The Genotoxin Colibactin Exacerbates Lymphopenia and Decreases Survival Rate in Mice Infected With...

M A J O R A R T I C L E

The Genotoxin Colibactin ExacerbatesLymphopenia and Decreases Survival Rate inMice Infected With Septicemic Escherichia coli

Ingrid Marcq,1,2,3,4,7,a Patricia Martin,1,2,3,4 Delphine Payros,1,2,3,4 Gabriel Cuevas-Ramos,1,2,3,4 Michèle Boury,1,2,3,4

Claude Watrin,1,2,3,4 Jean-Philippe Nougayrède,1,2,3,4 Maïwenn Olier,1,2,3,4,5 and Eric Oswald1,2,3,4,6

1UMR1043, Inserm, 2USC 1360, INRA, 3UMR 5282, CNRS, 4UPS, Centre de Physiopathologie de Toulouse Purpan, UPS, Université de Toulouse, 5Neuro-gastroenterologie et Nutrition, UMR INRA/ENVT 1331, and 6Hôpital Purpan, Service de bactériologie-Hygiène, CHU Toulouse, Toulouse; and 7EA 4666 UFRde Médecine, CAP-Santé (FED 4231), Université de Picardie Jules Verne, Amiens, France

Sepsis is a life-threatening infection. Escherichia coli is the first known cause of bacteremia leading to sepsis.Lymphopenia was shown to predict bacteremia better than conventional markers of infection. The pks genomicisland, which is harbored by extraintestinal pathogenic E. coli (ExPEC) and encodes the genotoxin colibactin, isepidemiologically associated with bacteremia. To investigate a possible relationship between colibactin and lym-phopenia, we examined the effects of transient infection of lymphocytes with bacteria that were and those thatwere not producing the genotoxin. A mouse model of sepsis was used to compare the virulence of a clinicalExPEC isolate with its isogenic mutant impaired for the production of colibactin. We observed that colibactininduced double-strand breaks in the DNA of infected lymphocytes, leading to cell cycle arrest and to cell deathby apoptosis. E. coli producing colibactin induced a more profound lymphopenia in septicemic mice, comparedwith the isogenic mutant unable to produce colibactin. In a sepsis model in which the mice were treated byrehydration and antibiotics, the production of colibactin by the bacteria was associated with a significantlylower survival rate. In conclusion, we demonstrate that production of colibactin by E. coli exacerbates lympho-penia associated with septicemia and could impair the chances to survive sepsis.

Keywords. E. coli; toxin; lymphonia; sepsis; colibactin.

Sepsis is a clinical syndrome that complicates severeinfection. In addition to exhibiting the cardinal signs ofinflammation, patients present marked respiratory andhemodynamic instability [1]. A subset of patients en-counters multiple organ dysfunction syndrome, whichrapidly leads to death [2]. Another subset recovers butis more prone to developing secondary life-threateningmicrobial infections [3]. Sepsis is therefore the mostcommon cause of death in many intensive care units

[4]. An epidemiological study in North America re-vealed that the incidence of sepsis correlates with anannual burden of approximately 750 000 cases. Theoverall mortality rate is approximately 30% and canrise to 40% among elderly people and to 50% amongpatients displaying a more-severe syndrome (ie, septicshock) [5].

The initial phase of sepsis is thought to result from acytokine storm caused by the activation of the cells ofinnate and adaptive immunity and from the systemicrelease of proinflammatory mediators [5]. This initialhyperinflammatory response is followed by a periodof immunosuppression or so-called immunoparalysis[6–8]. During the late prolonged immunosuppressedphase of sepsis, even after successful early therapy pa-tients are susceptible to life-threatening secondary hos-pital-acquired infections [9] or to reactivation of latentviruses [10]. This immunosuppression is characterizedby numerous deficiencies in both the innate and adap-tive immune systems. Autopsies of patients with sepsis

Received 16 September 2013; accepted 21 January 2014; electronically pub-lished 31 January 2014.

aPresent affiliation: EA 4666 UFR de Médecine, CAP-Santé (FED 4231), Universitéde Picardie Jules Verne, Amiens, France.

Correspondence: Eric Oswald, DVM, PhD, Centre de Physiopathologie de Tou-louse-Purpan, Inserm UMR1043 - CNRS UMR5282 - Universite Toulouse III, INRAUSC1360, CHU Purpan - BP3028, 31024 Toulouse Cedex 3, France ([email protected]).

The Journal of Infectious Diseases 2014;210:285–94© The Author 2014. Published by Oxford University Press on behalf of the InfectiousDiseases Society of America. All rights reserved. For Permissions, please e-mail:[email protected]: 10.1093/infdis/jiu071

Colibactin Aggravates Lymphopenia • JID 2014:210 (15 July) • 285

at INSE

RM

on August 11, 2014

http://jid.oxfordjournals.org/D

ownloaded from

mailto:[email protected]



http://jid.oxfordjournals.org/

have revealed extensive apoptosis of lymphocytes in the spleen[11, 12], suggesting that the loss of immune effector cells couldresult in the profound immunosuppression associated with thisdisorder. These findings were corroborated with animal studiesthat showed that the immune defect was critical to pathogenesisand mortality [13, 14] and that the prevention of lymphocyteapoptosis improved survival [11, 15, 16].

Escherichia coli is a bacterium that colonizes the mammaliangut within few days after birth and becomes the predominantfacultative anaerobic bacterium in the adult microbiota. The ge-netic diversity of E. coli strains is substantial. The majority of E.coli strains can be assigned to 5 main phylogenetic groups: A,B1, B2, D, and E [17]. We identified a genomic island in E.coli strains of the phylogenetic group B2, the pks island, thatis responsible for the production of a hybrid non-ribosomalpeptide/polyketide genotoxin termed colibactin. Colibactinwas shown to induce DNA damage and genomic instabilityboth in vitro and in vivo in enterocytes or colonocytes [18,19].The pks island is highly represented within a highly virulentsubset of B2 strains, namely, extraintestinal pathogenic E. coli(ExPEC), that exhibit an increased likelihood of causing bacter-emia [20].

The aim of our study was therefore to determine whether col-ibactin is genotoxic on lymphocytes and to examine the role ofthe toxin in the virulence of ExPEC.

METHODS

Bacterial StrainsThe laboratory K12 Escherichia coli strain DH10B hosting thevector bacterial artificial chromosome (BAC vector) or BACharboring the functional pks island (BAC pks) were describedpreviously [19]. The O18:K1:H7 ExPEC strain SP15 isolatedfrom newborn meningitis harbors the pks island required forcolibactin production (SP15WT) [19].A chromosomal isogenicmutant of SP15 unable to produce colibactin was generated bydisrupting the clbA gene by allelic exchange (SP15 ΔclbA) aspreviously described [18]. This isogenic clbA mutant was trans-formed with pMB808 plasmid harboring the wild-type clbAgene (SP15 clbA + pclbA) to restore colibactin production [19].

Cell Culture and Bacterial InfectionJurkat cells (human, peripheral blood, leukemia, and T cell)were maintained by serial passages in RPMI medium (Invitro-gen) supplemented with 10% fetal calf serum (FCS; Eurobio),50 µM 2-MercaptoEthanol, nonessential amino acids (Invitro-gen), and 50 µg/mL gentamicin.

Splenocytes isolated from C57BL/6J mice (Janvier Le GenestSaint Isle, France), were maintained in RPMI supplemented with10% FCS, 2 mM L-glutamine, penicillin, streptomycin, 10 mMHEPES, 50 µM 2-MercaptoEthanol, nonessential amino acids,1 mM sodium pyruvate, and 4 µg/mL concavalin A.

For bacterial infections, overnight LB broth cultures of E. coliwere diluted in interaction medium (RPMI, 5% FCS, 25 mMHEPES), and cell cultures were infected at the appropriate mul-tiplicity of infection (MOI). Four hours after inoculation, cellswere washed 3 times with HBSS and incubated in cell culturemedium with 200 µg/mL gentamicin until analysis.

Flow Cytometry and Cell Cycle AnalysisFluorescein isothiocyanate (FITC)–conjugated antibody anti-CD8 (53.6.7) and anti-CD4 (GK1.5) and allophycocyanin-conjugated anti-CD45R (RA3–6B2) were purchased fromeBiosciences (San Diego, CA). Anti-phospho-H2AX was pur-chased from Cell Signaling Technology. Cells were incubatedwith antibodies in staining buffer (phosphate-buffered saline[PBS] supplemented with 2.5% FCS) for 20 minutes and thenwashed. For DNA content analysis, cells were incubated inPBS 70% ethanol for 1 hour at −20°C, washed in PBS, andstained in PBS with 40 µg/mL propidium iodide and 1 µg/mLRNAse. Labeled cells were analyzed on a FACSCalibur flow cyto-meter (Becton Dickinson), using FlowJo software (Tree Star,Ashland, OR).

Western Blot AnalysisCells were collected and suspended in Laemmli loading buffer,sonicated to shear DNA, and 5 min heated at 100°C. Proteinswere separated on a 4%–12% NuPage gradient gel (Invitrogen),transferred to nitrocellulose membranes, blocked with 10%nonfat milk buffer, and probed with anti-phospho-H2AX(Cell Signaling Technology) and anti-actin (ICN), followed byhorseradish peroxidase–conjugated secondary antibodies andchemiluminescent autoradiography (Lumiglo, Cell SignalingTechnology). Protein loading was normalized with anti-actinWestern blots.

Immunofluorescence MicroscopyFor morphological analysis and phosphorylated H2AX detection,Jurkat cells were fixed in 2% formaldehyde, and DNAwas labeledwith 4′,6-diamidino-2-phenylindole hydrochloride (DAPI). γ-H2AX was stained with rabbit anti-phospho-H2AX antibodies(Cell Signaling Technologies), followed by goat anti-rabbit-FITC antibodies (Zymed). Images were acquired with an Olym-pus IX70 confocal microscope and Fluoview software FV500.

Propidium Iodine (PI) Uptake AnalysisJurkat T cell lines, splenocytes, CD8+ T-cell, CD4+ T-cell, andB-lymphocyte viability was determined by PI uptake analysis.Eighteen hours later, fluorescence-activated cell-sorter analysiswas performed to determine the percentage of cells that died.

Fluorochrome Inhibitors of Caspases (FLICA) AnalysisThe FLICA Pan-Caspase Detection Kit (Millipore) is a fluores-cence-based assay for detection of active caspases in cells under-going apoptosis. Jurkat cells were incubated 2 hours with FLICA

286 • JID 2014:210 (15 July) • Marcq et al

at INSE

RM

on August 11, 2014


ownloaded from


at different times (18 hours, 48 hours, and 72 hours) after theend of infection. The percentage of positive cells was deter-mined by flow cytometry.

Mouse Sepsis ModelAnimal experiments were performed in accordance with theEuropean directive for the protection of animals used for scien-tific purposes. The protocols were validated by the local ethicscommittee on animal experimentation, Comité d’éthique MidiPyrénées pour l’expérimentation animale.

Footpad injections were performed as described previously[21, 22]. Briefly, female, age-matched, 8–9-week-old C57BL/6Jmice were used in all experiments. Each mouse was injectedsubcutaneously in the left hind footpad with PBS or 1 × 108

colony-forming units of strains SP15 WT, SP15 ΔclbA, or SP15ΔclbA + pclbA. When required, mice were euthanized 18 hoursafter injection. For the mouse sepsis rescue protocol, footpad injec-tions were performed as described above. A total of 14 hours and24 hours after injection, mice were treated with 0.1 mL of genta-micin injected intraperitoneally (1 mg/mL), together with ringersolution injected subcutaneously (twice 0.5 mL) for rehydration.

Histologic AnalysisEighteen hours after footpad injection, mice were euthanized.Spleen and thymus were collected and frozen rapidly to −80°C.The specimens were embedded in Optimum Cutting Tempera-ture compound. Tissue sections (5–10 µm) were stained withhematoxylin and eosin and examined at ×2.5, ×20, or ×40 mag-nification by microscopy.

Quantification of Cytokine ExpressionSpleen samples were frozen in RNAlater (Qiagen). Tissues werehomogenized in RLT buffer using the Precellys beads kit (CK-mix beads; Bertin Technologies). Total RNA from tissue ho-mogenate was extracted using the RNeasy Mini Kit (Qiagen)in accordance with the supplier’s protocol and was treatedwith DNase (Sigma). iScript cDNA synthesis kit (Bio-Rad)was used to convert RNA (1 µg). The amplification reactionswere performed in a total volume of 20 µL, using IQ SYBRGreen Supermix (Bio-Rad) and a Bio-Rad CFX 97 apparatus.Quantification of tumor necrosis factor α (TNF-α) and inter-leukin 1β (IL-1β) expression was performed using pairs ofprimers (for TNF-α, forward CGTCGTAGCAAACCACCAAGand reverse TTGAAGAGAACCTGGGAGTAGACA; for IL-1β,forward CAACCAACAAGTGATATTCTCCATG and reverseGATCCACACTCTCCAGCTGCA). Gene GAPDH was usedas control (forward TTCACCACCATGGAGAAGGC and re-verse GGCATGGACTGTGGTCATGA).

Fluorescent TUNELEighteen hours after footpad injection, mice were euthanized,and cell death was quantified by terminal deoxynucleotidyltransferase–mediated tetramethyl rhodamine-dUTP (TMR-

dUTP) nick-end labeling (TUNEL kit, Roche). Frozen sectionsof spleen were fixed with 2% formaldehyde (pH 7.4) andpermeabilized with PBS 0.1%, Triton X 100%–0.1%, sodium cit-rate. DNA was labeled with TO-PRO-3 (Invitrogen). Apoptoticnuclei presenting DNA nicks (strand breaks) were labeled withTMR-dUTP red. Images were acquired with an Olympus IX70laser scanning confocal microscope and Fluoview softwareFV500.

Statistical AnalysisData are presented as a means (±standard errors of the mean)for each group (the numbers of independent experiments aregiven in the figure legends). Differences for total viablecell yields and percentages were considered to be significant ifP values were <.05, as determined by χ2 analysis. For in vivoexperiments, survival curves were analyzed using the log-ranktest adjusted for multiple comparisons by computing theBonferroni-corrected threshold (P < .05). Statistical significanceof differences between experimental groups was tested using1-way analysis of variance with the Bonferroni multiple-comparisons posttest. Two-sided analyses were used through-out, and P values of < .05 were considered statisticallysignificant.

RESULTS

E. coli Strains Producing Colibactin Induce Double-Strand DNABreaks and Cell Cycle Arrest in T LymphocytesTo investigate the genotoxicity of colibactin on T lymphocytes,Jurkat T cells were infected with E. coli producing or not produc-ing colibactin. The Jurkat T cells were exposed for 4 hours to lab-oratory E. coli strain K12 that was or was not harboring the pksisland coding for colibactin (K12 + BAC pks or K12 + BAC vec-tor, respectively). DNA damage, megalocytosis (Figure 1A–C),and cell cycle arrest (Figure 1D)—3 hallmarks of the colibactineffect [19]—were analyzed in infected T cells at the same magni-fication. Immunofluorescence analysis revealed increased phos-phorylation of histone H2AX (γ-H2AX), a marker of DNAdouble-strand breaks, resulting from infection with colibactin-producing E. coli K12 + BAC pks (Figure 1A). γ-H2AX was fur-ther examined by flow cytometry 6 hours, 9 hours, 12 hours, and18 hours after exposure to the bacteria (Figure 1B). This revealeda strong induction of γ-H2AX in cells infected with colibactin-producing E. coli K12 + BAC pks beginning 12 hours after infec-tion (Figure 1B). This finding was confirmed byWestern blotting18 hours after infection with strain K12 + BAC pks (Figure 1C)but also with the ExPEC strain SP15, which naturally producescolibactin (WT; Figure 1C). Disruption of the clbA gene, requiredfor the synthesis of colibactin, abrogated the induction of γ-H2AX in the infected cells (ΔclbA; Figure 1C).

The ability of colibactin-producing bacteria to induce cellcycle arrest in Jurkat T cells was also investigated 18 hours


at INSE

RM

on August 11, 2014


ownloaded from


after infection. Infection of Jurkat T cells with an increasingMOI of colibactin-producing E. coli resulted in G2 cell cycle ar-rest (colibactin +; Figure 1D). Cell cycle arrest was not observedfollowing infection with E. coli strains unable to produce coli-bactin (ie, K12 + BAC vector and SP15 ΔclbA; colibactin –;Figure 1D).

These data demonstrated that E. coli strains producing coli-bactin induce double-strand DNA breaks and cell cycle arrest inT lymphocytes, similar to that previously shown in cultured ep-ithelial cells and enterocytes.

E. coli Strains Producing Colibactin Induce Death by Apoptosisin T LymphocytesTo further investigate the susceptibility of lymphocytes to coli-bactin-induced toxicity, we quantified T-cell death by examin-ing membrane integrity. Jurkat T lymphocytes were transientlyinfected with E. coli K12 + BAC pks or + BAC vector, and theExPEC strain that was or was not producing colibactin (SP15WT and SP15 ΔclbA, respectively). The cell membrane perme-ability was determined 72 hours after infection by estimatingthe PI uptake capacity of infected Jurkat T cells (Figure 2A).

Figure 1. Colibactin induces DNA double-strand breaks and cell cycle arrest in immortalized T lymphocytes. A, Jurkat T cells were transiently infected for4 hours with Escherichia coli K12 strain that did (K12 + BAC pks) or did not (K12 + BAC vector) produce colibactin. The multiplicity of infection (MOI) was 10bacteria per cell. The cells were fixed 18 hours after infection and examined by confocal microscopy, at the same magnification, for DNA (blue) and γ-H2AX(green). B, Jurkat cells infected as described in panel Awere analyzed by flow cytometry at different times after infection to determine the level of γ-H2AX.C, Western blot analysis of γ-H2AX in Jurkat T cells 18 hours after infection with E. coli strains that were (K12 + BAC pks and ExPEC SP15 WT) or were not(K12 + BAC vector and ExPEC SP15 ΔclbA) producing colibactin. Actin was probed as a protein loading control. D, Jurkat T cells were infected at differentMOIs (1, 5, and 10) with E. coli strains that were (K12 + BAC pks and SP15 WT; colibactin +) or were not (K12 + BAC vector and SP15 ΔclbA; colibactin –)producing colibactin. Eighteen hours after infection, the cells were analyzed by flow cytometry for cell cycle distribution. Data are plotted as the linear DNAcontent ( propidium iodide [PI] fluorescence) versus cell number. Results are representative of 3 independent experiments, with at least 20 000 cellsanalyzed.


at INSE

RM

on August 11, 2014


ownloaded from


This showed that about 65% of Jurkat T cells died after exposureto bacteria producing colibactin, whereas only 20% of the cellsdied after contact with bacteria unable to produce colibactin(Figure 2A). To determine whether this cell death involved acaspase-dependent apoptotic pathway, Jurkat T cells were incu-bated with the FLICA probe 18 hours, 48 hours, and 72 hoursafter injection. The probe is a membrane-permeant, fluorescentcaspase inhibitor that binds activated caspase enzymes and thusstains apoptotic cells. This revealed activation of caspases in40%– 60% of Jurkat T cells 48 hours and 72 hours after

infection with E. coli producing colibactin (K12 + BAC pksand SP15 WT), contrary to the strains not producing the gen-otoxin (K12 + BAC vector and SP15 ΔclbA; Figure 2B). Togeth-er, these data showed that E. coli producing colibactin inducedcell death by apoptosis in T lymphocytes.

E. coli Strains Producing Colibactin Induce Cell Death inPrimary LymphocytesTo examine the lymphotoxicity of colibactin on primary lym-phocytes, splenocytes were collected from C57BL/6J mice. Col-lected lymphocytes were exposed to E. coli that was or was noproducing colibactin. Cell death among the different popula-tions of lymphocytes was determined by estimating the PI up-take capacity of the cells. Noninfected splenocytes were used asa negative control, whereas splenocytes isolated from 10-Grayirradiated mice were used as positive controls (Figure 3A). Anal-ysis of 3 independent experiments showed that 75%–90% ofCD4+ and CD8+ T lymphocytes and B220+ B lymphocytesdied after exposure to bacteria producing colibactin (Figure 3B).Infection with either E. coli K12 + BAC pks or SP15WT resultedin levels of lymphotoxicity equivalent to the lymphotoxicity re-sulting from total body irradiation (Figure 3B). Infection withdifferent MOIs of colibactin-producing E. coli revealed adose-dependent response of lymphotoxicity (Table 1). In con-trast, cell death rates in noninfected splenocytes and splenocytesinfected with nongenotoxic bacteria (K12 + BAC vector andSP15 ΔclbA) were not significantly different (Table 1). Thus,E. coli producing colibactin induced cell death in T lymphocytescell line, as well as in primary lymphocytes.

ExPEC Producing Colibactin Enhance Sepsis-AssociatedLymphopeniaTo address the effects of colibactin lymphotoxicity on the viru-lence of E. coli in vivo, we investigated sepsis resulting from in-fection of mice with virulent E. coli strain SP15, an ExPEC ofserotype O18:K1:H7 isolated from neonatal meningitis. TheSP15 WT, SP15 ΔclbA mutant, and SP15 ΔclbA + pclbA com-plemented strains were injected into mice footpads. Mice inject-ed with PBS were used as controls. Monitoring of mousesurvival indicated that 70%–80% animals died ≤26 hours fol-lowing ExPEC injection (Figure 4A). Similar kinetics of mortal-ity were measured in the groups of mice injected with ExPECthat was or was not producing colibactin (Figure 4A), consistentwith our previous findings [22].

To examine a possible role for colibactin in histologic alter-ation of primary and secondary lymphoid tissues before mortal-ity, mice were euthanized 18 hours after injection with PBS,ExPEC SP15 WT, or ΔclbA, and the thymus and spleen werecollected. Microscopic sections of thymus (Figure 4B) andspleen (Figure 4C) were stained with hematoxylin and eosinand examined. Contrary to thymi, which presented similar as-pects (Figure 4B), we observed a lower density of splenocytes in

Figure 2. Colibactin induces death by apoptosis in immortalized T lym-phocytes. Jurkat cells were transiently infected for 4 hours with colibactin-producing Escherichia coli strains that were (K12 + BAC pks and ExPECSP15 WT) or were not (K12 + BAC vector and ExPEC SP15 ΔclbA) producingcolibactin. A, The cells were collected 72 hours after infection, and propi-dium iodide was added to evaluate, by flow cytometry, the percentage ofcells that died. B, Jurkat T cells were incubated with the fluorochrome in-hibitors of caspases (FLICA) probe (which stains active caspases in apopto-tic cells) at different times points after the end of infection. The results arerepresentative of 3 independent experiments. The data are presented asmeans (with standard errors of the mean) for each group. The statisticalsignificance of differences in total viable cell yields was determined bythe χ2 test. ***P < .001.


at INSE

RM

on August 11, 2014


ownloaded from


mice infected with SP15 WT, compared with mice injected withSP15 ΔclbA or PBS (Figure 4C). The bacterial load in spleenswas quantified on LB agar plates and did not differ betweenthe groups injected with the different derivatives of strainSP15 (data not shown).

To determine whether the histologic alteration detected inthe spleen tissue was associated with quantitative modifications,splenocytes were quantified in each group of animals. The miceinjected with strain SP15 producing colibactin displayed a lowernumber of splenocytes than those injected with strain SP15ΔclbA or PBS (Figure 4D).

Two main representative proinflammatory mediators pro-duced in spleen during infection are TNF-α and IL-1β [23].The expression of genes encoding both cytokines was quantifiedand was found to be significantly higher 18 hours after infectionin the spleens of mice injected with the SP15 strain producingcolibactin, compared with the animals infected with strain SP15ΔclbA impaired for the production of the genotoxin.

ExPEC Producing Colibactin Enhance Lymphocyte Death In VivoTo test whether the increased lymphocyte death associated withcolibactin production observed in vitro also occurred in vivo,apoptosis was examined in spleens of infected mice 18 hoursafter injection. The tissues were labeled using the fluorescentTUNEL method to identify apoptotic nuclei (Figure 5A). Thisrevealed that infection with ExPEC that was or was not produc-ing colibactin had no significant effect on the percentage ofTUNEL-positive splenocytes (Figure 5A).

To delineate the population in the spleen that was undergo-ing death, splenocytes isolated from infected animals were cul-tured with complete medium and 4 µg/mL concavalin A, apolyclonal lymphocyte activator, and then stained with a com-bination of fluorescently labeled antibodies (anti-CD4, anti-CD8, and anti-B220) and PI (Figure 5B). The PI uptake analysisdemonstrated a marked increase in the frequency of deathamong splenocytes and, more precisely, among CD4+ T cellsand B220+ lymphocytes in the mice injected with SP15 WT

Figure 3. Escherichia coli strains producing colibactin induce cell death in primary lymphocytes. Splenocytes were exposed for 4 hours to E. coli thatwere (K12 + BAC pks and SP15 WT) or were not (K12 + BAC vector and SP15 ΔclbA) producing colibactin (multiplicity of infection, 10). A, Representativedata from the different experiments analyzed in panel B. Splenocytes were incubated with propidium iodide (PI) to estimate cell death 24 hours afterinfection. Anti-CD4, anti-CD8, and anti-B220 antibodies were used to distinguish the different populations of splenocytes. B, Quantification of celldeath in the different populations of lymphocytes exposed to E. coli that were (grey bars) or were not (white bars) producing colibactin.


at INSE

RM

on August 11, 2014


ownloaded from


or SP15 ΔclbA + pclbA (Figure 5B). Together, these data indi-cate that, in this sepsis model, colibactin increased lymphopeniain the spleen.

Colibactin Decreases the Survival Rate of Mice Infected WithExPECNext, to investigate the effect of colibactin on the later sepsisphase, we investigated animal survival in a therapeutic protocolwhere infected mice are treated with antibiotics (Figure 6). Thedifferent derivatives of strain SP15 (SP15 WT, SP15 ΔclbA, orSP15 ΔclbA + pclbA) were injected in mouse footpads. Fourteenhours and 24 hours after injection, the animals were adminis-tered gentamicin (100 µg per mouse). Monitoring of animalsurvival revealed that the mortality of mice injected with coli-bactin-producing SP15 (SP15 WT and SP15 ΔclbA + pclbA)was significantly higher than that in the SP15 ΔclbA group (Fig-ure 6). Thus, in a mouse model mimicking the antibiotherapygiven to septicemic patients, production of colibactin appears tobe an aggravating factor, since it decreases the survival rate.

DISCUSSION

Postmortem studies of patients who died of sepsis have provid-ed important insights into why septic patients die and high-lighted key immunological defects impairing host immunity[2, 24, 25]. Many patients dying from sepsis display profound

lymphocyte depletion. Sepsis-induced multiple organ failureis indeed associated with lymphocyte apoptosis in the spleen,in the intestinal lamina propria, and in lymphoid aggregatesthroughout the body [26]. Therefore, sepsis results in the gen-eration of an immunosuppressive environment [29, 30]. Inaddition, apoptotic cells themselves are immunosuppressive[31, 32]. Animal studies have also shown that sepsis induces ex-tensive apoptosis [14, 15]. Considered together, these studiesprovide strong supporting evidence that loss of lymphocytesin sepsis is a central pathogenic event. Our in vitro results dem-onstrate that the induction of death in lymphocytes by transientE. coli infection producing colibactin is a consequence of DNAdouble-strand breaks and G2 cell cycle arrest. We propose thatthe immune system could represent one of the primary targetsof colibactin in vivo. In vivo, the death of T lymphocytes createsa situation that favors suppression of the immune response ofthe host cells, thereby affecting the course of the initial infectionby facilitating spread, multiplication, and persistence, but mayalso lead to enhanced susceptibility to infection by secondarypathogens [27].

It is essential that patients with sepsis reconstitute their im-mune effector cells if they are to eradicate their primary infec-tion and avoid contracting secondary hospital-acquiredinfections. Several studies have reported the prevention of lym-phocyte apoptosis by a variety of compounds that inhibit cas-pases, which resulted in improved survival in a peritonitis

Table 1. The Lymphotoxicity of Colibactin Is Dose Dependent

Treatment of Cells

Propidium Iodide Positivity by Cell Type, %, Mean ± SEM

All Splenocytes CD4+ T Cells CD8+ T Cells B220+ B Cells

Control cells 23 ± 1.56 42.08 ± 3.54 49.6 ± 2.73 37.73 ± 6.29Irradiated cells 41 ± 0.65b 91.8 ± 0.15c 94.47 ± 0.93c 98.17 ± 1.18c

Infected cells

BAC pksMOI 1 23.7 ± 0.34 56.68 ± 5.06a 64.75 ± 8.87a 48.1 ± 12.6

MOI 5 30.5 ± 4.57 77.52 ± 2.75c 65.1 ± 10.43a 49.6 ± 5.17

MOI 10 41 ± 6.05b 86.3 ± 3.82c 81.85 ± 3.2c 74.83 ± 12.35c

BAC vector

MOI 10 19.1 ± 2.68 43.36 ± 2.68 51.45 ± 2.19 39.8 ± 7.73

ExPEC WTMOI 1 26.5 ± 2.64 49.55 ± 2.2 43.73 ± 2.1 56.9 ± 13.25

MOI 5 32.8 ± 6.86 67.83 ± 7.6b 71.2 ± 6.97c 72.45 ± 8.25c

MOI 10 43.3 ± 8.3b 79.18 ± 8.9c 80.2 ± 8.4c 83.25 ± 3.9c

ExPEC ▵clbAMOI 10 21.6 ± 5.17 49.93 ± 4.39 47.6 ± 2.35 45.3 ± 7.95

Data are from 3 independent experiments. Cells were infected at different MOIs with bacteria that were (K12 + BAC pks or SP15WT) or were not (K12 + BAC vectoror SP15 ▵clbA) producing colibactin.

Abbreviations: MOI, multiplicity of infection; SEM, standard error of the mean.a P < .05 for differences in total viable cell yields, by the χ2 test.b P < .01 for differences in total viable cell yields, by the χ2 test.c P < .001 for differences in total viable cell yields, by the χ2 test.


at INSE

RM

on August 11, 2014


ownloaded from


Figure 4. Effect of colibactin in a mouse model of sepsis. A, Mice underwent footpad injection with phosphate-buffered saline (PBS) or 108 colony-forming units of strains SP15 WT, SP15 ΔclbA, and SP15 ΔclbA + pclbA.Mouse survival was evaluated in the different groups. B and C, Mice used for acutestudies were euthanized 18 hours after injection to examine the thymus and spleen (B). Hematoxylin and eosin staining of microscopic sections of thymusand spleen (C) isolated from mice infected with ExPEC that were or were not producing colibactin. The results shown are representative of 2 independentexperiments with 5 mice each. D, The number of splenocytes in the spleen of mice euthanized 18 hours after infection was evaluated after erythrocytedepletion. E, Quantification of the expression of 2 proinflammatory cytokines, tumor necrosis factor α (TNF-α) and interleukin 1β (IL-1β), in the spleen, byquantitative reverse-transcription polymerase chain reaction.


at INSE

RM

on August 11, 2014


ownloaded from


animal model of sepsis [6, 11, 16]. Recovery from lymphopeniarelies on the expansion of peripheral T cells, which results in therestoration of their numbers. This process is called lymphope-nia-induced homeostatic proliferation (HP). Because HP canresult in the generation of memory and effector T cells, the pos-sibility exists that this process could lead to the generation ofself-reactive clones that mediate autoimmunity or to primedmemory cells that would be protective upon rechallenge withthe same organisms [28]. Therefore, it would be of interest to

compare the repertoire of T lymphocytes after sepsis inducedby an E. coli strain that does or does not produce colibactin.

Moreover, understanding the mechanisms of T-cell recoveryfollowing septic insult will help in the design of rational inter-ventions that could accelerate reconstitution of the immune sys-tem and reduce the number of deaths in intensive care units.

Johnson et al reported that the E. coli colibactin synthesisgenes were significantly associated with an especially high-virulence subset of bacteremic E. coli strains that exhibit elevat-ed virulence scores and an increased likelihood of causingbacteremia [20]. Here, we observed that the production of col-ibactin was not associated with increased mortality in the clas-sical untreated sepsis mouse model. This was consistent withour recent study that revealed that the bacterial siderophores,rather than colibactin, are crucial for the mice survival in thismodel [22]. Nevertheless, we demonstrate here that the produc-tion of colibactin by the septicemic E. coli strain decreases thesurvival rate among mice in a sepsis model including antibiotictreatment aiming at rescuing the animals. Therefore, this workprovides the first experimental evidence that colibactin is a vir-ulence factor for E. coli.

In vitro, a single, short infection of various mammalian cellswith live E. coli producing colibactin induced anaphase bridges,micronuclei, and chromosome aberrations [19]. Aneuploidy,tetraploidy, anaphase bridges, and ring chromosomes persistedin dividing cells, indicating occurrence of breakage-fusion-bridge cycles. Infected cells also exhibited a significant increasein gene mutation frequency, indicating impaired reparability ofcolibactin-induced double-strand breaks and genomic instabil-ity [18]. Our present results suggest that insulted lymphocytes

Figure 5. Colibactin induces lymphopenia during sepsis. A, Splenocytesfrom septic mice were isolated 18 hours after infection, labeled using thefluorescent TUNEL method to identify apoptotic nuclei, and quantified byflow cytometry. The Kruskal–Wallis test with Dunn’s posttest was used forstatistical analyses. B, Splenocytes collected 18 hours after infection werecultured in complete Roswell Park Memorial Institute medium supplement-ed with 4 µg/mL concavalin A. The percentage of splenocytes that diedwas evaluated by flow cytometry following propidium iodide (PI) staining.Cell surface markers with fluorophore-conjugated antibodies were used todetermine T-cell or B-cell classes. The results are mean values (±standarderrors of the mean); data are pooled from 4 independent experiments. Dif-ferences for death cell yields were determined by the Student t test. *P < .05,**P < .01, and ***P < .001. Abbreviation: PBS, phosphate-buffered saline.

Figure 6. Colibactin decreases the survival rate of mice infected withExPEC. Mice underwent footpad injection with 108 colony-forming unitsof Escherichia coli SP15 WT strain or derivatives and were treated withgentamicin (100 µg per mouse) 14 hours and 24 hours after footpad injec-tion. The percentage of mice that survived was monitored. Between 10 and40 mice were used per group. A log-rank test was used for statistical anal-ysis. *P < .05. Abbreviation: PBS, phosphate-buffered saline.


at INSE

RM

on August 11, 2014


ownloaded from


that survive the initial genotoxic exposure could acquire geno-mic instability. We thus speculate that the presence of the col-ibactin-encoding pks island may constitute a predisposingfactor for the development of lymphoma.

Notes

Acknowledgments. We thank Dr Fatima-Ezzahra L’Faqihi-Olive andDr Valerie Duplan-Eche (INSERM U1043 flow cytometry facility) and thepersonnel of the animal facility.Financial support. This work was supported by the FEDER (MYCA)

and the French National Research Agency (grant ANR-09-MIE-005).Potential conflict of interest. All authors: No reported conflicts.All authors have submitted the ICMJE Form for Disclosure of Potential

Conflicts of Interest. Conflicts that the editors consider relevant to the con-tent of the manuscript have been disclosed.

References

1. Russell JA. Management of sepsis. N Engl J Med 2006; 355:1699–713.2. Boomer JS, To K, Chang KC, et al. Immunosuppression in patients who

die of sepsis and multiple organ failure. JAMA 2011; 306:2594–605.3. Alberti C, Brun-Buisson C, Burchardi H, et al. Epidemiology of sepsis

and infection in ICU patients from an international multicentre cohortstudy. Intensive Care Med 2002; 28:108–21.

4. Stone R. Search for sepsis drugs goes on despite past failures. Science1994; 264:365–7.

5. Cohen J. The immunopathogenesis of sepsis. Nature 2002; 420:885–91.6. Hotchkiss RS, Karl IE. The pathophysiology and treatment of sepsis. N

Engl J Med 2003; 348:138–50.7. Remick DG. Pathophysiology of sepsis. Am J Pathol 2007; 170:1435–44.8. Murphy TJ, Paterson HM, Mannick JA, Lederer JA. Injury, sepsis, and

the regulation of Toll-like receptor responses. J Leukoc Biol 2004;75:400–7.

9. Hawkins CA, Collignon P, Adams DN, Bowden FJ, CookMC. Profoundlymphopenia and bacteraemia. Intern Med J 2006; 36:385–8.

10. Hotchkiss RS, Coopersmith CM, McDunn JE, Ferguson TA. Thesepsis seesaw: tilting toward immunosuppression. Nat Med 2009;15:496–7.

11. Hotchkiss RS, Tinsley KW, Swanson PE, et al. Prevention of lymphocytecell death in sepsis improves survival in mice. Proc Natl Acad Sci U S A1999; 96:14541–6.

12. Hotchkiss RS, Tinsley KW, Swanson PE, et al. Sepsis-induced apoptosiscauses progressive profound depletion of B and CD4+ T lymphocytes inhumans. J Immunol 2001; 166:6952–63.

13. Hiramatsu M, Hotchkiss RS, Karl IE, Buchman TG. Cecal ligationand puncture (CLP) induces apoptosis in thymus, spleen, lung, andgut by an endotoxin and TNF-independent pathway. Shock 1997;7:247–53.

14. Ayala A, Herdon CD, Lehman DL, Ayala CA, Chaudry IH. Differentialinduction of apoptosis in lymphoid tissues during sepsis: variation in

onset, frequency, and the nature of the mediators. Blood 1996; 87:4261–75.

15. Hotchkiss RS, Chang KC, Swanson PE, et al. Caspase inhibitors im-prove survival in sepsis: a critical role of the lymphocyte. Nat Immunol2000; 1:496–501.

16. Hotchkiss RS, Swanson PE, Knudson CM, et al. Overexpression of Bcl-2in transgenic mice decreases apoptosis and improves survival in sepsis.J Immunol 1999; 162:4148–56.

17. Chaudhuri RR, Henderson IR. The evolution of the Escherichia coliphylogeny. Infect Genet Evol 2012; 12:214–26.

18. Cuevas-Ramos G, Petit CR, Marcq I, Boury M, Oswald E, NougayredeJP. Escherichia coli induces DNA damage in vivo and triggersgenomic instability in mammalian cells. Proc Natl Acad Sci U S A;107:11537–42.

19. Nougayrede JP, Homburg S, Taieb F, et al. Escherichia coli inducesDNA double-strand breaks in eukaryotic cells. Science 2006; 313:848–51.

20. Johnson JR, Johnston B, Kuskowski MA, Nougayrede JP, Oswald E.Molecular epidemiology and phylogenetic distribution of theEscherichia coli pks genomic island. J Clin Microbiol 2008; 46:3906–11.

21. Kamala T. Hock immunization: a humane alternative to mouse footpadinjections. J Immunol Methods 2007; 328:204–14.

22. Martin P, Marcq I, Magistro G, et al. Interplay between siderophoresand colibactin genotoxin biosynthetic pathways in Escherichia coli.PLoS Pathog 2013; 9:e1003437.

23. Schulte W, Bernhagen J, Bucala R. Cytokines in sepsis: potent immu-noregulators and potential therapeutic targets–an updated view. Medi-ators Inflamm 2013; 2013:165974.

24. Torgersen C, Moser P, Luckner G, et al. Macroscopic postmortem find-ings in 235 surgical intensive care patients with sepsis. Anesth Analg2009; 108:1841–7.

25. Unsinger J, McGlynnM, Kasten KR, et al. IL-7 promotes T cell viability,trafficking, and functionality and improves survival in sepsis. J Immu-nol; 2010; 184:3768–79.

26. Hotchkiss RS, Swanson PE, Freeman BD, et al. Apoptotic cell death inpatients with sepsis, shock, and multiple organ dysfunction. Crit CareMed 1999; 27:1230–51.

27. Hornef MW, Wick MJ, Rhen M, Normark S. Bacterial strategies forovercoming host innate and adaptive immune responses. Nat Immunol2002; 3:1033–40.

28. Unsinger J, Kazama H, McDonough JS, Hotchkiss RS, Ferguson TA.Differential lymphopenia-induced homeostatic proliferation for CD4+and CD8+ T cells following septic injury. J Leukoc Biol 2009; 85:382–90.

29. Hotchkiss RS, Karl IE. The pathophysiology and treatment of sepsis.N Engl J MED 2003; 348:138–50.

30. Wesche DE, Lomas-Neira JL, Perl M, Chung CS, Ayala A. J Leukoc Biol2005; 78:325–37.

31. Ferguson T. A Ocul Immunol Inflamm 1997; 5:213–5.32. Ferguson TA, Herndon J, Elzey B, Griffith TS, Schoenberger S, Green

DR. J Immunol 2002; 168:5589–95.


at INSE

RM

on August 11, 2014


ownloaded from


The Genotoxin Colibactin Exacerbates Lymphopenia and Decreases Survival Rate in Mice Infected With...

Documents

Transcript of The Genotoxin Colibactin Exacerbates Lymphopenia and Decreases Survival Rate in Mice Infected With...