Ler-0, which are among the

most commonly used accessions, were included together

with Kas-1, as it originates from central Asia, and is thus

likely to be genetically more divergent from the other four

accessions. The WUE of the latter two accessions was not

tested by Nienhuis et al. (1994).

The overall pattern of expression regulation of PIPs was

found to be conserved between the five accessions during

drought stress (Figure 1). Importantly, the upregulation of

AtPIP1;4 and AtPIP2;5, and the downregulation of most PIPs,

as we previously showed only in the Col-0 accession

(Alexandersson et al., 2005), seem to be a general pattern

of PIP regulation during drought stress. Although the

regulation of AtPIP1;4 is consistent with the finding of an

upregulated PIP1 in response to drought in pea (Guerrero

et al., 1990), it could only be speculated whether this pattern

could also be expected in other plants. It is possible that the

drought regulation of PIPs represents an adaptation to the

habitat and lifestyle specific for Arabidopsis. A general

downregulation of AQPs might be a way for the plant to

minimize water loss and uphold turgor in leaves. The

upregulation of a few individual PIPs could be a way for

the plant to direct water flow to specific organs or cells that

are crucial for plant survival during drought or necessary for

a fast recovery upon rehydration of the plant, as we have

previously proposed (Alexandersson et al., 2005). Even

though the general regulation pattern is well conserved

among the accessions, there are significant minor differ-

ences in PIP regulation between some of these for AtPIP2;4,

AtPIP2;5 and AtPIP2;6. Interestingly, Lip-0 and Edi-0, the two

accessions with the highest difference in WUE are found

among these accessions. However, the variation in basal

expression levels among accessions complicates the inter-

pretation of the regulatory differences, and the relatively

large variation between biological replicates could mask

more subtle differences that might exist between, for

example, Col-0 (that has a slightly lower WUE than Lip-0)

and Edi-0. Whether AtPIP2;4 and AtPIP2;6 contribute to the

differences in WUE, and what mechanisms might lie behind

this, remains to be investigated.

Principal component analysis is a very powerful method

to identify and visualize the major variation in multivariate

data sets without the requirement of specifying any partic-

ular hypothesis regarding potential correlations. In PCA,

new variables – the so-called principal components (PCs) –

are constructed by a linear combination of the original

variables, so that the major variation is captured by the first

principal component, followed by the second and so on. In

this way the main variation among multidimensional sam-

ples may be projected onto a plane defined by PC1 and PC2.

Although we do not find any accession-specific patterns, the

variation introduced by analyzing all the different accessions

together revealed that: (i) for each sample the regulation of

PIP expression in the drought experiments is closely asso-

ciated with PC1 (Figure 2a); (ii) PC1 explains 90% of the

variation, and accordingly the regulation of most Arabidop-

sis PIP genes is closely linked to PC1 (Figure 2b); and (iii) PC1

seems to be correlated to leaf water content (Figures 2a and

3). Thus, during drought stress PIP expression is strongly

reflected by PC1, which in its turn seems to be dependent on

the leaf water content. Even though the exact nature of this

dependency is unclear because of the limited volume of

data, it is tempting to hypothesize that there is an associa-

tion between leaf water content and the variation in PIP

expression, resulting from a common regulatory mecha-

nism of PIP expression. Possible scenarios as the leaf water

content decreases ranges from a simple induction of tran-

scription factors, acting directly as activators or repressors

Figure 6. Correlation between GUS and PIP transcriptions.

The bars show the ratio of uid (encoding GUS) transcriptional regulation

(regulated by the AtPIP1;4, AtPIP2;5 or AtPIP2;6 promoter) and the transcrip-

tional regulation of the endogenous AtPIP1;4, AtPIP2;5 or AtPIP2;6 gene in

response to drought stress. Three independent lines are shown for each

construct (transformed by promoter AtPIP1;4 (1.6 kb), AtPIP2;5 (1.6 kb) or

AtPIP2;6 (1.6 kb) GUS). Ratios are shown in log2 scale (0 means that the ratio

is 1, e.g. the GUS and PIP transcripts are regulated exactly the same upon

drought stress). The error bars represent � SDs from three replicates of the

drought stress experiment. Note that for one of the PIP2;6 promoter construct

lines, only data from one drought stress experiment was available, and hence

no error bars are shown for that line.

Conserved drought regulation of aquaporin genes 655

ª 2010 The AuthorsJournal compilation ª 2010 Blackwell Publishing Ltd, The Plant Journal, (2010), 61, 650–660

on the up- and downregulated groups of PIPs, to a more

complex regulatory network, where the PIPs are indirectly

regulated via a cascade of transcription factors. The

co-expression of MIPs is further discussed below in connec-

tion with the ATTED-II analysis.

Co-variation of MIP expression

Gene co-expression of MIPs as a family has been reported

before. In Arabidopsis, Schmid et al. (2005) found that 33

members of the MIP family had a higher level of

co-expression than could be expected by chance, when

examining the expression in 79 diverse samples covering

different developmental stages. Using several internet-

based databases and tools, which enable the discovery and

investigation of co-expressed genes (ACT, ATTED-II and

csb.db) we thoroughly analyzed the co-expression of PIPs

and TIPs. In Figure 4 the gene co-expression network con-

structed by co-expression coefficients retrieved from

ATTED-II shows that many AtPIP and AtTIP genes that

are downregulated upon drought stress are strongly

co-expressed. In contrast, AtPIP1;4 and AtPIP2;5, which were

upregulated, and AtPIP2;6, which was stably expressed

upon drought, do not fall into this group or co-express with

each other (r < 0.6). We obtained similar results by per-

forming expression co-correlation plots with the help of ACT

(Figure S2). As it is possible to retrieve genes with nega-

tively correlated expression in ACT, we surveyed ACT but

did not find any clear negative correlations (r < )0.5) among

PIPs and TIPs (not shown).

The Arabidopsis genome has extensive syntenic regions,

indicative of several rounds of genome-wide duplications

(reviewed in Henry et al., 2006). Several of the closely related

PIP pairs in the co-expressed cluster (e.g. PIP1;1 and PIP1;2,

and PIP2;1 and PIP2;2/2;3) are located in duplicated regions,

and hence a positive co-correlation could be expected

because the promoter regions were most likely duplicated

together with the gene. Interestingly, the three gene pairs

with strongest co-correlations are not closely related: two of

them are PIP1 and PIP2 pairs, whereas the third is a TIP1 and

TIP2 pair. This points to a functional link between these

MIPs, as transcripts in a pair are both needed at the same

time under most conditions, leading to a very similar

transcriptional relation to other genes (Figure S2A–C).

Whether this reflects a direct physical interaction, as has

been suggested for PIP1s and PIP2s (Zelazny et al., 2007), a

functional complement in subcellular localization, or sub-

strate specificity, awaits further investigation.

The expressional regulation of AtPIP2;5 shows similarity

to genes connected to the establishment of shoot meristem

formation, and/or leaf shape and growth (GIF1, PINHEAD/

ZWILLE, MYB17; Kim and Kende, 2004; Newman et al., 2002;

Schmitz and Theres, 2005). This co-expression might reflect

the localization of AtPIP2;5 to the base of leaf petioles, and

possibly the shoot meristem, seen by AtPIP2;5 promoter-

GUS constructs (see below). The co-expression of AtPIP2;5

with other MIP genes is low, and only AtPIP1;4 is among the

300 most co-expressed genes according to ATTED-II

(r = 0.47). In comparison with AtPIP1;4 and AtPIP2;5,

AtPIP2;6 shows a higher degree of co-expression with many

genes, and interestingly 30 out of the 50 most co-expressed

genes are annotated to be associated with photosynthesis

(ATTED-II). The co-expression of AtPIP2;6 with several genes

encoding chloroplast proteins is also seen in the ACT and

csb.db databases (not shown). This co-expression is consis-

tent with our earlier results showing that AtPIP2;6 is the

major MIP transcript in leaves (Alexandersson et al., 2005).

However, although the promoter-GUS fusion (see below)

confirms that AtPIP2;6 is strongly expressed in leaves, the

GUS staining is not found in mesophyll cells where the

chloroplasts are most abundant. This would argue against a

localization of PIP2;6 to the chloroplast, as suggested for the

PIP1 isoform NtAQP1 in tobacco (Uehlein et al., 2008).

Tissue-specific expression of AtPIP1;4, AtPIP2;5 and

AtPIP2;6, and promoter element analysis

Promoter-GUS constructs with 1.6-kb-long AtPIP1;4,

AtPIP2;5 and AtPIP2;6 promoter sequences were con-

structed in order to monitor the spatial expression pattern in

the plant, and to determine if the cis-element(s) regulating

expression upon drought was present in these promoter

regions (Figures 5 and 6).

In unstressed tissue GUS expression shows a concentra-

tion at the base of the petioles, as well as in the vascular

tissues of petioles and leaves, in some developmental

stages for all three constructs. Notably, AtPIP1;4 is

expressed in emerging and young leaves. AtPIP2;6 displays

a distinct expression pattern in leaves, restricted to the mid-

nerve, and was also the only one of the three genes with an

expression in hydathodes. In flower tissue all show a similar

expression pattern, except that AtPIP2;6 is also expressed in

stamens. In accordance with earlier transcript expression

studies (Jang et al., 2004; Alexandersson et al., 2005), the

expression of the three genes is low in roots. AtPIP1;4 seems

to be exclusively expressed in root tips, and AtPIP2;5 in

lateral roots (not shown). Thus, the expression of AtPIP1;4

and AtPIP2;5 seem to be spatially divided in roots. The

expression patterns, level of expression (AtPIP1;4 comprises

a much higher portion of the total expression of PIP isoforms

in rosette leaves than AtPIP2;5; Table S2) and lack of

correlation of expression (Figure 5) points to AtPIP1;4 and

AtPIP2;5 having different roles in drought stress, and in

stress response in general.

To investigate whether the promoter regions contained

the necessary cis-element(s) for regulating expression upon

drought, a promoter-GUS-transformed Arabidopsis lines

were exposed to drought stress on soil, as previously

performed for the accessions. Regulation of the expression

of GUS transcripts under the control of AtPIP1;4, AtPIP2;5 or

656 Erik Alexandersson et al.

ª 2010 The AuthorsJournal compilation ª 2010 Blackwell Publishing Ltd, The Plant Journal, (2010), 61, 650–660

AtPIP2;6 promoters was compared with the endogenous

AtPIP1;4, AtPIP2;5 or AtPIP2;6 transcripts. This showed that

GUS and endogenous AtPIP1;4, AtPIP2;5 and AtPIP2;6

transcription were not significantly different in two out of

three lines (Figure 6), suggesting that the 1.6-kb AtPIP1;4

and AtPIP2;5 promoter regions include the drought-respon-

sive cis-element(s), leading to an upregulation during

drought stress. Supporting this, we were also able to

visually detect increased GUS activity in lines transformed

by AtPIP1;4-GUS or AtPIP2;5-GUS promoter constructs

drought stressed on agar plates. For lines transformed by

AtPIP1;4-GUS promoter constructs, GUS activity was also

spatially increased in leaves, whereas the higher expression

of AtPIP2;5 seems instead to relate to an increased expres-

sion intensity at the base of the petioles upon drought stress

(Figure S3). As drought induction of the endogenous

AtPIP1;4 gene and the AtPIP1;4-GUS promoter constructs

are similar, it is likely that the extended expression pattern

observed for the promoter-GUS construct is also represen-

tative for endogenous AtPIP1;4 expression. However, the

physiological relevance of the increased expression of

AtPIP1;4 and AtPIP2;5 is unclear.

For AtPIP2;6, the results indicate that the cloned region is

sufficient to mimic the drought-insensitive transcription of

the endogenous gene. The observed difference between

individual lines carrying the same construct may result from

positional effects caused by the random insertion of the

promoter-GUS construct in the genome. For AtPIP2;5, the

GUS transcript was slightly less induced by drought in all

three lines, possibly because of missing regulatory elements

outside of the cloned 1.6-kb promoter region. Our results

demonstrate that the relative expression levels of a pro-

moter–reporter gene and the corresponding endogenous

gene can be used to map promoter cis-elements. In addition

to validating that the cloned promoter contains all the

response elements of interest, this method provides a large

advantage to an absolute comparison in drought experi-

ments, as it is virtually impossible to achieve exactly the

same level of drought stress in different plants. Using this

technique, promoter regions may be further examined by

deletion studies to better define the cis-elements.

CONCLUSIONS

Here, we show that the general pattern of drought regulation

of PIPs is conserved among five accessions of Arabidopsis. In

our studies, AtPIP1;4 and AtPIP2;5 are the only AQP tran-

scripts that show distinct upregulation upon drought stress,

whereas most AtPIPs are downregulated. At the same time

there are significant differences in the expression of certain

PIPs between accessions that could have importance for

accession-specific traits, e.g. WUE. A bioinformatics analysis

of microarray data reveals that most of the downregulated

PIPs have correlated expression, with specific pairs of PIP1s

and PIP2s having the highest correlations. In contrast,

AtPIP1;4 and AtPIP2;5 expression are not correlated in gen-

eral, even though both are upregulated by drought stress.

Differences in expression patterns visualized by GUS staining

also suggest that these genes have distinct functional roles.

Future investigations should further clarify the physiological

role of the general drought stress expression pattern of AQPs

in plants, as well as the relevance of the identified natural

variation in PIP expression among accessions.

EXPERIMENTAL PROCEDURES

Plant material and treatments

Accessions Lip-0, Edi-0 and Kas-1, with stock codes N1337, N1123and N1265, were obtained from the European Arabidopsis StockCentre (http://arabidopsis.info). For drought stress experimentsArabidopsis seeds were planted on soil and vernalized at 8�C 1 weekbefore trays were placed in growth chambers (100 lE, 14-h lightperiod) at 20�C with 70–80% humidity. Plants were grown for4–4.5 weeks before drought stress was initiated by ceasing watering.Control plants were grown next to stress-treated plants, and werecontinuously watered during the experiments. In order to monitorthe soil water loss of the stressed plants and maintain constant soilwater content of control plants, the trays were weighed throughoutthe experiment. Drought stress was carried out for 8–11 days beforesampling to achieve a similar degree of stress based on soil watercontent. In each experimental repetition all accessions were har-vested at the same time to avoid developmental differences. Rosetteleaves of between five and seven plants (12–15 for plants trans-formed by promoter-GUS constructs, see below) of drought-stres-sed and control plants were harvested at every sampling point, aswell as leaves of between four and six plants to determine dry weightand leaf water content, which was determined by comparing thefresh weight with the dry weight after drying plant material at 80�Cfor 24 h. Harvesting was always carried out 4 h after the onset oflight. Plants with promoter-GUS constructs were grown both on soiland on MS agar plates (half-strength MS + MS vitamins; Murashigeand Skoog, 1962) in order to monitor the expression of GUS.

RNA isolation and RT-qPCR

RNA was isolated with the Plant Total RNA Miniprep System(Viogene, http://www.viogene.com) following the manufacturer’sinstructions, and was then treated with RNase-free DNaseI (Pro-mega, http://www.promega.com) to degrade contaminating geno-mic DNA. qPCR-primers (MWG, http://www.eurofinsdna.com) weredesigned according to specific criteria, which included a predictedmelting temperature of 60 � 2�C, a primer length of 18–24 nucleo-tides, a product size of 60–150 bp and a GC content of 45–60%.Primer sequences are available in Table S1. cDNA from approxi-mately 500 ng total RNA (determined by spectrophotometry, A260)was synthesized with the use of oligo(dT23) primers (ProtoScript kit;New England Biolabs, http://www.neb.com) following themanufacturer’s instructions. qPCR was carried out with a Rotor-Gene 3000 (Corbett, http://www.corbettlifescience.com) usingPlatinum qPCR SYBR�green supermix (Invitrogen, http://www.invitrogen.com). Melting curve analyses were performed for allsamples by elevating the temperature from 55 to 99�C at a rate of0.5�C s)1, and products were routinely checked by 2% agarose gelelectrophoresis. To account for possible differences between sam-ples in original RNA quantity and efficiency of cDNA transcription,samples were normalized by actin2, a reference gene that wasshown to be only weakly affected by drought stress in previousmicroarray experiments (Alexandersson et al., 2005). This was also

Conserved drought regulation of aquaporin genes 657

ª 2010 The AuthorsJournal compilation ª 2010 Blackwell Publishing Ltd, The Plant Journal, (2010), 61, 650–660

confirmed by Genevestigator (Zimmermann et al., 2004), andCzechowski et al. (2005) showed that actin2 expression changed byless than 50% upon drought. In addition, the conserved overallexpression pattern of PIPs among the accessions supported thechoice of the reference gene. The comparison of expression wasperformed by the function ‘Comparative Quantification’ included inROTOR-GENE 6 (Corbett).

Differences in gene regulation during drought for the accessionswere analyzed in a two-way fashion. First, one-way ANOVA was usedto find accession-specific deviations from a common mean. Then apost-hoc analysis (‘multcompare’, as implemented in MAT-

LAB R2006b; The MathWorks Inc., http://www.mathworks.com)was performed on genes with a significant deviation (as indicatedby ANOVA) in order to find out which accessions differed signifi-cantly from each other.

Promoter-GUS construction and plant transformation

Approximately 1.6-kb-long sequences upstream of the ATG startcodon of AtPIP1;4, AtPIP2;5 and AtPIP2;6 were amplified fromgenomic DNA isolated from Arabidopsis Col-0 plants by the fol-lowing primer pairs (numbers denote the position of the primer inrelation to the start codon, set as position +1; all forward primershave CACC added in the 5¢ end, in order to allow directionalrecombination of the PCR product into the pENTR D-TOPO-vectorusing the Gateway� system). Promoter AtPIP1;4, forward,CACC)1659GGCAACGAAGCATGTGAGAT)1639; promoter AtPIP1;4,reverse,)1CAAAAGAGGGAGAGGGAGAGAA)22;promoterAtPIP2;5,forward, CACC)1692TTTTGGTGCTGACGAGAGTG)1672; promoterAtPIP2;5, reverse )1AAGTTTGGTGAAGAATAAGAAGACA)25; pro-moter AtPIP2;6, forward, CACC)1622ATGGTCGTCGCTCGATTA-TT)1602; promoter AtPIP2;6, reverse, )1CGTGAAGGCTAAGTCTGAAAGA)22.

In the following step, the promoter regions were recombined intothe pKGWFS7 destination vector, which contains the uid genecoding for GUS (Plant Systems Biology, http://www.psb.ugent.be),using the LR recombination mix (Invitrogen, http://www.invitro-gen.com/).

The constructs were transformed into competent Agrobacteriumtumefaciens GV3101, and were introduced into Arabidopsis Col-0by floral dip as described previously (Clough and Bent, 1998). The400-ml cultures of A. tumefaciens containing the promoter-GUSconstructs were grown overnight at 28�C. The bacteria were pelletedand resuspended in 400 ml 5% sucrose containing 200 ll of thedetergent Silwet L-77 (Lehle Seeds, http://www.arabidopsis.com).Bolting Arabidopsis plants were dipped into the bacterial suspen-sion for 3 min, followed by coverage with plastic foil for 2 days. Thedipping procedure was repeated after 1 week to increase thetransformation frequency. Seeds were germinated on agar plateswith kanamycin (half-strength MS + MS vitamins, 50 lg ml)1 kana-mycin) to select for transformed plants. The surviving plants werethen transplanted to soil.

GUS staining

The GUS expression patterns were visualized by dispensing theplant tissue to substrate solution [1 mM X-gluc, 100 mM potassiumphosphate buffer, pH 7.0, 10 mM EDTA, pH 8.0, 1 mM potassiumferricyanide, 0.1% (v/v) Triton X-100] and incubating at 37�C over-night. The plant tissues were then kept in 95% ethanol at 4–8�C. Plantstransformed by GUS constructs were grown on agar plates withoutkanamycin (half-strength MS + MS vitamins) for 2 weeks before theGUS expression pattern was visualized in intact seedlings. Flowers,leaves and siliques (containing seeds) for GUS staining were takenfrom plants grown for 6–10 weeks. Twenty of the 30 promoter

AtPIP1;4 GUS lines examined showed GUS expression. The corre-sponding numbers for the lines transformed with the AtPIP2;5 andAtPIP2;6 promoter-GUS constructs were eight of 11 and 12 of 28,respectively. All plants studied were either T2 or T3 generations. Nopropagation of homozygous lines was performed.

Database search and PCA analysis

Principal component analysis stands for a spectral decompositionof a given data covariance or correlation matrix, consisting ofmeasurements of variables for a set of given samples. It finds un-correlated directions (the PCs) in variable space ordered by thevariance that the samples have in the corresponding direction.Thus, for example, the first principal component is the direction invariable space in which the samples have the highest variance. PCAwas introduced by K. Pearson (1901), and is now widely used inexploratory data analysis. In this work an uncentered version of PCAwas used. This makes it possible to visualize and estimate both theintervariability in the dataset as well as the overall behavior. ThePCA of variation of leaf water content and PIP gene expression wascalculated from expression ratios (drought/control), and was visu-alized by QLUCORE OMICS EXPLORER (Qlucore Omics Explorer 2009;Qlucore, http://www.qlucore.com). Analysis of the co-variation ofPIP and TIP transcripts was carried out with ACT (http://www.arabidopsis.leeds.ac.uk/act/; Jen et al., 2006), ATTED-II (http://atted.jp/; Obayashi et al., 2004) and csb.db (http://csbdb.mpimp-golm.mpg.de/; Rautengarten et al., 2005). ATTED-II expression datacomprised 58 different experimental conditions from a total of 1388Affymetrix (ATH1) arrays, and ACT expression data consisted of 322Affymetrix (ATH1) arrays covering various stress treatments anddevelopmental stages. Data was retrieved in August 2006 (ATTED-IIand csb.db) and February 2009 (ACT).

ACKNOWLEDGEMENTS

We would like to thank Adine Karlsson for help with maintainingand growing the plants. Funding by the Swedish Research Council,Formas, Carl Tryggers Stiftelse for Vetenskaplig Forskning and theResearch School of Pharmaceutical Sciences (FLAK) is gratefullyacknowledged.

SUPPORTING INFORMATION

The following Supporting Information is available for this articleonline:Figure S1. Ratios (log2) of mRNA levels of drought-stressed andcontrol plants for the 13 plasma membrane intrinsic protein (PIP)transcripts in five different accessions of Arabidopsis.Figure S2. Co-correlation scatter plots generated by ACT of PIPs andTIPs with Pearson’s correlation coefficients higher than or equal to0.6 in the ATTED analysis.Figure S3. Expression patterns with and without drought stress ofrepresentative lines carrying the 1.6-kb promoter::GUS constructsof AtPIP1;4 (A, B) and AtPIP2;5 (C, D).Table S1 Primers used for qPCR.Table S2 Level of plasma membrane intrinsic protein (PIP) expres-sion in comparison with actin2 in Col-0, Ler-0, Lip-0, Edi-0 and Kas-1.Table S3 The genes most highly co-expressed with the non-drought-inhibited major intrinsic proteins (MIPs; AtPIP1;4, AtPIP2;5and AtPIP2;6), according to data retrieved from ATTED-II.Please note: As a service to our authors and readers, this journalprovides supporting information supplied by the authors. Suchmaterials are peer-reviewed and may be re-organized for onlinedelivery, but are not copy-edited or typeset. Technical supportissues arising from supporting information (other than missingfiles) should be addressed to the authors.

658 Erik Alexandersson et al.

ª 2010 The AuthorsJournal compilation ª 2010 Blackwell Publishing Ltd, The Plant Journal, (2010), 61, 650–660

REFERENCES

Aharon, R., Shahak, Y., Wininger, S., Bendov, R., Kapulnik, Y. and Galili, G.

(2003) Overexpression of a plasma membrane aquaporin in transgenic

tobacco improves plant vigor under favorable growth conditions but not

under drought or salt stress. Plant Cell, 15, 439–447.

Alexandersson, E., Fraysse, L., Sjovall-Larsen, S., Gustavsson, S., Fellert, M.,

Karlsson, M., Johanson, U. and Kjellbom, P. (2005) Whole gene family

expression and drought stress regulation of aquaporins. Plant Mol. Biol.,

59, 469–484.

Biela, A., Grote, K., Otto, B., Hoth, S., Hedrich, R. and Kaldenhoff, R. (1999) The

Nicotiana tabacum plasma membrane aquaporin NtAQP1 is mercury-

insensitive and permeable for glycerol. Plant J., 18, 565–570.

Bienert, G.P., Moller, A.L., Kristiansen, K.A., Schulz, A., Moller, I.M., Schjo-

erring, J.K. and Jahn, T.P. (2007) Specific aquaporins facilitate the diffusion

of hydrogen peroxide across membranes. J. Biol. Chem., 282, 1183–1192.

Chaumont, F., Barrieu, F., Jung, R. and Chrispeels, M.J. (2000) Plasma

membrane intrinsic proteins from maize cluster in two sequence sub-

groups with differential aquaporin activity. Plant Physiol., 122, 1025–1034.

Chaumont, F., Barrieu, F., Wojcik, E., Chrispeels, M.J. and Jung, R. (2001)

Aquaporins constitute a large and highly divergent protein family in maize.

Plant Physiol., 125, 1206–1215.

Chen, W.J., Chang, S.H., Hudson, M.E., Kwan, W.K., Li, J., Estes, B., Knoll, D.,

Shi, L. and Zhu, T. (2005) Contribution of transcriptional regulation to

natural variations in Arabidopsis. Genome Biol., 6, R32.

Clough, S.J. and Bent, A.F. (1998) Floral dip: a simplified method for Agro-

bacterium-mediated transformation of Arabidopsis thaliana. Plant J., 16,

735–743.

Czechowski, T., Stitt, M., Altmann, T., Udvardi, M.K. and Scheible, W.R.

(2005) Genome-wide identification and testing of superior reference genes

for transcript normalization in Arabidopsis. Plant Physiol., 139, 5–17.

Daniels, M.J., Mirkov, T.E. and Chrispeels, M.J. (1994) The plasma membrane

of Arabidopsis thaliana contains a mercury-insensitive aquaporin that is a

homolog of the tonoplast water channel protein TIP. Plant Physiol., 106,

1325–1333.

Danielson, J.A. and Johanson, U. (2008) Unexpected complexity of the aqu-

aporin gene family in the moss Physcomitrella patens. BMC Plant Biol. 8,

45.

Dordas, C., Chrispeels, M.J. and Brown, P.H. (2000) Permeability and channel-

mediated transport of boric acid across membrane vesicles isolated from

squash roots. Plant Physiol., 124, 1349–1362.

Fetter, K., Van Wilder, V., Moshelion, M. and Chaumont, F. (2004) Interactions

between plasma membrane aquaporins modulate their water channel

activity. Plant Cell, 16, 215–228.

Fraysse, L.C., Wells, B., McCann, M.C. and Kjellbom, P. (2005) Specific plasma

membrane aquaporins of the PIP1 subfamily are expressed in sieve ele-

ments and guard cells. Biol. Cell, 97, 519–534.

Gaspar, M., Bousser, A., Sissoeff, I., Roche, O., Hoarau, J. and Mahe, A. (2003)

Cloning and characterization of ZmPIP1-5b, an aquaporin transporting

water and urea. Plant Sci. 165, 21–31.

Gerbeau, P., Guclu, J., Ripoche, P. and Maurel, C. (1999) Aquaporin Nt-TIPa

can account for the high permeability of tobacco cell vacuolar membrane to

small neutral solutes. Plant J., 18, 577–587.

Guerrero, F.D. and Crossland, L. (1993) Tissue-specific expression of a plant

turgor-responsive gene with amino acid sequence homology to transport-

facilitating proteins. Plant Mol. Biol., 21, 929–935.

Guerrero, F.D., Jones, J.T. and Mullet, J.E. (1990) Turgor-responsive gene

transcription and RNA levels increase rapidly when pea shoots are wilted.

Sequence and expression of three inducible genes. Plant Mol. Biol., 15,

11–26.

Guo, L., Wang, Z.Y., Lin, H., Cui, W.E., Chen, J., Liu, M., Chen, Z.L., Qu, L.J. and

Gu, H. (2006) Expression and functional analysis of the rice plasma-mem-

brane intrinsic protein gene family. Cell Res., 16, 277–286.

Henry, Y., Bedhomme, M. and Blanc, G. (2006) History, protohistory and

prehistory of the Arabidopsis thaliana chromosome complement. Trends

Plant Sci., 11, 267–273.

Jahn, T.P., Moller, A.L., Zeuthen, T., Holm, L.M., Klaerke, D.A., Mohsin, B.,

Kuhlbrandt, W. and Schjoerring, J.K. (2004) Aquaporin homologues in

plants and mammals transport ammonia. FEBS Lett., 574, 31–36.

Jang, J.Y., Kim, D.G., Kim, Y.O., Kim, J.S. and Kang, H. (2004) An expression

analysis of a gene family encoding plasma membrane aquaporins in

response to abiotic stresses in Arabidopsis thaliana. Plant Mol. Biol., 54,

713–725.

Jen, C.H., Manfield, I.W., Michalopoulos, I., Pinney, J.W., Willats, W.G.,

Gilmartin, P.M. and Westhead, D.R. (2006) The Arabidopsis co-expression

tool (ACT): a WWW-based tool and database for microarray-based gene

expression analysis. Plant J., 46, 336–348.

Johanson, U., Karlsson, M., Johansson, I., Gustavsson, S., Sjovall, S.,

Fraysse, L., Weig, A.R. and Kjellbom, P. (2001) The complete set of genes

encoding major intrinsic proteins in Arabidopsis provides a framework for

a new nomenclature for major intrinsic proteins in plants. Plant Physiol.,

126, 1358–1369.

Johansson, I., Karlsson, M., Shukla, V.K., Chrispeels, M.J., Larsson, C. and

Kjellbom, P. (1998) Water transport activity of the plasma membrane

aquaporin PM28A is regulated by phosphorylation. Plant Cell, 10, 451–459.

Kaldenhoff, R., Grote, K., Zhu, J.J. and Zimmermann, U. (1998) Significance of

plasmalemma aquaporins for water-transport in Arabidopsis thaliana.

Plant J., 14, 121–128.

Kammerloher, W., Fischer, U., Piechottka, G.P. and Schaffner, A.R. (1994)

Water channels in the plant plasma membrane cloned by immunoselection

from a mammalian expression system. Plant J., 6, 187–199.

Katsuhara, M., Koshio, K., Shibasaka, M., Hayashi, Y., Hayakawa, T. and

Kasamo, K. (2003) Over-expression of a barley aquaporin increased the

shoot/root ratio and raised salt sensitivity in transgenic rice plants. Plant

Cell Physiol., 44, 1378–1383.

Kim, J.H. and Kende, H. (2004) A transcriptional coactivator, AtGIF1, is

involved in regulating leaf growth and morphology in Arabidopsis. Proc.

Natl. Acad. Sci. USA, 101, 13374–13379.

Klebl, F., Wolf, M. and Sauer, N. (2003) A defect in the yeast plasma membrane

urea transporter Dur3p is complemented by CpNIP1, a Nod26-like protein

from zucchini (Cucurbita pepo L.), and by Arabidopsis thaliana delta-TIP or

gamma-TIP. FEBS Lett., 547, 69–74.

Kliebenstein, D.J., West, M.A., van Leeuwen, H., Kim, K., Doerge, R.W.,

Michelmore, R.W. and St Clair, D.A. (2006) Genomic survey of gene

expression diversity in Arabidopsis thaliana. Genetics, 172, 1179–1189.

Lian, H.L., Yu, X., Ye, Q., Ding, X., Kitagawa, Y., Kwak, S.S., Su, W.A. and

Tang, Z.C. (2004) The role of aquaporin RWC3 in drought avoidance in rice.

Plant Cell Physiol., 45, 481–489.

Lian, H.L., Yu, X., Lane, D., Sun, W.N., Tang, Z.C. and Su, W.A. (2006) Upland

rice and lowland rice exhibited different PIP expression under water deficit

and ABA treatment. Cell Res., 16, 651–660.

Liu, L.H., Ludewig, U., Gassert, B., Frommer, W.B. and von Wiren, N. (2003)

Urea transport by nitrogen-regulated tonoplast intrinsic proteins in

Arabidopsis. Plant Physiol., 133, 1220–1228.

Loque, D., Ludewig, U., Yuan, L. and von Wiren, N. (2005) Tonoplast intrinsic

proteins AtTIP2;1 and AtTIP2;3 facilitate NH3 transport into the vacuole.

Plant Physiol., 137, 671–680.

Martre, P., Morillon, R., Barrieu, F., North, G.B., Nobel, P.S. and Chrispeels,

M.J. (2002) Plasma membrane aquaporins play a significant role during

recovery from water deficit. Plant Physiol., 130, 2101–2110.

Maurel, C., Reizer, J., Schroeder, J.I. and Chrispeels, M.J. (1993) The vacuolar

membrane protein gamma-TIP creates water specific channels in Xenopus

oocytes. EMBO J., 12, 2241–2247.

Maurel, C., Javot, H., Lauvergeat, V., Gerbeau, P., Tournaire, C., Santoni, V.

and Heyes, J. (2002) Molecular physiology of aquaporins in plants. Int. Rev.

Cytol., 215, 105–148.

Moshelion, M., Becker, D., Biela, A., Uehlein, N., Hedrich, R., Otto, B., Levi, H.,

Moran, N. and Kaldenhoff, R. (2002) Plasma membrane aquaporins in the

motor cells of Samanea saman: diurnal and circadian regulation. Plant Cell,

14, 727–739.

Murashige, T. and Skoog, F. (1962) A Revised Medium for Rapid Growth and

Bio Assays with Tobacco Tissue Cultures. Physiol. Plant. 15, 473-&.

Newman, K.L., Fernandez, A.G. and Barton, M.K. (2002) Regulation of axis

determinacy by the Arabidopsis PINHEAD gene. Plant Cell, 14, 3029–3042.

Nienhuis, J., Sills, G.R., Martin, B. and King, G. (1994) Variance for water-use

efficiency among ecotypes and recombinant inbred lines of Arabidopsis

thaliana. Am. J. Bot., 81, 943–947.

Obayashi, T., Okegawa, T., Sasaki-Sekimoto, Y. et al. (2004) Distinctive fea-

tures of plant organs characterized by global analysis of gene expression in

Arabidopsis. DNA Res., 11, 11–25.

Pearson, K. (1901) On Lines and Planes of Closest Fit to Systems of Points in

Space. Phil. Mag. 2, 559–572.

Conserved drought regulation of aquaporin genes 659

ª 2010 The AuthorsJournal compilation ª 2010 Blackwell Publishing Ltd, The Plant Journal, (2010), 61, 650–660

Rautengarten, C., Steinhauser, D., Bussis, D., Stintzi, A., Schaller, A., Kopka,

J. and Altmann, T. (2005) Inferring hypotheses on functional relationships

of genes: analysis of the Arabidopsis thaliana subtilase gene family. PLoS

Comput. Biol. 1, e40.

Sakurai, J., Ishikawa, F., Yamaguchi, T., Uemura, M. and Maeshima, M. (2005)

Identification of 33 rice aquaporin genes and analysis of their expression

and function. Plant Cell Physiol., 46, 1568–1577.

Schmid, M., Davison, T.S., Henz, S.R., Pape, U.J., Demar, M., Vingron, M.,

Scholkopf, B., Weigel, D. and Lohmann, J.U. (2005) A gene expression map

of Arabidopsis thaliana development. Nat. Genet., 37, 501–506.

Schmitz, G. and Theres, K. (2005) Shoot and inflorescence branching. Curr.

Opin. Plant Biol., 8, 506–511.

Siefritz, F., Tyree, M.T., Lovisolo, C., Schubert, A. and Kaldenhoff, R. (2002)

PIP1 plasma membrane aquaporins in tobacco: from cellular effects to

function in plants. Plant Cell, 14, 869–876.

Uehlein, N., Lovisolo, C., Siefritz, F. and Kaldenhoff, R. (2003) The tobacco

aquaporin NtAQP1 is a membrane CO2 pore with physiological functions.

Nature, 425, 734–737.

Uehlein, N., Otto, B., Hanson, D.T., Fischer, M., McDowell, N. and Kaldenhoff,

R. (2008) Function of Nicotiana tabacum aquaporins as chloroplast gas

pores challenges the concept of membrane CO2 permeability. Plant Cell,

20, 648–657.

Vandeleur, R.K., Mayo, G., Shelden, M.C., Gilliham, M., Kaiser, B.N. and

Tyerman, S.D. (2009) The role of plasma membrane intrinsic protein

aquaporins in water transport through roots: diurnal and drought stress

responses reveal different strategies between isohydric and anisohydric

cultivars of grapevine. Plant Physiol., 149, 445–460.

Vuylsteke, M., van Eeuwijk, F., Van Hummelen, P., Kuiper, M. and Zabeau, M.

(2005) Genetic analysis of variation in gene expression in Arabidopsis

thaliana. Genetics, 171, 1267–1275.

Weig, A., Deswarte, C. and Chrispeels, M.J. (1997) The major intrinsic pro-

tein family of Arabidopsis has 23 members that form three distinct

groups with functional aquaporins in each group. Plant Physiol., 114, 1347–

1357.

Yamada, S., Katsuhara, M., Kelly, W.B., Michalowski, C.B. and Bohnert, H.J.

(1995) A family of transcripts encoding water channel proteins: tissue-

specific expression in the common ice plant. Plant Cell, 7, 1129–1142.

Zelazny, E., Borst, J.W., Muylaert, M., Batoko, H., Hemminga, M.A. and

Chaumont, F. (2007) FRET imaging in living maize cells reveals that plasma

membrane aquaporins interact to regulate their subcellular localization.

Proc. Natl. Acad. Sci. USA, 104, 12359–12364.

Zimmermann, P., Hirsch-Hoffmann, M., Hennig, L. and Gruissem, W. (2004)

GENEVESTIGATOR. Arabidopsis microarray database and analysis tool-

box. Plant Physiol., 136, 2621–2632.

660 Erik Alexandersson et al.

ª 2010 The AuthorsJournal compilation ª 2010 Blackwell Publishing Ltd, The Plant Journal, (2010), 61, 650–660