The origin of Indian Star tortoises (Geochelone elegans) based on nuclear

and mitochondrial DNA analysis: A story of rescue and repatriation

A. Gaur, A. Reddy, S. Annapoorni, B. Satyarebala & S. Shivaji*Centre for Cellular and Molecular Biology, Uppal Road, Hyderabad, 500 007, India(*Corresponding author: phone: +91-40-27192504; fax: +91-40-27160591; e-mail: shivas@ccmb.res.in)

Received 24 February 2005; accepted 27 June 2005

Key words: Geochelone elegans, Indian Star tortoise, microsatellites, mtDNA, repatriation

Abstract

The Indian Star tortoise (Geochelone elegans) belongs to the family Testunidae and is distributed insouthwest India and Sri Lanka. In addition to facing loss of its natural habitat, the species is also illegallytraded as food and as an exotic pet internationally. Here we report DNA-based analyses for identificationand repatriation of these tortoises into their natural habitat. We have attempted to establish the geo-graphical origin of these tortoises rescued from smugglers, by comparing the microsatellite and mito-chondrial markers of rescued animals with animals of known provenance. Star tortoises exhibited stronggenetic structure in India. The populations from western India were genetically distinct at microsatellite andmitochondrial loci from southern populations. The rescued individuals had similar multilocus genotypesand mitochondrial DNA haplotypes as the reference individuals from south India. However, the precisegeographic origin of many of the rescued samples remains unresolved, because we could not assign them tosouthern populations and the Neighbor-Joining cluster analysis indicated that some of rescued tortoisesformed distinct clusters. These data strongly suggest that the rescued group of tortoises is composed of amix of individuals from differentiated source populations that are probably located in southern India andpossibly Sri Lanka. Our study provides valuable information based on molecular markers for the assess-ment of genetic diversity in Indian Star tortoises.

Introduction

Among the 42 extant tortoise species, many are nowat risk due to commercial exploitation. Geocheloneis the largest genus of tortoises, with 21 recognizedliving species (Iverson 1992). However, very little isknown about the status of the majority of the spe-cies in the wild and it is impossible to quantify theeffect of the tortoise trade in Asia (van Dijk et al.2000). Furthermore, considering the low repro-ductive rate of most tortoise and turtle species(Congdon et al. 1993), there is little doubt that thisexploitation is unsustainable, and may lead toextinction of the affected species from the wildwithin a short time span.

The Indian Star tortoise (Geochelone elegans)belongs to the family Testunidae and is distributedin the dry regions of south-eastern and southernIndia, north-western India, northern and eastern SriLanka and extreme eastern Pakistan (Daniel 1983;Iverson 1992; Das 2002). It is primarily found inscrub forests, grasslands and coastal scrublands ofarid and semi-arid regions (Daniel 1983; Das 2002).Aggressive use of forests and other natural re-sources together with the increasing demand foragricultural land to satisfy the basic needs of theever-increasing population has led to the destruc-tion of suitable habitat for the Star tortoise. Inaddition, this species is subject to heavy exploitationby humans as a food delicacy as well as an exotic pet

Conservation Genetics (2005) � Springer 2005DOI 10.1007/s10592-005-9002-z

in the USA, Europe, Middle and Southeast Asiancountries (van Dijk et al. 2000). A conservativeestimate of the yearly toll on the Indian populationis 10,000–20,000 animals taken from the wild(Sekhar et al. 2004). The species has been placed onAppendix II of the Convention on InternationalTrade in Endangered Species (CITES), and it is alsoprotected under the Indian Wildlife Act of 1972,where it has been placed under Schedule IV,makingit illegal both to possess and trade Star tortoisesinside India. These animals are still being smuggledout of India and Sri Lanka and sometimes customsor airport authorities impound such smuggledconsignments. Ideally these rescued tortoises shouldbe repatriated to their populations of origin both toavoid mixing genetically distinct populations andpotential outbreeding depression and to increase thelikelihood of successful reestablishment (Storfer1999; Tallmon et al. 2004).

In India, there are two major races of the Startortoises – the southern type inhabiting AndhraPradesh, Tamil Nadu, Karnataka and Kerala; andthe western type inhabiting Gujarat andRajasthan. Although morphological differentia-tion in overall size, limb dimension and carapaceshape is substantial in the southern and the wes-tern types, it is difficult to assign individuals ofunknown origin unambiguously on the basis ofmorphology alone. Molecular genetics provides apowerful tool for resolving the origin of unknownindividuals (Baker et al. 2000; Roman and Bowen2000, Shivji et al. 2002). Establishing the origin ofunknown individuals has immediate conse-quence(s) for small population(s), particularlywhen addition of individuals of appropriate originis crucial for successful breeding, rehabilitationand reintroduction programmes (Burns et al.2003). The present study has been undertaken withtwo objectives: to study genetic variation in IndianStar tortoises and to develop DNA-based methodsfor the identification and subsequent repatriationof rescued Star tortoises to their original geo-graphical locations in the wild.

Materials and methods

Sample collection and DNA isolation

Blood samples were collected from 92 IndianStar tortoises seized by the Singapore airport

authorities and housed in the Nehru ZoologicalPark, Hyderabad. In addition, 59 samples werecollected from different locations in southern andwestern India to use as controls (Figure 1, Table 1).Blood samples were collected from the branchialvein of the forelegs. A small (<1 cm2) skin biopsywas obtained from the shoulder region of a fewanimals. Both were preserved in buffer containing0.1 M Tris-HCl, 0.1 M EDTA, 0.2 M NaCl and1% SDS, pH 8.0, and subsequently stored at 4 �C.Total genomic DNA was isolated from the abovesamples using the standard proteinase K/phe-nol:chloroform protocol of Sambrook et al. (1989),dissolved in TE (10 mMTris-HCl, 1.0 mMEDTA,pH 8.0) buffer and stored at )20 �C until use.

Microsatellites analysis

Five nuclear dinucleotide microsatellite locideveloped for Geochelone nigra (Cioffi et al. 2002)were used for the genotyping of the individuals. Inaddition, a pair of primers was designed for a locus(G1) using a known sequence of G. nigra from theGenbank (Accession No. AF239973). Primersequences, annealing temperature, the number ofalleles and allele size are given in Table 2. Poly-merase chain reaction was performed in a 10 llreaction containing 1� PCR buffer (Perkin-Elmer,USA), 1 unit of Amplitaq� Gold (Perkin-Elmer,USA), 2.5 mM MgCl2, 0.2 mM of eachdNTP, 0.5 lM of forward primer, and 0.5 lM offluorescence labeled reverse primer. Amplificationswere performed in a thermocycler (MJ Research,USA) with the following amplification conditions;an initial denaturation cycle of 94 �C for 10 minfollowed by 30–35 cycles of denaturation at 94 �Cfor 30 s, annealing at 50–62 �C for 30 s andextension at 72 �C for 45 s, followed by a finalextension at 72 �C for 5 min. Standard precau-tions including the use of negative controls weretaken to avoid contamination. PCR ampliconswere analysed in ABI 377 automated DNAsequencer (Applied Biosystems, USA). The allelesize was determined using GENESCANTM andGENOTYPERTM software (Applied Biosystems,USA).

Genetic diversity was estimated separately asthe total number of alleles at each locus, averagenumber of alleles per locus, size range of thealleles, allelic richness (number of alleles per

locus corrected for sample size), observed het-erozygosity (Ho) and expected heterozygosity(HE) at each locus using ARLEQUIN 2.0

(Schneider et al. 2000) and FSTAT 2.9.3.2(Goudet 2002). The unbiased expected heterozy-gosity at each locus in every population was

Table 1. Details of the Indian Star tortoise (G. elegans) samples collected from various locations in India

Region Location Number (n)

Western Junagarh, Gujarat (J) 11

Vadodra, Gujarat (V) 12

Surat Park (SP), Surat, Gujarat 05

Surat Pakshi Ghar (SPG), Surat 06

Southern Sri Venkateshwara National Park,

Tirupathi, Andhra Pradesh (T)

11

Punganoor, Chittoor, Andhra Pradesh (C) 10

Bannarghatta National Park, Bangalore, Karnataka (K) 04

Rescued Changi Airport, Singapore (R) 92

Figure 1. A map of India and the neighboring countries showing the current location (shaded block in the inset) of the Star tortoisesand sampling localities. J – Junagarh, SP – Surat Park, SPG – Surat Pakshi Ghar and V – Vadodra, are samples from west India; T &ST – Tirupati, C – Chittoor and K – Bannarghatta National Park, Karnataka, are samples from south India.

estimated as HE=2n(1) Rp2)/(2n)1), where p isthe frequency of each of the alleles at a locusand n is the number of individuals sampled (Nei1987). Tests for significance of deviation fromHardy–Weinberg Equilibrium (HWE) for eachlocus in each population and tests for genotypiclinkage disequilibrium for each pair of loci inthree populations were done using the Markovchain method (1000 iterations, Guo andThompson 1992) available in GENEPOP 3.4(Raymond and Rousset 2003). Departures fromHWE were tested using both alternativehypotheses of deficit and excess of heterozygotesfor each locus and globally across loci andpopulations (Fisher’s method).

To assess the extent of differentiation amongpopulations an analysis of molecular variance(AMOVA), was used to estimate FST values,whose statistical significance was tested using10,000 permutations as implemented in ARLE-QUIN 2.0. Genetic distances between all pairs ofindividuals (Dxy) were calculated as 1 ) Pxy, wherePxy is the proportion of shared alleles (Bowcocket al. 1994). The individual pairwise distances werecalculated using MICROSAT 1.5d (Minch 1997).These distances were used to construct anunrooted Neighbor-Joining dendrogram in PHY-LIP 3.5 (Felsenstein 1993).

Assignment of individuals to specific popula-tions was tested with GENECLASS 2.0 (Cournetet al. 1999; Piry et al. 2004), using a likelihood-based method of classification, which assigns an

individual to the population, in which the indi-vidual’s genotype is most likely to occur. As rec-ommended by Cournet et al. (1999) the Bayesianapproach of Rannala and Mountain (1997) waschosen. The assignment of rescued individuals toeither of the known populations was furtherchecked by calculating the probabilities that eachrescued individual belongs to the southern orwestern population based on the Monte-Carloresampling method of Paetkau et al. 2004, asimplemented in GENECLASS 2.0 (Piry et al.2004). The threshold probability to exclude theindividual’s assignment was set to 0. 01.

Mitochondrial DNA analysis

The cytochrome b (cyt b) and the mitochondrialDNA (mtDNA) control region of various groupsof the Indian Star tortoise (G. elegans) weresequenced. To amplify the cyt b region, a pair ofprimers was designed using the known sequencefrom G. pardalis (Shaffer et al. 1997, AccessionNo. U81353). Additionally, the control region(�417 bp) was also amplified and sequenced usingthe primers designed from sequence of G. nigra(Caccone et al. 2002, Accession No. AY098119).Primer sequences and annealing temperature aregiven in Table 2. The PCR conditions were thesame as for the microsatellite loci, except thatannealing was for 1 min and cyclic extension wasfor 2 min. Amplicons were directly sequencedusing Big dye Terminator and ABI 3700 (Applied

Table 2. Characteristics of microsatellite and mitochondrial DNA markers used to study genetic diversity in Indian Star tortoises(G. elegans).

Locus Forward Primer (5¢–3¢) Reverse Primer (5¢–3¢) Tm (�C) Number

of

Alleles

Allelic

Range

(bp)

G50* TGGGACAGGCAAACTAACAAAACTT TGCAGAAGTTAATCCCTTTCTCCTT 62 22 83–151

G73* ATTATGTGCTTGTGTCATCTTTTTC TTGAAGATACTCATCCTCGATACA 57 4 64–90

G75* GAAGCCATTTACCACAAACTTATT GTTACCATAGCATTCCTGATTATAG 56 5 62–70

G127* TAACTATAAACATCAACTGGCAGAA GTTTAGTGTCATCTGCATATGC 56 5 86–94

G263* GGGAAAGTACTATTTCCAGAGCTGG GCTGAGGCTAGCTAATTTTTATGT 56 5 87–95

G1 # GAACGATATGGGCGTCAAAT TCTGGCATTTCCTAGCTCTTG 53 25 190–246

Cyt b TGCCTGATGAAACTTCGGAT AATAGGGCAAGTACGCCTCC 53 – –

CR AGCACCGGTCTTGTAAACCA ACAAAACAACCAAAGGCCAG 54 – –

*Cioffi et al. 2002.#Accession No. AF239973.Cyt b is Cytochrome b.CR is Control Region.

Biosystems, USA) genetic analyser. To promoteaccuracy, both strands were sequenced.

MtDNA sequences were initially edited andaligned using Autoassembler software (AppliedBiosystem, USA). The edited sequences werealigned using CLUSTALX (Thompson et al.1997), visually checked and submitted in Genbank(Accession No. AY776251–AY776274). Initialsequence comparison, measures of variability andphylogenetic relationships among the haplotypesfrom different groups were examined usingNeighbor-Joining analysis based on Kimura two-parameter (Kimura 1980) distance with gammacorrection, as implemented in MEGA 2.1 (Kumaret al. 2001). The cyt b sequences of differentGeochelone species, including all haplotypes of G.elegans were also compared using the parsimonymethod in PAUP* 4.0 (Swofford 2001). ForMaximum Parsimony (MP) analysis, heuristicsearches were performed with tree bisectionreconnection (TBR) branch swapping, 1000 repli-cates, stepwise addition starting tree and randomsequence addition option. Gopherus was used asthe outgroup. Measures of population geneticsparameters such as gene diversity i.e. the proba-bility that two randomly chosen mtDNA se-quences are different in the sample and nucleotidediversity (p per nucleotide site i.e. the probabilitythat randomly chosen homologous nucleotides aredifferent in the sample (Nei 1987)) were estimatedfrom the mtDNA dataset using ARLEQUIN 2.0(Schneider et al. 2000). To assess the extent of

differentiation among populations an analysis ofmolecular variance (AMOVA), was used to esti-mate FST values, whose statistical significance wastested using 10,000 permutations as implementedin ARLEQUIN 2.0.

Results

In the present study, we have analysed a total of151 Star tortoises using six microsatellites and twovariable motifs of mitochondrial DNA. Genotyp-ing of 34 western, 25 southern and 92 rescuedsamples using 6 STR loci revealed that all loci werepolymorphic with 3 or more alleles (Table 3).Relatively high numbers of alleles were detectedfor the loci G50 and G1, with as many as 24 allelesobserved in the rescued population. In the rescuedsamples, five to six loci had a significant deficit ofheterozygotes (Table 3). These deficits were prob-ably not indicative of the presence of null allelesfor four of these loci (G50, G73, G75 and G127),since neither the western or southern populationsexhibited significant heterozygote deficits at theseloci. Null alleles may be responsible for the het-erozygote deficit at locus G1 since there was aconsistent deficit in all three populations. Tests forgenotypic linkage disequilibrium within eachpopulation revealed only five pairs of loci (G75 XG50, G75 X G127, G73 X G263, G73 X G1 andG263 X G1) that were significantly (P<0.05) out

Table 3. Measures of genetic diversity based on microsatellite analyses in Indian Star tortoises (G. elegans).

Locus Population

Western (n=34) Southern (n=25) Rescued (n=92)

K RA AR Ho He K RA AR Ho He K RA AR Ho He

G1 12 190–246 10.80 0.470 0.839* 10 190–246 10.00 0.440 0.764 24 190–246 18.56 0.521 0.939*

G50 11 105–151 10.63 0.529 0.889 7 83–107 7.00 0.720 0.764 14 85–123 13.26 0.554 0.913*

G73 2 74–76 2.00 0.323 0.275 3 74–90 3.00 0.560 0.502 3 64–76 2.82 0.076 0.154

G75 3 62–66 2.99 0.676 0.498 3 64–68 3.00 0.680 0.500 5 62–70 3.74 0.445 0.628*

G127 2 88–90 2.00 0.617 0.473 3 86–94 3.00 0.760 0.555 4 88–94 3.99 0.260 0.671*

G263 3 89–93 2.99 0.823 0.562* 3 89–93 3.00 0.920 0.632* 5 87–95 3.52 0.826 0.571*

Mean 5.50 – 5.23 0.573 0.589 4.83 – 4.83 0.680 0.619 9.16 – 7.64 0.447 0.646

n: Number of individuals of different species.K: Number of alleles per locus.RA: Range of alleles in bp.AR: Allelic richness.Ho and He: Observed and expected heterozygosity, respectively.*(P<0.001) depicts significant deviation from Hardy–Weinberg equilibrium.

of genotypic equilibrium, and all of these werewithin the rescued population.

There was significant geographical structureamong the populations at microsatellite loci. TheAMOVA revealed that 7.15% (P<0.01) of thegenetic variation was partitioned between the tworegions (western and southern); while 6.70%(P<0.01) was partitioned among the subgroupswithin regions and 86.15% (P<0.01) occurredwithin populations.

A STR based Neighbor-Joining tree revealedthat all the western samples clustered together witha high bootstrap value (>85%). While many ofthe rescued samples clustered with the southernsamples, some rescued individuals also formeddistinct clusters that were separate from bothwestern and southern samples (Figure 2). Theassignment test assigned most individuals (56 of59) sampled in the western or southern populationto their respective populations. Thirty-nine of the92 rescued tortoises (42%) had their highestassignment score in the southern population i.e.these 39 individuals had a higher probability ofoccurring in the southern population than the setthreshold probability of 0.01. The remaining 53individuals were not assigned to either of the ref-erence populations.

Sequence analysis of cyt b (�823 bp) region in45 rescued individuals, revealed 4 haplotypes(RH1–RH4) with a nucleotide diversity of 0.001.Three transitions and a single transversion wererecorded at four polymorphic sites (Table 4a).Only 2 cyt b haplotypes were observed among the39 known-locality animals. One of these (WH1)was found in all 21 individuals from westernpopulations and the other haplotype (SH1) wasfound in all 18 individuals from southern popu-lations. The two haplotypes differed from eachother by two transitions (Table 4a).

A sequence analysis of control region (�417 bp), revealed a total of 11 haplotypes (RH1–RH11) amongst the 92 rescued samples, with 6transitions and 3 transversions. In the southernpopulation (n=25), five haplotypes (SH1–SH5)were recorded with three transitions and twotransversions (Table 4b). The nucleotide diversityin southern samples was found to be 0.012 ascompared to 0.008 in the rescued samples. Thewestern population showed only 2 haplotypes(WH1 and WH2) among 34 individuals, with asingle transition and a nucleotide diversity of

0.004. Similarly, the gene diversity in southerntypes was 0.542 while in western type and res-cued samples the gene diversities were 0.078 and0.623, respectively. The AMOVA analyses ofcontrol region also showed significant structureamong the populations. The AMOVA revealedthat 46.80% (P<0.01) of the genetic structurewas partitioned between the two known regions;while 3.68% (P<0.01) was distributed amongthe groups and 49.52% (P<0.01) occurredwithin populations.

Phylogenetic analyses of mitochondrial cyt band control region recover Geochelone as amonophyletic group with 100% bootstrap sup-port (trees not shown). Within G. elegans, hapl-otypes from rescued individuals and individualsfrom southern India consistently form a mono-phyletic group (>90% bootstrap support) to theexclusion of western haplotypes. Further thevarious cyt b haplotypes of Indian Star tortoises(G. elegans) clustered together as a single groupin the most parsimonious tree constructed usingthe sequences of other Geochelone species avail-able in the Genbank database (Figure 3). Theunweighted MP bootstrapped tree placedG. elegans as a sister taxon to G. sulcata. Allrelationships were assigned with greater than95% confidence and with a high bootstrap(83%) support.

Discussion

Genetic, ecological and demographic data areimportant for understanding population structureand crucial for implementing repatriation plans(Cioffi et al. 2002). No detailed genetic studieshave been conducted on Indian Star tortoises todate. This study was undertaken to identify thepopulation origins of Star tortoises that wereconfiscated from illegal trade and to seek infor-mation on the genetic structure of wild tortoises.Our study provides valuable information based onmolecular markers for the assessment of geneticdiversity and population structure that may help indevising conservation strategies for this endan-gered species.

All the microsatellite markers originally developed from G. nigra were polymorphic andamplified consistently in G. elegans, showing theconserved nature of the flanking regions. Similar

0.1

JF7SP3 JMC

JF6JF5JF0 SP1JF3V6JF4 V8SP2 V12

V3 V10V11V7 JF2SP4JF8 V4

V5V9 JF1

SP5 SPG6V1SPG1V2SPG3SPG5

SPG2SPG4JF95R 6R9R73R 79R

80R 78R81R 72R71R

75R77R76R74R2R 11R12R

4R7R8R10R3R57R63R 46R

21R24R64R 23R32R18R33R 14R22R62R

65R 35R59R 61R 90R50R53R52R54R

55R 38R39R36R26R27R 25RC7ST341RC9 T5

T6 T4 70R 83RST2K2 C1 47RK3

K4C5K1C2T2

T1 86R87R85R82R84R

66R67R68R69RT3C6 60RC4 ST4ST6ST5 C388R89R

91R29R43R30R44R58R92R 40R 51R 1R

13R37R 15R 17R16R 34R45R 20R49R

56R 28R48R 31R

42R19R C10 C8

WesternSouthernRescued

Figure 2. Phylogenetic relationship among the individual Star tortoises based on the composite genotype of six microsatellite loci.Neighbor-Joining unrooted dendrogram was constructed based on the distance 1 – (proportion of shared alleles) between all pair ofindividuals. J – Junagarh, SP – Surat Park, SPG – Surat Pakshi Ghar and V – Vadodra, are samples from west India; T & ST –Tirupati, C – Chittoor and K – Bannarghatta National Park, Karnataka, are samples from south India; R are rescued samples.

success with cross – species amplification havebeen found for G. gigantea (Palkovacs et al. 2003)and marine turtles (FitzSimmons et al. 1995).

Star tortoises in India exhibited strong geneticstructure. Western populations of tortoises weredistinct from the southern populations at micro-satellite loci and at the mitochondrial controlregion and the cyt b region. Previous studies on

other tortoise species such as the Masceareantortoise (Cylindraspis) reported a sufficient level ofsequence divergence to infer a pattern of coloni-zation (Austin and Arnold 2001). However, ourobservations are in contrast with the studies onDipsochelys (earlier G. gigantea), where no varia-tion was observed in mitochondrial cyt b or thecontrol region and no significant structuring wasfound at microsatellite loci (Palkovacs et al. 2002;2003). The maximum parsimony analysis of all themitochondrial genes supported the monophyly ofthe genus Geochelone and also a close relationshipof G. elegans with G. sulcata. Crumly (1982), basedon the morphological characters had placedG. elegans closer to the other species like G. radiataand G. gigantea (now Dipsochelys).

Overall, the genetic identity of rescued indi-viduals based on multilocus microsatellite geno-types corroborated the results obtained bymtDNA. Although the reference samples fromwestern and southern regions were less in number,the results clearly indicated that the rescued sam-ples shared similar alleles and showed maximumhomology with the reference samples collectedfrom the southern part of the country, while thereference samples from the western region made a

Table 4a. Alignment of Cyt b sequences of the different hapl-otypes of the three populations of Indian Star tortoises(G.elegans) used in this study

Haplotypes Nucleotides position

444444666667777777701123477899011245596186572726951837039

Rescued Wild

RH2 (04) – ATTCTCCCGCCTATCCACT

RH3 (13) – ..C.............T.C

RH4 (03) – ..C.C..............RH1 (28) SH1 (18) ..C................-- WH1 (21)..C....T....G......

Variable positions are shown in bold letters. Numbers inparentheses indicate the number of individuals sharing eachhaplotype. RH: Rescued haplotype; SH: Southern haplotype;and WH: Western haplotype.

Table 4b. Alignment of control region sequences of the different haplotypes of Indian Star tortoises (G. elegans) used in this study

Haplotypes Nucleotides

position

1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 3 3 32 3 3 4 4 2 2 2 3 3 4 4 5 5 6 6 6 7 9 9 9 3 3 3 3 3 1 1 1

1 8 2 8 0 1 0 1 7 7 8 0 1 8 9 1 5 7 5 0 3 9 0 3 4 5 8 5 6 7

Rescued Wild

RH11 (3) SH2 (2) C T T T A G G C G T G T T C G C A C T C A T A C T T A C A G– SH3 (4) . . . . . . . . . . A . . . . . . . . . . . . . . . . . . .RH9 (4) – . . . . . . . T . . . . . . . . . . . . . . . . . . . . . .RH2 (6) – . . . . . . . . . . . . . . . . . . . . . C . . . . . A . .RH6 (3) SH4 (4) . . . . . . . . . . . . . . . . . . . . . . . . C . . A . .RH10 (4) – . . . . . . . . . . . . . . . . . T . . . . . . C . . A . .RH1 (29) SH5 (9) . . . . . . . . . . . . . . . . . . . . . C . . C . . A . .RH4 (22) SH1 (6) . . . . . . . A . . . . . . . . . . . . . C . . C . . A . .RH8 (5) – . C . . . . . A . . . . . . . . . . . . . C . . C . . A . .RH5 (4) – . . . . . . . . . . . . . . . . . T . . . C . . C . . A . .RH7 (6) – . . . . . . . . . . . . . . . . . A . . . C . . C . . A . .RH3 (6) – . . . . . . . . . . . . . . A . . . . . . C . . C . . A . .– WH1 (12) . . . C . . . . . . . . . . . . . T . . . C . . C . . A . .– WH2 (22) . . . C . . . . . . . . . . . . . . . . . C . . C . . A . .

Variable positions are shown in bold letters. Numbers in parentheses indicate the number of individuals sharing each haplotype. RH:Rescued haplotype; SH: Southern haplotype; and WH: Western haplotype.

distinct cluster. Based on these observations, it wasconcluded that the rescued star tortoises probablybelonged to areas located in south India and rec-ommendations were made to release the rescuedIndian Star tortoises in the wild after identifyingsuitable sites with ample food and shelter.

However, we were unable to assign many of therescued tortoises to the southern population andthe cluster analysis indicated that some of therescued tortoises formed distinct cluster that didnot include individuals from the southern popu-lation. Within the rescued group of tortoises, thereis high genetic diversity, unique alleles and hapl-otypes not found in the western or southern sam-ples, a consistent heterozygote deficit at most loci,and the presence of genotypic linkage disequilib-rium. These data strongly suggest that the rescuedgroup of tortoises is composed of a mix of indi-viduals from differentiated source populations thatare probably located in southern India and possi-bly Sri Lanka. Therefore, increased samplingespecially from Sri Lanka, and across southernand northwest India would expand the geograph-ical scope of the study and will ensure that there isno mixing of genetically different populationswhen they are released into the wild. In conclu-sion, our studies have helped in identifying thegeographical and genetic origin of the rescued Startortoises. Further, the genotypic data generated

could serve as a reference database for Star tor-toises.

Acknowledgements

We are grateful to Dr. Lalji Singh, for his constanthelp and inspiration. We are thankful to the ChiefWildlife Warden, Andhra Pradesh and Curator,Nehru Zoological Park, Hyderabad, for permis-sion; Umapathy, Sadanand, Shivaram and Sha-keel for their help during sample collection andArunabala for her help during final analyses. Wealso wish to acknowledge Dr. K Thangaraj and thethree anonymous referees, whose comments andsuggestions helped us, improve the manuscript.We gratefully acknowledge the financial supportof Department of Biotechnology, Government ofIndia, Central Zoo Authority, Ministry of Envi-ronment and Forest, Government of India, andCouncil of Scientific and Industrial Research(CSIR), India.

References

Austin JJ, Arnold EN (2001) Ancient mitochondrial DNA and

morphology elucidate an extinct island radiation of Indian

Ocean giant tortoises (Cylindraspis). Proc. R. Soc. Lond.,

268, 2515–2523.

G. pardalis

G. radiata

G. yniphora

G. denticulata

G. carbonaria

Dipsochelys sp.

G. chilensis

G. nigra darwini

G. nigra hoodensis

G. sulcata

G. elegans South

G. elegans Rescued

G. elegans West

Gopherus

100

100

94

89

71

63

65

83

Figure 3. A maximum parsimony tree between the different haplotypes of cyt b in the three populations of Indian Star tortoises(G. elegans) and other Geochelone species. Gopherus was used as the out-group. Bootstrap values (>50% only) based on 500 replicatesare shown below each node.

Baker CS, LentoGM, Cipriano F, et al. (2000) Predicted decline of

protected whales based on molecular genetic monitoring of Jap-

anese andKoreanmarkets.Proc. R. Soc. Lond., 267, 1191–1199.

Bowcock AM, Ruiz-Linares A, Tomfohrde J, et al. (1994)

High resolution of human evolutionary trees with poly-

morphic microsatellites. Nature, 368, 455–457.

Burns CE, Ciofi C, Beheregaray LB, et al. (2003) The origin of

captive Galapagos tortoises based on DNA analysis: impli-

cation for the management of natural populations. Anim.

Conserv., 6, 329–337.

Caccone A, Gentile G, Gibbs JP, et al. (2002) Phylogeography and

history of Giant Galapagos tortoise. Evolution, 56, 2052–2066.

Ciofi C, Milinkovitch MC, Gibbs JP, et al. (2002) Microsat-

ellite analysis of genetic divergence among populations of

giant Galapagos tortoises. Mol. Ecol., 11, 2265–2283.

Congdon JD, Dunham AE, Van Loben Sels RC (1993) Delayed

sexual maturity and demographics of Blanding’s turtles

(Emydoidea blandingii): Implications for conservation and

management of long-lived organisms. Conserv. Biol., 7, 826–

833.

Cornuet JM, Piry S, Luikart G, et al. (1999) New methods

employing multilocus genotypes to select or exclude popu-

lations as origin of individuals. Genetics, 153, 1989–2000.

Crumly CR (1982) A cladistic analysis of Geochelone using

cranial osteology J. Herpetol., 16, 215–234.

Daniel JC (1983) The Book of Indian Reptiles, Bombay

Natural History Society and Oxford University Press,

Bombay, India.

Das I (2002) A Photographic Guide to Snakes and Other Reptiles

of India, New Holland Publishers, London, UK.

Felsenstein J (1993) PHYLIP (Phylogeny Inference Package)

version 3.5c, Computer programe and manual distributed by

the author, University of Washington, Seattle.

FitzSimmons NN, Moritz C, Moore SS (1995) Conservation

and dynamics of microsatellite loci over 300 million years of

marine turtle evolution. Mol. Biol. Evol., 12, 432–440.

Goudet J 2002 FSTAT, a program to estimate and test gene

diversities and fixation indices (version 2.9.3.2). – Available

from http://www.unil.ch/izea/softwares/FSTat.html.

Guo SW, Thompson EA (1992) Performing the exact test of

Hardy–Weinberg proportions for multiple alleles. Biomet-

rics, 43, 805–811.

Iverson JP (1992) A Revised Checklist with Distribution Maps

of the Turtles of the World. Privately printed, Richmond,

Indiana, USA.

Kimura M (1980) A simple method for estimating evolutionary

rates of base substitutions through comparative studies of

nucleotide sequences J. Mol. Evol., 16, 111–120.

Kumar S, Tamura K, Jakobson IB, et al. (2001) MEGA 2:

Molecular evolutionary genetics analysis Version 2.1. Bio-

informatics, 17, 1244–1245.

Minch E (1997) MICROSAT 1.4d A computer program for

calculating various statistics on microsatellite allele data,

Stanford University, Stanford.

Nei M (1987) Molecular Evolutionary Genetics, Columbia

University Press, New York, NY.

Paetkau D, Slade R, Burden M, et al. (2004) Direct, real-time

estimation of migration rate using assignment methods: A

simulation-based exploration of accuracy and power. Mol.

Ecol., 13, 55–65.

Palcovacs EP, Gerlach J, Caccone A (2002) The evolutionary

origin of Indian Ocean giant tortoise.Mol. Phylogenet. Evol.,

24, 216–227.

Palcovacs EP, Marshner M, Ciofi C, et al. (2003) Are the native

giant tortoises from the Seychelles really extinct? A genetic

perspective based on mtDNA and microsatellite data. Mol.

Ecol., 12, 1403–1413.

Piry S, Alapetite A, Cornuet JM, et al. (2004) GeneClass2: A

Software for genetic assignment and first-generation migrant

detection. J. Hered., 95, 536–539.

Rannala B, Mountain JL (1997) Detecting immigration by

using multilocus genotypes. Proc. Natl. Acad. Sci. USA, 94,

9197–9221.

Raymond M, Rousset F (2003) GENEPOP 3.4. Population

genetics software for exact tests and ecumenicism. J. Hered.,

86, 248–249.

Roman J, Bowen BW (2000) The mock turtle syndrome: Ge-

netic identification of turtle meat purchased in the south-

eastern United States of America. Anim. Conserv., 3, 61–65.

Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning:

A Laboratory Manual., 2nd edn. Cold Spring Harbor Lab-

oratory Press, New York.

Schneider S, Roessli D, Excoffier L (2000) ARLEQUIN 2.0. A

Software for Population Genetics Data Analysis, University

of Geneva, Switzerland.

Sekhar AC, Gurunathan N, Anandhan G (2004) Star tor-

toise – A victim of the exotic pet trade. Tigerpaper, 31, 4–

6.

Shaffer HB, Meylan P, McKnight ML (1997) Tests of turtle

phylogeny: Molecular, morphological, and paleontological

approaches. Syst. Biol., 46, 235–268.

Shivji M, Clarke S, Pank M, et al. (2002) Genetic identification

of pelagic shark body parts for conservation and trade

monitoring. Conserv. Biol., 16, 1036–1047.

Storfer A (1999) Gene flow and endangered species transloca-

tions: A topic revisited Biol. Conserv., 87, 173–180.

Swafford DL (2001) PAUP*: Phylogenetics analysis using par-

simony (*and other methods) Ver 4.0b., Sinauer Associates,

Sunderland, MA.

Tallmon DA, Luikart G, Waples RS (2004) The alluring sim-

plicity and complex reality of genetic rescue. Trends Ecol.

Evol., 19, 489–496.

Thompson JD, Gibson TJ, Plewniak F, et al. (1997) The

CLUSTAL_X windows interface: Flexible strategies for

multiple sequence alignment aided by quality analysis tools.

Nucl. Acids Res., 25, 4876–4882.

van Dijk PP, Stuart BL, Rhodin AGJ, ed. (2000) Asian

Turtle Trade: Proceedings of a Workshop on Conservation

and Trade of Freshwater Turtles and Tortoises in Asia,

Phnom Penh, Cambodia, 1–4 December 1999. Chelonian

Research Foundation, Chelonian Research Monographs

No. 2.