THE EXTENSIVE PROLIFERATION OF HUMAN CANCER ...

1

THE EXTENSIVE PROLIFERATION OF HUMAN

CANCER CELLS WITH EVER-SHORTER TELOMERES

Rebecca Dagg

A thesis submitted in fulfilment of the requirements for the degree of

Doctor of Philosophy

Faculty of Medicine

The University of Sydney

2017

i

Statement of Originality

This is to certify that to the best of my knowledge, the content of this thesis is my own work. This

thesis has not been submitted for any degree or other purposes.

I certify that the intellectual content of this thesis is the product of my own work and that all the

assistance received in preparing this thesis and sources have been acknowledged.

Rebecca Dagg

ii

Abstract

Cellular immortalisation is currently regarded as an essential step in malignant transformation and is

consequently considered a hallmark of cancer. Acquisition of replicative immortality is achieved by

activation of a telomere lengthening mechanism (TLM), either telomerase or the alternative

lengthening of telomeres (ALT), to counter normal telomere attrition. However, a substantial

proportion of glioblastomas, liposarcomas, retinoblastomas, and osteosarcomas are reported to be

TLM-negative. The lack of serial untreated malignant human tumour samples over time has made it

impossible to examine telomere length over time and therefore determine whether they are truly

TLM-deficient, or whether this is the result of false-negative assays. Here we describe a subset (11%)

of high-risk neuroblastomas (NB; MYCN-amplified or metastatic disease) that lack evidence of any

significant TLM activity despite a 51% 5-year mortality rate. NB cell lines (COG-N-291 and LA-N-6)

derived from such tumours proliferated for 500 population doublings (PDs) with ever-shorter

telomeres (EST). COG-N-291 and LA-N-6 cells had exceptionally long and heterogeneous telomere

lengths as measured by terminal restriction fragment (TRF) analysis (mean TRF of 31 and 37.8 kb,

respectively) and telomere fluorescence in situ hybridisation. Both cell lines were telomerase negative

during culturing and did not have elevated markers of ALT or associated gene mutations. The

telomeres of these cells shortened by 80 and 55 bases/PD, consistent with telomere attrition due to

normal cell division, but did not reach senescence after 500 PDs in culture. This is conclusive evidence

that cells from highly malignant, lethal tumours are able to undergo continuous proliferation in spite

of an EST phenotype. The EST phenotype was rescued by activation of telomerase (via transduction

with hTERT expression constructs) or ALT (spontaneous occurrence of a nonsense TP53 mutation,

followed by spontaneous activation of ALT after 100 PDs). We also found that NB EST cells are very

sensitive to topoisomerase I inhibitors indicating the potential to target the EST phenotype with

topoisomerase I inhibitors in high-risk NB.

iii

Acknowledgements

The first person that I need to thank is my supervisor Dr Loretta Lau. I cannot express how grateful I

am that you took a chance and employed me eight years ago. I am the scientist that I am today because

of you. Thank you for your guidance and support and putting up with short deadlines with my writing.

You have been a great teacher, friend and mentor and I couldn’t have asked for a better supervisor.

I would also like to thank my co-supervisor Prof. Roger Reddel. I am constantly astounded by

your replies to emails at all times of the day and I am so grateful for your guidance and insights. Thank

you for always having an open door, because of you I have learnt to be a better scientist and critical

thinker. The success of my PhD is in large part due to the support that I have received from both of

my supervisors.

To all of the members of the CCRU past and present you have made the long hours in the lab

far more enjoyable and become some of my dearest friends. I would especially like to thank Vanita for

always answering my questions (no matter how many times I had to ask about the same form), Belinda

for always offering me advice with a smile, and lunches and dinners spent laughing with Radikha, Jess,

Cuc, Kylie, Michael, Greg, Nick, Amanda, Oksana, Natalie, Namratha, Camilla, and Yu Wooi. Yuyan your

support has helped me more than I can express and I will miss being able to chat with you at the bench.

To Peta, Sarah, Naz, Kaitlin and Amy I can’t believe we decided to start Stress whilst doing our PhD but

I’m so proud of what we achieved! Ladies you have become some of my dearest friends and I can’t

imagine having survived the last few years without you. I also need to thank the past and present

members of the cancer research and telomere length regulation units at CMRI for all of the advice and

assistance I’ve received which have made this a better thesis.

During my PhD I have spent more time in the lab than anywhere else and I would like to thank

all of my friends and family for being so understanding about the events that I’ve missed, left early or

been late to, or had to reschedule around experiments. You have all been so understanding and I

iv

cannot say how much I love you and appreciate your support. I would especially like to thank Chris

and my grandparents for being an unending source of support, you have helped me become who I am

today and I love you more than I can say. To Mum and Katherine, I don’t think that there are words to

say what you mean to me, but to start with I love you. You have seen me at my best and worst during

the PhD and done everything you can to make sure that I’m still sane at the end of it. Thank you for

always listening, being there when I need you, and doing everything from eating cake with me to

getting posters printed when I was on the other side of the world. I never doubted that I would get to

the end of this because of your unending love, support and encouragement. In many ways, I think of

this as something that we have achieved together, so thank you for getting onto this rollercoaster with

me and helping me become the person that I am today.

v

Publications

Dagg RA, Pickett HA, Neumann AA, Napier CE, Henson JD, Teber ET, Arthur JW, Reynolds CP, Murray

J, Haber M, Lau L MS, Reddel RR (2017). Extensive proliferation of human cancer cells with ever-shorter

telomeres. Cell Reports. Vol 20;19(12): 2544-2556.

Hayward NK, Wilmott JS, Waddell N, Johansson PA, Field MA, Nones K, Patch A, Kakavand H,

Alexandrov LB, Burke H, Jakrot V, Kazakoff S, Holmes O, Leonard C, Sabarinathan R, Mularoni L, Wood

S, Xu Q, Waddell N, Tembe V, Pupo GM, Paoli-Iseppi RD, Vilain RE, Shang P, Lau L MS, Dagg RA,

Schramm S, Pritchard A, Dutton-Regester K, Newll F, Fitzgerald A, Shang CA, Grimmond SM, Pickett

HA, Jean Y. Yang JY, Stretch JR, Behren A, Kefford RF, Hersey P, Long GV, Cebon J, Shackleton M,

Spillane AJ, Saw R PM, Lopez-Bigas N, Pearson JV, Thompson JF, Scolyer RA, Mann GJ (2017). Whole

genome landscapes of major melanoma subtypes. Nature. Vol 11;545(7653): 175-180.

Bradbury P, Turner K, Mitchell C, Griffin K, Lau L, Dagg RA, Taran E, Cooper-White J, Fabry B, O’Neill GM

(2017). The focal adhesion targeting (FAT) domain of p130 Crk associated substrate (p130Cas) confers

mechanosensing function. Journal of Cell Science. Vol 1;130(7): 1263-1273.

Scarpa A, Chang DK, Nones k, Corbo V, Patch A, Bailey P, Lawlor RT, Johns AL, Miller DK, Mafficini A,

Rusev B, Scardoni M, Antonello D, Barbi S, Sikora KO, Cingarlini S, Vicentini C, Simpson S, Quinn MCJ,

Bruxner TJC, Christ AN, Harliwong I, Idrisoglu S, Manning S, Nourse C, Nourbakhsh E, Wilson PJ,

Anderson MJ, Fink JL, Newell F, Waddell N, Holmes O, Kazakoff SH, Leonard C, Wood S, Xu Q, Nagaraj

SH, Amato E, Dalai I, Bersani S, Cataldo I, Capelli P, Davì MV, Landoni L, Malpaga A, Miotto M, Whitehall

V, Leggett B, Khanna KK, Harris J, Jones MD, Humphris J, Chantrill LA, Chin V, Nagril A, Pajic M, Scarlett

vi

CJ, Pinho A, Rooman I, Toon C, Wu J, Pinese M, Cowley M, Giry-Laterriere M, Mawson A, Humphrey

ES, Colvin EK, Chou A, Lovell JA, Jamieson NB, Duthie F, Gingras M, Muzny D, Dagg RA, Lau LMS, Lee

M, Pickett HA, Reddel RR, Samra JS, Kench JG, Merrett ND, Epari K, Nguyen NQ, Zeps N, Falconi M,

Simbolo M, Butturini G, Fassan M, Australian Pancreatic Cancer Genome Initiative, Gill AJ, Wheeler

DA, Gibbs RA, Musgrove EA, Bassi C, Tortora G, Pederzoli P, Pearson JV, Waddell N, Biankin AV and

Grimmond SM (2017). Whole-genome landscape of pancreatic neuroendocrine tumours. Nature. Vol

543: 65–71.

Henson JD, Lau L MS, Koch S, Martin La Rotta N, Dagg RA, Reddel RR (2016). The C-circle assay for

Alternative-Lengthening-of-Telomeres activity. Methods. http://dx.doi.org/10.1016/j.ymeth.2016.

08.01

Farooqi AS, Dagg RA, Choi LM R, Shay JW, Reynolds P, Lau L MS (2014). Alternative Lengthening of

Telomeres in neuroblastoma cell lines is associated with a lack of MYCN genomic amplification and

with p53 pathway aberrations. Journal of Neuro-Oncology. Vol 119(1): DOI:10.1007/s11060-014-

1456-8.

Lee M, Hills M, Conomos D, Stutz M, Dagg RA, Lau L MS, Reddel RR, Pickett HA (2014). Telomere

extension by telomerase and ALT generates variant repeats by mechanistically distinct processes.

Nucleic Acids Research. Vol 42 (3): 1733-1746.

Lau L MS, Dagg RA, Henson J, Au A, Royds J, Reddel RR (2013). Detection of Alternative Lengthening

of Telomeres (ALT) by telomere quantitative PCR. Nucleic Acids Research. Vol 41 (2): e34.

vii

List of Abbreviations

ɸ29 phi 29 polymerase

β-actin beta-actin

32P phosphorus-32

123I-MIBG meta-iodobenzylguanidine

6-thio-dG 6-thio-2’-deoxyguanosine

36B4 acidic ribosomal phosphoprotein P0

53BP1 p53-binding protein 1

γ-H2AX H2AX phosphorylated at serine 139

ALT alternative lengthening of telomeres

ABDIL antibody dilution buffer

ACRF Australian Cancer Research Foundation

ALU Short stretch of DNA, transposable element

ANOVA analysis of variance

APB ALT‐associated PML body

ALK anaplastic lymphoma kinase

ASF1 anti‐silencing factor 1

ATM ataxia telangiectasia mutated

ATO arsenic trioxide

ATP adenosine triphosphate

ATR ataxia telangiectasia and Rad3‐related

ATRA all trans retinoic acid

ATRX alpha thalassemia/mental retardation syndrome X‐linked

AU arbitrary units

Alt-NHEJ alternative non-homologous end joining

BCA Bicinchoninic acid

BLM Bloom syndrome

bp base pair

BRCA1 breast cancer type 1 susceptibility protein

BSA bovine serum albumin

C Cytosine

CAF1 chromatin assembly factor 1

viii

CC/C-circle C‐rich telomere circle

cDNA complementary DNA

CDKN1B cyclin dependent kinase inhibitor 1B

cells/mL Cells/millilitre

ChIP chromatin immunoprecipitation

CHAPS 3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulphonate

c-Myc V-Myc Avian Myelocytomatosis Viral Oncogene Homolog

CO2 carbon dioxide

COG Children’s Oncology Group

CpG 5’-C-phosphate-G-3’

CST CTC1-STN1-TEN1 complex

Ct cycle threshold

DABCO 1,4 diazabicyclo(2.2. 2)octane

DAPI 4',6‐diamidino‐2‐phenylindole dihydrochloride

dATP deoxyadenosine triphosphate

DAXX death domain‐associated protein 6

DC dyskeratosis congenital

DDR DNA damage response

dGTP deoxyguanosine triphosphate

DKC1 dyskerin gene

D‐loop displacement loop

DMEM Dulbecco’s modified Eagle’s medium

DMs double-minute chromatin bodies

DMSO Dimethylsulphoxide

DNA deoxyribonucleic acid

DNAse Deoxyribonuclease

DNMT DNA methyltransferase: 1, 3a or 3b

dNTP deoxyribonucleotide triphosphate

DOX Doxorubicin

dsDNA double-stranded DNA

DTT Dithiothreitol

dTTP deoxythymidine triphosphate

EDTA ethylenediaminetetraacetic acid

EGTA ethyleneglycoltetraacetic acid

ix

EFS event-free survival

EST ever-shorter telomeres

ExoI exonuclease I

F Forward

FANCA Fanconi anaemia group A

FAND2 Fanconi anaemia group D2

FBS fetal bovine serum

FEN1 flap endonuclease 1

FFPE formalin-fixed paraffin-embedded

FISH fluorescence in situ hybridisation

g Gravity

G Guanine

GAPDH glyceraldehyde‐3‐phosphate dehydrogenase

G‐circle G‐rich telomere circle

GD2 ganglioside 2

G-MCSF granulocyte macrophage colony-stimulating factor

G-quadruplex secondary structures formed in guanine rich sequences

GWAS genome-wide association study

G1 phase cell cycle phase gap 1

G2 phase cell cycle phase gap 2

H2AX Histone variant H2AX

H3 histone H3

H3.3 histone variant H3.3

H3F3A H3 Histone Family Member 3A

H3K9me3 H3 trimethylated at lysine 9

H4 histone H4

H4K20me3 H4 trimethylated at lysine 20

HBG Haemoglobin

HCl hydrochloric acid

HEPES 4‐(2‐hydroxyethyl)piperazine‐1‐ethanesulphonic acid

HIRA histone regulator A

HJ Holliday junction

HMTase histone methyltransferase

hnRNPs heterogeneous nuclear ribonucleoproteins

x

HP1 heterochromatin protein-1

HPV human papillomavirus

hr(s) hour(s)

HRP horseradish peroxidase

HSRs homogeneously staining regions

hTERT human telomerase reverse transcriptase

HSP70 heat shock protein 70

HSP90 heat shock protein 90

hTR human telomerase RNA

IARC International Agency for Research on Cancer

IC50 inhibitor concentration required for 50% growth inhibition

IF Immunofluorescence

IgG immunoglobulin G

IL-2 interleukin 2

IMDM Iscove's Modified Dulbecco's Media

Indel insertion or deletion

INPC International neuroblastoma pathology classification system

IP Immunoprecipitation

INRGSS International neuroblastoma risk group staging system

INSS International neuroblastoma staging system

ITS insulin-transferrin-selenium-sodium pyruvate

IVA Ingenuity Variant Analysis

kb Kilobase

KCl potassium chloride

kDa Kilodalton

kg Kilogram

KOH potassium hydroxide

LgT large T antigen

LHC-MM Laboratory of Human Carcinogenesis mesothelial medium

LOH Loss of heterozygosity

M Molar

M/MUT Mutant

MAPK mitogen-activated protein kinase

MEM minimum essential medium

xi

meta‐TIF metaphase‐TIF

MgCl2 magnesium chloride

min(s) minute(s)

mL Millilitre

mM Millimolar

MMS21 methyl methanesulphonate-sensitivity 21

MOPS 3-(N-morpholino)propanesulphonic acid

MRN MRE11/RAD50/NBS1

mRNA messenger RNA

MYCN V-Myc Avian Myelocytomatosis Viral Oncogene Neuroblastoma Derived

Homolog

n number of replicates

NaCl sodium chloride

NaF sodium fluoride

NaHCO3 sodium bicarbonate

Na2HPO4 disodium hydrogen phosphate

NaOH sodium hydroxide

Na3V04 sodium orthovanadate

NB Neuroblastoma

NBS1 Nijmegen breakage syndrome 1 (Nibrin) gene

NCBI National Center for Biotechnology Information

NEAA non-essential amino acids

ng Nanogram

ng/mL nanogram/millilitre

ng/µg nanogram/microgram

ng/µL nanogram/microliter

nM Nanomolar

nm Nanometre

NHEJ non-homologous end joining

NP-40 Nonidet P-40

NuRD nucleosome remodelling and histone deacetylation

ORC origin replication complex

p16INK4A cyclin-dependent kinase inhibitor 2A

p21 cyclin-dependent kinase inhibitor 1

xii

PAGE polyacrylamide gel electrophoresis

PanNET pancreatic neuroendocrine tumour

PBS phosphate-buffered saline

PCNA proliferating cell nuclear antigen

PCR polymerase chain reaction

PCT pressure cycling technology

PD(s) population doubling(s)

PFA Paraformaldehyde

pH potential of hydrogen

PML promyelocytic leukaemia

PML-NB promyelocytic leukaemia nuclear body

PMSF phenylmethanesulphonyl fluoride

PNA peptide nucleic acid

POT1 protection of telomeres protein 1

PPTP Pediatric Preclinical Testing Program

pRb retinoblastoma protein

PTEN phosphatase and tensin homolog

PVDF polyvinylidene fluoride

qPCR quantitative polymerase chain reaction

R Reverse

RAP1 repressor-activator protein 1

RFC replication factor C

RNA ribonucleic acid

RNase Ribonuclease

RNaseH1 ribonuclease H1

RPMI-1640 Roswell Park Memorial Institute 1640 Medium

RPA replication protein A

RTEL1 regulator of telomere elongation helicase 1

RT-PCR reverse transcriptase polymerase chain reaction

SCG single copy gene

SD standard deviation

SDS sodium dodecyl sulphate

sec Second

SIOPEN International Society of Paediatric Oncology Europe Neuroblastoma

xiii

shelterin protein complex that binds the telomere

SKP2 S-phase kinase-associated protein 2

SLX4 SLX4 Structure-Specific Endonuclease Subunit gene

SNP single nucleotide polymorphism

SNV single nucleotide variation

S-phase cell cycle phase- DNA synthesis

SSC saline-sodium citrate

ssDNA single-stranded DNA

STR short tandem repeat

SV structural variation

SV40 Simian virus 40

SWATH sequential window acquisition of theoretical fragment ion spectra

TBE tris-borate-EDTA

TBS tris-buffered saline

TC telomere content

T-circle telomere circle

TE tris-EDTA

TEP telomerase-associated protein 1

TERC telomerase RNA component gene

TERT telomerase reverse transcriptase gene

TERRA telomeric repeat containing RNA

TIF telomere dysfunction induced focus

TIN2 TRF1- and TRF2-interacting nuclear factor 2

T-loop telomere loop

TLM telomere lengthening mechanism

TOPO IIIα topoisomerase III alpha

TP53/p53 tumour protein 53

TPE telomere position effect

TPP1 Shelterin protein encoded by the ACD gene

TRAP telomere repeat amplification protocol

TRF terminal restriction fragment

TRF1 telomeric repeat-binding factor 1

TRF2 telomeric repeat-binding factor 2

Tris tris (hydroxymethyl) aminomethane

xiv

T-SCE telomere-sister chromatid exchange

TTBS Tween-20, tris buffered saline

TZAP zinc finger and BTB domain containing 48 (ZBTB48)

U/µg Unit/microgram

µg Microgram

µg/mL microgram/millilitre

µg/well microgram/well

µL Microliter

µm Micrometre

µM Micromolar

USA United States of America

UTR untranslated region

UV Ultraviolet

VAV2 Vav Guanine Nucleotide Exchange Factor 2

V/cm volts/centimetre

V/sec volts/second

v/v volume/volume

WGS whole genome sequence

WRN Werner syndrome RecQ like helicase

w/v weight/volume

W/WT wild type

XRCC3 X-Ray Repair Cross Complementing 3 gene

YFP yellow fluorescent protein

yr Year

xv

Table of Contents

Statement of Originality ........................................................................................................................... i

Abstract ................................................................................................................................................... ii

Acknowledgements ................................................................................................................................ iii

Publications ............................................................................................................................................. v

List of Abbreviations ............................................................................................................................. vii

Table of Contents .................................................................................................................................. xv

List of Figures ........................................................................................................................................ xxi

List of Tables ....................................................................................................................................... xxiii

Chapter 1: Introduction .......................................................................................................................... 2

1.1. Telomere biology ......................................................................................................................... 2

1.1.1. Telomeres and chromosome end-protection ....................................................................... 2

1.1.2. Telomeric chromatin ............................................................................................................. 5

1.1.3. Telomere replication ............................................................................................................. 7

1.1.4. Telomere transcription ......................................................................................................... 8

1.2. Telomeres and replicative aging .................................................................................................. 9

1.2.1. Senescence ............................................................................................................................ 9

1.2.2. Immortalisation ................................................................................................................... 11

1.3. Telomere length regulation ....................................................................................................... 14

1.4. Telomere lengthening mechanisms ........................................................................................... 14

xvi

1.4.1. Telomerase .......................................................................................................................... 14

1.4.2. Alternative Lengthening of Telomeres (ALT) ...................................................................... 19

1.4.3. Telomere lengthening maintenance negative samples ...................................................... 35

1.5. Neuroblastoma .......................................................................................................................... 36

1.5.1. Disease stages ..................................................................................................................... 36

1.5.2. Risk stratification................................................................................................................. 37

1.5.3. Treatment ........................................................................................................................... 41

1.5.4. Predisposition genes ........................................................................................................... 43

1.5.5. Genetic features of sporadic neuroblastoma ..................................................................... 43

1.5.6. Prognostic relevance of telomerase activity ....................................................................... 46

1.5.7. ALT in neuroblastoma ......................................................................................................... 48

1.6. Aims of the project..................................................................................................................... 49

Chapter 2: Materials and Methods ....................................................................................................... 52

2.1. Buffers and solutions ................................................................................................................. 52

2.2. Patient samples .......................................................................................................................... 52

2.3. Cell culture ................................................................................................................................. 53

2.4. Vectors and viral transfections .................................................................................................. 53

2.5. Cell proliferation assay ............................................................................................................... 55

2.6. Immunostaining and fluorescence in situ hybridisation (FISH) ................................................. 55

2.6.1. ATRX and DAXX immunofluorescence (IF) .......................................................................... 55

2.6.2. APB detection...................................................................................................................... 58

2.6.3. MetaTIF assay ..................................................................................................................... 59

xvii

2.6.4. Telomere FISH on metaphase spreads ............................................................................... 61

2.6.5. Telomere sister chromatid exchange (T-SCE) analysis ........................................................ 61

2.7. DNA extraction and quantitation ............................................................................................... 62

2.8. C-circle assay .............................................................................................................................. 62

2.8.1. Slot-blot detection .............................................................................................................. 62

2.8.2. Exonuclease treatment of DNA ........................................................................................... 63

2.8.3. Telomere quantitative polymerase chain reaction (qPCR) detection ................................ 64

2.9. Telomere length analysis ........................................................................................................... 65

2.9.1. Telomere restriction fragment (TRF) analysis ..................................................................... 65

2.9.2. Telomere qPCR .................................................................................................................... 65

2.10. T-circle detection ..................................................................................................................... 67

2.11. Telomere chromatin immunoprecipitation (ChIP)................................................................... 67

2.11.1. Cell lysis and chromatin isolation...................................................................................... 67

2.11.2. Immunoprecipitation (IP) .................................................................................................. 68

2.11.3. DNA isolation .................................................................................................................... 68

2.11.4. Quantitation ...................................................................................................................... 68

2.12. Labelling probes with 32P ......................................................................................................... 69

2.13. Whole genome sequencing (WGS) and bioinformatics ........................................................... 69

2.13.1. WGS and read alignment .................................................................................................. 69

2.13.2. Variant annotations .......................................................................................................... 71

2.14. Sanger sequencing ................................................................................................................... 72

2.15. RNA extraction ......................................................................................................................... 73

xviii

2.16. qPCR analysis ........................................................................................................................... 73

2.16.1. Reverse transcriptase qPCR (RT-qPCR) ............................................................................. 73

2.16.2. Genomic qPCR ................................................................................................................... 73

2.17. Telomeric repeat-containing transcript (TERRA) ..................................................................... 74

2.18. Telomerase activity .................................................................................................................. 74

2.18.1. Protein Lysis ...................................................................................................................... 74

2.18.2. Immunoprecipitation ........................................................................................................ 75

2.18.3. Telomeric repeat amplification protocol (TRAP) .............................................................. 75

2.19. Immunoblotting ....................................................................................................................... 75

2.20. Statistical analyses ................................................................................................................... 77

Chapter 3: A subgroup of high-risk MYCN non-amplified neuroblastomas lacks a telomere lengthening

mechanism ............................................................................................................................................ 79

3.1. Introduction ............................................................................................................................... 79

3.2. Results ........................................................................................................................................ 80

3.2.1. Unique subgroup of high-risk MYCN non-amplified neuroblastoma ................................. 80

3.2.2. ALT-negative and telomerase-negative cancer cell lines .................................................... 84

3.3. Discussion ................................................................................................................................... 97

Chapter 4: Long-term proliferation occurs in cancer cells with ever-shorter telomeres ................... 101

4.1. Introduction ............................................................................................................................. 101

4.2. Results ...................................................................................................................................... 102

4.2.1. Cells with ever-shorter telomeres are capable of long-term proliferation ...................... 102

4.2.2. Characteristics of EST cells ................................................................................................ 102

xix

4.2.3. Genetics of EST cells .......................................................................................................... 109

4.3. Discussion ................................................................................................................................. 111

Chapter 5: Activation of a telomere lengthening mechanism rescues the ever-shorter telomere

phenotype ........................................................................................................................................... 115

5.1. Introduction ............................................................................................................................. 115

5.2. Results ...................................................................................................................................... 115

5.2.1. Activation of telomerase rescues the EST phenotype ...................................................... 115

5.2.2. Activation of ALT rescues the EST phenotype .................................................................. 120

5.2.3. EST neuroblastoma cell lines are unable to generate t-circles ......................................... 124

5.3. Discussion ................................................................................................................................. 127

Chapter 6: Neuroblastoma EST cells are sensitive to topoisomerase inhibitors ................................ 131

6.1. Introduction ............................................................................................................................. 131

6.2. Results ...................................................................................................................................... 132

6.2.1. EST cells are sensitive to topoisomerase inhibitors .......................................................... 132

6.2.2. EST cells do not exhibit increased cell death with potential ALT inhibitors or after induction

of replication stress ..................................................................................................................... 136

6.2.3. EST cells have alterations to genes involved in DNA damage repair and replication ....... 137

6.3. Discussion ................................................................................................................................. 137

Chapter 7: Discussion .......................................................................................................................... 143

7.1. The ever-shorter telomeres phenotype in human cancer ....................................................... 143

7.2. Targeting telomere biology in the clinic .................................................................................. 145

7.3. Conclusion ................................................................................................................................ 146

xx

Chapter 8: References ......................................................................................................................... 149

Appendix I: Information Relating to Chapter 2 ................................................................................... 193

Appendix II: Data Pertaining to Chapter 4 .......................................................................................... 199

xxi

List of Figures

Figure 1.1. Structure of the human telomere. ........................................................................................ 4

Figure 1.2. Telomere length during cell division. .................................................................................. 13

Figure 1.3. Potential templates of homologous recombination mediated telomere lengthening. ..... 27

Figure 1.4. Prevalence of ALT in human cancer based on tumour tissue type. .................................... 33

Figure 2.1. Schematic of neuroblastoma (NB) tumours used in this study based on MYCN amplification

status. .................................................................................................................................................... 53

Figure 3.1. A subgroup of high-risk MYCN non-amplified neuroblastoma with long telomeres are ALT-

negative................................................................................................................................................. 81

Figure 3.2. A unique subgroup of high-risk ALT-negative/MYCN non-amplified/TC≥15 NBs have poor

survival. ................................................................................................................................................. 83

Figure 3.3. Two neuroblastoma cell lines (COG-N-291 and LA-N-6) have long and heterogeneous

telomere lengths similar to the ALT-negative/TC≥15 tumour group. .................................................. 86

Figure 3.4. The COG-N-291 and LA-N-6 cell lines are phenotypically similar to the ALT-negative/TC≥15

tumour group. ....................................................................................................................................... 89

Figure 3.5. The cell lines COG-N-291 and LA-N-6 lack characteristic of ALT. ........................................ 90

Figure 3.6. COG-N-291 and LA-N-6 lack DNA damage at the telomere and characteristics of ALT. .... 92

Figure 3.7. The level of telomere bound proteins does not differ between ALT neuroblastoma cell lines

and COG-N-291 and LA-N-6. ................................................................................................................. 93

Figure 3.8. Some melanoma tumours are ALT-negative with TC≥15. .................................................. 95

Figure 3.9. ALT-negative/long telomere melanoma cell lines are telomerase positive. ...................... 96

Figure 4.1. Two neuroblastoma cell lines (COG-N-291 and LA-N-6) are capable of long term

proliferation despite the ever-shorter telomere (EST) phenotype. ................................................... 103

Figure 4.2. EST cells are capable of proliferation for hundreds of population doublings. ................. 104

xxii

Figure 4.3. Characteristics of EST cells during continuous proliferation for 600 population doublings.

............................................................................................................................................................ 105

Figure 4.4. A subpopulation of COG-N-291 cells are responsible for sporadic increases in C-circles in

the first 300 PDs of culture. ................................................................................................................ 107

Figure 4.5. Periodically a population of COG-N-291 cells activate an ALT mechanism but a slower

proliferation rate prevents them outgrowing the EST cells. .............................................................. 108

Figure 4.6. Characteristics of COG-N-291 sublines during continuous long-term proliferation. ....... 110

Figure 5.1. Retroviral transduction of hTERT results in telomerase activity in LA-N-6 cells. .............. 116

Figure 5.2. Ectopic expression of telomerase rescues the EST phenotype. ....................................... 118

Figure 5.3. No change to ALT characteristics following ectopic expression of hTERT. ....................... 119

Figure 5.4. A LA-N-6 subline spontaneously acquired a premature stop codon in TP53. .................. 120

Figure 5.5. Activation of ALT results in rescue of the EST phenotype. ............................................... 122

Figure 5.6. Loss of p53 results in activation of ALT in an EST culture (LA-N-6). .................................. 123

Figure 5.7. LA-N-6 MUT p53 cells did not activate ALT due to aberrations to ATRX or DAXX. ........... 125

Figure 5.8. EST cells do not form t-circles after activation of ALT or extreme telomere lengthening by

telomerase activity. ............................................................................................................................ 127

Figure 5.9. EST cells express genes involved in t-circle formation...................................................... 128

Figure 6.1. EST cells are sensitive to topoisomerase inhibitors. ......................................................... 133

Figure 6.2. Telomere biology does not influence sensitivity of NB cells to common NB therapies. .. 135

Figure 6.3. Telomere biology does not predict the response of cell lines to inhibitors that cause

replication stress or reduce factors critical to the ALT mechanism. ................................................... 139

xxiii

List of Tables

Table 1.2. Neuroblastoma risk group classification for stages L1/L2, L1 and MS. ................................ 39

Table 1.3. Neuroblastoma risk group classification of stage L2............................................................ 39

Table 1.4. Neuroblastoma risk group classification of stage M. ........................................................... 39

Table 2.1. Composition of common buffers and solutions. .................................................................. 52

Table 2.2. Characteristics of NB cell lines ............................................................................................. 54

Table 2.3. Telomere lengthening mechanism of control cell lines ....................................................... 54

Table 2.4. Cell culture medium. ............................................................................................................ 56

Table 2.5. Seeding density of cell lines in the cell proliferation assay. ................................................. 58

Table 2.6. List of drugs and stock concentrations................................................................................. 60

Table 2.7. List of primers. ...................................................................................................................... 66

Table 2.8. Antibodies for telomere ChIP. .............................................................................................. 70

Table 2.8. TRAP PCR conditions. ........................................................................................................... 76

Table 2.9. Antibodies and conditions used for Western blot analysis. ................................................. 76

Table 3.1. Characteristics of 35 neuroblastoma cell lines. ................................................................... 85

Table 6.1. IC50 values for common NB chemotherapeutics. .............................................................. 136

Table 6.2. IC50 values for inhibitors that cause replication stress and inhibit factors associated with

ALT....................................................................................................................................................... 138

Table A1.1. Primers used to Sanger sequence ATRX. ......................................................................... 193

Table A1.2. Primers used to Sanger sequence DAXX. ......................................................................... 195

Table A1.3. PCR cycling conditions for program 1. ............................................................................. 196





xxiv


Table A2.1. Characteristics of high-risk NB ALT tumours (n=36). ....................................................... 199

Table A2.2. Characteristics of high-risk MYCN amplified NB tumours (n=55). ................................... 201

Table A2.3. Characteristics of high-risk ALT-negative/long telomere NB tumours (n=17). ................ 204

Table A2.4. Characteristics of high-risk MYCN non-amplified/short telomere NB tumours (n=41). . 205

Table A2.5. Genes examined by whole genome sequencing. ............................................................ 208

Table A2.6. Genetic events identified by whole genome sequencing. ............................................... 249

1

Chapter 1:

Introduction

2

Chapter 1: Introduction

1.1. Telomere biology

1.1.1. Telomeres and chromosome end-protection

Chromosomes contain genetic material that must be conserved for correct cellular function. The linear

chromosomes of mammalian cells terminate with 3-12 kilobases (kb) of tandem arrays of TTAGGG

repeats (Moyzis et al., 1988), known as the telomere. The proximal 2 kb region of human telomeres

consist of non-random arrays of variant (TCAGGG, TGAGGG, and TTGGGG) and canonical (TTAGGG)

repeats (Allshire et al., 1989; Baird et al., 1995; Coleman et al., 1999). The telomere sequence is

predominantly double-stranded with the terminal 100-200 bases on the G-rich strand ending in a 3’

single-stranded overhang (Makarov et al., 1997) (Figure 1.1.A). To prevent recognition of the telomeric

3’ overhang as a double-stranded DNA (dsDNA) break which would lead to activation of a DNA damage

response (DDR) at chromosome ends or chromosome end-to-end fusion, the telomere forms a protein-

DNA complex that can induce a unique chromatin structure at the telomere known as the T-loop (Griffith

et al., 1999) (Figure 1.1.B). A T-loop is formed when the 3’ overhang invades the upstream duplex

telomeric DNA forming a Holliday junction (HJ) (Liu and West, 2004) before annealing to the

complementary C-rich strand inducing a displacement or D-loop (Figure 1.1.B). This sequesters the

single-stranded telomeric DNA and provides a protective cap that defines the end of the chromosome,

ultimately preventing it initiating a DDR (de Lange, 2004).

Telomeres provide specific binding sites for a number of proteins, of which the six-subunit

protein complex known as shelterin is the best characterised. The shelterin complex is involved in the

formation and stabilisation of the T-loop structure and is critical to preventing a DDR at the telomere

(Liu et al., 2004a; Ye et al., 2004c) (Figure 1.1.C, D). The shelterin complex binds to telomeric DNA

through three sequence-specific DNA binding proteins: telomeric repeat binding factor 1 (TRF1) and

4

Figure 1.1. Structure of the human telomere.

(A) The human telomere is a predominantly double-stranded sequence of (TTAGGG)n repeats that

ends in a 3’ single-stranded overhang of 100-200 bp on the G-rich strand. (B) The single-stranded 3’

overhang can invade the duplex sequence to form a T-loop. (C & D) The shelterin complex is able to

bind telomeric DNA through TRF1 and TRF2 interaction with the dsDNA of the telomere and through

POT1 binding to the ssDNA of the 3' overhang or the D-loop. TIN2 and TPP1 connect POT1 to TRF1

and TRF2 and RAP1 binds directly to TRF2.

telomeric repeat binding factor 2 (TRF2) which bind directly to double-stranded telomeric DNA

(Benarroch-Popivker et al., 2016; Bilaud et al., 1997; Broccoli et al., 1997; Chong et al., 1995; van

Steensel et al., 1998), and protection of telomeres 1 (POT1) which specifically binds to the single-

stranded telomeric DNA (Baumann and Cech, 2001; Loayza et al., 2004). TRF1 mediates T-loop formation

by bending the dsDNA, and this allows the single-stranded overhang to invade the duplex telomere

sequence and form a HJ, a process mediated by TRF2 (Griffith et al., 1999; Stansel et al., 2001).

Telomeres represent a challenge to the DNA replication machinery and cells require TRF1 to ensure

efficient telomere replication (Chastain et al., 2016; Martinez et al., 2009; Sfeir et al., 2009; Stewart et

al., 2012). TRF2 prevents an ataxia telangiectasia mutated (ATM) dependent DDR (Celli and de Lange,

2005; Denchi and de Lange, 2007; Karlseder et al., 2004) through two mechanisms: firstly the formation

and stabilisation of the T-loop structure (Doksani et al., 2013; Griffith et al., 1999; Poulet et al., 2009)

which prevents classical non-homologous end joining (NHEJ) at telomeres (Smogorzewska et al., 2002;

van Steensel et al., 1998) or cleavage of the structure by resolvases (Poulet et al., 2009) and secondly,

by direct inhibition of ATM (Okamoto et al., 2013). TRF2 recruits and binds the shelterin component

repressor-activator protein 1 (RAP1) to the telomere, which aids in suppressing illegitimate

recombination events at telomeres (Li et al., 2000; Martinez et al., 2010; Sfeir et al., 2010; Ye and de

Lange, 2004). The fifth component of the shelterin complex, TRF1- and TRF2-interacting nuclear factor

2 (TIN2), can bind both TRF1 and TRF2 and acts to stabilise the binding of these two proteins to the

5

telomere (Houghtaling et al., 2004; Kim et al., 2004; Kim et al., 1999; Liu et al., 2004a; Ye et al., 2004c).

TPP1, the final component of the shelterin complex, directly binds to POT1 and with TIN2 mediates POT1

interaction with TRF1 and TRF2 (Frescas and de Lange, 2014a; Frescas and de Lange, 2014b; Liu et al.,

2004b; Takai et al., 2011; Ye et al., 2004b). The TPP1/POT1 complex suppresses ataxia telangiectasia

and Rad3 related (ATR) dependent DNA repair (Denchi and de Lange, 2007; Wu et al., 2006), likely

through exclusion of the DDR protein replication protein A (RPA) from the single-stranded overhang

(Gong and de Lange, 2010).

In addition to the T-loop, telomeres can form G-quadruplex secondary structures. G-

quadruplexes are formed by G-rich DNA sequences which are able to associate with each other by

Hoogsteen base pairing (Gellert et al., 1962; Gilbert and Feigon, 1999). G-quadruplexes have been

detected in telomere sequence in vitro (Sen and Gilbert, 1988; Sundquist and Klug, 1989) and in vivo in

organisms including ciliates (Paeschke et al., 2008; Paeschke et al., 2005) and humans (Biffi et al., 2013).

Such structures can induce DNA damage at the telomere and hence must be unfolded by helicases

including Bloom syndrome helicase (BLM) for correct cellular functions including DNA replication (Wu

et al., 2015).

1.1.2. Telomeric chromatin

DNA is condensed into chromatin, a structure comprised of DNA bound to histone proteins, to allow all

genetic material to fit into the nucleus of a cell. Chromatin also provides a mechanism to regulate DNA

processes such as transcription. There are two types of chromatin; heterochromatin and euchromatin.

Heterochromatin is a compact structure that renders the DNA transcriptionally inactive and is

consequently associated with gene sparse regions of the chromosome (Pontecorvo, 1944). In contrast,

euchromatin is less condensed and therefore found in regions of the genome that are transcriptionally

active (Pontecorvo, 1944). The nucleosome is the basic subunit of chromatin and is comprised of 147

base pairs (bp) of DNA wrapped tightly around a disc-shaped histone octamer (Kornberg, 1974;

Kornberg and Thomas, 1974). A histone octamer contains two molecules each of H2A, H2B, H3 and H4

6

histones (Felsenfeld and Groudine, 2003; Kornberg, 1974; Kornberg and Thomas, 1974). Histones

sterically prevent factors such as RNA polymerase from binding to the DNA, and chromatin remodelling

is therefore required to allow transcription to occur. There are two methods of chromatin remodelling:

nucleosomes can slide or be temporarily disassembled by adenosine triphosphate (ATP) dependent

molecules (Cote et al., 1994; Lia et al., 2006; Saha et al., 2002; Saha et al., 2005), or the post-translational

modification of histones (acetylation or methylation) can modulate DNA-histone binding or recruit other

proteins to the nucleosome (Pogo et al., 1966; Schubeler et al., 2004).

Telomeric chromatin has features consistent with heterochromatin, including histone H3 tri-

methylation at lysine 9 (H3K9me3) and histone H4 tri-methylation at lysine 20 (H4K20me3) (Garcia-Cao

et al., 2004). The histone methyltransferase (HMTase) Suv39h mediates trimethylation of H3K9 (Peters

et al., 2001) which recruits heterochromatin protein-1 (HP1), necessary for chromatin compaction, to

the telomere and subtelomere regions (Cheutin et al., 2003). HP1 then recruits the HMTase Suv4-20h

resulting in trimethylation of H4K20 (Benetti et al., 2007b). Telomeric heterochromatin can also

influence the chromatin structure of reporter genes in the subtelomere resulting in gene silencing

through a process known as the telomere position effect (TPE) (Baur et al., 2001; Gottschling et al.,

1990). There is a low level of H3 and H4 acetylation at sub- and telomeric regions in mortal cells (Benetti

et al., 2007a). Mammalian telomeres lack CpG sequences and hence are not methylated, compared to

the sub-telomeric regions which may be highly methylated by the action of the DNA methyltransferases

DNMT1, DNMT3a and DNMT3b (Brock et al., 1999; Gonzalo et al., 2006). Nucleosomes have been

detected in human telomeres although they have an altered nucleosome structure compared to non-

telomeric regions of the genome (Ichikawa et al., 2014; Lejnine et al., 1995; Makarov et al., 1993;

Tommerup et al., 1994). Repetitive sequences are predicted to be a difficult substrate to maintain

packaged as a nucleosome, suggesting telomeres may also have rapid nucleosome turnover

(Schneiderman et al., 2009).

7

1.1.3. Telomere replication

Mammalian telomeres are replicated throughout S phase (Arnoult et al., 2010; Verdun and Karlseder,

2006; Wright et al., 1999) from replication start sites largely originating in the subtelomere (Drosopoulos

et al., 2012). However, there is emerging evidence that replication can also initiate in the telomere itself

(Drosopoulos et al., 2012; Kurth and Gautier, 2010; Sfeir et al., 2009). Telomeric structures such as the

T-loop, G-quadruplexes and heterochromatin present a barrier to replication forks (Paeschke et al.,

2011). Therefore, proteins that unwind structures within the telomere or restart stalled replication forks

associate with the telomere during S or G2 phase (Chawla et al., 2011; Crabbe et al., 2004; Gu et al.,

2012; Sfeir et al., 2009; Uringa et al., 2012; Vannier et al., 2013; Ye et al., 2010). To facilitate replication

of the telomere, telomeric structures must unfold either in response to the DNA polymerase or by active

unwinding by helicases (Vannier et al., 2012). The helicases Werner syndrome ATP-dependent helicase

(WRN), regulator of telomere elongation helicase 1 (RTEL1), and BLM are recruited to the mammalian

telomere by TRF1, TRF2 and POT1 which subsequently remove T-loop and G-quadruplex structures to

allow telomeric replication (Crabbe et al., 2004; Drosopoulos et al., 2015; Opresko et al., 2002; Sarek et

al., 2015; Sfeir et al., 2009; Vannier et al., 2012; Wu et al., 2015; Zaug et al., 2005). There is evidence

that during telomere replication single-stranded DNA (ssDNA) becomes exposed and induces the

formation of a structure similar to the stalled replication fork (Verdun and Karlseder, 2006). This is

detected by MRE11 and RPA which trigger an ATR/ATM-dependent response that leads to the

completion of replication (Verdun and Karlseder, 2006).

Upon completion of replication, there is a small 3’ overhang caused by the inability of the

replicating DNA to fill the terminal RNA primer during lagging strand synthesis (Levy et al., 1992). This

generates an ATM-dependent DNA damage response, indicated by the localisation of MRE11 and ATM

to the telomere during G2/M (Verdun and Karlseder, 2006). Consequently, the end of the telomere is

processed by Apollo, Exo1, the CST (CTC1-STN1-TEN1) complex and POT1 (Chow et al., 2012; Huang et

al., 2012; Lam et al., 2010; Stewart et al., 2012; Wu et al., 2012b; Wu et al., 2010) to generate a long 3’

overhang before the shelterin proteins and recombination proteins including RAD51, RAD52 and XRCC3

8

(X-Ray Repair Cross Complementing 3 protein) reform the T-loop at the end of the telomere (Amiard et

al., 2007; Doksani et al., 2013; Stansel et al., 2001; Verdun and Karlseder, 2006).

1.1.4. Telomere transcription

Telomeres are transcribed into long non-coding RNA termed TERRA (telomere repeat-containing RNA)

by RNA polymerase II from transcription initiation sites in the subtelomere (Azzalin et al., 2007;

Nergadze et al., 2009; Schoeftner and Blasco, 2008). TERRA transcripts consist of UUAGGG repeats

ranging in size from 100 bases to 9 kb (Azzalin et al., 2007) and about 7% of human TERRA transcripts

have a poly-A tail (Azzalin and Lingner, 2008; Porro et al., 2010). Initial reports suggested approximately

25% of telomeres in human cells transcribe TERRA from specific transcription start sites defined by CpG

DNA islands (Nergadze et al., 2009; Porro et al., 2010), although, controversially, it has recently been

proposed that only one or two subtelomeres are responsible for TERRA transcription (Lopez de Silanes

et al., 2014; Montero et al., 2016). Cohesin, involved in regulating sister-chromatid cohesion, and CTCF,

a chromatin organising factor, are components of human subtelomeres which are involved in the

regulation of TERRA expression (Deng et al., 2012). DNMT3B, a DNA methyltransferase which regulates

the methylation of repetitive sequences (Hansen et al., 1999), has also been implicated in the control of

TERRA transcription (Yehezkel et al., 2008). Telomere length is involved in the regulation of TERRA levels

via telomeric H3K9me3 density (Arnoult et al., 2012). Interaction between TRF1 and RNA polymerase II

is also involved in regulating TERRA levels (Schoeftner and Blasco, 2008). TERRA expression is associated

with the cell cycle, with levels peaking during early S phase before decreasing towards the end of S

phase/G2 (Arnoult et al., 2012; Flynn et al., 2011; Porro et al., 2010). The low TERRA levels in late S phase

facilitate DNA replication of the telomeres and as cells pass through mitosis and into the following G1

phase TERRA expression increases again (Porro et al., 2010).

TERRA transcripts are retained at telomeres post-transcription (Azzalin et al., 2007; Ho et al.,

2008; Schoeftner and Blasco, 2008) and can form DNA-RNA hybrids due to the GC-rich nature of the

sequences (Arora et al., 2014; Balk et al., 2013; Pfeiffer et al., 2013). Telomere DNA-RNA hybrids are

9

regulated by the RNA endonuclease RNaseH1 (Arora et al., 2014). TERRA is also able to form G-

quadruplex structures and can bind to telomere interacting proteins (Biffi et al., 2014; Xu et al., 2010).

Heterogeneous nuclear ribonucleoproteins (hnRNPs) bind to telomeric ssDNA (Lopez de Silanes et al.,

2010), an interaction regulated by TERRA (Yamada et al., 2016). TERRA assists in T-loop formation by

promoting POT1 binding to the telomeric ssDNA after DNA replication through its interaction with

hnRNPA1 which will lead to RPA displacement from the ssDNA to allow POT1 binding (Flynn et al., 2011).

Telomeric transcripts can bind to TRF1 and TRF2 (Azzalin et al., 2007; Deng et al., 2009; Schoeftner and

Blasco, 2008) and telomeric heterochromatin formation is in part mediated by the interaction of TRF2

and TERRA (Deng et al., 2009). This interaction also recruits the origin replication complex (ORC) to the

telomere for the initiation of replication and formation of heterochromatin (Deng et al., 2009).

1.2. Telomeres and replicative aging

1.2.1. Senescence

Normal somatic cells have a limited proliferative capacity in vitro (Hayflick, 1965; Hayflick and

Moorhead, 1961). As proliferation ceases the cells undergo numerous biochemical and morphological

changes as they enter a state of permanent growth arrest known as senescence. It was postulated by

Olovnikov that the end replication problem was responsible for the initiation of senescence (Olovnikov,

1971). The end replication problem refers to the inability of the DNA replication machinery to fully

replicate the end of linear DNA molecules. DNA polymerases are unidirectional and require a primer to

initiate synthesis therefore, the gap caused by the terminal RNA primer cannot be filled which ultimately

results in the loss of telomeric sequence during each round of cell division (Levy et al., 1992). However,

this process generates only a small overhang, which is converted to a 100-200 bp overhang by an

exonuclease that acts in the 5’ to 3’ direction, shortening the C-rich telomere strand and thereby

increasing the length of the G-rich single-stranded telomeric tail (Makarov et al., 1997). In fibroblasts

telomere lengths decrease by 31-85 bp/population doubling (PD) (Harley et al., 1990) and mean

telomere lengths decrease with age in the human population (Hastie et al., 1990; Lindsey et al., 1991).

10

Thus, the terminal telomere sequence is lost at the end of each cell division until the cell is prompted to

exit the cell cycle.

Cells require functional telomeres to form structures such as the T-loop to prevent chromosome

end fusions or recognition of the end of the chromosome as a dsDNA break. However, as normal cell

division erodes the telomere sequence the telomeres become critically short and dysfunctional.

Depletion of shelterin proteins results in a dissociation between telomere length and the induction of

senescence (Karlseder et al., 2002; van Steensel et al., 1998) implying that alterations to the telomere

structure, and not just shorter telomere lengths, result in activation of senescence due to the DDR that

forms at a subset of telomeres (d'Adda di Fagagna et al., 2003). This DDR is visualised by the localisation

of DDR components such as p53-binding protein 1 (53BP1) or phosphorylated histone H2AX (γ-H2AX) to

the telomere where they form a telomere dysfunction induced focus (TIF) (Takai et al., 2003).

Visualisation of telomeres and γ-H2AX in metaphase spreads allow an accurate quantification of TIFs

(Cesare et al., 2009; Thanasoula et al., 2010). In young primary human cells a very low frequency of TIFs

is observed however, they accumulate in presenescent cells until at least five foci are present in

senescent nuclei (Kaul et al., 2012). Consequently, it has been postulated that telomeres exist in three

states (Cesare et al., 2013). The first state is a ‘closed-state’ where telomeres form structures that

prevent a DDR at the end of the chromosome. If the structure fails to form, the cells have an

‘intermediate-state’ telomere which induces a DDR but is still able to prevent repair by end-joining; if a

sufficient number of intermediate-state telomeres is present, then senescence is induced, associated

with changes in the level of histones and consequently the chromatin architecture (O'Sullivan et al.,

2010). The ‘uncapped-state’ allows chromosome end fusions to occur when cells continue to proliferate

beyond the normal induction of senescence.

Dysfunctional telomeres are only one of the stimuli that can induce senescence. Indeed, chronic

activation of a DDR regardless of the genomic site will induce senescence (Nakamura et al., 2008).

Double-stranded DNA breaks, potent activators of senescence, can be the result of ionising radiation,

11

topoisomerase inhibitors, and other types of cytotoxic chemotherapies (Chang et al., 2002; Novakova

et al., 2010; Robles and Adami, 1998; Schmitt et al., 2002; Sedelnikova et al., 2004). Oxidative stress

results in DNA damage to a nucleotide or a ssDNA break which gets converted to a dsDNA break during

base excision repair or DNA replication (Kuzminov, 2001; Wilstermann and Osheroff, 2001). The

resulting dsDNA break can ultimately initiate senescence. Oxidative stress has also been implicated in

telomere shortening by inducing damage at the G-rich sites of the telomere sequence (Kawanishi and

Oikawa, 2004). Therefore, senescence is frequently induced as a result of directly or indirectly generated

dsDNA damage.

Senescence can also be induced by upregulated or unbalanced mitogenic and proliferation-

associated signals. Chronic activation of the mitogen-activated protein kinase (MAPK) signalling

pathway will induce senescence in normal cells (Lin et al., 1998). Mutations to the Ras pathway including

the H-RASV12 mutant (Serrano et al., 1997) and oncogenic mutations to BRAF (Michaloglou et al., 2005)

also result in senescence when the p53 and p16INK4A pathways are intact. Subsequent studies

determined that senescence is mediated by activation of the DNA damage signalling pathway in

response to oncogenic mutations (Bartkova et al., 2006; Di Micco et al., 2006; Mallette et al., 2007).

There is emerging evidence that genes frequently altered in cancer, including c-Myc (Wu et al., 2007),

CDKN1B (Lin et al., 2010), SKP-2 (Lin et al., 2010) and PTEN (Chen et al., 2005), are involved in mediating

senescence in normal cells.

1.2.2. Immortalisation

Senescence is primarily established or maintained by activation of the p53/p21 and p16INK4A/pRB

pathways (Beausejour et al., 2003). Therefore, the p53, pRb and p16INK4A proteins are considered tumour

suppressor proteins and inactivation of their normal function is associated with an increased

proliferative capacity in cells (Beausejour et al., 2003; Gire and Wynford-Thomas, 1998). The normal

function of p53 can be abrogated as the result of spontaneous loss of the wild type TP53 allele of Li-

Fraumeni cells (a syndrome where one TP53 allele contains a null-mutation) (Rogan et al., 1995),

12

transduction with mutated TP53 (Bond et al., 1994), or infection with human papillomavirus (HPV).

Regardless of the mechanism, loss of p53 function results in proliferation beyond the PDs that generally

induce senescence (Bond et al., 1999). Adenovirus, HPV and Simian virus 40 (SV40) are DNA viruses that

express proteins capable of binding to and inactivating p53 and pRB tumour suppressor proteins. When

the SV40 T-antigen (binds p53 and pRB), E1A/E1B (binds pRB/p53 respectively) adenovirus genes, or the

E6/E7 (binds p53/pRB respectively) HPV genes are artificially expressed in human fibroblasts the cells

have an increased proliferative capacity (Shay et al., 1991). Loss of up- or down-stream genes in the p53

or pRB pathways also result in the bypass of senescence (Brown et al., 1997; Dimri et al., 2000;

Huschtscha et al., 1998; O'Loghlen et al., 2015; Okamoto et al., 1994; Vogt et al., 1998). Therefore, a

critical step in the development of cells with indefinite replicative potential, or cellular immortality, is

inactivation of the p53 or pRB pathways (Duncan et al., 1993; Lehman et al., 1993; Rogan et al., 1995;

Shay et al., 1995).

With bypass of senescence by inactivation of the p53 or pRB pathways the telomere sequence

continues to be eroded during each round of cell division. The short, unprotected telomere ends are

able to undergo classic NHEJ or alternative end joining (alt-NHEJ) (Rai et al., 2010; Sfeir and de Lange,

2012) when there are <13 pure TTAGGG repeats distal to the final telomere variant repeat (Capper et

al., 2007). The resultant di-centric chromosomes lead to chromatin bridges between the daughter cells

during cell division and the resolution of these bridges causes genomic instability (Artandi et al., 2000;

Soler et al., 2005). The telomeres will eventually become critically short and induce the cells to enter a

period of crisis where most cells will undergo apoptosis (Girardi et al., 1965). In the case of human

fibroblasts, approximately 1 in 107 cells escape crisis (Huschtscha and Holliday, 1983) by activation of a

telomere lengthening mechanism (TLM) which stabilises the telomere lengths and allows unlimited

proliferation of the cells hence the immortal nature of post-crisis cells (Counter et al., 1992; Meyerson

et al., 1997; Rogan et al., 1995) (Figure 1.2). Cellular immortalisation is a hallmark of cancer (Hanahan

and Weinberg, 2000; Hanahan and Weinberg, 2011) and to date two TLMs have been described:

13

Figure 1.2. Telomere length during cell division.

Cells that have constitutively active telomerase activity such as embryonic stem cells may

completely maintain telomere length (blue line). Stem cells that express tightly regulated levels of

telomerase partially maintain telomere length (green line). In normal somatic cells telomere

erosion occurs as a result of normal cell division (grey line) until cells reach senescence. A

proportion of cells may acquire an abrogation to the p53 or pRb pathway that allows the cells to

overcome senescence. Cell division continues until cells enter crisis. A small proportion of cells may

escape crisis through activation of a telomere lengthening mechanism which allows continued cell

division without telomere length erosion (red line).

telomerase (Greider and Blackburn, 1989) and alternative lengthening of telomeres (ALT) (detailed in

section 1.4.).

14

1.3. Telomere length regulation

The telomere length of normal human cells is determined by a balance of lengthening and shortening

events (Gilson and Londono-Vallejo, 2007). Overlengthening of telomeres by activation of a TLM results

in telomere trimming and the generation of t-circles (Pickett et al., 2009). A t-circle refers to double-

stranded circular telomeric DNA that has a nick in both the C- and G-rich strands preventing the structure

from becoming supercoiled (Cesare and Griffith, 2004; Wang et al., 2004). They are generated when

telomere lengths are extended past a threshold length, likely due to resolution of the HJ formed by the

T-loop (Pickett et al., 2009). A number of genes are involved in the regulation of t-circles (XRCC3

(Compton et al., 2007; Wang et al., 2004), NBS1 (Compton et al., 2007; Wang et al., 2004), SLX4 (Sarkar

et al., 2015), ZBTB48 (encodes TZAP) (Li et al., 2017) and RTEL1 (Deng et al., 2013)) and their involvement

in homologous recombination and DNA replication supports this hypothesis. Recently, TZAP has been

implicated in the initiation of telomere trimming as long telomeres have a reduced concentration of

shelterin proteins which allows TZAP to bind to the telomere, and it is this switch from shelterin to TZAP

that is proposed to initiate telomere trimming (Li et al., 2017). T-circles are conserved in mammals

(Pickett et al., 2011; Rivera et al., 2017), yeast (Lustig, 2003), and plants (Watson and Shippen, 2007)

and observed in normal human and mouse cells (Pickett et al., 2011) indicating that telomere trimming

is a conserved process with a role in normal telomere biology. This process is tightly controlled and does

not result in activation of a DNA damage response or telomere fusions (Pickett et al., 2009).

1.4. Telomere lengthening mechanisms

1.4.1. Telomerase

1.4.1.1. Structure and function

In 1985 Greider and Blackburn discovered an enzyme in Tetrahymena capable of synthesising telomeric

sequence (Greider and Blackburn, 1985) by reverse transcribing the template region of its RNA subunit

(Greider and Blackburn, 1989) and in 1989 Morin described the human equivalent, telomerase (Morin,

15

1989). Telomerase, a ribonucleoprotein, is comprised of the catalytic reverse transcriptase domain

hTERT (human telomerase reverse transcriptase) (Nakamura et al., 1997), the human telomerase RNA

hTR (Feng et al., 1995), and the associated protein dyskerin (Cohen et al., 2007). In vitro studies indicate

that telomerase is a dimer comprised of two molecules each of hTERT, hTR and dyskerin (Cohen et al.,

2007; Sauerwald et al., 2013; Wenz et al., 2001) although there is debate about whether a higher order

structure is strictly necessary for telomerase function as several studies indicate that telomerase is

functional as a monomer (Alves et al., 2008; Errington et al., 2008). Experiments to isolate subunits of

the enzyme responsible for telomere elongation in yeast Saccharomyces cerevisiae utilised mutants

defective for telomere addition (Lundblad and Szostak, 1989). This led to a continual loss of telomere

length and ultimately senescence, a phenotype known as ever shorter telomeres (EST) with the gene

subsequently termed EST1. Further studies identified other EST genes including EST2 which was

subsequently identified as the catalytic component of telomerase in S.cerevisiae (Counter et al., 1997;

Lendvay et al., 1996).

The RNA subunit of telomerase permits de novo addition of six nucleotide repeats of telomere

sequence, 5’-GGTTAG-3’, to the 3’ single-stranded overhang of telomeres. The hTR transcript is

comprised of 451 nucleotides with an eleven nucleotide (5’-CUAACCCUAAC-3’) template region (Feng

et al., 1995), encoded from the TERC gene. The hTR RNA is composed of four domains; a pseudoknot

domain (CR2/CR3), a H/ACA box domain (CR6/CR8), CR4/CR5 domain, and C7 domain (Chen et al., 2000).

The H/ACA box domain is a characteristic of small nucleolar RNA and the region also contains a Cajal

body targeting sequence (CAB box) which facilitates localisation and retention of telomerase to Cajal

bodies (Ganot et al., 1997). Cajal bodies are subnuclear structures that contain several proteins such as

coilin and TCAB1. They provide a site for RNA processing and ribonucleoprotein assembly (Bauer and

Gall, 1997; Jady et al., 2003) and facilitate the recruitment of telomerase to telomeres.

The reverse transcriptase hTERT features: a reverse transcriptase motif located in the C-terminal

end of the protein, a telomerase specific region (T motif), dissociates activities of telomerase (DAT)

16

domain, the telomerase essential N-terminal (TEN) domain and the N-terminal end of the protein

(Armbruster et al., 2001; Moriarty et al., 2002; Nakamura et al., 1997; Xia et al., 2000). hTERT N-terminal

regions are essential for hTR binding (Moriarty et al., 2002; Xia et al., 2000), whilst the C-terminus of

hTERT and the TEN domain are responsible for the processivity of the telomerase enzyme (Akiyama et

al., 2015; Bryan et al., 2000; Hossain et al., 2002; Peng et al., 2001), and the DAT domain is essential for

correct telomerase localisation to the telomere (Armbruster et al., 2004).

Telomerase requires accessory proteins for in vivo synthesis, subcellular localisation and

function. The proteins dyskerin, NHP2, NOP10, GAR1, Nopp140, NAF1, pontin/reptin and TCAB1

associate with the hTR/hTERT complex (Venteicher et al., 2009; Venteicher et al., 2008). The H/ACA

ribonucleoproteins dyskerin, GAR1, NOP10 and NHP2 form a complex that can bind to H/ACA RNAs such

as hTR (Ganot et al., 1997; Henras et al., 1998; Watkins et al., 1998). This complex is required to stabilise

hTR and facilitate the synthesis of telomerase. Pontin and reptin act as a complex that mediates

telomerase synthesis through an interaction with hTERT and dyskerin (Venteicher et al., 2008). These

proteins are hypothesised to accumulate and stabilise hTR, potentially by pontin’s ATPase activity, and

are present at a pre-telomerase intermediate complex with hTERT. TCAB1 binds the CAB box region of

hTR, accumulates telomerase at Cajal bodies, and traffics it to the telomere (Chen et al., 2015; Stern et

al., 2012). Recently, additional proteins including ATR and ATM were identified as contributing to

telomerase recruitment to the telomere (Lee et al., 2015; Tong et al., 2015). Therefore, accurate

telomerase function in vivo requires an array of telomerase-associated proteins in addition to the

enzyme components hTR, hTERT and dyskerin.

1.4.1.2. Role in cancer and normal cells

Telomerase activity in normal human and cancer cells has been extensively characterised by telomerase

activity assays, most commonly the telomerase repeat amplification assay (TRAP) (Kim et al., 1994).

Telomerase activity is tightly controlled in normal human tissue, with activity detected during

embryogenesis in tissues such as the liver, skin, lung and muscle which is subsequently downregulated

17

prior to birth (Ulaner and Giudice, 1997; Ulaner et al., 2001; Wright et al., 1996). However, highly

proliferative tissues such as male germ cells, haematopoietic stem cells, epithelial cells including the

gastrointestinal tract and hair follicle, and activated lymphocytes require tightly regulated telomerase

activity to maintain their cell population (Bachor et al., 1999; Broccoli et al., 1995; Counter et al., 1995;

Harle-Bachor and Boukamp, 1996; Hiyama et al., 1996; Hiyama et al., 1995b; Ramirez et al., 1997;

Tanaka et al., 1998; Yashima et al., 1998; Yui et al., 1998).

Telomere dysfunction can result in short telomere syndromes. Dyskeratosis congenita was the

first short telomere syndrome identified and is generally caused by mutations in the genes for hTR

(Mitchell et al., 1999; Vulliamy et al., 2001a), hTERT (Armanios et al., 2005) or dyskerin (Heiss et al.,

1998) that lead to defective telomerase, excessively short telomeres and reduced proliferation of highly

regenerative cells such as the bone marrow and skin (Drachtman and Alter, 1992; Tummala et al., 2015).

Mutations in telomerase genes, RTEL1, TCAB1, TIN2, TPP1 and PARN (Calado et al., 2011; Guo et al.,

2014; Kocak et al., 2014; Stuart et al., 2015; Tummala et al., 2015) have been identified in aplastic

anaemia (Vulliamy et al., 2002), Hoyeraal-Hreidarsson syndrome (Knight et al., 1999; Marrone et al.,

2007), Coats plus syndrome (Anderson et al., 2012; Polvi et al., 2012), Revesz syndrome (Savage et al.,

2008), and idiopathic pulmonary fibrosis (Armanios et al., 2007; Tsang et al., 2012). Patients who have

germ-line mutations in a telomerase gene also have significantly shorter telomeres than healthy age

matched individuals (Alder et al., 2008; Marrone et al., 2007; Vulliamy et al., 2002; Vulliamy et al.,

2001b).

To ensure that telomerase activity only occurs in specific normal cell types there is tight

regulation over the expression of hTERT and hTR. hTERT is a limiting factor for telomerase expression as

it has either low expression or is absent in telomerase-negative cells and ectopic expression of hTERT in

these cells is sufficient to reactivate telomerase (Bodnar et al., 1998; Counter et al., 1998b; Hahn et al.,

1999; Meyerson et al., 1997; Wen et al., 1998). Expression of hTERT can be regulated at several levels;

including transcription, alternative splicing, and post-translational modifications (Cong et al., 1999; Cong

18

et al., 2002; Horikawa et al., 1999; Liu et al., 1999; Takakura et al., 1999). hTR expression is present at

limiting levels in all cell types and can become upregulated once hTERT is expressed (Avilion et al., 1996;

Cao et al., 2008a; Cao et al., 2008b; Feng et al., 1995). Immortalisation is considered a critical step to

oncogenesis, achieved when cells in crisis activate a TLM. Telomerase is responsible for the

immortalisation of up to 90% of human cancers (Kim et al., 1994; Shay and Bacchetti, 1997) by

preferentially extending the shortest telomeres in the cell (Britt-Compton et al., 2009; Hemann et al.,

2001; Teixeira et al., 2004). Initially two models were proposed to explain the presence of telomerase

activity in cancer cells; the expansion of a stem cell population that failed to undergo differentiation and

subsequently formed cancers (Greaves, 1996), or the dysregulation of endogenously expressed

telomerase to overcome crisis (Shay and Wright, 1996). Subsequent studies identified upregulation of

endogenously expressed hTERT or hTR as frequent events in cancer cells suggesting telomerase activity

is upregulated during tumourigenesis to bypass crisis (Bell et al., 2015; Cao et al., 2008b; Fredriksson et

al., 2014; Horn et al., 2013; Huang et al., 2013; Horikawa et al., 1999; Peifer et al., 2015; Wang et al.,

1998; Wu et al., 1999; Zhang et al., 2000). Endogenous expression of hTERT can be upregulated in cancer

cells through a number of mechanisms including abnormally high levels of Myc activity (Horikawa et al.,

1999; Wang et al., 1998; Wu et al., 1999), gene amplification (Cao et al., 2008b; Zhang et al., 2000),

C228T and C250T mutations in the promoter region leading to the introduction of transcription factor

binding sites (Bell et al., 2015; Fredriksson et al., 2014; Horn et al., 2013; Huang et al., 2013), and

structural rearrangements upstream of the promoter region that result in super-enhancer elements

(Peifer et al., 2015).

1.4.1.3. Telomerase inhibitors as anti-cancer therapeutics

Telomerase is an attractive target for anti-cancer therapies because its expression is crucial for the

majority of cancers and a minority of normal cells. There are a number of strategies for telomerase anti-

cancer therapeutics: the direct inhibition of telomerase, stabilisation of the telomere structure to

prevent telomerase binding, or inducing cell death specifically in telomerase expressing cells (Shay and

Keith, 2008). A number of potential anti-cancer therapies have progressed to clinical trials including the

19

antisense oligonucleotide GRN163L (targeting hTR) (Chanan-Khan et al., 2008; Roth et al., 2010; Ruden

and Puri, 2013), immunotherapy GV1001 (hTERT peptide based vaccine) (Bernhardt et al., 2006;

Brunsvig et al., 2011; Buanes et al., 2009; Kyte, 2009; Ruden and Puri, 2013; Shaw et al., 2010a; Shaw et

al., 2010b), and immunotherapy GRNVAC1 (dendritic cell vaccine to stimulate TERT-specific CD4+ &

CD8+ cells) (DiPersio et al., 2009; Khoury et al., 2010; Ruden and Puri, 2013). However, the results of

these trials are still pending and there is currently no data available suggesting that these drugs improve

patient outcome by inhibiting telomerase activity (Jafri et al., 2016). There are also concerns about the

length of time required for telomerase inhibitors to induce telomere shortening and hence cell death or

senescence. This has led to the development of novel drugs such as 6-thio-2'-deoxyguanosine (6-thio-

dG), a nucleoside analogue which can be incorporated into telomerase mediated de novo synthesised

telomeric DNA, resulting in telomere dysfunction which leads to rapid cell death (Mender et al., 2015).

There is also evidence that treating cells with a combination of PARP and telomerase inhibitors reduces

the time required to observe telomere shortening (Lu et al., 2014; Seimiya et al., 2005). So, whilst there

are currently no telomerase targeted therapies as a standard cancer treatment, telomerase remains a

potential target for the development of novel therapies.

1.4.2. Alternative Lengthening of Telomeres (ALT)

The most common TLM used by human cancers is telomerase, however, a subset of cancer cells and

immortalised cell lines utilise the alternative lengthening of telomeres (ALT) to confer immortalisation.

ALT is defined as any telomerase-independent method of telomere length maintenance, which generally

utilises a DNA template to synthesise de novo telomeric sequence (Dilley et al., 2016; Dunham et al.,

2000). The existence of ALT in human cells was first demonstrated by the observation that some

immortalised cell lines maintain their telomere length without any detectable telomerase activity (Bryan

et al., 1997; Bryan et al., 1995) and it has subsequently been estimated 10-15% of human cancers utilise

the ALT mechanism to achieve unlimited proliferation (Henson et al., 2002). The molecular details of

the ALT mechanism are not yet fully understood but studies have ascertained a number of

characteristics that are hallmarks of the ALT mechanism.

20

1.4.2.1. Phenotypic characteristics of ALT

For over a decade since the discovery of ALT there was no biochemical assay to determine ALT activity

and the only definitive way to confirm cells utilise the ALT mechanism is to examine telomere length in

telomerase-negative cells over time. However, this requires serial untreated samples from the same

patient which are generally impossible to procure. Hence, a combination of ALT markers have

historically been used to determine ALT activity in human cells.

One of the most notable phenotypes of ALT is the presence of long and heterogeneous telomere

lengths within cells. Telomere lengths, in a mass population of cells, are observable by Southern blot

analysis of pulse field gel electrophoresed terminal restriction fragment (TRF) lengths, considered the

gold-standard technique to measure telomere lengths from a population of cells. From this technique,

the range of telomere lengths in ALT cells varies from <3 kb to >50 kb with an average length of 20 kb

(Bryan, 1997; Bryan et al., 1995; Grobelny et al., 2000; Murnane et al., 1994; Yeager et al., 1999)

compared to telomerase-positive cells which have relatively homogeneous telomere lengths with an

average length usually less than 10 kb (Bryan et al., 1995; Park et al., 1998). However, a large amount

of high quality genomic DNA (at least 2 g) is required to perform the analysis, often a limitation when

examining tumour samples. Telomere lengths within a single cell can be observed by telomere

fluorescent in situ hybridisation (FISH) on metaphase spreads. The telomere probe is visible at a range

of intensities within an individual ALT cell, with some chromosomes lacking a detectable signal

altogether, so called signal-free ends. Comparisons of FISH and TRF analysis confirm that TRFs reflect

the heterogeneous nature of telomere lengths within a single ALT cell (Lansdorp et al., 1998; Perrem et

al., 2001). Alternatively, telomere FISH can be performed on interphase cells allowing the examination

of telomere lengths in a range of sample types including formalin-fixed paraffin-embedded (FFPE)

tissues. Although long and heterogeneous telomere lengths are a marker of ALT in most situations,

ectopic overexpression of hTR and/or hTERT can result in extreme telomere lengthening and an average

length comparable to ALT cells (Cao et al., 2008b; Pickett et al., 2009). Therefore, telomere length alone

is not sufficient to indicate ALT activity. The ability to examine individual telomeres has also shown that

21

telomeres in ALT are very dynamic with rapid unsynchronised elongation and deletion events (Murnane

and Sabatier, 2004).

Promyelocytic leukaemia nuclear bodies (PML-NBs) are present in the nuclei of the majority of

mammalian cells (Bernardi and Pandolfi, 2007) and have been implicated in a number of cellular

processes including cell cycle regulation and DDR (Bernardi and Pandolfi, 2003; Dellaire and Bazett-

Jones, 2004; Dellaire et al., 2006), tumour suppression (He et al., 1997), induction of senescence and

apoptosis (Bernardi and Pandolfi, 2003; Ferbeyre et al., 2000; Jiang and Ringertz, 1997), transcriptional

regulation (Luciani et al., 2006; Zhong et al., 2000), protein refolding and degradation (Mattsson et al.,

2001), the immune system (Zheng et al., 1998), and viral replication (Chung and Tsai, 2009). PML-NBs

contain a number of proteins, including Sp100 and isoforms of PML, and in ALT cells a subset also contain

telomeric DNA and shelterin proteins, in addition to DNA repair, recombination and replication factors

(Henson et al., 2002; Jiang et al., 2005; Jiang et al., 2007; Yeager et al., 1999; Zhong et al., 2007). Hence,

such foci are termed ALT-associated promyelocytic leukemia nuclear bodies (APBs) (Yeager et al., 1999).

APBs associate with the termini of chromosomal telomeric DNA implying that this is a transient structure

and the PML-NBs can dissociate from the telomere to allow normal cellular processes to occur

(Molenaar et al., 2003). Methionine restriction in cells leads to an increase in the number of discernible

APBs and has shown that TRF1, TRF2, TIN2, RAP1, PML, HP1 and the MRN (comprised of MRE11, RAD50

and NBS1) complex are necessary for APB formation (Henson et al., 2002; Jiang et al., 2005; Jiang et al.,

2007; Zhong et al., 2007). APB formation also requires proteins of the SMC5/6 complex (Potts and Yu,

2007). It has been hypothesised that APBs are the site of ALT activity, however, to date there is no

conclusive proof that this is the case. Evidence in support of this hypothesis includes a reduction in the

number of APBs following inhibition of ALT (Jiang et al., 2005; Perrem et al., 2001) by sequestration of

the MRN complex (a complex involved in homologous recombination), and the increased frequency of

APBs when cells approach senescence (Fasching et al., 2007; Jiang et al., 2007; Jiang et al., 2009). There

is also evidence that the intensity of telomeric FISH signals increase in a subset of APBs compared to

other telomeres (Yeager et al., 1999). Additionally, APB levels increase during the G2 phase of the cell

22

cycle which is when homologous recombination occurs most frequently and is likely when the ALT

mechanism is active (Grobelny et al., 2000; Wu et al., 2000). The APB assay requires interphase cells and

can be performed on a range of fixed cells including FFPA tissues and has often been used, in conjunction

with telomere length, to determine the frequency of ALT in tumour cohorts.

ALT cells have a high abundance of extrachromosomal telomeric repeats which can be either

linear or circular in form (Cesare and Griffith, 2004; Nabetani and Ishikawa, 2009; Ogino et al., 1998;

Pickett et al., 2009; Tokutake et al., 1998; Wang et al., 2004). Extrachromosomal telomeric DNA likely

results from rapid deletion events, and is a feature of ALT cells. T-circles are the product of telomere

trimming (see section 1.3.) and are more abundant in ALT cells than normal cells or endogenously

expressing telomerase cells (Cesare and Griffith, 2004; Fasching et al., 2005; Henson et al., 2009; Wang

et al., 2004). This greater proportion of t-circles is likely due to resolution of the T-loop during telomere

trimming of over-lengthened telomeres as a result of the rapid elongation events caused by the ALT

mechanism (Pickett and Reddel, 2012). When telomeres are over-lengthened by telomerase, generally

via overexpression of hTERT and/or hTR, abundant t-circles are also generated at levels comparable to

ALT-positive cell lines indicating it is telomere length and not a specific aspect of the ALT mechanism

that results in t-circle formation (Pickett et al., 2009).

C-circles are a type of circular telomeric DNA that appear to be closely related to the ALT

mechanism. C-circles are a C-rich circular telomeric sequence that is only partially double-stranded and

therefore able to self-prime a rolling circle amplification assay (Henson et al., 2009). G-circles are also

specific to ALT cells however, they occur in far lower frequency than C-circles (Henson et al., 2009). C-

circles are a specific and quantitative marker of ALT activity, not found in mortal or telomerase-positive

cells but detectable in all ALT cell lines assayed to date (Henson et al., 2009). Most importantly,

treatment of ALT cells with high levels of YFP-Sp100 fusion protein to sequester the MRN complex and

inhibit ALT, produced a rapid decrease in C-circle levels (Henson et al., 2009). Patients with ALT-positive

osteosarcomas had detectable C-circles in their blood samples (Henson et al., 2009), signifying the

23

potential the C-circle assay has as a routine clinical test to diagnose ALT tumours. The discovery of C-

circles and a simple, rapid detection method for ALT is an important development for identifying TLMs

in cancer patients and facilitates the development of anti-cancer therapeutics to target TLMs.

Telomere variant repeats have also been examined in the context of ALT. Minisatellites are

tandem variant repeat sequences 6-100 bp in length (Vergnaud and Denoeud, 2000). Notably, there is

increased instability at the MS32 minisatellite locus in ALT cells although the frequency of mutation

varies between cell lines (Jeyapalan et al., 2005). Further structural differences have been noted

between the telomeres of ALT cells and non-ALT cells. In mortal or telomerase-positive cells, variant

repeats are confined to the 2 kb region proximal to the end of the telomere (Baird et al., 1995; Coleman

et al., 1999). However, homologous recombination in ALT cells has led to the dispersal of variant repeats

throughout their telomeres, most frequently the TCAGGG variant but TTCGGG and GTAGGG have also

been observed (Conomos et al., 2012; Varley et al., 2002). Orphan nuclear receptors have been

identified at ALT telomeres through binding to the variant telomeric sequence TCAGGG, which in turn

recruits the zinc finger protein ZNF827 to the telomere (Conomos et al., 2014; Conomos et al., 2012;

Dejardin and Kingston, 2009). Subsequently, the histone deacetylation and nucleosome remodelling

complex NuRD is recruited to the telomere through its binding with ZNF827 which leads to telomeric

chromatin remodelling and facilitates the telomere-telomere interaction required for homologous

recombination and ALT activity (Conomos et al., 2014).

The telomeric transcript TERRA can form DNA-RNA hybrids with telomeres and has been found

to localise to APBs (Arora et al., 2014). TERRA levels are higher in ALT-positive cells than telomerase-

positive cells and these levels are associated with telomere length (Arora et al., 2014; Episkopou et al.,

2014; Kreilmeier et al., 2016; Ng et al., 2009). The association between ALT activity and TERRA level may

be the result of reduced sub-telomeric methylation in ALT cells (Ng et al., 2009) or the reduced

chromatin compaction at telomeres which promotes not only the ALT mechanism but telomere

transcription (Episkopou et al., 2014). Similarly, depletion of the chromatin remodeller α-thalassemia

24

mental retardation X-linked (ATRX) protein, an event observed in a subset of ALT cells and tumours

(discussed in section 1.4.2.3) (Heaphy et al., 2011a; Lovejoy et al., 2012), results in decreased TERRA

expression in telomerase-positive cells due to increased telomeric chromatin compaction, reduced RNA

polymerase II recruitment, and decreased cohesion abundance at telomeres (Eid et al., 2015; Episkopou

et al., 2014). A study in S. cerevisiae suggests that TERRA expression is sufficient to induce recombination

(Yu et al., 2014). The evidence thus suggests that TERRA may be involved in telomere maintenance,

although we do not currently understand the role of TERRA in the human ALT mechanism.

Telomere-sister chromatid exchange (T-SCE) is a reflection of recombination at the telomere

and has been used as a marker for ALT (Bechter et al., 2004; Londono-Vallejo et al., 2004). Whilst some

studies reported that post-replicative telomere exchange events were detected at a greater frequency

in ALT-positive cells compared to telomerase-positive cells (Bechter et al., 2004; Londono-Vallejo et al.,

2004), there is also evidence that some telomerase-positive cell lines have comparable T-SCE levels to

ALT cells (Vera et al., 2008). T-SCEs may be more frequent in ALT cells because of the increased number

of short, more recombinogenic telomeres resulting from the ALT mechanism. However, T-SCEs can also

result from dsDNA break repair in the telomere and hence are not universally indicative of ALT activity

(Doksani and de Lange, 2016).

As identification of the ALT mechanism relies on the presence of phenotypic characteristics,

some more specific for ALT than others, it is important to confirm the classification via as many

techniques as possible. Given the specificity, and comparative ease of detection, the C-circle assay in

conjunction with telomere length testing can be rapidly used to identify ALT in tumour samples, even

with limited quantities of DNA (Lau et al., 2013).

1.4.2.2. Mechanistic details of ALT

The exact details of the ALT mechanism are currently unknown. The present model proposes that the 3’

single-stranded overhang of a telomere invades double-stranded telomeric DNA and anneals to the

complementary telomere strand which can act as a primer to synthesise new telomeric DNA, which is

25

then converted to dsDNA. As outlined below, there are a number of potential sources of template

telomeric DNA, including: sister chromatid exchange, replication within the t-loop structure,

homologous recombination from linear extrachromosomal DNA, and DNA rolling circle replication

(summarised in Figure 1.3.A, B, C, D).

Homologous recombination was first hypothesised to be involved in ALT telomere length

maintenance because of the dynamic nature of the telomeres observed in ALT cells. Homologous

recombination at the telomere can be detected in vivo in mammalian cells by inserting a DNA tag into

one telomere and demonstrating that it is copied to other non-homologous telomeres (Dunham et al.,

2000; Neumann et al., 2013; O'Sullivan et al., 2014) or duplicated in the original location (Muntoni et

al., 2009). This was observed in ALT but not telomerase-positive cells. These observations indicate that

ALT cells can use a telomere on a sister chromatid, another telomere, or even itself as a template to

copy telomeric sequence (Figure 1.3.A, B, C). This process appears to rely on break-induced replication

(Dilley et al., 2016; Roumelioti et al., 2016).

Break-induced replication is a process to repair DNA damage at the termini of the chromosome

(McEachern and Haber, 2006). A recent study indicates replication factor C (RFC) loads proliferating cell

nuclear antigen (PCNA) onto the exposed end of the chromosome, which is recognised as a site of DNA

damage, leading to polymerase δ recruitment to the telomere (Dilley et al., 2016). This leads to one end

of the break invading a template which is used for homology-directed telomere synthesis. In addition to

linear chromosomes, circular extrachromosomal telomeric DNA can act as a template for telomere

elongation via rolling circle amplification machinery (Henson et al., 2009; Natarajan and McEachern,

2002)(Figure 1.3.D). Introduction of exogenous t-circles to the telomerase negative Kluyveromyces lactis

27

Figure 1.3. Potential templates of homologous recombination mediated telomere lengthening.

Homologous recombination can use a number of templates to mediate telomere lengthening as

proposed in the ALT mechanism. These include (A) another telomere, (B) the T-loop of the same

telomere, and possibly (C) linear extrachromosomal DNA or (D) circular extrachromosomal DNA.

resulted in incorporation of the exogenous sequence into the chromosomal telomere and subsequent

spreading of the sequence by homologous recombination (Natarajan et al., 2003; Natarajan and

McEachern, 2002; Topcu et al., 2005).

The telomere templates used for homology-directed synthesis may be spatially close to the

termini of the telomere for example a sister chromatid, or spatially separated, such as a distant

telomere. To allow telomeres to find templates over long distances the cells require a mechanism to

move telomeres within the nuclei. Loss of the shelterin protein TRF2 results in a DDR at the telomere

and an increased mobility within the nuclei (Dimitrova et al., 2008). A spontaneous DDR is commonly

detected at the telomere of ALT cells (Cesare et al., 2009) and a subset of ALT telomeres have directional

movement which allows transient binding with each other and APBs (Molenaar et al., 2003). Of late,

evidence has emerged of a HOP2-MND1- and RAD51 dependent homology search mechanism that

drives rapid, directional, long-range movement of telomeres leading to telomere clustering, ultimately

initiating homology based telomere synthesis (Cho et al., 2014; Zhao and Sung, 2015). It is currently

unknown what proportion of the telomere ends utilise long-range movement to find template DNA for

the ALT mechanism.

1.4.2.3. Genetic changes and telomeric chromatin in ALT

It has been presumed that for the ALT mechanism to occur in cells, p53 would need to be inhibited to

allow recombination events to occur. There is some indirect evidence to suggest this is the case: in

glioblastoma, 78% of ALT tumours were p53 deficient but only 21% of telomerase-positive tumours

28

lacked p53 (Chen et al., 2006). However, this finding may be specific to glioblastoma, as ALT has also

been detected in other tumour types, such as primary neuroblastoma (NB) tumours which have a very

low incidence of p53 deficiency (Vogan et al., 1993; Kurihara et al., 2014; Lundberg et al., 2011; Onitake

et al., 2009; Valentijn et al., 2015). Of the ALT cell lines characterised to date only four have a wild type

TP53 allele and only one of these is known to have normal p53 protein levels (Henson and Reddel, 2010).

These data suggest that inhibition of p53 may be required in the majority of circumstances to permit

the ALT mechanism to activate, however, it is clearly not an absolute requirement for ALT to occur.

Genes that are involved in chromatin remodelling have recently been implicated in activation

of the ALT mechanism. An association between ALT-positive tumours and mutations to ATRX or Death-

Associated protein 6 (DAXX) was established in pancreatic neuroendocrine tumours (PanNETs) (Heaphy

et al., 2011a; Jiao et al., 2011; Scarpa et al., 2017). Studies in other tumour types including glioblastoma

(Schwartzentruber et al., 2012), liposarcoma (Lee et al., 2015) and NB (Kurihara et al., 2014) have

confirmed there is a correlation between ALT-positive tumours and ATRX mutations, although DAXX

mutations are rarely observed. Mutations in the histone variant H3.3, encoded by the gene H3F3A, have

also been associated with ALT (Schwartzentruber et al., 2012). ALT-positive cell lines frequently lack

ATRX expression (Bower et al., 2012; Lovejoy et al., 2012) although this is not necessarily due to loss-of-

function mutations in the gene (Lovejoy et al., 2012). A study of 22 ALT cell lines indicated that loss of

ATRX expression is not necessarily the result of somatic mutations, 19/22 cell lines had loss of ATRX

and/or DAXX protein but only 7/19 cell lines contained a loss-of-function mutation in ATRX and 0/19

had mutations in DAXX or H3F3A (Lovejoy et al., 2012). It is clear that loss of ATRX, DAXX and/or H3.3

expression is not solely responsible for initiation of the ALT mechanism as 14% of ALT cell lines exist

with normal levels of ATRX and DAXX and knockdown of either protein did not result in ALT

immortalisation of mortal cells (Lovejoy et al., 2012; Napier et al., 2015).

ATRX is a member of the ATP dependent SWI2/SNF2 family (Picketts et al., 1996) and mutations

to the ATRX gene cause alpha thalassemia in patients with a normal alpha globin gene which led to the

29

hypothesis that ATRX is involved in the regulation of gene expression (Gibbons et al., 1995). ATRX is

localised to PML bodies, pericentric heterochromatin, and sub-telomeric and telomeric DNA where the

protein is involved in regulating DNA methylation and the chromatin structure (De La Fuente et al., 2004;

Gibbons et al., 2000; Ritchie et al., 2008). To perform its chromatin remodelling function, ATRX forms a

complex with DAXX (Xue et al., 2003). DAXX can bind to H3.3 and the ATRX/DAXX complex can then

deposit H3.3 into ribosomal, telomeric, and pericentric repeat sequences (Drane et al., 2010; Goldberg

et al., 2010; Lewis et al., 2010). H3.3 is a histone variant associated with nucleosomes undergoing rapid

turnover at transcriptionally active sites (Ahmad and Henikoff, 2002). Therefore, H3.3 may be stabilising

the telomere chromatin structure as it does at other sites of rapid nucleosome turnover. Loss of either

ATRX or H3.3 in mouse embryonic stem cells resulted in an increased number of cells with five or more

TIFs (Wong et al., 2010) demonstrating that both proteins are important to maintaining telomere

function. ATRX and H3.3 are involved in maintaining the heterochromatin state across the genome and

mediate silencing of genetic regions including endogenous retroviral elements (Elsasser et al., 2015;

Sadic et al., 2015) and imprinted loci (Voon et al., 2015). Defective function of ATRX or H3.3 results in

hypo-methylation (Voon et al., 2015) and ALT cells have reduced compaction of telomeric chromatin

compared to telomerase-positive cells (Episkopou et al., 2014). However, knockdown of ATRX in isogenic

telomerase and ALT-positive cells led to increased telomeric chromatin compaction suggesting other

factors mediate the reduced telomeric chromatin compaction observed in ALT cells (Episkopou et al.,

2014). Furthermore, depletion of ASF1, a histone chaperone that interacts with histone regulator A

(HIRA) and the chromatin assembly factor 1 (CAF1) complex, led to the activation of ALT phenotypes in

a mortal and telomerase-positive cell line providing further evidence that normal chromatin structure

is critical in repressing ALT in normal cells (O'Sullivan et al., 2014).

1.4.2.4. ALT proteins

The hypothesis that ALT exploits normal homologous recombination pathways is supported by the

involvement of proteins utilised in DDR, homologous recombination, and DNA replication in the ALT

mechanism. Notably, a large proportion of these proteins are present in APBs lending support to the

30

hypothesis that they are the active site of the ALT mechanism (Henson and Reddel, 2010). Proteins

required for homologous recombination including RAD51, RAD52, RPA, NBS1, SLX4, BLM, MRN, BRCA1

and BRIT1, have been identified in the APBs of ALT-positive cells (Bhattacharyya et al., 2009; Cesare and

Reddel, 2010; Conomos et al., 2014; Wan et al., 2013; Wilson et al., 2013; Yeager et al., 1999). The

members of the MRN complex, involved in the early steps of homologous recombination (van den Bosch

et al., 2003), were some of the first proteins identified as critical for telomere lengthening by ALT. The

MRN complex recruits ATM to dsDNA breaks and facilitates resection of the chromosome end to create

the 3’ overhang for strand invasion and subsequent homologous recombination (Lee and Paull, 2007).

Therefore, the MRN complex may be involved in the initiation of ALT activity by recruiting ATM to the

telomere and creating a larger 3’ overhang at the telomere end to be used for strand invasion of

template telomeric DNA. Sp100 binds to and sequesters the MRN complex via its interaction with NBS1,

and overexpression of Sp100 led to the repression of ALT, where normal cell division based telomere

length attrition and a reduction in APBs was observed (Jiang et al., 2005). In support of the hypothesis

that the MRN complex is critical for the ALT mechanism, depletion of any individual component of the

complex resulted in loss of ALT mediated telomere maintenance (Zhong et al., 2007). The SMC5/6

recombination complex is comprised of 8 subunits, three of which (methy methanesulphonate-

sensitivity 21 (MMS21), SMC5, and SMC6) are required for ALT-mediated telomere maintenance (Potts

and Yu, 2007). The MMS21 SUMO ligase is required to sumoylate the telomere binding proteins TRF1,

TRF2, TIN2, and RAP1 (Potts and Yu, 2007; Wu et al., 2012a). Whilst the exact role of the SMC5/6

complex in ALT remains to be elucidated, the complex may recruit the telomere to APBs via sumoylation

of shelterin proteins.

Other components of dsDNA break repair machinery and DNA replication including Fanconi

anaemia group A (FANCA) (Fan et al., 2009), Fanconi anaemia group D2 (FANCD2) (Fan et al., 2009), flap

enonuclease 1 (FEN1) (Saharia and Stewart, 2009), and MUS81 endonuclease (Zeng et al., 2009), have

been implicated in the ALT mechanism although depletion of these proteins does not result in overall

loss of telomere length due to ALT inhibition. RecQ family DNA helicases are important for the resolution

31

of atypical DNA structures and mutations to the proteins result in chromosomal abnormalities and

disease in patients (Croteau et al., 2014). RecQ like proteins in humans include WRN, RECQL4, and BLM

(Ellis et al., 1995; Killoran and Keck, 2006; Yu et al., 1996), mutations in which are responsible for

Werner, Rothmund-Thomson, and Bloom syndrome, respectively. The binding partners of the BLM

protein, as identified by mass spectrometry, include heat shock protein 90 (HPSP90), telomerase-

associated protein 1 (TEP1), topoisomerase III alpha (TOPO IIIα), and the shelterin proteins TRF1 and

TRF2 (Bhattacharyya et al., 2009). Depletion of TOPO IIIα in ALT but not telomerase-positive cells

resulted in increased cell death and DNA damage at the telomere but a concurrent reduction in the level

of TRF2 protein could also account for these observations (Bhattacharyya et al., 2009; Temime-Smaali

et al., 2008). Interestingly, the WRN protein is not essential to the ALT mechanism (Laud et al., 2005)

despite its role in the separation of dsDNA, likely due to redundancy in the function of other RecQ

helicases. Indeed, recent studies have suggested that many DDR and homologous recombination

proteins maintain normal telomere function rather than, or perhaps in addition to, being required for

the ALT mechanism (Fan et al., 2009; Saharia and Stewart, 2009; Saharia et al., 2010; Verdun and

Karlseder, 2006; Zeng and Yang, 2009).

1.4.2.5. ALT in cancer and normal cells

The role of ALT has not been established in normal human cells and currently the best evidence for ALT

function in embryogenesis and normal somatic cells comes from murine models. Telomere length

analysis of oocytes and early embryos revealed that telomeres were short in oocytes but then

lengthened until blastocysts were formed (Liu et al., 2007). Telomerase activity remained consistently

low until blastocyst formation, demonstrating that telomerase activity alone was not responsible for the

increase in telomere length and indeed, the early cleavage embryos contained evidence of telomere

sister chromatid exchange and recombination suggestive of the ALT mechanism (Liu et al., 2007).

However, there is not complete concordance with these results, as a subsequent study incorporating a

tag into a single telomere only observed copying of the telomere via recombination in somatic cells and

not germ-line cells (Neumann et al., 2013). This discrepancy may be due to the different detection

32

methods used by each group and the inability of the telomere tag to detect intra-telomeric

recombination arising from the ALT mechanism (Neumann et al., 2013). The ALT mechanism has also

been detected in a range of eukaryotes including mosquitoes (Mason and Biessmann, 1995), the plant

Arabidopsis thaliana (Riha et al., 2001), the worm Caenorhabditis elegans (Cheng et al., 2012; Lackner

et al., 2012) and the yeasts C. cerevisiae (Lundblad and Blackburn, 1993) and K. lactis (McEachern and

Blackburn, 1996). These studies provide evidence that ALT activity is present in a range of cells and the

ALT mechanism observed in human cancers may be the result of a dysregulated normal TLM.

The prevalence of ALT in human cancers has not been as widely studied as telomerase due to

the difficulty in obtaining enough tumour material for assays and the need to perform multiple assays

for the identification of the ALT mechanism. However, this has changed with the recent development

of a telomere quantitative polymerase chain reaction (qPCR) based assay to detect C-circles which

allows ALT to be detected from as little as 30 ng of DNA (Lau et al., 2013). Lau et al. (2013) described a

cut-off for C-circle levels indicative of an active ALT mechanism, detected by qPCR, which gives 100%

concordance with APB assay results and the conventional C-circle assay detected by a P32-radiolabelled

telomere probe, validated in a cohort of 23 cell lines and 43 tumours including glioblastoma, melanoma,

and soft tissue sarcoma samples. The prevalence of ALT has been studied in cancers including

osteosarcoma, gastric carcinoma, soft tissue sarcoma, astrocytoma, mesothelioma, adrenocortical

carcinoma, ovarian carcinoma, melanoma, NB, medulloblastoma, breast carcinoma, colon carcinoma,

Ewings sarcoma, PanNETs and lung carcinoma (Figure 1.4. indicates prevalence of ALT according to

tumour tissue type) (Bryan et al., 1997; Costa et al., 2006; Else et al., 2008; Guilleret et al., 2002; Hakin-

Smith et al., 2003; Heaphy et al., 2011b; Henson et al., 2005; Jiao et al., 2011; Johnson et al., 2005;

Matsuo et al., 2009; Montgomery et al., 2004; Omori et al., 2009; Onitake et al., 2009; Sanders et al.,

2004; Scarpa et al., 2017; Subhawong et al., 2009; Ulaner et al., 2004; Ulaner et al., 2003; Villa et al.,

2008; Yan et al., 2002).

33

Figure 1.4. Prevalence of ALT in human cancer based on tumour tissue type.

The prevalence of ALT varies depending on the tumour tissue type with ALT yet to be identified in

any hematopoietic, pancreas or prostate tumours. Adapted from Dilley and Greenberg 2015.

The association between upregulation of ALT and prognosis is dependent on the tumour type.

ALT is utilised for immortalisation by approximately 50% of osteosarcomas but there is no difference in

survival between ALT-positive and ALT-negative patients (Henson et al., 2005). Interestingly, 29% of

liposarcomas are ALT-positive and these patients have a worse survival than telomerase-positive

patients (Pricolo et al., 1996). In contrast, glioblastoma patients with ALT tumours have a longer median

survival compared to non-ALT tumours (Hakin-Smith et al., 2003). The prevalence of ALT is also highly

variable in different tumour types, up to 60% of astrocytomas and sarcomas (neuroepithelial and

mesenchymal origin respectively) are ALT-positive compared to carcinomas (epithelial in origin) where

5-15% of tumours utilise ALT. This difference may be due to the regulation of ALT in specific cell types

(Henson and Reddel, 2010).

34

Normal cells appear to contain repressors of the ALT mechanism since the fusion of the ALT cell

line GM847 and normal fibroblasts resulted in a rapid loss of telomere sequence and onset of

senescence (Perrem et al., 1999). Hybridisation of ALT and telomerase-positive immortalised cell lines

created cells that utilised only one telomere maintenance mechanism (Bower et al., 2012; Ishii et al.,

1999; Perrem et al., 2001). This implies that telomerase-positive cells contain a repressor of ALT and

ALT-positive cells contain repressors of telomerase (Bower et al., 2012). Hence, the tumour types with

low or no ALT activity may contain repressors of ALT and tumour types with higher ALT prevalence may

more tightly regulate telomerase expression.

1.4.2.6. Anti-cancer therapeutics and ALT

To date, there are no ALT targeted anti-cancer therapeutics available, although there is some debate

regarding the potential to use ATR inhibitors as an anti-ALT therapy (Deeg et al., 2016; Flynn et al., 2015).

A better understanding of the mechanism and the prevalence of ALT is necessary to develop treatments

and determine patient groups eligible for targeted therapies. There is also evidence that cells within a

single tumour can utilise both telomerase and ALT (Bryan et al., 1997), although it is unclear if both exist

in a single cell or it is the result of heterogeneity within the tumour. It is possible to artificially generate

telomerase expression in ALT immortalised cell lines, and this has been used to demonstrate that both

mechanisms can co-exist in a single cell (Cerone et al., 2001; Grobelny et al., 2001; Perrem et al., 2001).

Consequently, anti-cancer therapies targeted to a TLM must take into consideration whether one or

both TLMs are present in the tumour.

Another concern with telomere maintenance mechanism targeted therapies is the possibility

that cells can change their active mechanism if one becomes non-functional. Inhibition of hTERT in a

telomerase positive cell line resulted in cells that could maintain telomere length and grow for over 200

PDs once telomerase became inactive, although the cells possessed no typical features of ALT such as

APBs or long and heterogeneous telomere lengths (Kumakura et al., 2005). This indicates, in principle,

that cells have the ability to activate alternative pathways for telomere length maintenance if their TLM

35

becomes compromised. Whilst, there is no evidence to suggest that human cancers treated with a

telomerase targeted anti-cancer therapeutic activate the ALT mechanism to continue telomere length

maintenance, telomerase inhibition has resulted in the emergence of ALT cells in mouse cells (Hu et al.,

2012). Therefore, targeting telomerase as an anti-cancer therapeutic has the potential to select for ALT-

positive cells which would be resistant to such therapies supporting the need to develop anti-cancer

therapeutics against both TLMs.

1.4.3. Telomere lengthening maintenance negative samples

Immortalisation via activation of a TLM is currently regarded as a hallmark of cancer (Hanahan and

Weinberg, 2000; Hanahan and Weinberg, 2011) although, it has been postulated that immortalisation

may not be required in cancers with a low level of tumour cell death or genetically simple cancers that

do not require extensive clonal evolution (Kipling, 1995; Parkinson, 1996; Reddel, 2000). A human

fibroblast isolated from a middle-aged person is capable of an additional 20-40 PDs (Hayflick, 1965). If

every cell survives, 40 PDs can generate 240 cells which would form a tumour mass of 1 kg. However, cell

death occurs in most tumours due to factors like an inadequate blood supply resulting in hypoxia and

necrosis, or due to non-viable cells created during the clonal evolution of the tumour. Consequently,

the majority of tumours activate a TLM to obtain the proliferative capacity to form a tumour mass. This

may not be required for tumours that have long telomere lengths in their progenitor cells, in cancers

such as leukaemias which do not undergo cell death due to limited blood supply, and in genetically

simple cancers. In keeping with the hypothesis that immortalisation is not an absolute requirement of

carcinogenesis, a substantial proportion of liposarcomas (Costa et al., 2006; Jeyapalan et al., 2008),

glioblastoma (Hakin-Smith et al., 2003), retinoblastomas (Gupta et al., 1996), and osteosarcomas

(Ulaner et al., 2003) have been reported as TLM-negative. While these tumours may be truly TLM-

negative, this could also be the result of false negative assays or an as-yet unidentified ALT mechanism

lacking the usual phenotypic characteristics. To date, it has been impossible to test which of these

scenarios is true, as the definitive test for telomere length maintenance is to examine telomere length

over time which would require serial samples of untreated human tumours, samples impossible to

36

obtain. It is increasingly important to define what is happening in this group of tumours as TLM-

inhibitors are moving toward clinical use and TLM-negative tumours would be resistant to such

treatment. Large-scale studies are also moving towards genetic markers such as telomere length and

hTERT and ATRX/DAXX mutations to define TLMs (Barthel et al., 2017; Pekmezci et al., 2017; Scarpa et

al., 2017; Valentijn et al., 2015) and the molecular details of TLM-negative tumours would ensure that

tumours are not misclassified.

1.5. Neuroblastoma

Neuroblastoma (NB) is an embryonal cancer that arises in the sympathetic nervous system. The disease

predominantly affects infants or young children, with an annual incidence of 29 patients/million infants

<1-year-old, which is reduced to one patient/million in children 10-14 years old (Lau and Irwin, 2017).

NB is the most common extracranial solid tumour in children, responsible for 7-10% of cancers in

children under 15 years, yet it accounts for 15% of deaths in paediatric oncology patients (Maris et al.,

2007).

1.5.1. Disease stages

The majority of NB patients (65%) present with a primary tumour in the abdomen, most commonly

adjacent to the adrenal gland. Other sites of primary disease include the pelvis, chest and neck (Maris

et al., 2007). Metastatic disease is present in nearly half of patients at diagnosis, either in lymph nodes

adjacent to the primary tumour, or at distant sites such as the bone marrow, cortical bones, the liver

and non-adjacent lymph nodes (Maris et al., 2007). Diagnosis can be made by the histology of the

tumour or the presence of tumour cells in the bone marrow combined with elevated catecholamine

levels in the urine. The tumour size and invasiveness and metastatic sites can be determined with CT or

MRI scan in conjunction with radiolabelled meta-iodobenzylguanidine (123I-MIBG).

Established in 1993, The International Neuroblastoma Staging System (INSS) (Brodeur et al.,

1993) is a classification system based on clinical and biological prognostic markers. However, a more

37

recent system of classification, the International Neuroblastoma Risk Group Staging System (INRGSS)

(Cohn et al., 2009), has been developed to ensure uniform risk stratification and comparison of clinical

trials across large international bodies such as the Children’s Oncology Group (COG) and the

International Society of Paediatric Oncology Europe Neuroblastoma (SIOPEN). The INRGSS classifies NB

into stages L1, L2, M, and MS. Stage L1 and L2 represent locoregional disease in the absence and

presence of image-defined risk factors, respectively. Stage M (equivalent to INSS stage 4) includes all

metastatic disease unless classified stage MS. Stage MS is similar to INSS Stage 4S with metastases

limited to the liver, skin and bone marrow, except that it includes patients up to age 18 months and

large primary tumours (L1 or L2) (Monclair et al., 2009). Stage MS, which will be referred to as stage 4S

in remainder of this thesis, is a unique group of NB that has the propensity to spontaneously regress in

the absence of treatment (D'Angio et al., 1971). The staging of NB reflects the heterogeneity of the

disease, ranging from tumours that can spontaneously regress, to metastatic disease that conveys a 2-

year event free survival of only 66% (Yu et al., 2010).

1.5.2. Risk stratification

There are a number of biological and clinical factors that need to be considered when stratifying NB

patients into risk groups, including: stage, age at diagnosis, histology of the tumour, differentiation

within the tumour, MYCN amplification, 11q aberration, and ploidy of the tumour. Based on these

features the INRGSS classifies NB patients into 16 pre-treatment risk categories (A to R) which are

further classified into risk subsets based on the 5-year event-free survival (EFS) of each category (Table

1.2); very low risk (5-year EFS >85%), low-risk (5-year EFS >75 to ≤85%), intermediate-risk (5-year EFS

≥50% to ≤75%) and high-risk (5-year EFS <50%) (Cohn et al., 2009; Monclair et al., 2009).

1.5.2.1. Histology and degree of differentiation

NB tumours are comprised of small, round blue cells with reduced cytoplasm and darkly staining nuclei.

A panel of antibodies is used to distinguish NB from other solid tumour types and the International

Neuroblastoma Pathology Classification System (INPC) uses a modified Shimada system to determine

38

the degree of Schwannian stroma (NB, stroma-poor; ganglioblastoma intermixed, stroma-rich;

ganglioneuroma, stroma-dominant; or ganglioneuroblastoma, composite rich/dominant and stroma-

poor), neuroblast differentiation (differentiating, poorly differentiated, or undifferentiated) and mitosis-

karyorrhexis index (high, intermediate or low) of the tumour (Shimada et al., 1999). The tumours are

classified into favourable or unfavourable histology groups based on the combination of these features

and age at diagnosis (Shimada et al., 2001).

1.5.2.2. Age at diagnosis

The median age at diagnosis of NB is 19 months, and 90% of patients are younger than 5 years of age at

diagnosis (London et al., 2005). Age at diagnosis correlates to the EFS of patients with Stage 4 MYCN

non-amplified NB, with children >24 months at diagnosis (6-year EFS of 31%) having a significantly

poorer prognosis than patients 12 to 18 months old at diagnosis (6-year EFS of 74%) (Schmidt et al.,

2005).

1.5.2.3. MYCN amplification

The proto-oncogene MYCN is located at chromosome 2p24 and amplification of the gene occurs in

approximately 22% of primary tumours and is associated with high-risk NB across all stages of disease

(Ambros et al., 2009; Bagatell et al., 2009; Brodeur et al., 1984; Cohn et al., 2009; Seeger et al., 1985).

Amplified MYCN DNA can be found in double-minute chromatin bodies (DMs) or homogeneously

staining regions (HSRs) which can be detected by MYCN FISH in the nuclei of NB cells (Corvi et al., 1994;

Schwab et al., 1984). MYCN amplification is defined as ≥10 copies of MYCN in a diploid cell or a >4-fold

increase in signal compared to chromosome 2. MYCN oncoprotein is a transcription factor that binds to

the promoter region of target genes involved in differentiation, cellular proliferation, and apoptosis,

through binding to E-box recognition sites (Murphy et al., 2009). Transgenic mouse models of MYCN

overexpression result in spontaneous NB, indicating MYCN expression has a role in NB oncogenesis

(Weiss et al., 1997), however, it remains to be elucidated by which mechanisms MYCN amplification

results in aggressive NB tumours. Currently, there is no successful therapeutic to target MYCN but as

39

Table 1.2. Neuroblastoma risk group classification for stages L1/L2, L1 and MS.

Stage L1/L2 L1 MS

Age (months) <18

Histology

Ganglioneuroma maturing;

ganglineuroblastoma intermixed

Any except ganglioneuroma

maturing or ganglineuroblastoma

intermixed

Differentiation

MYCN Non-

amplified Amplified Non-amplified Amplified

11q loss of heterozygosity

No Yes

Ploidy

INRG category A B K C Q R

Risk group Very low Very low High Very low High High

Table 1.3. Neuroblastoma risk group classification of stage L2.

Stage L2

Age (months) <18 ≥18

Histology

Any except ganglioneuroma maturing or ganglineuroblastoma

intermixed

Ganglineuroblastoma nodular or neuroblastoma

Differentiation Differentiating Poorly or un-differentiated

MYCN Non-amplified Non-amplified Non-amplified Amplified


No Yes No Yes

Ploidy

INRG category D G E H H N

Risk group Low Intermediate Low Intermediate Intermediate High

Table 1.4. Neuroblastoma risk group classification of stage M.

Stage M

Age (months) <18 <12 Dec-18 <18 ≥18

Histology

Differentiation

MYCN Non-amplified Non-amplified Non-amplified Amplified


Ploidy Hyperdiploid Diploid Diploid

INRG category F I J O P

Risk group Low Intermediate Intermediate High High

40

Aurora kinase A is required to stabilise MYCN protein, the inhibitor MLN8237 is currently in clinical trial

in combination with chemotherapy (Mosse et al., 2012) (clinical trial: NCT01601535). Inhibition of the

MYCN downstream target ornithine decarboxylase by difluoromethylorthinine is also in clinical trial

(clinical trial: NCT02030964).

1.5.2.4. Tumour ploidy and chromosome aberrations

Tumour ploidy is an independent prognostic factor, predominantly in patients less than 18 months of

age (George et al., 2005; Schleiermacher et al., 2010). The ploidy of a NB tumour refers to the DNA

content of the cells and is indicative of the type of genetic rearrangement that the tumour has

undergone. Hyperdiploid tumours have whole chromosome gains and therefore, little structural

rearrangement of chromosomes, which confers a more favourable outcome for patients (Kaneko et al.,

1987; Look et al., 1991). In contrast, diploid tumours are associated with advanced-stage disease and

poor prognostic markers including MYCN amplification and loss of 1p or 11q (Attiyeh et al., 2005; Cohn

et al., 2009; Kaneko et al., 1987; Look et al., 1991).

Loss of heterozygosity (LOH) of 11q has been identified in 34-45% of primary NBs (Attiyeh et al.,

2005; Guo et al., 1999; Plantaz et al., 1997; Spitz et al., 2003). 11q LOH does not correlate with MYCN

amplification but is associated with high-risk features such as unfavourable histology and poor survival.

Consequently, LOH of 11q has been identified as a prognostic factor in MYCN non-amplified tumours

and is used in the INRGSS to predict outcome in the stage L2 MYCN non-amplified tumours. The short

arm of chromosome 1 (1p) is deleted in 25-35% of NBs and correlates with MYCN amplification (Attiyeh

et al., 2005; Brodeur et al., 1981; Christiansen et al., 2000; Kaneko et al., 1987; Plantaz et al., 1997).

Allelic loss at 1p36 is associated with an increased risk of relapse, although it is only an independent

prognostic factor in low or intermediate risk tumours. Gain of additional copies of 17q, often occurs

through unbalanced translocation with chromosome 1 or 11, and is associated with aggressive disease

(Bown et al., 1999; Van Roy et al., 1997). It has been suggested that changes to ploidy are required for

the gain of tumour driver genes on 17q and a loss of tumour suppressor genes on 1p or 11q, however,

41

a recent study identified loss of 1p and 11q in relapse but not matched primary tumours (Eleveld et al.,

2015), suggesting these events are not tumour initiating but rather a step in aggressive tumour

evolution.

1.5.3. Treatment

NB treatment may vary depending on clinical trials group. The following therapies reflect COG protocols

for NB treatment. Low-risk NB has a good prognosis and a 5-year EFS of 75-85% (Monclair et al., 2009).

As such, minimal treatment is offered to patients who have tumours with favourable biology. If surgery

is performed, partial resection with residual disease is not a risk for relapse in these patients (Strother

et al., 2012). Chemotherapy (with or without surgery) consisting of low doses of carboplatin,

cyclophosphamide, doxorubicin and etoposide is given to patients who have life-threatening symptoms,

progressive disease after surgery, or unfavourable tumour biology in the resected tumour. In contrast,

stage 4S NB with no high-risk markers can be observed and given supportive care. Treatment with

chemotherapy is only given if the patient becomes symptomatic or the tumour has unfavourable biology

as most tumours spontaneously regress without any intervention (Nickerson et al., 2000).

Intermediate risk NB have a poorer survival (5-year EFS 50-75%) than low risk patients, and are

treated with chemotherapy and surgery (Baker et al., 2010). Chemotherapy can consist of 4 or 8 cycles

of carboplatin, cyclophosphamide, doxorubicin and etoposide. Four cycles are given for tumours with

favourable biology whilst 8 cycles are used when the biology is unfavourable.

The standard regimen for high-risk NB treatment consists of three phases: induction,

consolidation, and post-consolidation (Matthay et al., 1999; Park et al., 2011). The current COG trial

protocol for induction therapy involves 6 cycles of dose-intensive chemotherapy. The first two cycles

include a combination of topotecan and cyclophosphamide, then a combination of etoposide and

cisplatin for cycles 3 and 5, and for cycles 4 and 6 a combination of doxorubicin, cyclophosphamide and

vincristine (Park et al., 2011). The response to induction therapy is a prognostic indicator for high-risk

patients, and correlates with patient survival after the completion of therapy (Cheung et al., 1991).

42

Consequently, tumours are monitored with MIBG scoring systems at diagnosis and at the end of

induction therapy (Yanik et al., 2013). Local resection of the tumour is recommended after 4-6 cycles of

chemotherapy, although it is debatable that complete resection improves the outcome of patients

(Alonso et al., 2006; Castel et al., 2002; Du et al., 2014; Simon et al., 2013). Patients then receive

consolidation therapy consisting of myeloablative chemotherapy and autologous stem cell

transplantation. Myeloablative chemotherapy comprises of treatment with melphalan, followed by

carboplatin and etoposide. After completion of consolidation therapy, patients may also receive

radiation treatment. Though patients receive multi-modal therapy, relapse remains common in high-

risk NB, suggesting that minimal residual disease is an important factor in recurrence. To treat minimal

residual disease, it is standard to use non-cytotoxic differentiation therapy (treatment with 13-cis

retinoic acid), as post-consolidation therapy for high-risk NB (Matthay et al., 2009b) in addition to

immunotherapy with anti-ganglioside 2 (GD2) chimeric antibody (Simon et al., 2011) and cytokines

(interleukin-2 [IL-2] and granulocyte macrophage colony-stimulating factor [GMCSF]) (Yu et al., 2010).

Despite intensive treatment many high-risk patients have refractory disease or experience

recurrence, and there is no curative therapy for the majority of these patients (London et al., 2011).

Indeed, stage 4 patients with relapsed disease only have a 5-year overall survival of 8% (London et al.,

2011). Relapsed patients generally present with metastatic disease, that has acquired mutations as a

result of primary therapy and are consequently drug resistant (Carr-Wilkinson et al., 2010; Keshelava et

al., 2001; Tweddle et al., 2001). Therefore, patients that are treated with further chemotherapy, receive

agents with a mode of action distinct from therapies used in the initial treatment. Examples of relapse

therapy include temozolomide with irinotecan, topotecan in combination with etoposide or

cyclophosphamide, high dose 131I-MIBG therapy and a second autologous stem cell transplantation

(Kushner et al., 2006; Matthay et al., 2009a; Simon et al., 2007). Patients can also be enrolled in early

phase clinical trials.

43

1.5.4. Predisposition genes

Familial NB is rare, accounting for only 1-2% of NB cases, and is generally autosomal dominant with

incomplete penetrance (Kushner et al., 1986; Maris et al., 2002). Correlation between mutations and

cases of familial NB led to candidate predisposition regions being located at 16p, 12p and 2p23-26 (Maris

et al., 1997), ultimately resulting in the identification of the anaplastic lymphoma kinase (ALK) gene. A

proportion of the ALK mutations identified in patients are the result of germline missense mutations

(Chen et al., 2008; George et al., 2008; Janoueix-Lerosey et al., 2008; Mosse et al., 2008). Patients with

NB associated with Hirschsprung disease or congenital central hypoventilation have germline PHOX2B

mutations (Mosse et al., 2004; Trochet et al., 2004). Consequently, the two most common

predisposition genes associated with NB tumour formation are ALK and PHOX2B. Single nucleotide

polymorphisms (SNPs) that have been reported to increase the risk of NB include HACE1 (Diskin et al.,

2012), LIN28B (Diskin et al., 2012), BARD1 (Capasso et al., 2009; Pugh et al., 2013), FGFR4 (Whittle et

al., 2016), CHEK2 (Pugh et al., 2013), PINK1 (Pugh et al., 2013), TP53 (Pugh et al., 2013) and LM01 (Wang

et al., 2011).

1.5.5. Genetic features of sporadic neuroblastoma

Despite the ability to stratify patients there is very little understood about how these factors drive the

NB tumour. Recently, studies utilising next generation sequencing techniques have been undertaken to

determine the genetic mutations that are responsible for driving NB pathogenesis in an effort to design

targeted therapies. Genome-wide association studies (GWAS) have identified several SNPs that are

associated with sporadic NB. Low-risk NB is associated with SNPs in DUSP12, HSD17B12, and

DDX4/IL31RA at chromosome 5q11.2 (Nguyen le et al., 2011), whereas high-risk tumours are associated

with SNPs within or upstream of 6p22 (Maris et al., 2008), HACE1 (Diskin et al., 2012), LIN28B (Diskin et

al., 2012), BARD1 (Capasso et al., 2009), FGFR4 (Whittle et al., 2016), and LM01 (Wang et al., 2011). A

common copy number variation in chromosome 1q21 that effects NBPF23 expression was also

identified in NB tumours (Diskin et al., 2009). In addition to familial NB, ALK mutations are present in

44

sporadic cases: 6-12% carry somatic mutations, 15-22% have gained copies of ALK and 3-4% have ALK

amplification (Chen et al., 2008; George et al., 2008; Janoueix-Lerosey et al., 2008; Mosse et al., 2008;

Pugh et al., 2013). Recent evidence suggests that there is epigenetic regulation of ALK expression in

samples with wild type ALK sequence (Gomez et al., 2015). Due to the prevalence of upregulated ALK

expression in unfavourable NB, ALK has become a target of novel NB therapies. Currently the ALK

inhibitor, crizotinib, is in clinical trial (Mosse et al., 2013) (clinical trial NCT01606878) and newer

inhibitors are under development.

With the increased ability to perform whole exome and whole genome sequencing several

genome wide studies (Cheung et al., 2012; Molenaar et al., 2012; Peifer et al., 2015; Pugh et al., 2013;

Sausen et al., 2013) have been conducted to determine the somatic alterations present in NB tumours.

As expected, genetic events previously linked to NB prognosis were identified including MYCN

amplification, 1p and 11q deletion and 17q gains. A very low level of recurrent gene mutations was

detected, only 12-14 amino acid affecting mutations were present per tumour (Molenaar et al., 2012;

Peifer et al., 2015; Pugh et al., 2013; Sausen et al., 2013). This is consistent with evidence that cancers

in paediatric patients carry fewer genetic alterations than adult cancers (Alexandrov et al., 2013; Jones

et al., 2008; Parsons et al., 2011; Vogelstein et al., 2013). The most frequently mutated genes in high-

risk NB are ALK (9.2%), ATRX (9.6%), PTPN11 (2.9%), MYCN (1.7%), and NRAS (0.83%) (Pugh et al., 2013).

Of interest, alterations to the ATRX gene were seen at rates comparable to ALK (Molenaar et al., 2012;

Peifer et al., 2015; Pugh et al., 2013) and predominantly in older patients without MYCN amplification

(Cheung et al., 2012; Peifer et al., 2015; Pugh et al., 2013). This suggests that ALT may be a significant

factor in NB pathogenesis, particularly for older patients. One study also identified the chromatin

remodelling genes ARID1A and ARID1B as altered in 11% of tumours and associated with poor survival

(Sausen et al., 2013). The Rac/Rho and neuritogenesis pathways were identified as frequently defective

in NB tumours in one study (Molenaar et al., 2012) however, this was not evident in the high-risk tumour

cohort of Pugh and colleagues (Pugh et al., 2013). Whilst mutations to TP53 are one of the most common

45

events in cancer overall, the gene is rarely mutated at diagnosis in NB (Vogan et al., 1993), although 15%

of recurrent tumours have acquired a TP53 mutation (Carr-Wilkinson et al., 2010).

Chromothripsis is a form of chromosomal rearrangement caused by the shattering of a

chromosomal region which results in the random reassembly of most of the fragments by DNA repair

mechanisms (Stephens et al., 2011). Analysis of structural rearrangements in NB identified

chromothripsis in 18% of high-stage tumours and absent in low-stage tumours (Molenaar et al., 2012).

Consequently, chromothripsis correlated with poor outcome although, subsequent studies found

chromothripsis in only 0-4% of NB (Peifer et al., 2015; Sausen et al., 2013). Another structural event that

has been identified in 24-31% of high-risk NB is a structural rearrangement 30-50 kb upstream of the

hTERT promoter on chromosome 5 (Peifer et al., 2015; Valentijn et al., 2015). This rearrangement results

in an upregulation of hTERT mRNA expression due to super-enhancer elements now adjacent to the

hTERT transcription start site (Peifer et al., 2015; Valentijn et al., 2015). The implication of these studies

is that NB is not a disease driven by a single mutation but rather by rare mutations, copy number

variation, structural rearrangements, and possibly epigenetic changes.

Mutations to the p53 pathway have been identified as events that contribute to drug resistance

and ultimately relapse in NB (Keshelava et al., 2001). Recently, next generation sequencing approaches

have been used to identify novel mutations acquired by relapse tumours. Relapse tumours have a 1.5-

2-fold increase in single nucleotide variations (SNVs) compared to primary tumours (Eleveld et al., 2015;

Schramm et al., 2015). Like primary tumours, relapse is not driven by one causative genetic aberration.

Schramm and colleagues identified genes involved in the epithelial-mesenchymal transition, a process

involved in cell migration, invasion and metastasis, as the most common pathway with aberrations in

relapse tumours (Schramm et al., 2015) however, this has yet to be validated in another tumour cohort.

The increased allelic frequency of CHD5, a putative tumour suppressor gene, from the primary to relapse

tumour suggests that clonal selection of the primary tumour occurs, likely due to therapy (Schramm et

al., 2015). A similar clonal evolution was observed in relapse tumours with activating ALK mutations in

46

which both increased allelic fraction of the ALK mutation, and an increase in the overall number of

tumours effected by ALK mutations (7-9% of primary tumours to 20-26% of relapse tumours) was

observed (Padovan-Merhar et al., 2016; Schleiermacher et al., 2014). Activating mutations to the

RAS/MAPK pathway have been identified in primary tumours and several studies have found this is

enriched in relapse tumours due to novel mutations and clonal selection (Eleveld et al., 2015; Padovan-

Merhar et al., 2016). Hence, the genome of NB tumours continually evolve under the selective pressure

of treatment and biopsies of relapse tumours are required for the use of targeted therapy in these

patients.

1.5.6. Prognostic relevance of telomerase activity

Telomerase expression in NB was first described over two decades ago. The initial studies utilised the

TRAP assay to determine telomerase activity. In 1995 Hiyama and colleagues detected telomerase

activity in 94% of tumours although, the level of activity ranged from high (20% of tumours) to low (76%

of tumours) (Hiyama et al., 1995a). Low telomerase activity was detected in the majority of stage 1 and

2 tumours whereas high telomerase activity was observed in stage 3 and 4 tumours. This correlated

with a poor patient outcome in 75% of tumours with high telomerase activity but only 3.3% of tumours

which exhibited low telomerase activity. Another study reported a similar number of tumours (96%) had

detectable telomerase activity and that the level of activity correlated with patient outcome (Hiyama et

al., 1997). It was therefore, concluded that telomerase activity could be a prognostic factor for NB.

Further studies confirmed that telomerase activity correlated with NB prognostic risk group

although, the total percentage of NB tumours reported as telomerase-positive decreased compared to

the initial two studies. These studies described 20% (Poremba et al., 1999), 24% (Krams et al., 2001),

29% (Poremba et al., 2000), 35% (Choi et al., 2000), and 37% (Onitake et al., 2009) of NBs as telomerase-

positive. The discrepancy between studies may be the result of false-positive TRAP results due to the

sensitivity of the PCR. Approximately 10% of localised NB tumours maintain telomere length via

telomerase compared to nearly 60% of metastatic disease (Poremba et al., 1999). Despite the varying

47

percentages of telomerase-positive NBs there is a correlation between high telomerase activity and

poor prognosis (30-45% 5-year overall survival depending on tumour cohort) (Ohali et al., 2006; Onitake

et al., 2009; Poremba et al., 2000).

Telomerase activity has also been identified in some, but not all, stage 4S tumours that exhibit

progressive disease (Brinkschmidt et al., 1998) and has been associated with fatal 4S tumours (Choi et

al., 2000). It has been proposed that the spontaneous regression of stage 4S tumours is the result of

telomere shortening and subsequent cellular senescence that occurs due to the low telomerase activity

in these tumours (Brinkschmidt et al., 1998). Indeed, examination of the telomere length of progressive

liver metastases biopsied from a single patient at different time points showed telomere shortening in

spite of low levels of telomerase (Hiyama et al., 1995a).

There are several ways that NB cells can upregulate telomerase activity. The amplification of

MYCN has been associated with upregulated telomerase activity, in one study 65% of tumours with high

telomerase activity were also MYCN amplified (Hiyama et al., 1997). This correlation is likely due to

MYCN driven telomerase activity as the hTERT promoter contains binding sequences for the MYCN

transcription factor (Cong et al., 1999; Mac et al., 2000; Wang et al., 1998). Expression of hTERT can also

be upregulated as a result of two mutations upstream of the promoter. However, this appears to be a

rare event in NB with 0/131 primary tumours harbouring either a C228T or a C250T mutation and only

3/19 cell lines (all derived from the same tumour) having a C228T mutation (Lindner et al., 2015).

Instead, up to 31% of NB tumours activate telomerase via chromosome 5 structural rearrangements

(Peifer et al., 2015; Valentijn et al., 2015). A breakpoint 30-50 kb upstream or 6-40 kb downstream of

the hTERT promoter results in the introduction of super-enhancer elements and the consequent

upregulation of hTERT mRNA expression. This event is mutually exclusive with MYCN amplification and

also with ATRX aberrations (Peifer et al., 2015; Valentijn et al., 2015). Telomerase activity has also been

identified in all but four NB cell lines screened to date (4/40 cell lines; Farooqi et al., 2014).

48

Given the correlation between telomerase activity and poor prognosis in NB, the mechanism

has become a target for the development of novel NB therapy. Long term treatment (4-6 weeks) with

the telomerase inhibitor telomestatin, at non-toxic concentrations in four NB cell lines, results in a

reduction in the growth rate of cells, a decrease in telomere length, and an increase in apoptosis (Binz

et al., 2005). This suggests that therapies targeting TLMs may have therapeutic relevance in NB.

1.5.7. ALT in neuroblastoma

A subgroup of NB tumours upregulates telomerase activity to maintain their telomere length however,

between 20 and 60% of high-risk tumours do not have detectable telomerase activity (Krams et al.,

2001; Onitake et al., 2009; Poremba et al., 2000; Poremba et al., 1999). The first evidence of ALT in NB

relied on telomere length to identify the mechanism. Long and heterogeneous telomere lengths, a

phenotypic characteristic of ALT, were observed in 5/9 telomerase-negative patients who had

protracted but fatal disease (Onitake et al., 2009). Another study utilising telomere length as a marker

of ALT indicated the mechanism may be used by up to 59% of NB tumours (Pezzolo et al., 2015). A

subsequent study that utilised telomere length and APBs to determine ALT activity confirmed that ALT

tumours have a poor outcome, approximately 45% 5-year overall survival, despite lacking poor

prognostic markers such as MYCN amplification (Lundberg et al., 2011).

Aberrations of the ATRX gene have been reported in NB tumours (Kurihara et al., 2014;

Lundberg et al., 2011; Onitake et al., 2009; Valentijn et al., 2015) and correlate with an upregulated ALT

mechanism in other tumour types (Chen et al., 2014; Heaphy et al., 2011a; Jiao et al., 2012; Jiao et al.,

2011). In NB, alterations to the ATRX gene associate with long telomeres, suggestive of ALT, and patients

with these tumours are older at diagnosis (ATRX mutations in 44% of patients aged ≥12 years, 17% of

patients aged 18 months to <12 years and 0% patients aged <18 months) (Cheung et al., 2012). A

retrospective examination of the tumours by Onitake and colleagues found all ALT tumours had an

aberration to ATRX or DAXX and that ATRX alterations led to a 5-year overall survival of approximately

40% (Kurihara et al., 2014). Mutations in ATRX or DAXX have been identified in 10-22% of high-risk NB

49

tumours (Cheung et al., 2012; Peifer et al., 2015; Valentijn et al., 2015). In most studies alterations to

the ATRX, hTERT, and MYCN genes are mutually exclusive (Cheung et al., 2012; Peifer et al., 2015;

Valentijn et al., 2015) and lead to a similarly poor overall survival rate of approximately 25% (Valentijn

et al., 2015).

A caveat of using large genome studies to identify ALT is that ATRX and DAXX mutations are not

a universal feature of the mechanism and relying on these genetic events would underestimate ALT in

NB. To date four telomerase-negative NB cell lines derived from metastatic disease have been identified

(Choi et al., 2000; Farooqi et al., 2014). Only one of these cell lines (CHLA-90) exhibited classical ALT

phenotypes including abundant C-circles and APBs, was MYCN non-amplified and ATRX and TP53

mutated, whilst a second cell line (SK-N-FI) retained wild type ATRX/DAXX expression but otherwise

exhibited classical features of ALT (Farooqi et al., 2014). Therefore, it appears that ALT is present and

clinically relevant in NB, although no study to date has utilised C-circles, the quantifiable ALT marker, to

identify ALT in NB tumours.

1.6. Aims of the project

High-risk NB confers a very poor prognosis and the identification of novel biomarkers is required for the

development of better therapy for these patients. Recent studies have identified mutations to genes

involved in TLMs as relatively frequent events in NB (Cheung et al., 2012; Peifer et al., 2015; Valentijn

et al., 2015). Telomerase activity is associated with poor outcome (Ohali et al., 2006; Onitake et al.,

2009; Poremba et al., 2000), whilst the identification of ALT has relied on genetic markers or telomere

length to identify the presence of this mechanism rather than C-circles, the active marker of ALT (Cheung

et al., 2012; Lundberg et al., 2011; Onitake et al., 2009; Peifer et al., 2015; Valentijn et al., 2015).

Consequently, the initial aim of this study was to determine the prognostic relevance of ALT in high-risk

NB utilising telomere length and abundant C-circles (Lau et al., 2013). Unexpectedly, we identified a

subgroup of high-risk tumours that lacked C-circles but had a telomere content indistinguishable from

50

ALT tumours and no telomerase activity. Therefore, the aim of this study became to investigate the

telomere biology of ALT-negative/long telomere NB. Specifically we sought to:

1. Determine if a subgroup of fatal malignant NB tumours can develop in the absence of a TLM

and the consequence of extensive proliferation on the telomere length of these cells.

2. Examine the effect of activation of a TLM on ALT-negative/long telomere NB cells.

3. Study the association between telomere biology and sensitivity to chemotherapeutics in NB.

4. Investigate similar phenotype in other tumour types.

51

Chapter 2:

Materials and Methods

52

Chapter 2: Materials and Methods

2.1. Buffers and solutions

The buffers and solutions used throughout the methods are listed in Table 2.1.

Table 2.1. Composition of common buffers and solutions.

Solution Composition

6X DNA loading buffer 0.0001% (v/v) SDS 15% (w/v) Ficoll 400

0.25% (w/v) Bromophenol blue 6X TBE (Tris, borate and EDTA)

10X phosphate buffered saline (PBS) 1.37 M NaCl 0.1 M Na2HPO4

0.018 M KH2PO4

20X saline-sodium citrate (SSC) 3 M NaCl 0.3 M Tri-sodium citrate

Tris, borate and EDTA (TBE) 0.9 M Tris pH 8 0.9 M Boric acid

0.02 M ethylenediaminetetraacetic acid (EDTA)

Tris-EDTA (TE) 10 mM Tris pH 7.6 0.1 mM EDTA

2.2. Patient samples

The study cohort contained 149 high-risk NB samples: 19 frozen tumour specimens from The Children’s

Hospital at Westmead Tumour Bank (Australia), 46 DNA samples from the Children’s Cancer Institute

Tumour Bank (Australia), and 84 samples (35 frozen and 49 DNA) from the Children’s Oncology Group

Neuroblastoma Biobank (USA). High-risk NB was defined as tumours with MYCN amplification or

metastatic disease in patients aged ≥12 months. The samples were obtained at original diagnosis and

data on sex, age at diagnosis, tumour stage, MYCN status (Figure 2.1), and survival were retrieved from

the clinical database from the source of the sample. The Sydney Children’s Hospital Network and

Northern Hospital Network Human Research Ethics Committees provided ethics approval for this study.

53

Figure 2.1. Schematic of neuroblastoma (NB) tumours used in this study based on MYCN

amplification status.

One hundred and forty-nine high-risk NB tumours were examined in this study, 55 were MYCN

amplified and 94 were MYCN non-amplified tumours.

2.3. Cell culture

NB cell lines (characteristics of 6 cell lines predominantly used in the thesis in Table 2.2), and ALT and

telomerase lines used as controls (Table 2.3), were cultured with medium supplemented with fetal

bovine serum (FBS) and additional additives, as listed in Table 2.4. All cell lines were grown in a

humidified incubator at 37°C with atmospheric oxygen and 5% CO2, except COG-N-328h which was

grown under normoxic conditions (5% oxygen balanced with nitrogen). Cell lines were authenticated by

16-locus short tandem repeat (STR) profiling and were found to be free of Mycoplasma species by

CellBank Australia (Children’s Medical Research Institute, Westmead, NSW, Australia).

2.4. Vectors and viral transfections

Plasmid contructs pBABE-hTERT (Counter et al., 1998a), pBABE-hTR (Wong and Collins, 2006), pBABE

hTR/hTERT (Wong and Collins, 2006), and pBABE empty vector (Morgenstern and Land, 1990) were

obtained from Addgene (Plasmid #1771, 27666, 27665, 1764, respectively). Retrovirus was generated

by Lipofectamine 2000 (Life Technologies) transfection of Phoenix-AMPHO cells (ATCC CRL-3213) with

the plasmids, followed by harvest of the retrovirus 24 hours (hrs) later. LA-N-6 cells were retrovirally

transduced by two rounds of viral infection with 4 µg/mL polybrene (Sigma) and retrovirus. Cells that

stably expressed the plasmid were selected with culture medium containing 0.3 µg/mL puromycin (Life

54

Table 2.2. Characteristics of NB cell lines

Cell Line Patient Characteristics

Tissue sample of origin

Tumour Formation in

Mice

References

SH-SY5Y Stage 4, Female,

48 months old at diagnosis

Progressive disease, post

chemotherapy, bone marrow

Yes (Ross et al., 1983) (Nevo et al., 2008)

SK-N-BE2c Stage 4, Male,




Yes (Biedler et al., 1978) (Ciccarone et al. 1989) (Reynolds et al., 1988)

SK-N-FI

Stage 4, Male,




Yes (Reynolds et al., 1988) (Tsutsumimoto et al.,

2014) (Farooqi et al., 2014)

CHLA-90

Stage 4, Male,


Progressive disease, bone

marrow transplant

(Keshelava et al., 1998)

LA-N-6

Stage 4, Male,




Yes (Reynolds et al., 1988) (Wada et al., 1993)

COG-N-291 Progressive

disease, post chemotherapy

(Farooqi et al., 2014)

Table 2.3. Telomere lengthening mechanism of control cell lines

Cell Line Telomere Lengthening Mechanism

Reference

A2182 Telomerase + (Ng et al., 2009)

DOS16 ALT + (Henson et al., 2009)

G292 ALT + (Bryan et al., 1997)

GM639 Telomerase + (Bryan et al., 1995)

GM847 ALT + (Bryan et al., 1995)

HeLa 1.2.11 Telomerase + (Whitaker et al., 1995)

HFF5 Mortal (Bryan et al., 1995)

HT1080 Telomerase + (Whitaker et al., 1995)

HT1080 hTR Telomerase + (Pickett et al., 2009)

IIICF/c ALT + (Bryan et al., 1995)

MeT-4A ALT + (Bryan et al., 1995)

MG-63 Telomerase + (Bryan et al., 1997)

MRC-5 Mortal (Huschtscha and Holliday, 1983)

SAOS-2 ALT + (Bryan et al., 1997)

U-2 OS ALT + (Bryan et al., 1997)

55

Technologies) for 7 days. Sub-clones were isolated by plating cells, post puromycin selection, at a density

of 100 cells/mL with conditioning medium.

2.5. Cell proliferation assay

Cells were seeded in 96-well plates according to the density in Table 2.5 and treated with serial dilutions

of drugs (6 wells were treated with every drug concentration; Table 2.6) at 37°C with 5% CO2 for 6 PDs.

Drugs were replenished every 72 hrs and experiments were performed in triplicate. At the end of

treatment 10 µL of AlamarBlue (Thermo Fischer Scientific) was added to each well containing 100 µL of

medium/drug and incubated at 37°C with 5% CO2 for 4 hrs. AlamarBlue is a fluormetric indicator, where

the change in fluorescence correlates with the number of metabolically active cells. The fluorescence

was measured in a fluorescence plate reader (EnSpire, Perkin Elmer) with an excitation wavelength 570

nm and an emission wavelength at 585 nm. The results were expressed as a percentage of the untreated

control and GraphPad Prism6 was used to determine the IC50 dose (the dose that inhibited 50% of

untreated control cells growth).

2.6. Immunostaining and fluorescence in situ hybridisation (FISH)

2.6.1. ATRX and DAXX immunofluorescence (IF)

Cells grown in two-well chamber slides were washed once with 1X PBS and then fixed with 4% PFA for

10 minutes (mins) at room temperature. The cells were rinsed with 2X PBS and permeabilised in 0.1%

Triton-X for 10 mins, and then washed again with 2X PBS. Cells were blocked, at room temperature, with

5% goat serum/bovine serum albumin (BSA) for 20 mins before the cells were incubated for 1 hr at 37°C

with either anti-ATRX or DAXX rabbit polyclonal antibody (Sigma) diluted 1:500 in 3% BSA/4X SSC. To

remove excess antibody, the cells were washed three times with 0.1% Tween-20/4X SSC and were then

incubated with Alexa Fluor 594 goat anti-rabbit secondary antibody (Invitrogen) diluted 1:1000 in 3%

BSA/4X SSC. After incubation at room temperature for 1 hr, the cells were washed three times with 0.1%

Tween-20/4X SSC and the DNA was stained with 20 µg/mL 4, 6 diamidino-2-phenylindole (DAPI) in 1X

56

Table 2.4. Cell culture medium.

Cell Line Cell Type Medium FBS (%) Additives

A2182 Lung Carcinoma DMEM- with L-glutamine 10

CHLA-42 Neuroblastoma IMDM 15 2% L-glutamine

1X ITS


1X ITS


1X ITS


1X ITS


1X ITS


1X ITS


1X ITS


1X ITS


1X ITS


1X ITS

CHP-134 Neuroblastoma RPMI-1640 10 1% L-glutamine

COG-N-291 Neuroblastoma IMDM 15 2% L-glutamine

1X ITS

COG-N-328h Neuroblastoma IMDM 20 2% L-glutamine

1X ITS

COG-N-347 Neuroblastoma IMDM 20 2% L-glutamine

1X ITS

DOS16 Leiomyosarcoma RPMI-1640 10

FU-NB-2006 Neuroblastoma IMDM 15 2% L-glutamine

1X ITS

G292 Osteosarcoma McCoy's 5a Medium

Modified 10

GM639 Fibroblast, skin DMEM- with L-glutamine 10

GM847 Fibroblast, skin DMEM- with L-glutamine 10

HeLa 1.2.11 Cervical carcinoma RPMI-1640 10 1% L-glutamine

HFF5 Fibroblast, foreskin DMEM- with L-glutamine 10

HT1080 Fibrosarcoma DMEM- with L-glutamine 10

57

Abbreviations: DMEM, Dulbecco’s Modified Eagle’s Medium; IMDM, Iscove's Modified Dulbecco's

Medium; LHC-MM, Laboratory of Human Carcinogenesis Mesothelial Medium; MEM, minimum

essential medium; ITS, insulin-transferrin-selenium-sodium pyruvate; NEAA, non-essential amino acids;

RPMI-1640, Roswell Park Memorial Institute 1640.

HT1080 hTR Fibrosarcoma DMEM- with L-glutamine 10

IIICF/c

Fibroblast, breast,

Li-Fraumeni

syndrome

DMEM- with L-glutamine 10

IMR32 Neuroblastoma DMEM- with L-glutamine 10

KELLY Neuroblastoma RPMI-1640 10 1% L-glutamine

LA-N-1 Neuroblastoma MEM-F12 with L-glutamine 10 1% NEAA

LA-N-2 Neuroblastoma MEM-F12 with L-glutamine 10 1% NEAA

LA-N-5 Neuroblastoma RPMI-1640 10 1% L-glutamine

LA-N-6 Neuroblastoma RPMI-1640 10 1% L-glutamine

MeT-4A Mesothelial LHC-MM 3

MG-63 Osteosarcoma DMEM- with L-glutamine 10

MRC-5 Fibroblast, lung DMEM- with L-glutamine 10

NB69 Neuroblastoma RPMI-1640 10 1% L-glutamine

SAOS-2 Osteosarcoma DMEM- with L-glutamine 10

SH-EP Neuroblastoma DMEM- with L-glutamine 10

SH-SY5Y Neuroblastoma DMEM- with L-glutamine 10 1% NEAA

SK-LU-1 Adenocarcinoma DMEM- with L-glutamine 10

SK-N-AS Neuroblastoma DMEM- with L-glutamine 10

SK-N-BE1 Neuroblastoma RPMI-1640 10 1% L-glutamine

SK-N-BE2c Neuroblastoma DMEM- with L-glutamine 10

SK-N-DZ Neuroblastoma DMEM- with L-glutamine 10

SK-N-FI Neuroblastoma RPMI-1640 10 1% L-glutamine

SK-N-SH Neuroblastoma DMEM- with L-glutamine 10

SMS-KANR Neuroblastoma RPMI-1640 10 1% L-glutamine

SMS-KCN Neuroblastoma RPMI-1640 10 1% L-glutamine

SMS-KCNR Neuroblastoma RPMI-1640 10 1% L-glutamine

SMS-LHN Neuroblastoma RPMI-1640 10 1% L-glutamine

SMS-SAN Neuroblastoma RPMI-1640 10 1% L-glutamine

U-2 OS Osteosarcoma DMEM- with L-glutamine 10

58

Table 2.5. Seeding density of cell lines in the cell proliferation assay.

Cell Line Seeding Density (X104 cells/well)

COG-N-291 1.6

CHLA-90 0.25

GM639 0.125

GM847 0.1

HeLa 1.2.11 0.38

HT1080 0.1

HT1080 hTR 0.2

LA-N-6 2.5

SK-N-BE2c 0.15

SK-N-FI 1

SH-SY5Y 0.375

U-2 OS 0.125

PBS for 1 min. The slides were rinsed with water and mounted in DABCO (2.33% antifade compound

1,4-Diazabicyclo[2.2.2]octane [Sigma], 90% [v/v] glycerol, 20 mM Tris-HCl pH 8.0). Cells were

considered ATRX or DAXX positive when foci were present in the nucleus.

2.6.2. APB detection

Cell cultures were harvested by trypsinisation and resuspended in buffered hypotonic solution (United

Biosciences). The cells (110,000 cells/mL) were cytocentrifuged onto SuperFrost Plus glass slides

(Menzel-Glaser) at 110 x g for 10 min in a Shandon Cytospin 4 with medium acceleration. Slides were

permeabilised at room temperature for 10 mins with KCM buffer (120 mM KCl, 20 mM NaCl, 10 mM Tris

pH 7.5, 0.1% Triton X-100), rinsed in 1X PBS, and fixed in 4% (v/v) formaldehyde in 1X PBS at room

temperature for 10 mins. After several rinses with 1X PBS, the slides were treated with 100 µg/mL

DNase-free RNase A (Sigma) in antibody dilution buffer (ABDIL; 20 mM Tris pH 7.5, 2% BSA, 0.2% fish

gelatin, 150 mM NaCl, 0.1% Triton X-100, 0.1% sodium azide) at 37°C for 30 mins. The slides were then

incubated at 37°C for 1 hr with mouse anti-PML antibody (PG-M3; Santa Cruz), diluted 1:250 in ABDIL.

Slides were washed three times with 0.1% Tween-20/1X PBS and then incubated with Alexa Fluor 594

goat anti-mouse secondary antibody (Invitrogen; 1:1000). Following the incubation at 37°C for 30 mins,

the cells were washed three times with 0.1% Tween-20/1X PBS, and proteins were cross-linked with 4%

59

PFA for 10 mins at room temperature. The cells were dehydrated with an ethanol series (70%, 90%, and

100%) and then telomeric DNA was detected using the 5’ labelled telomere-specific peptide nucleic acid

(PNA) probe, Alexa 488-(CCCTAA)3 PNA probe (PNA Bio) (Chen et al., 1999; Perrem et al., 2001). After

the probe was placed on the slide, the DNA was denatured at 80°C for 3 mins and the probe was

hybridised for 3 hrs at room temperature. Unhybridised probe was removed by washing with Buffer A

(70% formamide, 0.01 M Tris pH 7.5, 0.1% BSA) for 15 mins, and then the nuclei were stained with DAPI

(20 µg/mL) in wash Buffer B (0.1 M Tris pH 7.5, 0.15 M NaCl, 0.08% Tween-20) for 3 mins. The slides

were washed with 1X PBS and rinsed in water before mounting in DABCO antifade mounting medium.

A Zeiss Axio Imager Z2 with ApoTome was used to capture Z-stacked images (ACRF Telomere Analysis

Centre). Quantitation was completed on three independent experiments, on at least 100

cells/experiment, using Zeiss ZEN software. An APB was defined as the colocalisation of telomeric DNA

and PML protein of any size (Yeager et al., 1999).

2.6.3. MetaTIF assay

Cell cultures were treated with 50 µg/mL vinblastine for 1 hr at 37°C in 5% CO2 to obtain metaphase

chromosomes. Cells were harvested by trypsinisation and resuspended in buffered hypotonic solution

at 37°C. NB cultures were incubated for 20 mins whereas control cell lines were incubated for 5 mins.

To obtain metaphase spreads 110,000 cells/mL were cytocentrifuged onto SuperFrost Plus glass slides

at 450 x g (high acceleration) for 10 min in a Shandon Cytospin 4. Slides were then permeabilised with

KCM buffer for 10 mins, rinsed in 1X PBS three times, and fixed in 4% (v/v) formaldehyde in 1X PBS for

10 mins at room temperature. The slides were treated with 100 µg/mL RNase A in ABDIL at 37°C for 30

mins, and then incubated for 1 hr at 37°C with mouse anti-γH2AX antibody (Ser139 Clone JBW301;

Merck Millipore) diluted 1:300 with ABDIL. To remove excess antibody, the slides were washed three

times and then incubated with Alexa Fluor 594 anti-mouse secondary antibody (1:1000 in ABDIL) at 37°C

for 30 mins. Slides were washed three more times with 0.1% Tween-20/1X PBS, cross-linked with 4%

PFA for 10 mins, and dehydrated with increasing concentrations of ethanol (70%, 90% and 100%).

Telomeric DNA was detected using the Alexa 488-(CCCTAA)3 PNA probe, applied to the slide prior to

60

Table 2.6. List of drugs and stock concentrations.

Drug Company Target Diluent Highest Drug

Concentration

Dilution

Factor

for Serial

Dilution

All trans

retinoic acid AbCam Differentiation induction Ethanol 45 µM 3

Aphidicolin AbCam DNA replication inhibitor DMSO 30 µM 6

Arsenic Trioxide Sigma-

Aldrich

Complex mode of action,

causes apoptosis

1 M

NaOH 10 µM 3

Cisplatin Cayman

Chemicals Cross-links DNA

0.9%

Saline

(w/v)

30 µM 4

Doxorubicin Cayman

Chemicals

Interferes with enzymes

involved in DNA

replication

DMSO 1.5 µM 5

Etoposide Cayman

Chemicals

Topoisomerase II

inhibitor DMSO 400 µM 10

Hydroxyurea AbCam Ribonucleotide reductase

inhibitor DMSO 1600 µM 2

Irinotecan Cayman

Chemicals Topoisomerase I inhibitor DMSO 600 µM 6

KU-60019 Selleckchem ATM inhibitor DMSO 24 µM 2

Mitomycin C Selleckchem

Interferes with enzymes

involved in DNA

replication

Water 3 µg/mL 4

ML216 Sigma-

Aldrich Bloom helicase inhibitor DMSO 225 µM 3

Temozolomide Cayman

Chemicals

Alkylating agent, induce

DNA damage DMSO 400 µM 6

Topotecan Cayman

Chemicals Topoisomerase I inhibitor DMSO 90 µM 12

VE-822 Selleckchem ATR inhibitor DMSO 7 µM 5

Vincristine AbCam Mitotic inhibitor DMSO 0.05 µM 6

denature at 80°C for 3 mins. After hybridisation of the probe at room temperature for 3 hrs, the slides

were washed with Buffer A for 15 mins. The DNA was stained with 20 µg/mL DAPI/Buffer B for 3 mins

and rinsed with water several times before mounting in DABCO. Images were obtained on the Metafer

61

slide scanning system (ACRF Telomere Analysis Centre) and a meta-TIF was defined as the localisation

of γ-H2AX protein to the end of the chromosome (with or without the presence of telomere signal)

(Cesare et al., 2009). Quantitation was performed, in triplicate, on at least 1000 chromosome ends.

2.6.4. Telomere FISH on metaphase spreads

Metaphase chromosomes were obtained by treating cells with vinblastine (50 µg/mL) overnight for 16

hrs. Cell cultures were harvested by trypsinisation, resuspended in buffered hypotonic solution at 37°C

for 20 mins, fixed (3:1 methanol/glacial acetic mix) and dropped onto SuperFrost Plus glass slides. The

slides were baked at room temperature overnight, then treated with 100 µg/mL RNase A at 37°C for 30

mins, and then dehydrated with increasing concentrations of ethanol. FISH was performed with an Alexa

Fluor 488 telomere specific PNA probe applied to the slide prior to denaturing the DNA for 3 mins at

80°C. After a 3 hr hybridisation, the slides were washed for 15 mins with Buffer A to remove excess

probe. A second wash (with Buffer B) was performed for 5 mins at room temperature, and then the

slides were stained with DAPI (20 µg/mL in PBS) for 3 mins to visualise the DNA. The slides were washed

with 1X PBS, rinsed with water and mounted in DABCO. Fluorescence microscopy images were obtained

on the Metafer slide scanning system (ACRF Telomere Analysis Centre) and the intensity of the telomere

signal was quantitated using TFL-Telo software (Zijlmans et al., 1997) in fifteen metaphase spreads for

each sample.

2.6.5. Telomere sister chromatid exchange (T-SCE) analysis

T-SCE analysis was performed as previously described (Bailey et al., 2004). Briefly, cells were cultured in

medium containing a 3:1 ratio of BrdU:BrdC (Sigma) with vinblastine (50 µg/mL) added for the final 16

hrs. Metaphases were harvested and resuspended in buffered hypotonic solution at 37°C for 20 mins.

Chromosomes were then fixed with 3:1 ice-cold methanol:acetic acid and dropped onto SuperFrost Plus

glass slides. The slides were incubated at 37°C for 30 mins with 100 µg/mL DNase-free RNase A (Sigma)

in 2X SSC. Slides were postfixed with 4% formaldehyde in PBS for 10 mins and then dehydrated in an

ice-cold ethanol series (75, 85, 100%) for 2 mins each. Metaphase spreads were stained with 0.5 µg/mL

62

Hoechst 33258 at room temperature for 15 mins and exposed to long wave 365 nm UV light for 45 mins.

An exonuclease III (NEB) digest was then performed for 30 mins at 37°C. The chromosomes were

denatured for 5 mins at 80°C in 70% formamide/30% 2X SSC before the slides were dehydrated in an

ice-cold ethanol series as previously described. The slides were incubated overnight with 0.3 µg/ml

TAMRA–OO-(TTAGGG)3 PNA probe (PNA Bio) and washed with Buffer A for 15 mins followed by a wash

with Buffer B for 5 mins at room temperature. Slides were incubated with 0.3 µg/ml Alexa 488–OO-

(CCCTAA)3 PNA probe overnight and washed with buffer A and B as previously described prior to staining

with DAPI (20 µg/mL in PBS) for 3 mins to visualise the DNA. Lastly, the slides were washed with 1X PBS,

rinsed with water and mounted in DABCO. Imaging was performed on the Metafer slide scanning system

(ACRF Telomere Analysis Centre).

2.7. DNA extraction and quantitation

Genomic DNA was extracted by lysis at 37°C overnight with 2% sodium dodecyl sulphate (SDS) buffer

containing 50 mM Tris, 20 mM EDTA, and 200 µg/mL Pronase protease (Sigma). Lysis was followed by 2

hrs salt precipitation at 4°C with 1.4 M NaCl, followed by serial centrifugation (15 mins at 3900 x g) until

the white precipitant was removed. The DNA was precipitated at 4°C overnight with 100% ethanol (2.5

X volume of lysis buffer with NaCl), before centrifugation at 3900 x g for 30 mins. The DNA pellet was

washed with 70% ethanol, centrifuged for 15 mins, and then allowed to air-dry. The DNA was

resuspended in TE and quantitated with a Qubit Fluorometer (Invitrogen).

2.8. C-circle assay

2.8.1. Slot-blot detection

Rolling circle amplification of C-circles was performed on 10 ng of genomic DNA. The assay was

performed with and without Φ29 polymerase for each sample. The DNA (10 µL) was added to 10 µL of

the amplification mix, for a 20 µL reaction containing 4 µM DL-Dithiothreitol (DTT), 200 µg/mL BSA, 0.1%

Tween-20, 1X Φ29 buffer (New England BioLabs), 7.5 Units Φ29 polymerase (New England BioLabs), and

63

1 mM each of dATP, dGTP and dTTP (Roche), which was incubated at 30°C for 8 hrs and then at 65°C for

20 mins to heat inactivate the enzyme (Henson et al., 2009). The C-circle assay product was diluted with

100 µL of 2X SSC, and using slot-blot apparatus, blotted onto a Biodyne B 0.45 µM nylon membrane

(Pall). The membrane was dried and then the DNA was UV-cross-linked onto the membrane in a

Stratagene UV Stratalinker 1800. PerfectHyb Plus buffer (Sigma) was used to pre-hybridise the

membrane for 1 hr at 37°C, and a 32P-ATP-labelled (CCCTAA)3 telomeric probe was hybridised to the

DNA overnight, under native conditions. The membrane was washed four times at 37°C with 0.5X

SSC/0.1% SDS for 15 mins and exposed to a storage phosphor screen, which was scanned on a Typhoon

imager (GE Healthcare) the following day. Signals were quantitated using ImageQuant (GE Healthcare)

and the level of C-circles was calculated by subtracting the 32P-probe signal of the C-circle assay without

Φ29 from that of the C-circle assay with Φ29.

2.8.2. Exonuclease treatment of DNA

Genomic DNA was pretreated with 6 U/ug of the restriction enzymes HinfI and RsaI (New England

BioLabs) and 25 ng/µg RNase (Roche) at 37°C for 12 hrs, followed by heat inactivation of the enzymes

at 80°C for 20 mins. The digested DNA was ethanol precipitated (0.3 volume of 10 M ammonium acetate

and 3.3 volumes of 100% ethanol with 1 µL glycogen) and resuspended in TE, prior to quantitation by

the Qubit Fluorometer. To remove linear DNA from the C-circle reaction, 1 µg of pretreated DNA was

digested with lambda exonuclease (12.5 U/µg; New England BioLabs), exonuclease I (100 U/µg; New

England BioLabs), and 1X lambda buffer (New England BioLabs) at 37°C for 20 mins followed by 80°C for

20 mins (Henson et al., 2009). The DNA was quantitated, and additional rounds of exonuclease digestion

were performed, until there was <100 ng of DNA remaining. As a control, a mock reaction without

exonucleases was also carried out for each sample. The exonuclease digested DNA, and control sample,

were precipitated by ethanol precipitation as described above and resuspended in 20 µL Tris. To perform

the C-circle amplification reaction, 5 µL of the DNA was diluted with 5 µL of Tris and added to the

reaction. The rolling circle amplification product was quantitated by slot-blot analysis as described in

section 2.8.1.

64

2.8.3. Telomere quantitative polymerase chain reaction (qPCR) detection

Rolling circle amplification of C-circles was performed on 16 ng (in 5 µL) of genomic DNA, with and

without Φ29 polymerase for each sample. The total reaction volume was 10 µL (including DNA), and the

components and conditions were the same as section 2.8.1, with a modification to the amount of Φ29

polymerase (Lau et al., 2013), which was halved. The 10 µL C-circle assay product was diluted with 30

µL of TE, and 5 µL of the diluted product was used for each PCR. For every sample, the following PCRs

were performed in triplicate: telomere PCR of C-circle assay/Φ29+, telomere PCR of C-circle assay/

Φ29-, single copy gene (SCG) PCR of C-circle assay/Φ29+, and SCG PCR of C-circle assay/Φ29-. The SCG

for NB cell lines and tumours was VAV2 (Lau et al., 2013), whilst the SCG for oesophageal and PanNETs

was HBG, and the SCG for melanoma tumours and cell lines was 36B4 (Lau et al., 2013). Primer

sequences are listed in Table 2.7. A standard curve of DNA was included for each PCR, to allow for

subsequent analysis. Concentrations in the telomere PCR were 2.5, 1, 0.2, 0.04, 0.02, 0.01 ng/µL and

concentrations of the SCG genes were 2.5, 1.25, 0.625, 0.3125, 0.156, 0.078 ng/µL. Each qPCR reaction

consisted of 1X Rotor-Gene SYBR Green (Qiagen), 5 µL C-circle assay product or standard DNA, and the

primer sets. The final primer concentrations were, telomere: forward 500 nM and reverse 500 nM,

VAV2: forward 700 nM and reverse 400 nM, 36B4: forward 300 nM and 500 nM reverse, and HBG:

forward 500 nM and reverse 500 nM. PCR conditions were, telomere: 95°C for 15 mins, 30 cycles of 95°C

for 7 sec and 58°C for 10 sec, VAV2: 95°C for 5 mins, 43 cycles of 95°C for 15 sec, 61°C for 30 sec, and

72°C for 20 sec, and 36B4/HBG: 95°C for 5 mins, 40 cycles of 95°C for 15 sec and 58°C for 30 sec. All PCR

conditions concluded with a melt curve analysis. Analysis was conducted using the two standard curves

method (Cawthon, 2002), and the telomere product was corrected for loading with the SCG product. All

PCR results were expressed as the mean of triplicate reactions. The relative telomeric DNA content (TC)

of a sample was obtained from the mean normalised C-circle assay/Φ29- reaction, relative to the TC of

SK-N-FI or IIICF/c, ALT-positive cell lines with arbitrary TC values of 14.0 and 30.0, respectively. The

relative C-circle level of a sample was the normalised C-circle assay/Φ 29+ subtracted by the normalised

C-circle assay/Φ29-, relative to the C-circle level of SK-N-FI and IIICF/c, with arbitrary values of 196 and

65

100, respectively. Long telomeres were indicated by a relative TC≥15, and a sample was considered ALT+

when the relative C-circle level was ≥7.5 (Lau et al., 2013).

2.9. Telomere length analysis

2.9.1. Telomere restriction fragment (TRF) analysis

Genomic DNA was digested at 37°C for 12 hrs with 6 U/µg of the restriction enzymes HinfI and RsaI (New

England BioLabs) and 25 ng/µg RNase (Roche) (Perrem et al., 2001), followed by heat inactivation of the

enzymes at 80°C for 20 mins. Prior to gel electrophoresis, the DNA was ethanol precipitated (0.3 volume

of 10 M ammonium acetate and 3.3 volumes of 100% ethanol with 1 µL glycogen) and then resuspended

in TE. The digested DNA was quantitated by the Qubit Fluorometer and 1.5 µg/well was loaded on a 1%

(w/v) agarose gel in 0.5X TBE. To resolve bands in COG-N-291 and LA-N-6, the DNA was separated using

pulsed-field gel electrophoresis (BioRad) in 14°C recirculating 0.5X TBE buffer at 6 V/sec for 16 hrs, with

an initial switch time of 1 and final switch time of 6. Gels containing other samples were run for 14 hrs.

The gels were dried for 2 hrs at 65°C, denatured in 0.82 M NaOH/2.5 M NaCl for 1 hr, and neutralised in

0.7 M Tris pH 8/1.5 M NaCl for 1 hr at room temperature. Gels were pre-hybridised for 1 hr at 50°C in

Church buffer (0.5 M Na2HPO4 pH 7.2, 1 mM EDTA, 7% SDS, and 1% BSA) and then hybridised with a 32P-

ATP-labelled (CCCTAA)4 telomeric probe overnight. The gels were washed for 30 mins in 4X SSC, three

times at room temperature and once at 50°C, and then exposed to a storage phosphor screen. The

screen was scanned the following day with a Typhoon imager and the signals were quantitated using

Las4000-Multigauge software. The unweighted mean TRF length was calculated using Telorun software

(Baur et al., 2004), which utilised linear regression analysis of molecular weight marker positions to

calculate telomere length.

2.9.2. Telomere qPCR

The TC of cells, independent of C-circles, can be determined via the protocol described in section 2.8.3.

with modification to the input sample. Rather than rolling circle amplification product, 5 µL of 1 ng/µL

66

Table 2.7. List of primers.

Gene Primer sequence Methods section

Telomere F: 5’-CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT- 3’

R: 5’-GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT- 3’ 2.8.3.

VAV2 F: 5’ -TGGGCATGACTGAAG ATGAC- 3’

R: 5’ -ATCTGCCCTCACCTTCTCAA- 3’ 2.8.3.

36B4 F: 5’ -CAGCAAGTGGGAAGGTGTAATCC- 3’

R: 5’ -CCCATTCTATCATCAACGGGTACAA- 3’ 2.8.3.

HBG F: 5’ -GCTTCTGACACAACTGTGTTCACTAGC- 3’

R: 5’ - CACCAACTTCATCCACGTTCACC- 3’ 2.8.3.

TP53 exon 2-3

F: 5’ -CCAGGTGACCCAGGGTTGGA- 3’

R: 5’ -AGCATCAAATCATCCATTGC- 3’ 2.14.

TP53 exon 4

F: 5’ -TGCTCTTTTCACCCATCTAC- 3’

R: 5’ -ATACGGCCAGGCATTGAAGT- 3’ 2.14.

TP53 exon 5-6

F: 5’ -TGTTCACTTGTGCCCTGACT- 3’

R: 5’ -TTAACCCCTCCTCCCAGAGA- 3’ 2.14.

TP53 exon 7

F: 5’ -CTTGCCACAGGTCTCCCCAA- 3’

R: 5’ -AGGGGTCAGCGGCAAGCAGA- 3’ 2.14.

TP53 exon 8-9

F: 5’ -TTGGGAGTAGATGGAGCCT- 3’

R: 5’ -AGTGTTAGACTGGAAACTTT- 3’ 2.14.

TP53 exon 10

F: 5’ -CAATTGTAACTTGAACCATC- 3’

R: 5’ -GGATGAGAATGGAATCCTAT- 3’ 2.14.

TP53 exon 11

F: 5’ -AGACCCTCTCACTCATGTGA- 3’

R: 5’ -TGACGCACACCTATTGCAAG- 3’ 2.14.

H3F3A exon 1

F: 5’ -GATTTTGGGTAGACGTAATCTTCA- 3’

R: 5’ -AACAAAAAGATGGATAACAGGAAA- 3’ 2.14.

H3F3A exon 2

F: 5’ -TTTCTTTGAAGCTGCCCACT- 3’

R: 5’ -TCCAAATTGTTGCATGTGCT- 3’ 2.14.

H3F3A exon 3

F: 5’ -AGCATCTTGCCCAGTCATTTT- 3’

R: 5’ -CAGGTATTGGCAGTTTTTCCA- 3’ 2.14.

TERT F: 5’-CGGAAGAGTGTCTGGAGCAA- 3’

R: 5’-TCGTAGTTGAGCACGCTGAACAG- 3’ 2.16.1.

TERC F: 5’-CTAACCCTAACTGAGAAGGGCGT- 3’

R: 5’-GGCGAACGGGCCAGCAGCTGAC- 3’ 2.16.1.

Dyskerin F: 5’-GCCGAAATACAACACGCTGAAG- 3’

R: 5’-CAGAGGATTTGAACCACATGCA- 3’ 2.16.1.

GAPDH F: 5‘-ACCCACTCCTCCACCTTTG- 3’

R: 5’-CTCTTGTGCTCTTGCTGGG- 3’ 2.16.1.

SLX4 F: 5’-CTGTGCCATCAAAGCAGAAA-3’

R: 5’-CGGAGATTTTTCTGGGAACA- 3’ 2.16.1.

XRCC3 F: 5’-CCATTCCGCTGTGAATTTG-3’

R: 5’-GCCTCTGTCACCTGGTTGAT- 3’ 2.16.1.

RTEL1 F: 5’-CACTCGCAACTCACACAGGT-3’

R: 5’-TTACGGCACAAGTGGATCTG- 3’ 2.16.1.

ZBTB48 F: 5‘-GGGTGAGGAAGTTTGAGTGC- 3’

R: 5’-ACCACCACCATCTTCTCGTC- 3’ 2.16.1.

NBS1 F: 5‘-CCCACCTCTTGATGAACCAT- 3’

R: 5’-CCCACCTCCAAAGACAACTG- 3’ 2.16.1.

67

MYCN F: 5’-GCCGGAAGAGACAGATAAGC-3’

R: 5’-TTCTCCACAGTGACCACGTC-3’ 2.16.2.

M2 5’-AAT CCG TCG AGC AGA GTT-3’ 2.18.3.

ACX 5’-GCGC GGC TTA CCC TTA CCC TTA CCC TAA CC-3’ 2.18.3.

Abbreviations: F, forward; R, reverse. Primer sequences for section 2.8.3. were described in Henson et al., 2017 & Lau et al., 2013. TP53 primer sequences were obtained from the International Agency for Research on Cancer (IARC) website (http://p53.iarc.fr/Download/TP53_DirectSequencing_IARC.pdf). H3F3A primers were obtained from (Bower et al., 2012) and RT-qPCR primers from section 1.15.1 were obtained from (Cao et al., 2008b). The M2 and ACX primers were described in (Kim and Wu, 1997; Piatyszek et al., 1995).

genomic DNA was added to the PCR. The relative TC of a sample was obtained from the mean of

triplicate telomere reactions normalised to the SCG reactions.

2.10. T-circle detection

T-circles were detected using two-dimensional TRF analysis. Genomic DNA was restriction digested with

HinfI and RsaI, using the TRF protocol. Digested DNA was separated in a 0.6% agarose gel at 1 V/cm for

13.5 hr, in the first dimension. Lanes were excised and run in a 1.1% agarose gel containing 300 ng/mL

ethidium bromide at 6 V/cm for 4 hrs, in the second dimension. Following the TRF protocol in section

2.9.1, gels were dried, denatured and hybridised overnight to a 32P-ATP-labelled (CCCTAA)4 telomeric

probe in Church buffer. Gels were washed, exposed to a storage phosphor screen and scanned on a

Typhoon imager.

2.11. Telomere chromatin immunoprecipitation (ChIP)

2.11.1. Cell lysis and chromatin isolation

Cells were harvested by trypsinisation, washed in 1X PBS and collected as 1X107 cell pellets. Pellets were

resuspended in 1 mL of cell lysis buffer (5 mM HEPES-KOH pH 8, 85 mM KCl, 0.4% [v/v] NP-40, and,

added fresh each time, 1X complete protease inhibitor (Roche), and 1 mM phenylmethylsulphonyl

fluoride [PMSF]) and incubated on ice for 10 mins. To pellet the nuclei, samples were centrifuged at

6000 x g for 15 sec at 4°C, and the supernatant discarded. The chromatin bound proteins were cross-

linked at room temperature with 1% (v/v) formaldehyde in cell lysis buffer, lacking NP-40, for 10 mins.

http://p53.iarc.fr/Download/TP53_DirectSequencing_IARC.pdf

68

To end the fixation, 75 µL of 1.5 M glycine was incubated with the nuclei for 5 mins at room temperature.

The nuclei were centrifuged at 4°C for 15 sec at 6000 x g, and the supernatant was discarded. Nuclei

were lysed with 50 µL nuclei lysis buffer (50 mM Tris-HCl pH 8.1, 1 mM EDTA, 1% [v/v] SDS, added fresh

each time: 1X complete protease inhibitor, and 1 mM PMSF) on ice for 10 mins, and then diluted with

750 µL buffer A, containing 20 mM HEPES-KOH pH 8, 2 mM MgCl2, 300 mM KCl, 1 mM EDTA, 10% (v/v)

glycerol, and 0.1% (v/v) Triton X-100. The DNA was fragmented by sonication on a Branson sonifier in

an ice/ethanol bath. Sonication was performed with a duty cycle of 10, and 60 second pulse/pause cycles

at outputs 3, 4, and 5. Solubilised chromatin was isolated by retaining the supernatant after

centrifugation at 17,000 x g for 10 mins at 4°C.

2.11.2. Immunoprecipitation (IP)

IP was conducted in a buffer of 20 mM HEPES-KOH pH 7.9, 150 mM KCl, 1.5 mM EDTA, 1% (v/v) Triton

X-100, and, added fresh each time, 1X complete protease inhibitor, and 1 mM PMSF. The chromatin

(112 µL) was rotated at 4°C for 1 hr with 225 µL of the IP buffer, and the antibody as indicated in Table

2.8. A pre-blocked suspension of Protein G agarose beads (Roche), were bound to the antibody by

rotating 60 µL/sample at 4°C overnight. The next day, the chromatin/antibody/bead complexes were

collected by centrifugation at room temperature for 30 sec at 17,000 x g. Unbound chromatin and

antibodies were removed by washes: two washes with buffer A and once with TE, with the centrifuge

step repeated between each wash.

2.11.3. DNA isolation

Immunoprecipitated DNA was eluted from the beads by digestion of the antibody with 200 µg of

proteinase K (Sigma) in elution buffer (50 mM NaHCO3, 1% [v/v] SDS) at 45°C for 2 hrs. The DNA was

purified with the Qiagen PCR purification kit and eluted in 140 µL of TE.

2.11.4. Quantitation

The amount of telomeric chromatin immunopurified by each antibody was quantitated using slot-blot

analysis. The purified DNA was denatured with 980 µL of 0.46 M NaOH and heated at 95°C for 5 mins.

69

The cooled samples were then halved, and 560 µL loaded into a slot-blot well and blotted onto

Biodyne B 0.45 µM nylon membrane (Pall). The remainder of the sample was used to make a duplicate

membrane. For the purpose of quantitation, a standard was included for every sample; 1%, 5%, 10%

and 25% purified input (lacking IP) was also blotted. The membranes were air-dried, cross-linked in a

Stratagene UV Stratalinker 1800, and pre-hybridised with Church buffer at 50°C for 1 hr. One membrane

was hybridised overnight with a 32P-ATP-labelled (CCCTAA)3 telomere probe, and the other was

hybridised with 32P-dATP-labelled ALU sequence. The following day, both membranes were washed four

times: telomere membranes with 2X SSC at room temperature for 15 mins, and ALU membranes with

0.1% SDS/0.2X SSC at 37°C for 15 mins, and then exposed to a phosphor screen overnight. The phosphor

screen was imaged with a Typhoon imager and then signals were quantitated using ImageQuant

software. Standard curves were generated for each sample and used to normalise the telomeric DNA

immunoprecipitated. All experiments were performed on two biological replicates.

2.12. Labelling probes with 32P

Experiments used two types of C-rich telomere probes, [CCCTAA]3 or [CCCTAA]4. Both probes were end

labelled with ATP-γ32-P radiation (Perkin Elmer) by a T4 polynucleotide kinase (New England BioLabs) at

37°C for 30 mins. Unlabelled probe was removed using a Quick Spin Mini Oligo Column (Roche). The

same method was used to end-label the GAPDH probe in section 2.17. The ALU probe in section 2.11.4,

was labelled with α-32P-dATP (Perkin Elmer) using the DECAprime II Random Primed DNA Labeling Kit

(Ambion). Unlabelled DNA was removed using a Quick Spin Mini DNA Column (Roche).

2.13. Whole genome sequencing (WGS) and bioinformatics

2.13.1. WGS and read alignment

Whole genome sequencing was performed on the Illumina HiSeq X Ten platform, by Macrogen Inc.

(Korea) and the Kinghorn Centre for Clinical Genomics/Garvan Medical Research Institute, to generate

paired-end (2 × 150 bp) sequence reads. Subsequent analysis was performed by Dr Erdahl Teber. The

70

Table 2.8. Antibodies for telomere ChIP.

reads were trimmed, and poor quality reads were removed using Trimmomatic (v0.32; parameters:

ILLUMINACLIP:TruSeq3-PE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:20 MINLEN:75). The

remaining paired-end reads were aligned to NCBI hg19 reference genome using BWA (v0.7.10; main

parameters: mem -M). Using Picard (v1.119), the generated BAM file was sorted; duplicates were

removed, and the reads placed into read groups and indexed. Picard (v1.1.19) modules,

CollectAlignmentSummaryMetrics and CollectMultipleMetrics, determined the mapping quality

metrics. Insertion or deletion (indel) realignment was carried out with RealignerTargetCreator and

IndelRealigner, and known indel sites were based on Mills_and_1000G_gold_standard.indels.hg19.vcf

and 1000G_phase1.indels.hg19.vcf (GATK v3.2.2 resource bundle). This was followed by

BaseRecalibrator (parameters for KnownSites are: Mills_ and_1000G_gold_standard.indels.hg19.vcf,

1000G_phase1.indels.hg19.vcf,dbsnp_138.hg19.vcf) and PrintReads (GATK v3.2.2). MuTect v1.1.4

(Cibulskis et al., 2013) (parameters: --dbsnp dbsnp_138.hg19.vcf --cosmic cosmic_v71.vcf) was used to

generate single nucleotide variants (SNVs), only a ‘PASS’ entry in the FILTER column was accepted. Indels

were generated using GATK v3.2.2 HaplotypeCaller (paremeters: --genotyping_mode DISCOVERY -

stand_call_conf 30 -stand_emit_conf 10), filtered by GATK VariantFiltration (parameters: --

filterExpression "QD < 2.0 || FS > 200.0 || ReadPosRankSum < -20.0"), and were decomposed and left

Antibody Company Isolated from Dilution

TERF21P/ RAP1 Novus Biologicals

(NB100-292) Rabbit 1:40

TRF2 Novus Biologicals

(NB110-57130) Rabbit 1:70

Normal Mouse IgG Merck Millipore

(12-371) Mouse 1:30

Normal Rabbit IgG Cell Signaling Technology

(2729) Rabbit 1:30

Histone H3 Cell Signaling Technology

(4620) Rabbit 1:40

H3K9me3 Abcam

(ab8898) Rabbit 1:30

H3K4me2 Cell Signaling Technology

(9725) Rabbit 1:50

71

normalised (Vt normalisation reference, http://genome.sph.umich.edu/wiki/Vt) (Tan et al., 2015). Short

indel calls were generated by PINDEL v0.2.4w (Ye et al., 2009a) and were left normalised. For each cell

line, a final vcf file was generated, and used in all downstream analysis. This file contained the

intersecting variant calls between normalised Haplotypecaller and PINDEL, all unique HaplotypeCaller

indels sized 1 to 9 bp, unique PINDEL calls ≥100 bp, and all SNV ‘PASS’ Mutect calls.

Delly v0.6.7 (Rausch et al., 2012) identified structural variant (SV) calls to detect the four SV

types (deletion, DEL; duplication, DUP; inversion, INV; translocation, TRA). The results were

concatenated and sorted using vcftools (v0.1.13) and annotated into Class A and Class B categories,

whilst TxDb.Hsapiens.UCSC.hg19.knownGene (v3.2.2) R package was used to map the transcript and

gene structures. A Class A annotation indicated the gene(s) overlapping at a breakpoint, and the Class B

annotation, indicated the gene(s) between two breakpoints or within the SV.

2.13.2. Variant annotations

To determine potentially pathogenic genetic alterations Ingenuity Variant Analysis (IVA, v4.2.20160927)

was used to filter and annotate SNV and indel results. To remove variants present in a healthy

population, the analysis parameters included: a read depth of at least 10, variants had to be outside of

the top 1% most exonically variable genes in healthy genomes (1000 genomes), and variants observed

in at least 0.001% of the 1000 genomes project, ExAc and NHLBI ESP exomes were excluded. The next

step was to determine potentially deleterious events using the predicted deleterious filter. From the

settings used we obtained a gene list including mutations: pathogenic or likely pathogenic, established

in literature, gene fusion, inferred activating mutation by Ingenuity, predicted gain of function by BSIFT,

frameshift/in-frame indel or start/stop codon change, missense unless predicted tolerated by SIFT or

PolyPhen-2, splice site loss up to 2 bases into intron or as predicted by MaxEntScan, or a loss of function

structural variant.

http://genome.sph.umich.edu/wiki/Vt

72

2.14. Sanger sequencing

All ATRX and DAXX exons were amplified using the primers, PCR buffer and PCR conditions previously

reported (Jiao et al., 2011), and summarised in Appendix I. The protocol for TP53 sequencing was

described on the International Agency for Research on Cancer (IARC) website

(http://p53.iarc.fr/Download/TP53_DirectSequencing_IARC.pdf) and the primers are listed in Table 2.7.

Briefly, the Qiagen HotStar Taq (0.8 Units) was used to amplify the TP53 exons 2-3 and 7 in a reaction

mix containing 1X PCR buffer, 1X Q-solution, 0.2 mM each dNTP, 0.4 µM forward primer and 0.4 µM

reverse primer. The PCR conditions for exon 2-3 were: 94°C for 2 mins, followed by 50 cycles of 94°C for

30 sec, 61°C for 45 sec and 72°C for 45 sec, and the final cycle of 72°C for 10 mins, and for exon 7 were:

95°C for 15 mins, followed by 50 cycles of 94°C for 30 sec, 60°C for 30 sec and 72°C for 30 sec, and the

final cycle of 72°C for 10 mins. Whereas, 0.8 Units of Taq Platinum (Invitrogen) were used to amplify

TP53 exons 4, 5-6, 8-9 and 11 in a reaction containing 1X PCR buffer, 1.5 mM MgCl2, 0.2 mM each dNTP,

0.4 µM forward primer and 0.4 µM reverse primer. Exons 4, 5-6, 8-9, and 11 were amplified with the

conditions: 94°C for 2 mins, followed by 20 cycles of 94°C for 30 sec, 63°C for 45 sec (-0.5°C every 3

cycles) and 72°C for 60 sec, then 30 cycles of 94°C for 30 sec, 60°C for 45 sec and 72°C for 60 sec, and

the final cycle of 72°C for 10 mins. Finally, TP53 exon 10 was amplified with the PCR conditions: 94°C for

2 mins, followed by 20 cycles of 94°C for 30 sec, 58.5°C for 45 sec (-0.5°C every 3 cycles) and 72°C for 60

sec, then 30 cycles of 94°C for 30 sec, 55°C for 45 sec and 72°C for 60 sec, and the final cycle of 72°C for

10 mins. The gene H3F3A was sequenced using primers previously reported to amplify exons 1, 2 and 3

of the gene (Bower et al., 2012). Invitrogen’s Taq Platinum was used to amplify the exons, using the

primer sequences listed in Table 2.7, with the PCR conditions: 95°C for 5 mins, followed by 30 cycles of

94°C for 30 sec, 60°C for 1 min and 72°C for 2 mins, and the final cycle of 72°C for 10 mins. Prior to

sequencing, all PCR products were purified with the QIAquick PCR Purification Kit (Qiagen), and

subsequent Sanger sequencing was conducted at the Australian Genome Research Facility.

http://p53.iarc.fr/Download/TP53_DirectSequencing_IARC.pdf

73

2.15. RNA extraction

RNA was extracted from cell pellets using the RNeasy Mini Kit (Qiagen) with on column DNA digestion

(Qiagen DNase). The RNA was resuspended in RNase-free water and quantitated using a NanoDrop

spectrophotometer.

2.16. qPCR analysis

2.16.1. Reverse transcriptase qPCR (RT-qPCR)

Complementary DNA (cDNA) was synthesised from 1 µg of RNA using the Superscript III First Strand

Synthesis Kit (Invitrogen) with random primers. Transcripts of TERT, TERC, DKC1, and GAPDH were

detected as previously described (Cao et al., 2008b), using the primers in Table 2.7. Expression of NBS1,

XRCC3, RTEL1, ZBTB48, and SLX4 mRNA was detected using the primers described in Table 2.7. PCR

reactions contained 1X QuantiFAST SYBR Green PCR buffer (Qiagen), and 0.4 µM forward and reverse

primers for TERC, DKC1, NBS1, XRCC3, RTEL1, ZBTB48, SLX4 and GAPDH transcripts or 0.5 µM forward

and reverse primers for TERT transcripts. The cDNA reaction was diluted 1:2.5 with TE, and 2 µL was

loaded into each PCR reaction. The PCR was performed in triplicate with the following conditions: 1 cycle

at 95°C for 15 mins, followed by 40 cycles of 95°C for 15 sec and 60°C for 60 sec for TERT, TERC, DKC1,

and GAPDH or 40 cycles of 95°C for 15 sec, 60°C for 20 sec and 72°C for 30 sec for NBS1, XRCC3, RTEL1,

and SLX4 or 40 cycles of 95°C for 15 sec and 60°C for 60 sec for ZBTB48 and then melt curve analysis.

The level of expression was calculated using a delta delta cycle threshold (Ct) method, with GAPDH as a

reference gene, and expressed as RNA level relative to the appropriate control sample.

2.16.2. Genomic qPCR

MYCN copy number was determined by qPCR of 5 ng of genomic DNA. PCR reactions were performed

in triplicate using 1X QuantiFAST SYBR Green PCR buffer (Qiagen) containing 0.5 µM of forward and

reverse primers (Table 2.7) with the PCR conditions: 95°C for 5 mins then 43 cycles of 95°C for 15 sec,

61°C for 30 sec and 72°C for 20 sec, and melt curve analysis. Samples were quantitated using a standard

74

curve method, MYCN was normalised to the VAV2 gene, and copy number was expressed relative to the

normal DNA control (Applied Biosystems).

2.17. Telomeric repeat-containing transcript (TERRA)

The quantitation of TERRA was performed by slot-blot analysis of 1 µg of DNase treated RNA (Ng et al.,

2009). In addition to a DNase treated RNA sample for each cell line, 1 µg of RNA was also treated with

25 ng/µg RNase A (Sigma) to confirm that there was no DNA contamination. All samples were denatured

at 65°C for 15 mins in a solution of 66% (v/v) formamide, 2.6 M formaldehyde, and 13% (v/v) 3-(N-

morpholino)propanesulphonic acid (MOPS) solution (0.5 M sodium acetate, 0.01 M EDTA, 0.2 M MOPS).

The denatured RNA was diluted with 100 µL of 2X SSC and slot-blotted onto a Biodyne B nylon

membrane. Duplicates of all membranes were prepared. Membranes were dried and the RNA was

crossed-linked to the membrane using the Stratagene UV Stratalinker 1800. After UV-cross-linking, both

membranes were pre-hybridised with Church buffer at 55°C for 1 hr, then one membrane was

hybridized with a 32P-ATP-labelled (CCCTAA)3 telomeric probe and the other a 32P-labelled GAPDH probe

(ACCCACTCCTCCACCTTTG), overnight at 55°C. The following day, the membranes were washed three

times for 15 mins at room temperature with 2X SSC/0.1% SDS and then at 50°C with 0.2X SSC/0.1% SDS

for 15 mins. Membranes were exposed to a storage phosphor screen and scanned on a Typhoon imager.

Images were quantitated with ImageQuant software and the amount of TERRA was corrected for loading

by dividing by the intensity of the corresponding GAPDH transcript. Three biological replicates were

analysed.

2.18. Telomerase activity

2.18.1. Protein Lysis

Cells were trypsinised, washed with 1X PBS and pelleted. An equal number of cells were lysed at 4°C for

30 mins with 3-([3-cholamidopropyl] dimethylammonio)-1-propanesulphonate (CHAPS) lysis buffer (10

mM Tris-HCl pH 7.5, 1 mM MgCl2, 1 mM ethylene glycol-bis[2-aminoethylether]-N,N,N',N'-tetraacetic

75

acid [EGTA], 10% glycerol, 10% CHAPS), supplemented with 1mM PMSF and 5 mM 2-mercaptoethanol.

Following lysis, the samples were centrifuged at 15,500 x g for 20 mins at 4°C, and then the supernatant

was transferred to a new tube to remove cellular debris.

2.18.2. Immunoprecipitation

To purify the lysate and remove potential PCR inhibitors, anti-hTERT antibody (10 µg; obtained from Dr

Scott Cohen) was bound to telomerase by rotating samples at 4°C for 30 mins (Cohen and Reddel, 2008).

A 50% (v/v) suspension of Protein G beads (Roche), pre-blocked in BSA (New England BioLabs), was then

bound to the antibody at 4°C for 1 hr. The telomerase/antibody/bead complex was collected in an

Illustra micro-spin column (GE Healthcare) with vacuum suction, and the supernatant discarded. The

beads were washed with ice cold lysis buffer to remove any unbound proteins. To release the

telomerase enzyme from the bead/antibody complex, 1.5 mM antigenic peptide solution was combined

with the complex in the column and incubated at room temperature for 1 hr before collection of the

supernatant.

2.18.3. Telomeric repeat amplification protocol (TRAP)

Immunoprecipitated telomerase was added to 0.09 µg of the M2 primer (Table 2.7) and allowed to

extend via telomerase mediated base addition in a buffer containing 45 mM Tris pH 8.8, 11 mM

ammonium sulphate, 4.5 mM MgCl2, 10 mM EDTA pH 8, 76 mM 2-mercaptoethanol, 113 µg/mL BSA

(Ambion), 1 mM each of dNTPs (Roche), 0.045 µg of the reverse primer ACX (Table 2.7), and 2 Units Taq

polymerase (Roche). The TRAP reaction was performed under the conditions in Table 2.8. PCR products

were separated on a 10% denaturing polyacrylamide gel in 0.5X TBE and detected with SYBR Green I

(Molecular Probes), visualised on a Typhoon imager.

2.19. Immunoblotting

Cells were harvested, pelleted and resuspended in cold lysis buffer supplemented with complete

protease inhibitor (Roche), 100 mM NaF, and 200 µM Na3VO4 immediately before use. For analysis of

76

Table 2.8. TRAP PCR conditions.

Number of cycles Step Temperature Time

1 cycle Telomerase extension of

primer 25°C 30 mins

1 cycle Taq Hot start 95°C 2 mins

35 cycles Denaturation 95°C 10 sec

Annealing 50°C 25 sec

Extension 72°C 30 sec

1 cycle Denaturation 95°C 15 sec


Extension 72°C 60 sec

Table 2.9. Antibodies and conditions used for Western blot analysis.

Name Manufacturer Isolated

from Blocking agent Diluent Dilution Incubation

conditions

anti-ATRX Abcam

(ab72124) Rabbit 5% (w/v) skim milk 1X TBS 1:500

Room temperature,

2.5 hrs

anti-DAXX Sigma

(HPA008736-100UL)

Rabbit 5% (w/v) skim milk 1X TBS 1:250 Room

temperature, 2 hrs

anti-p53 (DO-1)

Merck Millipore (OP43L)

Mouse 5% (w/v) skim milk/1X TTBS

Same as blocking

agent 1:1000

Room temperature,

1 hr

anti-p21 (Waf1/Cip1)

Cell Signalling (2947)

Rabbit 5% (w/v) BSA/1X

TTBS

Same as blocking

agent 1:1000

Room temperature,

1 hr

anti-GAPDH ThermoFisher

Scientific (MA5-15738)

Mouse 5% (w/v) skim milk/1X TTBS

Same as blocking

agent 1:5000

Overnight, 40C

anti-β-actin Sigma

(A2228-100UL) Mouse 5% (w/v) skim milk 1X TBS 1:3000

Overnight, 40C

anti-HSP70 Sigma

(H5147-100UL)

Mouse 5% (w/v) skim milk 1X TBS 1:3000 Overnight,

40C

ATRX and DAXX proteins the cells were lysed in EBC buffer (50 mM Tris pH 8, 120 mM NaCl, and 0.5%

(v/v) NP-40), and for p53 and p21 immunoblots the cells were lysed in RIPA buffer (50 mM Tris pH 8,

150 mM NaCl, 0.1% (v/v) SDS, 1% (v/v) NP-40, and 0.5% (v/v) sodium deoxycholate). Cells were lysed

for 30 mins at 4°C and centrifuged at 15,500 x g for 20 mins to remove cell debris. The protein

concentration of the whole cell extract was determined against known concentrations of BSA standards,

using the bicinchoninic acid (BCA) protein assay kit.

77

Equal concentrations of protein lysates were mixed with NuPAGE LDS Sample Buffer (Life

Technologies) and denatured by boiling at 95°C for 10 mins. Proteins were resolved on a 3–8% NuPAGE

Tris-acetate polyacrylamide SDS gel (Life Technologies) (running buffer: 2.5 mM tricine, 2.5 mM Tris,

0.005% (v/v) SDS, pH 8.24) for ATRX, on a 10% Tris-glycine SDS polyacrylamide gel for DAXX, and on a

12% Tris-glycine SDS polyacrylamide gel for p53 and p21 (running buffer: 0.02 M Tris, 0.2 M glycine,

0.1% SDS (v/v), pH 8.3). Separated proteins were transferred to a methanol-activated 0.45 mm PVDF

membrane (Millipore), in chilled transfer buffer (22 mM Tris, 171 mM glycine, 0.01% (v/v) SDS, 20% (v/v)

methanol), and blocked for 1 hr at room temperature and then probed according to the conditions in

Table 2.9. The membranes were washed with a solution of 0.1% Tween-20, 50 mM Tris, and 150 mM

NaCl (TTBS) three times for 15 mins each, then probed at room temperature for 1 hr with HRP-

conjugated secondary antibodies (DakoCytomation) diluted 1:5000 in TTBS, and followed by another

wash series with TTBS. Chemiluminescence detection was performed using SuperSignal West Pico

chemiluminescent substrate (ThermoFisher Scientific) at room temperature for 5 mins, exposed to X-

ray film (Fujifilm), and developed on an X-ray developer (Konica).

2.20. Statistical analyses

GraphPad Prism 6 was used to generate graphs and perform statistical analysis. The Kaplan-Meier

product-limit method was used to estimate survival, comparisons of survival curves were performed by

the log-rank test, and medians and proportions were compared by the Mann-Whitney test and Chi-

square test, respectively. Two data sets were compared with unpaired Student’s two-tailed t tests or

two-tailed Mann-Whitney tests, and multiple data sets were compared using one-way ANOVA.

78

Chapter 3:

A subgroup of high-risk MYCN non-

amplified neuroblastomas lacks a

telomere lengthening mechanism

79

Chapter 3: A subgroup of high‐risk MYCN non‐amplified

neuroblastomas lacks a telomere lengthening

mechanism

3.1. Introduction

The acquisition of replicative immortality is a hallmark of human cancer, achieved by activation of a TLM

to counter the normal telomere attrition that accompanies cellular proliferation (Hanahan and

Weinberg, 2000; Hanahan and Weinberg, 2011). However, a substantial proportion of glioblastomas

(Hakin-Smith et al., 2003), liposarcomas (Costa et al., 2006; Jeyapalan et al., 2008), osteosarcomas

(Ulaner et al., 2003), and retinoblastomas (Gupta et al., 1996) have been reported as telomerase-

negative with no evidence of ALT activity. The consensus view in the telomere research field has been

that these results are due to false-negative assays; however, there can be other plausible explanations.

Firstly, telomerase-negative tumours may be able to maintain their telomere length by a different ALT

mechanism which lacks the known phenotypic characteristics of ALT. A second potential explanation is

that it is theoretically possible some tumours can achieve long term proliferation without an active TLM

(Reddel, 2000). To date, it has been impossible to demonstrate the latter scenario as serial sampling of

human tumours which are required to show continuous telomere shortening over extended periods of

time cannot usually be obtained. Therefore, suitable cell line models are required to determine if an

active TLM is a requirement for the long-term proliferation of malignant cells.

NB is an embryonal tumour of the sympathetic nervous system (Maris, 2010). Telomerase

activity has been identified as a poor prognostic factor in NB (Ohali et al., 2006; Onitake et al., 2009;

Poremba et al., 2000; Poremba et al., 1999) although it is absent in 20-60% of metastatic NB (Krams et

al., 2001; Onitake et al., 2009; Poremba et al., 2000; Poremba et al., 1999), supporting the presence of

80

ALT in NB. Thus far, ALT has either been diagnosed in NB tumours by long telomeres (a feature of ALT)

in the absence of telomerase (Onitake et al., 2009) or by the presence of mutation/deletion in ATRX

(Cheung et al., 2012; Kurihara et al., 2014; Molenaar et al., 2012; Peifer et al., 2015; Valentijn et al.,

2015), a chromatin remodelling factor where loss of function is associated with ALT activity (Bower et

al., 2012; Chen et al., 2014; Heaphy et al., 2011a; Lovejoy et al., 2012; Schwartzentruber et al., 2012).

However, C-circles, a quantifiable marker of ALT activity (Henson et al., 2009), have not been used to

detect ALT in any of these studies. Relying solely on long telomeres and the absence of telomerase can

potentially misclassify tumours as ALT-positive, especially in embryonal tumours that tend to have

longer telomeres, while using only ATRX mutations will likely underestimate the prevalence of ALT as

ATRX mutations are not a universal feature of ALT (Lovejoy et al., 2012).

We hypothesised that (1) a proportion of high-risk NB with long telomeres were ALT-negative

and (2) a subset of ALT-positive high-risk NB tumours were ATRX wild-type. Utilising quantitative PCR to

measure telomere content (TC) and C-circle levels (Lau et al., 2013) in a cohort of high-risk NB, we

detected ALT in a significantly higher frequency than previously reported on the basis of ATRX mutation

frequency, supporting the hypothesis that some ALT-positive NB are ATRX wild-type. Furthermore, we

found that a subset of MYCN non-amplified tumours with long telomeres lacked ALT activity. We also

went on to screen a large panel of NB cell lines and identified two NB cultures with exceptionally long

telomeres which were negative for both telomerase and C-circles.

3.2. Results

3.2.1. Unique subgroup of high-risk MYCN non-amplified neuroblastoma

Here we describe a cohort of 149 high-risk NB screened for C-circles and TC using telomere quantitative

PCR where ALT-positive tumours were defined as those with a relative C-circle level of ≥7.5 compared

to the ALT+ IIICF/c cell line with an arbitrary value of 100 (Lau et al., 2013) (Appendix II Table A2.1-4).

Twenty-four percent (36/149) of tumours were found to be C-circle/ALT-positive. None (0/36) of the

ALT-positive tumours had MYCN amplification, consistent with other studies reporting MYCN

81

Figure 3.1. A subgroup of high-risk MYCN non-amplified neuroblastoma with long telomeres are

ALT-negative.

(A) Relative telomere content (TC) in arbitrary units (AU), measured by telomere qPCR for individual

patient tumours (n=149), are plotted according to ALT status (ALT+ n=36, ALT- n=113). ALT+ was

defined by a relative C-circle (CC) level ≥7.5 compared to the ALT+ IIICF/c cell line with an arbitrary

value of 100. (B) Age at diagnosis for individual patient tumours is plotted according to ALT status

(n=149). (C) Relative TC of MYCN non-amplified tumours (n=94) is plotted according to ALT status

(ALT+ n=36, ALT- n=58). A subgroup of ALT- tumours (n=17) had long telomeres (TC≥15, indicated

by the bracket). (D) Age at diagnosis for individual MYCN non-amplified ALT-negative patient

tumours (n=58) is plotted according to TC.

Data points represent the average of triplicate TC measurements by qPCR. Horizontal red bar

indicates group median. * P<0.01

82

amplification and ATRX aberrations are mutually exclusive (Cheung et al., 2012; Kurihara et al., 2014;

Peifer et al., 2015; Pugh et al., 2013; Valentijn et al., 2015). This is contrast with ALT-negative tumours

where 49% (55/113) had MYCN amplification. The relative TC of ALT-positive tumours was significantly

higher than that of ALT-negative tumours (median 19.7 vs. 6.2; P<0.0001; Figure 3.1.A); this was not due

to younger patients in the ALT-positive group as patients with ALT NB were significantly older at

diagnosis than patients with ALT-negative NB (median age 4.4 vs. 2.3 years; P<0.0001; Figure 3.1.B). Of

note, within the MYCN non-amplified group, 29% (17/58) of tumours with long telomeres (TC≥15) were

ALT-negative (Figure 3.1.C). In addition, patients with ALT-negative/TC≥15 tumours were older at

diagnosis than patients with ALT-negative/TC<15 tumours (median age 4.67 vs. 2.72 years; P<0.01;

Figure 3.1.D). There was sufficient DNA to assess telomere length by Southern blot terminal restriction

fragment (TRF) analysis for 45 samples, including four of the 17 ALT-negative/TC≥15 tumours. The TRF

telomere length profile of the four ALT-negative/TC≥15 tumours was long and heterogeneous (relative

TC≥15 corresponds to mean TRF length 20 kb; Figure 3.2.A), with a mean length indistinguishable from

ALT-positive tumours (P>0.05). Frozen tumour samples were available for the four ALT-negative/TC≥15

tumours which allowed us to perform TRAP assays; all four tumours were telomerase-negative (Figure

3.2.B). This suggests that a subgroup of metastatic NB with long telomeres may not require a TLM to

allow long term proliferation as a result of their extensive telomere reserves.

The molecular details of ALT upregulation are not well defined but there is a correlation

between ALT activity and the loss of expression of ATRX or its binding partner DAXX (Bower et al., 2012;

Heaphy et al., 2011a; Lovejoy et al., 2012). Inactivation of p53 is also strongly correlated with ALT in cell

lines although this is less apparent in tumours (Henson and Reddel, 2010). Next-generation sequencing

results were available for 32 tumour samples; 13 ALT-positive and 19 ALT-negative. This includes

previously reported whole exome sequence data for 26 samples (Pugh et al., 2013) and whole genome

sequence data for nine tumours obtained as part of this study (of which 3 had existing whole exome

data from Pugh et al., 2013). Of the 13 ALT-positive tumours, eight had an ATRX mutation, one had a

83

Figure 3.2. A unique subgroup of high-risk ALT-negative/MYCN non-amplified/TC≥15 NBs have

poor survival.

(A) Terminal restriction fragment (TRF) analysis of 13 selected tumour samples. Telomere content

(TC) and C-circle (CC) status measured by telomere qPCR is indicated at the bottom with mean TRF

lengths. Black boxes represent the four ALT-negative/TC≥15 samples, green boxes represent the

ALT-positive samples, and ALT-negative/TC<15 are indicated by white boxes. (B) Telomere repeat

amplification protocol (TRAP) to detect telomerase activity in six selected tumour samples. Cell

lysates were immunopurified with anti-hTERT antibody to remove potential inhibitors. The ALT

sample U-2 OS was negative for telomerase and SH-SY5Y was included as a telomerase positive

control. (C, D) Event-free and overall survival of ALT-negative/TC≥15 (ALT-/ TC≥15) (n=17), ALT-

positive (n=36), and MYCN amplified (amp) (n=55) tumours.

TRF and IP-TRAP were performed by Dr Loretta Lau.

84

DAXX mutation, and one had a TP53 mutation. In contrast, abnormalities of ATRX, DAXX or TP53 were

observed in 0/19 ALT-negative tumours.

It is well established that MYCN amplification results in a worse outcome for patients than MYCN

non-amplified NB tumours (Ambros et al., 2009; Seeger et al., 1985). In our cohort, the outcome for

patients with ALT NB was as poor as the outcome for MYCN amplified patients (5-year event-free

survival 28% vs. 24%; 5-year overall survival 36% vs 28%; Figure 3.2.C, D), despite all ALT-positive

tumours being MYCN non-amplified. Like ALT NB, ALT-negative/TC≥15 NB also had later events or

deaths and a poor survival that was not significantly different from the ALT tumours, although this may

be due to the number of cases in each subgroup (5-year overall survival 49% vs. 36%; P=0.1908; Figure

3.2.C, D), ultimately leading to death in 51% of patients with this subgroup of disease.

3.2.2. ALT-negative and telomerase-negative cancer cell lines

3.2.2.1. Neuroblastoma

To determine whether ALT-negative/TC≥15 NB cells lack a TLM, or have an as-yet unidentified

telomerase-independent mechanism, the telomere length of these cells must be examined over time.

To perform this study, we screened 35 cell lines derived from metastatic NB for a phenotype

corresponding to the ALT-negative/TC≥15 tumours (TC≥15 and C-circle negative via quantitative PCR

and MYCN non-amplified). We identified three cell lines that have a TC≥15 (CHLA-90, COG-N-291, LA-N-

6) and one cell line with a TC of 14 (SK-N-FI); two cell lines (SK-N-FI and CHLA-90) were C-circle positive,

as previously reported (Farooqi et al., 2014; Lau et al., 2013), and two were C-circle negative (COG-N-

291 and LA-N-6; Table 3.1) and also had the highest TC of the 35 cell lines (25 and 38, respectively). TRF

analysis confirmed long and heterogeneous telomere lengths in COG-N-291 and LA-N-6 cells (mean 31.0

and 37.8 kb, respectively), comparable to U-2 OS, an ALT cell line with very long telomeres (mean TRF

38.8 kb; Figure 3.3.A). The TRF blots of LA-N-6 and COG-N-291 showed a banding pattern that has only

been observed when ALT activity was suppressed in ALT-positive cells by overexpression of Sp100 a

component of PML bodies (Jiang et al., 2005), and when telomerase-mediated telomere extension was

85

Table 3.1. Characteristics of 35 neuroblastoma cell lines.

Telomere content

SD C-

circle SD hTERT SD hTR SD Dyskerin SD MYCN SD

LA-N-6 38.0 0.047 -0.4 0.036 0.0 0.01 1.1 0.07 0.5 0.05 3.9 0.4

COG-N-291 25.0 0.006 -3.3 0.022 0.0 0.00 0.0 0.00 0.9 0.13 2.7 0.2

CHLA-90 15.6 0.005 139 0.285 0.1 0.06 2.8 0.44 0.8 0.04 18.9 0.8

SK-N-FI 14.0 0.013 196 0.695 0.0 0.00 0.3 0.04 1.4 0.24 4.2 0.5

CHLA-119 2.0 0.002 2.1 0.014 0.1 0.02 0.7 0.10 0.9 0.14 262 16.0

CHLA-122 0.8 0.001 -0.1 0.000 3.0 0.40 4.2 0.29 1.2 0.08 154 14.5

CHLA-136 0.8 0.003 -0.1 0.000 0.5 0.07 1.7 0.07 1.3 0.13 141 24.0

CHLA-140 1.2 0.009 -0.2 0.001 4.6 0.56 2.2 0.34 0.3 0.01 6.9 0.7

CHLA-171 1.3 0.001 0.3 0.001 3.3 0.28 1.1 0.07 0.6 0.11 2.7 0.1

CHLA-225 2.5 0.001 0.0 0.006 2.2 0.29 2.6 0.29 1.5 0.18 127 14.2

CHLA-42 0.4 0.001 0.3 0.001 0.6 0.09 2.5 0.08 1.0 0.13 4.8 0.6

CHLA-95 1.0 0.001 0.1 0.002 0.6 0.04 0.7 0.07 0.8 0.10 495 41.9

CHP-134 1.3 0.002 -0.1 0.001 2.1 0.07 1.0 0.14 1.6 0.07 485 60.5

COG-N-328h 0.5 0.001 -0.1 0.000 0.9 0.13 1.9 0.15 2.0 0.22 252 26.7

COG-N-347 0.4 0.002 -0.1 0.000 0.6 0.08 1.5 0.11 0.3 0.02 1066 77.0

FU-NB-2006 0.6 0.000 0.3 0.004 1.0 0.25 5.5 0.53 1.2 0.18 5.7 0.7

IMR32 0.5 0.002 0.0 0.002 1.0 0.10 1.0 0.11 1.0 0.10 120 25.4

KELLY 0.6 0.001 0.0 0.002 2.5 0.26 0.8 0.08 0.7 0.07 676 56.5

LA-N-1 1.3 0.001 0.0 0.002 0.3 0.05 0.8 0.13 1.0 0.09 392 85.5

LA-N-5 0.5 0.000 0.0 0.001 2.7 0.25 1.2 0.14 1.4 0.17 256 10.7

NB69 1.1 0.000 0.1 0.002 2.7 0.36 0.7 0.07 0.6 0.09 4.5 0.7

SH-EP 2.5 0.002 0.0 0.004 8.1 0.50 1.1 0.12 1.3 0.11 1.0 0.1

SH-SY5Y 1.2 0.003 -0.2 0.001 2.9 0.31 1.2 0.06 0.8 0.05 3.7 0.3

SK-N-AS 1.8 0.004 0.2 0.001 2.3 0.29 0.3 0.02 1.0 0.14 2.8 0.7

SK-N-BE1 1.8 0.005 0.3 0.005 1.0 0.14 1.6 0.14 0.4 0.05 475 41.6

SK-N-BE2c 0.6 0.001 0.0 0.002 0.4 0.05 0.9 0.11 1.0 0.14 115 8.4

SK-N-DZ 2.1 0.036 -0.3 0.001 0.8 0.11 0.9 0.08 1.0 0.08 220 36.3

SK-N-SH 1.2 0.001 -0.1 0.002 1.8 0.19 0.9 0.15 0.6 0.07 3.1 0.3

SMS-KANR 0.4 0.000 0.0 0.002 0.8 0.11 1.6 0.08 1.1 0.12 164 17.7

SMS-KCN 0.7 0.001 0.1 0.000 0.4 0.06 0.7 0.07 0.5 0.04 909 55.7

SMS-KCNR 0.4 0.000 0.0 0.002 0.5 0.07 1.2 0.09 0.6 0.02 537 32.5

SMS-LHN 1.3 0.002 -0.3 0.001 0.2 0.02 2.3 0.33 1.3 0.17 6.2 0.7

SMS-SAN 0.5 0.001 0.0 0.001 0.2 0.03 1.8 0.10 0.9 0.10 835 64.1

Note: Relative hTERT, hTR, and dyskerin mRNA levels (samples normalised to IMR32 set to 1) and MYCN copy number were measured by qPCR and expressed as the mean of triplicates.

86

Figure 3.3. Two neuroblastoma cell lines (COG-N-291 and LA-N-6) have long and heterogeneous

telomere lengths similar to the ALT-negative/TC≥15 tumour group.

(A) TRF analysis of a panel of seven cell lines. ALT-positive (ALT+) and telomerase-positive (TEL+) cell

lines are indicated. The HT1080 hTR line is a clone of HT1080 with telomeres over-lengthened due to

overexpression of hTR and upregulation of telomerase. (B) Representative images of telomere

fluorescent in situ hybridisation (FISH) including the ALT cell line U-2 OS and telomerase-positive cell

line SH-SY5Y. Telomeres are represented by green signals at the end of the chromosomes. (C)

Quantitation of telomere FISH in a panel of eleven cell lines. Dots in graph represent individual

telomere signals with mean telomere fluorescence indicated by red horizontal bar. 15 metaphases

were analysed per cell line. (D) Percentage of chromosome ends without telomere signal (images

from Figure 3.3.B). 15 metaphase spreads were analysed per cell line.

87

inhibited by deletion of the essential DNA helicase RTEL1 (Uringa et al., 2012). Telomere fluorescence

in situ hybridisation (FISH) analysis showed COG-N-291 and LA-N-6 have a greater range of fluorescent

intensities and fewer short telomeres (signal-free ends) than ALT cell lines (Figure 3.3.B, C, D).

Although COG-N-291 and LA-N-6 had very long telomeres, they did not have elevated markers

of ALT or telomerase activity. Both cell lines were telomerase-negative by TRAP (Figure 3.4.A). To

confirm this was not the result of PCR inhibitors present in the sample lysate resulting in a false-negative

TRAP result, the samples were spiked with a telomerase-positive lysate (Figure 3.4.B). The presence of

telomerase activity in the spiked samples confirmed these two cell lines were telomerase-negative. The

cells also lacked detectable mRNA expression for hTERT, the catalytic subunit of telomerase (Table 3.1,

Figure 3.4.C). Although a low level of APBs was identified in COG-N-291 and LA-N-6, the level was similar

to telomerase-positive samples and significantly lower than ALT-positive cell lines (P<0.001; Figure

3.4.D). C-circle levels were measured using a second method where a 32P-labelled telomeric probe was

used to detect products of the C-circle rolling circle amplification catalysed by Φ29 polymerase (Henson

et al., 2009). This detection method identified very low levels of signal above the no Φ29 polymerase

control (Figure 3.4.E). To determine whether this low level of signal was due to extension of genomic

linear telomeric DNA or amplification of C-circles, exonuclease digestion of linear telomeric DNA was

performed prior to the C-circle assay. The presence of radioactive signals following exonuclease

digestion confirmed that the cells contained very low levels of C-circles (Figure 3.4.F).

Both COG-N-291 and LA-N-6 lacked genetic variations associated with ALT activation, and like

the ALT-negative/TC≥15 tumours were MYCN non-amplified (Table 3.1). Whole genome sequencing

indicated both cell lines were wild-type for H3F3A, TP53, ATRX and DAXX genes (Appendix II Table A2.5,

6) and was confirmed by Sanger sequencing, although it has been previously reported that LA-N-6

possesses a homozygous deletion of CDKN2A (Garcia et al., 2010) and COG-N-291 possesses a TP53

polymorphism (Farooqi et al., 2014). Consistent with wild type TP53, the downstream target p21 was

induced when cells were treated with the DNA damaging agent doxorubicin (Figure 3.5.A). Full- length

89

Figure 3.4. The COG-N-291 and LA-N-6 cell lines are phenotypically similar to the ALT-

negative/TC≥15 tumour group.

(A) TRAP assay to detect telomerase activity in a panel of NB cell lines. Cell lysates were

immunopurified (IP) with anti-hTERT antibody to remove potential PCR inhibitors. (B) Telomerase

activity measured by TRAP. All telomerase-negative samples were spiked with lysate from the

telomerase-positive sample, SH-SY5Y, to confirm that no PCR inhibitors were present. (C) Melt curves

from SYBR Green hTERT RT-qPCR. Arrows indicate that primer dimers formed when no template was

present in CHLA-90 (ALT+) and LA-N-6. Second peak represents product formed by qPCR

amplification of template in telomerase-positive samples (SK-N-BE2c and SH-SY5Y). (D) ALT-

associated promyelocytic leukaemia bodies (APBs) in a panel of cell lines (co-localisation of telomeric

foci (green) and PML nuclear body (red), indicated by arrows). ALT-positive (ALT+) and telomerase-

positive (TEL+) cell lines are indicated. Data represent mean (+SD) of 3 independent experiments.

Scale bar represents 3 µM. (E) Representative C-circle (CC) assay with and without Φ29 polymerase,

followed by detection using a 32P labelled telomeric probe in slot-blot analysis. CC level was

calculated relative to that of the ALT-positive U-2 OS cell line (designated to be 100 AU). ALT-positive

(ALT+) and telomerase-positive (TEL+) cell lines are indicated. (F) Confirmation of C-circle assay

products in COG-N-291 and LA-N-6 at three different population doublings (PD). To remove linear

telomeric DNA prior to the C-circle assay, restriction enzyme-treated DNA was subjected to

exonuclease digestion. MeT-4A and DOS16 are ALT-positive cell lines with low CC levels (Henson et

al., 2009). SK-N-BE2c, a telomerase-positive cell line, was used as negative control.

ATRX and DAXX proteins were also expressed in both cell lines (Figure 3.5.B) and localised to the nucleus

(Figure 3.5.C). As expected for TP53 wild-type cultures (Cesare et al., 2009), the cells do not accumulate

DNA damage at the telomere (Figure 3.6.A). The level of the telomeric transcript TERRA has been

associated with telomere length and accordingly, levels are higher in ALT cells than telomerase-positive

cells (Arora et al., 2014; Episkopou et al., 2014; Ng et al., 2009). However, TERRA levels in COG-N-291

and LA-N-6 were well below those of any other sample with long telomeres (Figure 3.6.B). Taken

90

Figure 3.5. The cell lines COG-N-291 and LA-N-6 lack characteristic of ALT.

(A) p53 and p21 immunoblot with GAPDH loading control. Cultures were treated for 72 hrs with a

doxorubicin (DOX) dose equivalent to their IC50. p53 status is indicated for each cell line (W, wild

type; M, mutant). (B) ATRX and DAXX immunoblot with HSP70 loading control. CHLA-90 and U-2 OS

(ATRX-negative cell line with partial deletion of ATRX gene) were used as negative controls. (C)

Representative images of ATRX and DAXX foci (red) in the nuclei (blue) of NB cell lines.

91

together these data suggest that COG-N-291 and LA-N-6 cells lack the genetic and/or epigenetic

(Episkopou et al., 2014) changes that allow upregulation of ALT in some cancer cells.

To determine whether differences in the chromatin structure of COG-N-291 and LA-N-6 were

responsible for preventing upregulation of ALT in these cells, we performed telomere chromatin

immunoprecipitation (ChIP) for shelterin proteins and histone 3 (H3) marks. There was no difference in

the level of TRF2 or RAP1 shelterin proteins bound to the telomeres of ALT or COG-N-291 and LA-N-6

cells (Figure 3.7.A). Similarly, there was no increase in repressive histone marks at H3 compared to ALT

NB cell lines (Figure 3.7.B).

From the work described in this section, we conclude that the cell line screen has identified two

cell lines (COG-N-291 and LA-N-6) that are phenotypically and genetically similar to the ALT-

negative/TC≥15 tumours.

92

Figure 3.6. COG-N-291 and LA-N-6 lack DNA damage at the telomere and characteristics of ALT.

(A) Representative images of meta-TIF assay (telomere foci green and γ-H2AX red, arrows indicate

damage at telomere). Bottom panel is percentage of chromosome ends with or without telomere

signal that have DNA damage. p53 status is indicated below each cell line (WT wild type; M, mutant;

LgT, SV40 large T antigen). Mean +SD from 3 independent experiments. (B) Telomeric repeat-

containing RNA (TERRA) was quantitated from DNase treated RNA, followed by detection using a 32P

labelled telomeric or GAPDH (loading control) probe in slot-blot analysis. The TERRA levels of ALT

samples (CHLA-90, SK-N-FI, U-2 OS, SK-LU-1, SAOS-2 and G292), telomerase-positive cells (SH-SY5Y,

SK-N-BE2c, A2182 and MG63) and mortal cell lines (HFF5 and MRC-5) were compared to COG-N-291

and LA-N-6. Bar graph shows mean (+SD) TERRA levels from 3 independent experiments.

93

Figure 3.7. The level of telomere bound proteins does not differ between ALT neuroblastoma cell

lines and COG-N-291 and LA-N-6.

(A) Telomere-ChIP against the shelterin complex components RAP1 and TRF2. The telomerase-

positive cell lines SK-N-BE2c and SH-SY5Y, and ALT-positive cell lines SK-N-FI and CHLA-90 are

included for comparison. Quantitation of the percentage of telomeric pulled down is shown in the

graph. Mean +SD from 2 independent experiments. (B) Telomere-ChIP against histone H3 and

histone marks. The telomerase-positive cell line SH-SY5Y and ALT-positive cell lines SK-N-FI and

CHLA-90 are included for comparison. Quantitation of the percentage of telomeric pulled down

and normalised to H3 is shown in the panel below. Mean +SD from 2 independent experiments.

94

3.2.2.2. Other tumour types

In addition to NB, we screened a cohort of 94 PanNET tumours, 48 oesophageal tumours, and 2 cohorts

of melanoma tumours (n=82 and n=62) for the ALT-negative/TC≥15 phenotype. Four melanoma

tumours met the criteria, C-circle negative and TC≥15, whilst one oesophageal tumour had a TC just

below the cut-off for long telomeres (Figure 3.8.A, B, C, D). As with the NB tumours, to determine if

these samples are utilising an as-yet unidentified ALT mechanism, or if they proliferate despite lack of a

TLM, we require cell line models to examine telomere length over time. Subsequently, 146 melanoma

cell lines were examined for C-circle level and TC. There were four melanoma cell lines with longer

telomere lengths (TC>10; Figure 3.9.A) and no C-circles, however, they had detectable mRNA expression

for hTERT and hTR RNA (Figure 3.9.B), components of telomerase, and had telomerase activity (Figure

3.9.C). Therefore, the ALT-negative/TC≥15 phenotype is present in melanoma tumours but the current

study did not identify any corresponding cell line model.

95

Figure 3.8. Some melanoma tumours are ALT-negative with TC≥15.

(A) Relative TC in arbitrary units (AU) of pancreatic neuroendocrine tumours (PanNET), measured by

telomere qPCR for individual patient tumours (n=94), plotted according to ALT status (ALT+ n=33,

ALT- n=61). ALT+ was defined by a relative C-circle level ≥7.5 compared to the ALT+ IIICF/c cell line

with an arbitrary value of 100. (B) Relative TC of oesophageal tumours (n=48) is plotted according to

ALT status (ALT+ n=0, ALT- n=48). (C) Relative TC of melanoma tumours cohort 1 (n=82) is plotted

according to ALT status (ALT+ n=12, ALT- n=70). ALT-negative samples with TC≥15 compared to ALT+

IIICF/c cell line with arbitrary value of 30 are indicated by the bracket. (D) Relative TC of melanoma

tumours cohort 2 (n=62) is plotted according to ALT status (ALT+ n=1, ALT- n=61), ALT-negative

samples with TC≥15 compared to ALT+ IIICF/c cell line with arbitrary value of 30 are indicated by the

bracket.

Data points represent the average of triplicate measurements by qPCR. Horizontal red bar indicates

mean.

96

Figure 3.9. ALT-negative/long telomere melanoma cell lines are telomerase positive.

(A) Relative telomere content, in arbitrary units (AU), of ALT-negative cell lines. Data points represent

the average of triplicate TC measurements by qPCR. A cohort of 146 melanoma cell lines are

represented. The box indicates 4 melanoma cell lines with long telomeres (TC>10). (B) mRNA

expression of the telomerase components hTR and hTERT, measured by RT-qPCR, for the TC>10

melanoma cell lines in Figure 3.8.A. (C) TRAP to detect telomerase activity in the long telomere TC>10

melanoma cell lines from Figure 3.8.A, B. The cell lines LA-N-6 and U-2 OS (ALT) are included as

negative controls whilst SH-SY5Y is a telomerase positive NB cell line.

97

3.3. Discussion

In the past two decades, numerous reports have identified telomerase activity as a poor prognostic

factor in NB (Ohali et al., 2006; Onitake et al., 2009; Poremba et al., 2000; Poremba et al., 1999).

However, reports also identified a subgroup of metastatic disease that does not utilise telomerase for

continued proliferation (Choi et al., 2000; Krams et al., 2001; Poremba et al., 2000; Poremba et al., 1999;

Reynolds et al., 1997). Studies of ALT in NB tumours thus far have relied on telomere length (Onitake et

al., 2009), or ATRX/DAXX mutations (Cheung et al., 2012; Kurihara et al., 2014; Molenaar et al., 2012;

Peifer et al., 2015; Valentijn et al., 2015) to identify the mechanism. This is the first study of ALT in NB

tumours to utilise telomere length and C-circles, a quantifiable marker of ALT activity, to determine the

prevalence of ALT in metastatic NB.

We found 24% of high-risk NB were ALT-positive and that MYCN amplification and ALT were

mutually exclusive, in agreement with previous studies (Cheung et al., 2012; Farooqi et al., 2014;

Molenaar et al., 2012; Peifer et al., 2015; Pugh et al., 2013). Interestingly, ALT-positive patients had

more late events than MYCN amplified patients. The presence of ALT correlated with poor outcome in

high-risk NB as previously reported in ATRX mutated NB tumours (Kurihara et al., 2014; Lundberg et al.,

2011; Onitake et al., 2009; Valentijn et al., 2015), liposarcoma, and malignant fibrous histiocytoma

tumours (Henson and Reddel, 2010). Thirteen ALT tumours had whole exome or whole genome

sequence data available and four of these tumours were wild type for ATRX and DAXX. Mutations in

ATRX/DAXX, and consequently the prevalence of the ALT mechanism, have been reported in 10-22% of

high-risk NB tumours (Cheung et al., 2012; Peifer et al., 2015; Valentijn et al., 2015). The broad range of

ALT prevalence reported via ATRX/DAXX sequencing indicates inter-study variables impact significantly

on the final prevalence estimates obtained from sequencing. These studies under-report the prevalence

of ALT by 2-12% compared to ALT in high-risk NB detected by the presence of C-circles. Therefore,

relying on ATRX and DAXX mutations to identify ALT-positive NB tumours would underestimate the

prevalence of this mechanism.

98

Of note, we identified a subgroup of high-risk NB that had telomere lengths similar to the length

of ALT cells but with very low levels of C-circles and no telomerase activity. In addition, 51% of the

patients in this subgroup died from the disease. This is distinct from Stage 4S NB, a group of unique

tumours that generally spontaneously regress and has a survival of 70-90% (Nickerson et al., 2000; van

Noesel et al., 1997). Like ALT-negative/telomerase-negative tumours reported in liposarcoma,

glioblastoma, osteosarcoma, and retinoblastoma (Costa et al., 2006; Gupta et al., 1996; Hakin-Smith et

al., 2003; Jeyapalan et al., 2008; Ulaner et al., 2003), serial tumour samples are required to determine if

these tumours represent an unidentified ALT mechanism lacking phenotypic characteristics of ALT, or if

these tumours do not require a TLM for long term proliferation. The only definitive way to determine

which hypothesis is correct, is to determine what happens to telomere length over time. In the first

scenario telomere lengths would be maintained, whilst in the second telomeres would shorten over

time. To determine if telomere length shortened during tumour growth we had to identify

corresponding cell line models, as it is not possible to obtain serial tumours samples from the same

patient over an extended period of time when the high-risk NB is left untreated. Two NB cell lines, COG-

N-291 and LA-N-6, derived from patients who died of metastatic disease, were identified with

characteristics that correspond to the ALT-negative/TC≥15 tumours. Interestingly, these cells have a

very low level of C-circle activity (at least 2 times lower than MeT-4A which has one of the lowest C-

circle levels reported in ALT-positive cells (Henson et al., 2009)) which indicates a very low level of ALT

activity in these cells. The only definitive way to determine if this is sufficient for telomere maintenance

is to examine telomere length over time. Subsequent chapters of this thesis describe the consequences

of continued proliferation on telomere length in these cells.

We were unable to identify potential TLM-negative cell lines in other tumour types. The criteria

used to identify ALT-negative/TC≥15 NB may not reflect the phenotype of ALT-negative/telomerase-

negative cells in other tumour types. NB is a childhood cancer and consequently the tumour initiating

cells have not undergone as many cycles of replication induced telomere shortening as in adult cancers.

The NB ALT-negative/TC≥15 cells have extreme telomere lengths, hence cell lines derived from these

99

tumours still have very long telomeres despite the PDs, and consequent telomere shortening,

undergone by the cells during the establishment of the cell line. Whilst adult tumour types, such as

melanoma, have ALT-negative/TC≥15 tumours, they do not have the extreme telomere lengths seen in

NB. Hence cell lines derived from these tumours may not have lengths above the normal range after the

PDs required to derive a cell line from the tumour. Indeed, this hypothesis is supported by the

observation, by the Decottignies laboratory, that melanoma cells with telomeres which are at the upper

end of the normal length do not have a TLM (Viceconte et al., 2017). Consequently, when screening

adult cancer types for ALT-negative/telomerase-negative cell lines the telomere length cut-off may need

to be adjusted.

In conclusion, telomere biology plays an important role in NB pathogenesis as activation of

either TLM confers poor outcome, although the disease course differs between ALT and telomerase-

positive tumours. Currently, TLM inhibitors are being developed as anti-cancer therapies and may be

effective in improving the outcome in high-risk NB with TLM. However, we require a greater

understanding of the ALT-negative/TC≥15 phenotype to determine whether such inhibitors would be

effective in these tumours. Success of targeted therapies requires appropriate biomarkers to predict

response. Establishing the TLM status of a tumour is therefore required prior to treatment with TLM

inhibitors or other TLM-targeted therapies. Care must be taken to correctly define ALT tumours, because

neither high telomere content nor ATRX/DAXX mutation is sufficient to classify ALT tumours, and are

best complemented with C-circles as an ALT activity assay.

100

Chapter 4: Long-term proliferation

occurs in cancer cells with ever-shorter

telomeres

101

Chapter 4: Long‐term proliferation occurs in cancer cells

with ever‐shorter telomeres

4.1. Introduction

A subgroup of high-risk NB tumours lack telomerase activity and upregulate the ALT mechanism to

maintain telomere lengths; however, previous identification of ALT in NB has been limited to

examination of telomere length (Onitake et al., 2009) or ATRX/DAXX mutations (Cheung et al., 2012;

Kurihara et al., 2014; Molenaar et al., 2012; Peifer et al., 2015; Valentijn et al., 2015). In the previous

chapter we examined ALT in high-risk NB by simultaneous detection of long telomeres and abundant C-

circles. This method identified ALT in 24% of high-risk NB, as well as a subgroup of TLM-negative tumours

that had extremely long telomeres. In previous studies, TLM-negative tumours were assumed to result

from false-negative assays. Yet, it is possible that the cells utilise a yet to be identified mechanism to

lengthen telomeres. It has also been hypothesised that extreme telomere length in tumour progenitor

cells would be sufficient for the tumour to achieve long term proliferation, without the need to activate

a TLM (Reddel, 2000). The aim of this chapter was to determine the consequence of continued

proliferation on the telomere length of two NB cell lines, COG-N-291 and LA-N-6. These cells are

characteristic of ALT-negative/TC≥15 tumours when screened by qPCR. However, detection by 32P

labelled telomere probe revealed the cells have a very low level of C-circles (compared to MeT-4A, an

ALT cell line with low C-circle levels (Henson et al., 2009)) indicative of low levels of ALT activity. To

determine if this was sufficient to maintain telomeres in these cells, telomere length was examined

during four years of continuous cell culture. We found that the COG-N-291 and LA-N-6 telomeres

undergo continuous shortening during continuous proliferation for 500 PDs, a phenotype we termed

ever-shorter telomeres (EST) in accordance with terminology from S. cerevisiae mutants (Lundblad and

Szostak, 1989).

102

4.2. Results

4.2.1. Cells with ever-shorter telomeres are capable of long-term proliferation

To determine whether the NB cell lines COG-N-291 and LA-N-6 utilise an alternative non-telomerase

method to maintain telomeres, or if they are truly TLM-negative, we examined the telomere length of

the cells during continual proliferation for 500 PDs. If the first scenario was true, telomere lengths would

be maintained, whilst truly TLM-negative cells would have continuous telomere length shortening.

Southern blot TRF analysis showed the telomeres of both cell lines shortened continuously during

culture (Figure 4.1.A, B), at a rate of 80 and 55 bp/PD for COG-N-291 and LA-N-6, respectively (Figure

4.2.A). Normal somatic cell division results in a 31-85 bp/PD loss of telomere sequence (Harley et al.,

1990). Hence, the shortening exhibited by COG-N-291 and LA-N-6 is the result of cell division related

telomere erosion, indicating the cells lack a TLM. A reduction in telomere content by qPCR confirmed

the telomere shortening demonstrated by TRF analysis (Figure 4.2.B). Despite shortening telomeres and

a very slow proliferation rate (3.4 days/PD for COG-N-291 and 3 days/PD for LA-N-6), the cells have yet

to reach senescence after 500 PDs and over four years in culture (Figure 4.2.C). Therefore, NB cells

derived from lethal high-risk tumours continue to proliferate long-term in spite of their EST phenotype.

4.2.2. Characteristics of EST cells

Telomerase activity and levels of ALT characteristics were monitored during continuous proliferation of

the EST cells. The cells remained telomerase negative throughout the culture period (Figure 4.3.A) and

the APB levels did not change (Figure 4.3.B). The C-circle levels were compared to the ALT cell line MeT-

4A set at 10 arbitrary units. This ALT cell line has one of the lowest levels of C-circles previously detected

(Henson et al., 2009). The C-circles in COG-N-291 and LA-N-6 persisted at very low levels with sporadic

increases for the first 300 PDs in culture, but for the next 200 PDs of culture there was a stabilisation of

C-circle levels, at an amount similar to MeT-4A (Figure 4.3.C). ATRX and DAXX were expressed across

the period of culture (Figure 4.3.D).

103

Figure 4.1. Two neuroblastoma cell lines (COG-N-291 and LA-N-6) are capable of long term

proliferation despite the ever-shorter telomere (EST) phenotype.

(A, B) TRF analysis of COG-N-291 and LA-N-6 telomere lengths at progressive population doublings

(PD). The white gaps between lanes and different well heights indicate individual TRF analysis

performed at progressive time points throughout the culture period. Individual blots are aligned

with each other by molecular weight marker.

Initial half of TRFs were completed by Dr Loretta Lau.

104

Figure 4.2. EST cells are capable of proliferation for hundreds of population doublings.

(A) The average rate of telomere shortening was calculated by plotting the average TRF length of

four individual TRF bands (indicated by asterisks in Figure 4.1) against the number of population

doublings (PD). (B) Telomere content measured by telomere qPCR. Data represent mean + SD, n=3.

(C) Growth curves of COG-N-291 and LA-N-6 demonstrate long-term proliferation.

Calculations in panel (A) completed by Dr Loretta Lau.

105

Figure 4.3. Characteristics of EST cells during continuous proliferation for 600 population

doublings.

(A) Telomerase activity was monitored by TRAP at the specified PDs in COG-N-291 and LA-N-6 cells.

SH-SY5Y and SK-N-BE2c were used as positive controls, and SK-N-FI and CHLA-90 (ALT+) as negative

controls. (B) Frequency of APBs in EST cells at early and late population doublings (PD). Data

106

represent mean +SD of 3 independent experiments. (C) C-circle levels detected using 32P labelled

telomeric DNA probe on slot blot. Levels were calculated relative to those of the ALT+ MeT-4A cell

line (designated to be 10 AU). SK-N-BE2c (telomerase-positive) was included as a negative control.

(D) ATRX and DAXX immunoblot at specified population doublings (PD) with β-actin as loading

control.

IP-TRAP was, in part, performed by Dr Christine Napier.

4.2.2.1. ALT and the EST phenotype

C-circles were present at low levels in early populations of the EST cell lines. The cells undergo

continuous telomere shortening during this time, indicating that a small amount of ALT activity may be

present in these cells but at levels insufficient to confer telomere maintenance. This is consistent with

the observation that telomere shortening can occur in telomerase-positive normal cells (Broccoli et al.,

1995; Marion et al., 2009), and that ALT activity has been detected in somatic cells of mice (Neumann

et al., 2013). However, within the first 300 PDs of culture the cells had sporadic increases in C-circle

levels despite continuous telomere shortening ultimately resulting in a level of C-circles similar to the

ALT cell line MeT-4A after PD400 and telomere length stabilisation. To determine if a subpopulation of

the EST mass culture was responsible for the sporadic increases in C-circle levels at early PDs, COG-N-

291 cells at PD247 (the first timepoint where COG-N-291 had increased C-circle levels, Figure 4.3.C) were

sub-cloned by plating cells at very low density until colonies from a single cell arose. The TRF analysis of

subclones indicated clone 4 has long and heterogeneous telomere lengths, typical of ALT cells, whilst

the remaining cell lines have the banding pattern seen in the EST mass culture (Figure 4.4.A). The level

of C-circles in clone 4 was at least five-fold higher than the other COG-N-291 subclones (Figure 4.4.B),

which indicates that a subpopulation of cells is responsible for the increased C-circle level in the mass

culture.

107

Figure 4.4. A subpopulation of COG-N-291 cells are responsible for sporadic increases in C-circles

in the first 300 PDs of culture.

(A) TRF of the telomere length of COG-N-291 clones isolated at PD247. (B) C-circle slot blot detected

with 32P-labelled telomeric DNA probe. SK-N-FI was used as an ALT-positive, C-circle positive control

and SK-N-BE2c a telomerase-positive, C-circle negative control.

The TRF pattern and C-circle level in COG-N-291 clone 4 suggests that these cells have

upregulated the ALT mechanism whilst the other subclones isolated were EST cells. Examination of

telomere length over time by both TRF and qPCR analysis showed telomere maintenance in clone 4,

whereas clones 3 and 11 exhibited the EST phenotype (Figure 4.5.A, B). As expected, none of the

subclones exhibited telomerase activity during 100 PDs of culture (Figure 4.5.C), confirming that, by

definition, the clone 4 cells must be utilising some form of an ALT mechanism to maintain telomere

108

Figure 4.5. Periodically a population of COG-N-291 cells activate an ALT mechanism but a slower

proliferation rate prevents them outgrowing the EST cells.

(A) TRF analysis of the COG-N-291 subclones telomere lengths at progressive population doublings

(PD). (B) Telomere content measured by telomere qPCR in arbitrary units (AU). Data represent

mean + SD, n=3. (C) Telomerase activity was monitored by TRAP at the specified PDs. SH-SY5Y was

109

included as a positive control and U-2 OS as a negative control. (D) Growth curves of COG-N-291

subclones over 50 population doublings (PD).

lengths. The EST subclones had faster growth rates than clone 4; 3.3 days/PD for clone 3, 2 days/PD for

clone 11 vs. 3.8 days/PD for clone 4 but this did not result in senescence in the cultures after 100 PDs of

continuous proliferation (Figure 4.5.E). The slower growth rate of clone 4 implies that activation of the

ALT mechanism has not provided a survival advantage for these cells, and consequently they do not

become the predominant population in a mixed culture with the EST cells in the first 300 PDs of growth

(Figure 4.3C). Presumably, further molecular changes, caused by long term culture, were required for

these ALT-like cells to become the predominant population of cells observed after PD400 leading to the

increased C-circle levels (Figure 4.3C).

Subclone 4 was able to upregulate the ALT mechanism to a sufficient level to confer telomere

length maintenance; however, these cells do not possess any of the other characteristic features of ALT.

As expected, clone 4 cells maintained a high level of C-circles during culture whilst the EST subclones

had very low levels although, like the mass culture, clone 3 had a sporadic increase in C-circles (Figure

4.6.A). There was no increase in the level of APBs observed in clone 4 compared to the EST controls

(Figure 4.6.B). Gene mutations associated with ALT, such as alterations to ATRX, DAXX and TP53, were

absent in the clone 4 culture and ATRX and DAXX full length proteins were expressed (Figure 4.6.C).

There was also no increase in TERRA levels with activation of ALT (Figure 4.6.D) and as expected for TP53

wild type cells meta-TIFs did not accumulate (Figure 4.6.E).

4.2.3. Genetics of EST cells

To determine whether EST cells had genetic events that prevented sufficient upregulation of a TLM to

counteract telomere attrition, we used whole genome sequencing to examine 656 genes related to

telomere biology, ALT, and processes relating to RNA or DNA replication, repair and damage response

110

Figure 4.6. Characteristics of COG-N-291 sublines during continuous long-term proliferation.

(A) C-circle levels of three sub-clones of COG-N-291 (clone 4, 3, 11) detected using 32P-labelled

telomeric DNA probe on slot blot. Levels were calculated (as arbitrary units [AU]) relative to those

of the ALT cell line MeT-4A set to 10 AU. SK-N-BE2c (telomerase-positive) was included as a

negative control. (B) Frequency of APBs in COG-N-291 sublines compared to the COG-N-291 mass

culture. Graph shows the mean +SD of three independent experiments. (C) ATRX and DAXX

immunoblot with GAPDH as loading control. (D) Graph of meta-TIF assay results, percentage of

chromosome ends with or without telomere signal that have DNA damage. Mean +SD from 3

111

independent experiments. (E) TERRA detected by slot-blot analysis with GAPDH loading control.

Quantitation in bottom panel from 3 independent experiments (mean +SD).

(Appendix II Table A2.5). To represent each of the three telomere-biology groups (EST, ALT and

telomerase-positive), a total of 6 cell lines and 9 tumours were analysed (two NB cell lines and three

tumours per group). As matched normal DNA was not available for the samples, we filtered the data

using Ingenuity Variant Analysis to exclude genetic events previously reported in publicly available data

sets of normal genomes. Relevant alterations were those predicted to have unknown or deleterious

consequences and were not present in the ALT or telomerase-positive samples. There were no specific

genetic events identified for the EST phenotype (Appendix II Table A2.6).

4.3. Discussion

Cellular immortalisation, via activation of a TLM to counteract normal telomere attrition, is considered

to be an essential step in malignant transformation and therefore a hallmark of cancer (Hanahan and

Weinberg, 2000; Hanahan and Weinberg, 2011). To form a mass of approximately 1 kg, a single cell

needs to go through 40 cell divisions (240 cells), which many types of normal cells are able to achieve

(Parkinson, 1996; Reddel, 2000). However, this would require all cells to survive, which is not possible

in a tumour environment where there is an inadequate supply of oxygen and nutrients. Oncogenesis

also requires multistep oncogenic mutation and associated clonal evolution, resulting in an increase in

the number of cell divisions required for a tumour mass to form, and consequently the cells may require

immortalisation in order to form a clinically significant tumour (Parkinson, 1996; Reddel, 2000).

However, it has been postulated that immortalisation is not required if the progenitor cells have long

telomeres, the tumours are genetically simple such as paediatric cancers (Alexandrov et al., 2013; Jones

et al., 2008; Parsons et al., 2011; Vogelstein et al., 2013) and don’t require multiple rounds of clonal

evolution, or the tumour environment supports a high surviving fraction such as leukaemias (Reddel,

2000). The presence of the EST phenotype in malignant NB cells provides direct evidence to support the

112

hypothesis that immortalisation is not an absolute requirement for oncogenic development. The NB EST

cells have very long telomeres that can act as a substitute for an active TLM, permitting the cell divisions

required for additional oncogenic changes which are essential to the formation of malignant tumours.

The discovery of malignant and lethal TLM-negative cancer cells has implications for the

development of TLM inhibitors for clinical use as anti-cancer therapies. Tumours that rely on extreme

telomere length, and not a TLM, for continual proliferation will be resistant to these inhibitors. The

existence of EST cells illustrates the need to assay for TLMs prior to therapy with such drugs. The

similarity of the telomere lengths in EST and ALT cells indicate that it is not appropriate to define ALT by

telomere length alone: measurement by telomere qPCR, TRF or telomere FISH is not sufficient to

differentiate the two phenotypes. Furthermore, care must be taken when utilising C-circles to define

ALT; presence of low levels of C-circles does not indicate sufficient ALT activity to counter the EST

phenotype. This is further complicated by the evidence that EST cultures have periodic increases in C-

circles. Although misclassification of such a phenotype as ALT could result in the use of an ALT inhibitor

that targets a subpopulation of the tumour cells, the bulk of the tumour would be resistant to such

treatment.

The majority of ALT cell lines report inactivation of p53 function, either by viral oncoproteins or

TP53 mutations (Henson and Reddel, 2010). This implies that p53 has a role in supressing ALT, likely due

to p53 mediated senescence or apoptosis which may be triggered by the high levels of chromosomal

instability (Montgomery et al., 2004; Scheel et al., 2001; Ulaner et al., 2004) and telomeric DNA damage

signals present in ALT cells (Cesare et al., 2009; Stagno d'Alcontres et al., 2007). COG-N-291 subclone 4

is an example of a cell line that can maintain telomeres by a telomerase-independent mechanism while

retaining functional p53. As expected, these cells do not accumulate DNA damage signals at the

telomere, although they have reduced proliferation rates compared to the EST cells. In a mixed culture

of ALT and EST COG-N-291 cells, clone 4 is unable to outgrow the EST cells due to this reduced rate of

proliferation, resulting in their removal from the population and the fluctuating C-circle levels we

113

observed. Previous studies indicate ATRX can supress the ALT mechanism (Clynes et al., 2015; Napier et

al., 2015). Clone 4 cells lack abundant APBs but have wild type ATRX and DAXX, which may act with p53

to suppress some of the characteristics of ALT. However, a small proportion of ALT cell lines retain ATRX

and DAXX protein, whilst exhibiting classic ALT phenotypes (Lovejoy et al., 2012), indicating that

retention of p53, ATRX and DAXX protein is not soley responsible for the repressed ALT phenotype in

COG-N-291 clone 4 cells.

In conclusion, this chapter has provided evidence that lethal, malignant human cancers may, in

some cases, contain cells that can proliferate long term with continuously shortening telomeres. The

extreme telomere length which was presumably present in the progenitor cells gave rise to EST cells

that do not require immortalisation for proliferation in excess of 500 PDs. The overlap in some features

of the EST and ALT phenotypes indicates that appropriate assaying for TLMs is required before the use

of TLM inhibitors as anti-cancer therapeutics.

114

Chapter 5: Activation of a telomere

lengthening mechanism rescues the

ever-shorter telomere phenotype

115

Chapter 5: Activation of a telomere lengthening

mechanism rescues the ever‐shorter telomere

phenotype

5.1. Introduction

The previous chapter describes two NB EST cell lines that were capable of extensive proliferation in spite

of their continually shortening telomeres. Examination of C-circle levels in these cells identified a

subpopulation of cells that were able to activate a telomerase-independent TLM, although these cells

did not possess many of the characteristics of ALT. In principle, these cells show that activation of a TLM

would rescue the EST phenotype. The aim of this chapter is to provide evidence that ectopic expression

of hTERT in EST cells results in telomerase activity, and that TP53 mutated EST cells activate a typical

ALT mechanism, and ultimately, that activation of either TLM rescues the EST phenotype. In addition to

proving that activation of a TLM abolishes the EST phenotype, we determined that the EST lines were t-

circle deficient, suggesting that the EST phenotype may arise due to a failure of t-circle formation and

telomere trimming.

5.2. Results

5.2.1. Activation of telomerase rescues the EST phenotype

To confirm that activation of a TLM would abolish the EST phenotype we activated telomerase in LA-N-

6 cells at PD83. As established in Chapter 3, LA-N-6 cells lack expression of the telomerase catalytic

subunit, hTERT. Retroviral transduction of hTERT, or of hTERT plus hTR (telomerase RNA subunit; Figure

5.1.A), resulted in telomerase activity (Figure 5.1.B). To confirm that the telomerase activity detected

116

Figure 5.1. Retroviral transduction of hTERT results in telomerase activity in LA-N-6 cells.

(A) mRNA expression of the three telomerase components (hTR, hTERT and dyskerin; measured by

RT-qPCR) in LA-N-6 infected with plasmids for either hTR (clones, hTR C3 & C4), hTERT (clones,

hTERT C4 & C23) or hTR/hTERT (clones, hTR/hTERT C19 & C23). (B) Telomerase activity detected

by TRAP. U-2 OS and SH-SY5Y cells are negative and positive controls, respectively, for telomerase

activity. (C) TRAP assay performed on heat-inactivated lysates (55°C for 20 mins) from Figure 5.1.B

shows that there is no PCR product contamination. (D) Growth curves of LA-N-6 derivatives.

*P<0.0003

118

Figure 5.2. Ectopic expression of telomerase rescues the EST phenotype.

(A) TRF analysis of the telomere length of LA-N-6 clones at the indicated PDs. (B) Verification of TRF

results by telomere qPCR at the indicated PDs. qPCR data represent mean of triplicates +SD. (C)

Relative telomere fluorescent signals measured from telomere FISH (15 metaphases analysed per

cell line). Dots represent individual telomere signals and red horizontal bar indicates mean. (D) Graph

indicates the percentage of chromosome ends without telomere signal in telomere FISH from Figure

5.2.C.

was not due to PCR contamination a proportion of all samples had the telomerase enzyme heat

inactivated prior to the TRAP assay. These samples were negative on a TRAP gel (Figure 5.1.C) confirming

that the banding pattern in Figure 5.1.B was due to the presence of the telomerase enzyme in these

cells. As expected, expression of hTR alone did not result in telomerase activity. Activation of telomerase

led to a significant increase in the growth rate of these cells compared to LA-N-6 transduced with hTR

alone (Figure 5.1.D). Telomere length was examined by both TRF and qPCR, which showed that the EST

phenotype was abolished in all clones expressing telomerase (Figure 5.2.A, B). Two clones expressing

hTERT (C4 and C23) and one clone expressing hTR/hTERT (C19) maintained telomere length, whereas

one hTR/hTERT expressing clone (C23) underwent telomere lengthening over the 50 PDs of culture

(Figure 5.2.A, B). In the telomerase-positive cells, the shortest telomeres were preferentially elongated

(Figure 5.2.C, D). In contrast, two independent clones with overexpression of hTR did not abolish the

EST phenotype (Figure 5.2.A, B). The activation of telomerase resulted in elongated telomere lengths in

LA-N-6 but as expected this did not result in any changes to ALT characteristics. The level of APBs, C-

circles and TERRA did not differ between the hTR, hTERT, and hTR/hTERT clones (Figure 5.3.A, B, C, D).

Consequently, we have demonstrated that activation of telomerase in an EST cell line rescued the EST

phenotype.

119

Figure 5.3. No change to ALT characteristics following ectopic expression of hTERT.

(A) APB (localisation of telomere FISH signal to PML body) analysis of LA-N-6 derived cell lines. Mean

+SD from 3 independent experiments. (B) C-circle levels were detected by slot blot analysis. MeT-4A

and SK-N-BE2c were included as the ALT-positive control and the telomerase-positive negative

control, respectively. (C) Quantitation of C-circle results in Figure 5.3.B. (D) TERRA detected by slot-

blot analysis. Quantitation in bottom panel from 3 independent experiments (mean +SD).

120

Figure 5.4. A LA-N-6 subline spontaneously acquired a premature stop codon in TP53.

(A) Chromatograph from Sanger sequencing of LA-N-6 TP53 wild-type cells (LA-N-6 WT p53) and

the LA-N-6 subline that spontaneously acquired a stop codon (Y236*) (LA-N-6 MUT p53). (B) p53

immunoblot of LA-N-6 cells with wild-type and mutant TP53. GAPDH was used as loading control.

Western blot performed by Dr Loretta Lau.

5.2.2. Activation of ALT rescues the EST phenotype

Activation of telomerase in telomerase-negative cells only requires ectopic expression of the telomerase

components hTR and hTERT (Weinrich et al., 1997). By comparison activating ALT is far more

challenging. Currently, no one gene has been identified that is responsible for activating the ALT

mechanism. In the previous chapter, we provided evidence that COG-N-291 cells can spontaneously

activate ALT. In contrast to COG-N-291, LA-N-6 cells have a single copy of TP53 and consequently there

is a high likelihood that these cells may develop a spontaneous TP53 mutation during long-term culture.

Therefore, to determine if activation of ALT can rescue the EST phenotype, we developed a strategy to

identify a spontaneously activated ALT mechanism in LA-N-6 TP53 mutated cells.

122

Figure 5.5. Activation of ALT results in rescue of the EST phenotype.

(A) TRF analysis of the LA-N-6 culture from acquisition of the p53 mutation (PD90) to PD654.

(B) Telomere content of LA-N-6 MUT p53 cells measured by telomere qPCR. Mean +SD, n=3.

(C) Percentage of chromosome ends free of telomere signal (obtained from telomere FISH) in LA-

N-6 parental (wild-type TP53) and LA-N-6 MUT p53 cells. Quantitation from 15 metaphase spreads.

(D) Growth curves of LA-N-6 parental (wild-type TP53) and LA-N-6 MUT p53 culture. (E) Telomerase

activity was monitored by TRAP at the specified PDs in LA-N-6 MUT p53 cells. Lysates were

immunopurified (IP) with anti-hTERT antibody to remove potential inhibitors which could lead to

false negative results. SH-SY5Y and SK-N-BE2c were used as positive controls.

We first identified a subculture of LA-N-6 that spontaneously acquired a TP53 mutation at PD90. The

subclone had spontaneously acquired a base change in exon 7 of TP53 (Figure 5.4.A), resulting in a

premature stop codon (Y236*) and loss of p53 protein expression (hereafter referred to as LA-N-6 MUT

p53; Figure 5.4.B). As expected, the loss-of-function mutation was insufficient to activate ALT, and the

telomeres of this LA-N-6 MUT p53 subculture continued to shorten until PD209, i.e., for another 119 PD

(Figure 5.5.A). By PD222, the telomere length profile of the cells had changed to have the typical

appearance of ALT (Figure 5.5.A). Over the next 99 PD, the mean telomere length fluctuated slightly,

but after PD240 the continuous telomere shortening previously exhibited by these cells had ceased,

demonstrating that a TLM had been activated (Figure 5.5.A). Telomere qPCR confirmed telomere length

maintenance in LA-N-6 MUT p53 cells after PD209 (Figure 5.5.B). From PD222 onwards, the shortest

telomeres in the TRF were elongated, an observation supported by a decrease in the percentage of

chromosomes with telomere signal-free ends (Figure 5.5.C). The growth rate of the culture was

unchanged by the loss of p53 at PD90 and by activation of a TLM at PD209 (Figure 5.5.D). The LA-N-6

MUT p53 cells exhibited telomere maintenance in the absence of telomerase (Figure 5.5.E), therefore

the TLM that was activated was, by definition, an ALT mechanism. Consistent with this conclusion, we

observed a 2 to 4-fold increase in C-circle levels from PD222 until PD503, after which a further 2 to

123

Figure 5.6. Loss of p53 results in activation of ALT in an EST culture (LA-N-6).

(A) C-circle assay product was detected using slot-blot analysis. Levels were calculated relative to

the ALT-positive MeT-4A cell line with an arbitrary unit of 10 and graphed on the right. SK-N-BE2c

was included as a negative control. (B) Percentage of APB positive cells in TP53 wild type LA-N-6 at

124

PD95 compared to LA-N-6 mutant cells at PD704 (mean +SD, n=3 independent experiments). (C)

TERRA level in the ALT-positive LA-N-6 MUT p53 PD618 compared to TP53 wild-type LA-N-6 PD93

cells. Quantitation shows mean +SD (n=3 independent experiments). (D) Telomere sister chromatid

exchange (T-SCE) events indicated by colocalisation of red and green FISH labelled telomeres

(shown by arrows) and quantitated in the graph (mean +SD, n=2 independent experiments).

4-fold increase was observed (Figure 5.6.A), there was a 4-fold increase in APBs (Figure 5.6.B), a 2-fold

increase in TERRA (Figure 5.6.C), and a 4-fold increase in T-SCE events (Figure 5.6.D). The mechanism of

ALT activation in LA-N-6 MUT p53 cells is currently unknown; although down-regulated, ATRX and DAXX

expression was not abolished, and the proteins continued to localise to the nucleus (Figure 5.7.A, B).

Although loss of p53 removes a barrier to the accumulation of DNA damage responses at the telomere

(Cesare et al., 2009), the number of meta-TIFs remained unchanged (Figure 5.7.C). Irrespective of the

mechanism utilised to activate ALT, our results demonstrate that ALT is able to rescue the EST

phenotype.

5.2.3. EST neuroblastoma cell lines are unable to generate t-circles

During the investigation of spontaneous ALT activation in COG-N-291 clone 4 and LA-N-6 MUT p53 cells,

we examined the level of t-circles, a type of double-stranded circular telomeric DNA. T-circles are

abundant in ALT cells (Cesare and Griffith, 2004), and it has been proposed that this is the result of

telomere trimming following telomere over-lengthening by ALT (Pickett and Reddel, 2012). T-circles

have also been shown to form as a result of telomere trimming in cells that have had telomeres over-

lengthened by telomerase (Pickett et al., 2009). The two EST cell lines lack t-circles, and as expected, t-

circles are present in the two ALT NB cell lines (Figure 5.8.A). Contrary to what was expected, no t-circles

were generated in the LA-N-6 clones after activation of telomerase (Figure 5.8.B), even though all hTERT

or hTERT/hTR expressing clones had extremely long telomeres after activation of telomerase. The

LA-N-6 MUT p53 culture also failed to generate t-circles, even after hundreds of PDs utilising the ALT

mechanism, and perhaps less surprisingly the COG-N-291 clone 4 cells also lacked t-circles (Figure 5.8.C).

125

Figure 5.7. LA-N-6 MUT p53 cells did not activate ALT due to aberrations to ATRX or DAXX.

(A) ATRX and DAXX immunoblot with HSP70 loading control. (B) Immunofluorescence indicating

the presence of ATRX or DAXX foci (red) in the nucleus (blue). CHLA-90 is included as the ATRX

negative control and SH-SY5Y as the positive control for ATRX and DAXX expression. (C) Graph of

meta-TIF assay results demonstrating percentage of chromosome ends which have both DNA

damage and telomere signal (-H2AX/TTAGGG+) and chromosome ends which have DNA damage

in the absence of telomere signal (-H2AX/TTAGGG-) in LA-N-6 TP53 wild type PD96 and LA-N-6

MUT p53 PD707. Mean +SD from 3 independent experiments.

These results suggest that both of the EST cell lines are unable to undergo telomere trimming and

generate t-circles. A number of proteins are known to be involved in t-circle formation including: XRCC3

(Compton et al., 2007; Wang et al., 2004), NBS1 (Wang et al., 2004), SLX4 (Sarkar et al., 2015), TZAP (Li

et al., 2017), and RTEL1 (Deng et al., 2013), but whole genome sequencing of the EST cells did not reveal

any mutations in these genes (Appendix II Table A2.6) and all NB cell lines have detectable transcript for

the five genes involved in t-circle formation (Figure 5.9).

127

Figure 5.8. EST cells do not form t-circles after activation of ALT or extreme telomere lengthening

by telomerase activity.

(A) Two-dimensional gel electrophoresis of restriction-digested genomic DNA. Denatured gels were

hybridised with a 32P-labelled C-rich telomeric DNA probe. T-circle arcs are indicated by the arrow.

(B) hTR and hTERT expressing LA-N-6 clones do not have t-circles at early or later PDs. (C) T-circles

(indicated by arrow) are present in the ALT control but not in LA-N-6 MUT p53 or COG-N-291

clone 4.

The investigation of t-circles was conducted by A/Prof Hilda Pickett.

5.3. Discussion

This chapter describes the features of EST cultures that have activated a TLM, and thereby abolished

the EST phenotype. Spontaneous activation of a telomerase independent TLM, which is by definition

ALT, in a p53-mutant LA-N-6 clone (presented in this chapter) resulted in a different phenotype than a

COG-N-291 clone (described in Chapter 4). The COG-N-291 clone had a reduced proliferation rate with

no increase in APBs and TERRA, compared to COG-N-291 EST cells. In contrast, the LA-N-6 clone had a

similar proliferation rate, and increased APB and TERRA levels compared to LA-N-6 EST cells.

Interestingly, both cultures have a typical ALT TRF profile, an increase in C-circles, and are wild type for

ATRX and DAXX. The most notable difference between the ALT COG-N-291 and LA-N-6 cultures relates

to TP53 status. The COG-N-291 clone (clone 4) is the first cell line reported to retain expression of wild

type TP53 and full length ATRX protein whilst utilising a telomerase-independent mechanism to prevent

telomere shortening (Henson and Reddel, 2010; Lovejoy et al., 2012). The presence of functional p53

may account for the reduced proliferation rate in the COG-N-291 ALT clone that was not observed in

LA-N-6. Currently, we do not understand the mechanism that these cells have used to activate telomere

lengthening, but as we know that a proportion of ALT NB tumours are wild type for both TP53 and ATRX

(Chapter 3), this cell line will provide a valuable model for understanding this disease.

128

Figure 5.9. EST cells express genes involved in t-circle formation.

(A) Transcript levels of NBS1, TZAP, RTEL1, SLX4, and XRCC3, genes involved in t-circle formation.

The cell lines GM847, SK-N-FI and CHLA-90 are ALT cell lines that form t-circles.

The EST cells that we have identified indicate that a TLM may not be required for the formation

of metastatic and lethal tumours, presumably when the progenitor cells have telomeres long enough to

sustain extensive proliferation, though we do not know how this initial lengthening occurred in EST NB

cells. Telomerase is active during human embryogenesis, prior to downregulation during the late stages

of gestation, leaving somatic cells telomerase-negative (Ulaner and Giudice, 1997; Wright et al., 1996).

Telomere trimming, a process that generates t-circles, regulates telomere length in cells that have been

over-lengthened by telomerase (Pickett et al., 2009). We propose that a failure of telomere trimming,

and subsequently lack of t-circle formation, in EST NB cells resulted in in excessive telomere lengths

during embryogenesis. The EST NB cells lacked detectable t-circles, even in circumstances where their

long telomeres were lengthened further by telomerase. Abundant t-circles are also a feature of

lengthening by ALT (Cesare and Griffith, 2004), but t-circles were not detected in either of the COG-N-

129

291 or LA-N-6 clones that spontaneously activated an ALT mechanism. A lack of telomere trimming may

cause inhibition to the full expression of the ALT phenotype as observed in the ALT COG-N-291 or LA-N-

6 clones. Presumably, the EST cells downregulated telomerase activity as normal during embryogenesis,

leaving excessively lengthened telomeres, which have allowed very extensive proliferation to occur

without requiring significant upregulation of a TLM. As with tumours that activate a TLM, additional

oncogenic changes would need to have occurred to result in the development of malignant EST tumours,

and the excessively long telomeres presumably provide sufficient reserves of telomere content to

obviate the need for an activated TLM.

In summary, we have shown that activation of a TLM is sufficient to rescue the EST phenotype.

EST cells lack t-circles implying a failure of telomere trimming, regardless of the mechanism (either

activation of telomerase or ALT) used to overlengthen the telomeres. This is the first example of a

disease that may result from a failure of telomere trimming. Despite treatment in these patients, EST

tumours are lethal in approximately 50% of patients and the telomere trimming mechanism may

provide a unique way to target therapies to these cells.

130

Chapter 6: Neuroblastoma EST cells are

sensitive to topoisomerase inhibitors

131

Chapter 6: Neuroblastoma EST cells are sensitive to

topoisomerase inhibitors

6.1. Introduction

The aggressive behaviour of high-risk NB requires extensive cellular proliferation made possible via

activation of a TLM, either telomerase or ALT, or by an EST phenotype which is characterised by

extremely long telomeres that allow proliferation without significant upregulation of a TLM. In Chapter

3 we show that the prognosis of each of these groups of tumours is poor: the 5-year overall survival is

28% for patients with MYCN amplified tumours (which are generally telomerase positive (Hiyama et al.,

1997)), 36% for ALT-positive patients, and 49% for EST NB. In addition, telomere biology has an impact

on disease course, with ALT and EST NB patients having late events compared to MYCN amplified

tumours. Recently, several large scale genomic studies have been conducted to elucidate driver

mutations in NB (Molenaar et al., 2012; Pugh et al., 2013). Whilst these studies were unable to identify

a driver mutation, approximately 10% of tumours had mutations to the ATRX gene which is associated

with ALT activity (Cheung et al., 2012; Kurihara et al., 2014; Molenaar et al., 2012; Pugh et al., 2013), or

rearrangements upstream of hTERT which results in reactivation of telomerase (Peifer et al., 2015;

Valentijn et al., 2015). Therefore, telomere biology has become an attractive target for the development

of novel NB therapies.

Over the last two decades telomerase inhibitors have gone through various stages of

development, resulting in a number of clinical trials in diseases such as breast and lung cancer,

glioblastoma, and lympho-proliferative disorders (Arndt and MacKenzie, 2016). In contrast, ALT

inhibitors have yet to enter clinical trials and are still being developed in preclinical laboratory models

(Deeg et al., 2016; Flynn et al., 2015).

132

The EST NB cell lines have very low levels of C-circles which likely represent a very low level of

ALT activity that is insufficient to confer telomere maintenance in these cells. In yeast, ALT acts

preferentially on the shortest telomeres (Fu et al., 2014) although, Murnane and colleagues suggest that

this is not necessarily the case in human cells (Murnane et al., 1994). In the experiments described in

this chapter, we tested the hypothesis that the low level of ALT in EST cells may preferentially lengthen

the shortest telomeres as critically short telomeres will eventually trigger p53-mediated senescence or

apoptosis. If this was the case, even though ALT activity is clearly insufficient to prevent telomere

shortening, EST cells might rely on low levels of ALT to survive, and consequently inhibition of ALT would

result in increased cell death. The ALT mechanism relies on homologous recombination. APBs potentially

play a role in this process as proteins associated with homologous recombination are found at APBs

(Pickett and Reddel, 2015). One such protein, RPA, is associated with replication stress via its interaction

with ATR (Zou and Elledge, 2003). It has been suggested that ALT cells are acutely sensitive to ATR

inhibitors (Flynn et al., 2015), implying that replication stress has a role in ALT activity that can be

targeted by anti-cancer therapeutics. Therefore, the aim of this chapter was to determine the sensitivity

of EST cells to common NB chemotherapeutics, and to determine if treatment with drugs that target

the ALT mechanism led to an increased rate of cell death.

6.2. Results

6.2.1. EST cells are sensitive to topoisomerase inhibitors

EST cells represent a novel prognostic group of NB, with an approximately 50% 5-year mortality in high-

risk patients. To develop better treatments for these patients we first need to understand the role

telomere biology plays in the response of high-risk NB to chemotherapy. We asked whether cells of

different telomere biology groups (ALT-positive, telomerase-positive, or EST) had different sensitivity to

common NB chemotherapeutics. Using AlamarBlue, a redox indicator that provides a quantitative

measure of cell viability, we determined the effect of chemotherapeutics on the proliferation of six

telomerase-positive (SH-SY5Y and SK-N-BE2c NB cell lines; HT1080, GM639, HT1080 hTR and

133

Figure 6.1. EST cells are sensitive to topoisomerase inhibitors.

Cell lines were treated with increasing concentrations of (A) doxorubicin, (B) etoposide, (C, D)

irinotecan, and (E, F) topotecan for 6 PDs before proliferation was quantified using AlamarBlue. U-

2 OS and GM847 ALT cell lines, and HT1080, GM639, HT1080 hTR and HeLa 1.2.11 telomerase-

positive cell lines were included as non-NB controls. Results in panel (A), (B), (C), (E) are expressed

as percentages of growth compared to untreated controls and as means of triplicate independent

experiments +SD. Panel (D) displays the percentage of cell growth, compared to control cells, when

134

cells were treated with 2.8 µM irinotecan. COG-N-291 had significantly reduced growth compared

to all cell lines except SH-SY5Y and HT1080 hTR whilst LA-N-6 had significantly reduced growth

compared to U-2 OS, SK-N-BE2c and HeLa 1.2.11 cells (when significant P<0.05). Panel (F) displays

the percentage of cell growth, compared to control cells, when cells were treated with 0.0004 µM

topotecan. COG-N-291 and LA-N-6 cells had significantly reduced growth compared to all other cell

lines (P<0.001).

HeLa 1.2.11 non-NB cell line), four ALT-positive (SK-N-FI and CHLA-90 NB cell lines; U-2 OS and GM847

non-NB cell lines), and the two EST (COG-N-291 and LA-N-6 NB cells) cell lines. As the cell lines in this

panel had a range of growth rates, of which COG-N-291 and LA-N-6 were the slowest, it was not possible

to treat for a fixed length of time, instead cells were treated for a duration of 6 PDs. The DNA damaging

agent doxorubicin reduced proliferation of all cell lines, although there was no differential response to

doxorubicin based on telomere biology (Figure 6.1.A; Table 6.1). Treatment with etoposide, a

topoisomerase II inhibitor, resulted in the most significant growth inhibition of COG-N-291 cells (IC50

0.08 µM; the dose to inhibit 50% of control growth) (Figure 6.1.B), although sensitivity to topoisomerase

II inhibitors is not a general feature of EST cells as LA-N-6 had an IC50 of 0.23 µM, similar to telomerase-

positive cell lines (0.17 to 0.56 µM). In contrast, EST cells show a striking sensitivity to the topoisomerase

I inhibitors, irinotecan and topotecan (Figure 6.1.C, D, E, F). At a dose of 2.8 µM irinotecan COG-N-291

had significantly reduced cell growth compared to all cell lines except SH-SY5Y and HT1080 hTR whilst

LA-N-6 cells had a similar trend of sensitivity with significantly reduced growth compared to U-2 OS, SK-

N-BE2c and HeLa.1.2.11 cells (where significant P<0.05, Figure 6.1D). The EST cells were particularly

sensitive to topotecan treatment, 0.0004 µM topotecan led to significantly reduced EST cell growth

compared to all other cell lines tested (P<0.001, Figure 6.1F). The IC50 of irinotecan and topotecan for

non-EST cell lines with long telomeres (U-2 OS, HT1080 hTR, and HeLa 1.2.11), was generally higher than

the EST cells (Figure 6.1.C, D; Table 6.1), indicating that the telomere length of EST cells is not entirely

135

Figure 6.2. Telomere biology does not influence sensitivity of NB cells to common NB therapies.

Cell lines were treated with increasing concentrations of (A) vincristine, (B) cisplatin, (C)

temozolomide, and (D) all-trans retinoic acid (ATRA) for 6 PDs before proliferation was quantified

using AlamarBlue. U-2 OS and GM847 ALT cell lines, and HT1080, GM639, HT1080 hTR and HeLa

1.2.11 telomerase-positive cell lines were included as controls. Results are expressed as

percentages of growth compared to untreated controls and as means of triplicate independent

experiments +SD.

responsible for their sensitivity to topoisomerase I inhibitors. The response of cell lines to vincristine,

cisplatin and temozolomide (Figure 6.2.A, B, C) varied depending on the cell line and was not associated

with telomere length maintenance phenotype. All-trans retinoic acid (ATRA), a differentiating agent, did

not reduce the proliferation of cells in a treatment period of 6 PDs (Figure 6.2.D).

136

Table 6.1. IC50 values for common NB chemotherapeutics.

IC50 (µM)

Doxorubicin Etoposide Cisplatin Irinotecan Topotecan Temozolomide Vincristineb

All Trans

Retinoic Acid

LA-N-6 0.40 0.23 4.23 1.04 <0.0004 324.33 8.07 >45

COG-N-291 0.01 0.08 0.77 0.31 <0.0004 58.87 12.64 >45

SK-N-FI 0.69 3.65 2.62 5.64 0.07 >400 >25 >45

CHLA-90 0.20 8.11 6.60 30.44 0.42 >400 2.21 >45

GM847 0.01 0.41 1.57 6.14 0.02 191.54 0.59 >45

U-2 OS 0.02 0.74 5.93 11.64 0.16 >400 6.02 >45

SK-N-BE2c 0.03 0.29 16.19 8.59 0.09 >400 1.61 >45

SH-SY5Y 0.03 0.56 2.20 2.50 0.01 98.96 19.35 >45

HT1080 0.01 0.19 1.88 5.00 0.01 389.18 0.18 >45

GM639 0.01 0.17 1.75 3.59 0.01 126.93 1.02 >45

HT1080 hTRa 0.12 0.66 8.39 2.08 0.11 365.30 2.79

HeLa 1.2.11a 0.12 0.51 0.98 17.21 <0.0004 >400 22.67 aLong telomeres/telomerase-positive bIC50 (nM)

6.2.2. EST cells do not exhibit increased cell death with potential ALT inhibitors or after

induction of replication stress

The EST cells have a low level of ALT activity which we hypothesise is preferentially lengthening the

shortest telomeres, consequently these cells could be sensitive to agents that target the ALT

mechanism. Arsenic trioxide (ATO; results in PML degradation) and ML216 (BLM helicase inhibitor) have

been shown to downregulate C-circles in ALT cells (unpublished data). However, neither ALT nor EST

cells showed greater sensitivity for these agents than telomerase-positive cells (Figure 6.3.A, B; Table

6.2). Previous work by Flynn and colleagues found that ALT cells are hypersensitive to ATR inhibition

(Flynn et al., 2015). In this panel of cell lines, the IC50 values for the ATR inhibitor VE-822 ranged from

0.02-0.53 µM for telomerase-positive cells, 0.02-6.22 µM for ALT cells, and 0.39-3.52 µM for EST cells

(Figure 6.3.C; Table 6.2), which is consistent with a later report that shows ALT cells are not more

sensitive to ATR inhibition than telomerase-positive cells (Deeg et al., 2016). There was a slight increase

in the IC50 doses for EST and ALT cells in response to the ATM inhibitor Ku60019 (Figure 6.3.D; Table

6.2). Agents that induce replication stress, including mitomycin C, hydroxyurea, and aphidicolin reduce

137

proliferation in all cells; however, the extent of reduction was not related to the telomere biology of the

cells (Figure 6.3.E, F, G; Table 6.2). Whilst COG-N-291 cells were most sensitive to all three inhibitors,

the IC50s for LA-N-6 were similar to ALT and telomerase-positive cells, and we found no evidence that

ALT cells are more sensitive to replication stress than other cell types (Table 6.2). In summary, the

current study failed to identify any drug that specifically inhibits either ALT or telomerase-positive cells.

However, we were able to identify the significant sensitivity of EST cells to topoisomerase I inhibitors.

6.2.3. EST cells have alterations to genes involved in DNA damage repair and replication

We have previously shown (Chapter 3) that the EST NB cell lines have functional p53 capable of

activating downstream targets such as p21 and triggering p53-mediated apoptosis in response to DNA

damage. Mutations to pathways involved in DNA damage repair and replication would prevent the EST

cells from repairing damage caused by chemotherapeutics leading to apoptosis through the p53

pathway. Whole genome sequencing data revealed heterozygous alterations of a number of genes

involved in DNA damage repair and replication in the EST cell lines (Appendix II A2.6). The COG-N-291

cells have mutations in GEN1 a resolvase that cleaves Holliday junctions (Ip et al., 2008), HLTF which is

involved in DNA damage repair and replication fork reversal (Achar et al., 2011; Blastyak et al., 2010;

Kile et al., 2015), and MCM4, a gene involved in the initiation and progression of replication forks (Sheu

et al., 2014; Sheu et al., 2016). Moreover, LA-N-6 cells have altered EME2 which is involved in the

cleavage and restart of replication forks (Pepe and West, 2014), and POLM, a polymerase used for gap

filling in DNA damage repair by NHEJ (Pryor et al., 2015). The effect of heterozygous mutations of these

genes on DNA damage repair and replication remains to be elucidated.

6.3. Discussion

The poor survival rates of NB patients with high-risk disease indicate the need to develop better

therapies for these patients. Our results, in conjunction with a number of genomic studies (Cheung et

al., 2012; Kurihara et al., 2014; Molenaar et al., 2012; Peifer et al., 2015; Pugh et al., 2013; Valentijn et

138

Table 6.2. IC50 values for inhibitors that cause replication stress and inhibit factors associated with ALT.

IC50 (µM)

ML216 Arsenic Trioxide VE-822 Ku60019 Mitomycin Ca Hydroxyurea Aphidicolin

LA-N-6 >225 3.24 3.52 >24 0.94 429.24 0.62

COG-N-291 >225 3.51 0.39 >24 0.05 84.33 0.08

SK-N-FI >225 2.55 6.22 >24 >3 1199.17 2.38

CHLA-90 5.04 7.00 0.33 20.91 1.22 257.94 4.45

GM847 110.53 0.77 0.02 4.97 0.18 193.23 0.51

U-2 OS 95.98 2.19 0.09 13.37 1.32 731.70 16.13

SK-N-BE2c >225 4.88 0.07 12.91 0.51 348.27 0.19

SH-SY5Y >225 3.94 0.53 10.77 0.43 >1600 0.50

HT1080 26.98 1.26 0.04 3.52 0.52 229.45 0.97

GM639 95.11 1.26 0.02 11.79 0.49 262.79 0.57

aIC50 (µg/mL)

al., 2015), suggest that telomere biology may be a target for novel NB therapies. The EST cells are highly

sensitive to the topoisomerase I inhibitors topotecan and irinotecan. Topotecan and irinotecan are

derivatives of camptothecin, a topoisomerase I poison that stabilises the topoisomerase I-DNA cleavage

complex during DNA replication (Hsiang et al., 1985). This results in a dsDNA break when the advancing

DNA replication fork collides with the topoisomerase I-DNA complex leading to cell cycle arrest and

apoptosis (Hsiang et al., 1989). The differential response of EST cells to this form of DNA damage

compared with ALT or telomerase-positive cells was not due to therapy-acquired resistance in the ALT

or telomerase-positive NB cell lines as neither topotecan nor irinotecan were used to treat NB patients

from which these cells were derived more than two decades ago (Biedler et al., 1973; Keshelava et al.,

1998; Wada et al., 1993). Whilst COG-N-291 and LA-N-6 have obvious sensitivity to topoisomerase I

inhibitors the analysis is limited by the number of EST cell lines. The Pediatric Preclinical Testing Program

(PPTP) identified NB-1643 as acutely sensitive to topotecan in their cell line panel with an IC50 of 0.71

nM (Carol et al., 2010) and the Reynold’s lab has identified a further four cell lines that are telomerase-

139

Figure 6.3. Telomere biology does not predict the response of cell lines to inhibitors that cause

replication stress or reduce factors critical to the ALT mechanism.

Cell lines were treated with increasing concentrations of (A) arsenic trioxide (ATO) which degrades

PML, (B) the BLM inhibitor ML216, (C) the ATR inhibitor VE-822, (D) the ATM inhibitor KU60019, (E)

140

mitomycin C, (F) hydroxyurea, and (G) aphidicolin for 6 PDs before proliferation was quantified

using AlamarBlue. U-2 OS and GM847 ALT cell lines, and HT1080 and GM639 telomerase-positive

cell lines were included as controls. Results are expressed as percentages of growth compared to

untreated controls and as means of triplicate independent experiments +SD.

negative and lack C-circles (unpublished data). Therefore, further testing is required to establish if any

of these cell lines have the EST phenotype, with the potential to expand the EST NB cohort for further

drug screening. Genz-644282 is a recently developed new generation of topoisomerase I inhibitor, not

derived from camptothecin (Li et al., 2003). According to the PPTP screen, NB cells are generally more

sensitive to Genz-644282 than topotecan (Houghton et al., 2012), therefore, establishing the acute

sensitivity of EST cells to Genz-644282 will confirm EST cells are particularly sensitive to topoisomerase

I inhibitors.

One possible explanation for the EST cell sensitivity to topoisomerase inhibitors are the very

long telomeres of these cells. Telomeres are known to form G-quadruplex structures (Sen and Gilbert,

1988; Sundquist and Klug, 1989) which need to be removed prior to telomere replication in S. cerevisiae

(Paeschke et al., 2011). Long telomeres have a greater potential to form such structures which could

reduce the efficiency of telomeric replication and make complete DNA replication more difficult.

Furthermore, the replication fork must travel a further distance to fully replicate long telomeres. In this

study, we found no evidence that telomere length as a single factor was responsible for the EST

sensitivity to topoisomerase I inhibitors. The cell line U-2 OS has wild type TP53 which can induce p21

(Bensaad et al., 2006; Cesare et al., 2009) and has similar telomere lengths to EST cell lines however, it

is not sensitive to treatment with topotecan or irinotecan. Whole genome sequencing identified

aberrations in DNA damage repair and replication genes in the EST cell lines but further studies are

required to determine the effect of these heterozygous mutations. The EST cells may be particularly

sensitive to DNA damage by topoisomerase I inhibitors due to a combination of very long telomeres,

141

wild-type TP53 and impaired DNA repair/replication machinery, which means that the additional DNA

damage caused by topoisomerase I inhibition during replication, cannot be repaired by the cells leading

to p53-mediated apoptosis.

Topoisomerase levels may predict the response of cells to topoisomerase inhibitors (Burgess et

al., 2008). We are currently using pressure cycling technology (PCT) and sequential window acquisition

of all theoretical fragment ion spectra (SWATH) mass spectrometry (Guo et al., 2015) to measure the

level of proteins in EST, telomerase and ALT NB which will allow us to determine if the level of

topoisomerase I and II correlates with sensitivity to topoisomerase inhibitors. This study will also allow

us to determine the effect of heterozygous mutations on the protein expression of GEN1, HLTF, MCM4,

EME2, and POLM in the EST cells. We will also use the mass spectrometry results to determine a

proteomic profile of the EST cells compared to ALT and telomerase-positive NB to aid the development

of targeted therapies based on the telomere biology of NB cells.

The use of topoisomerase I inhibitors is a recent development in NB treatment. Topotecan has

only recently been incorporated into COG clinical trials as a part of induction therapy (Park et al., 2011)

or to treat relapsed/refractory disease (Garaventa et al., 2003) whilst irinotecan is only used to treat

relapsed or refractory NB (Kushner et al., 2006). Our results indicate that 11% of high-risk NB, i.e. the

EST tumours, could be acutely sensitive to upfront treatment with topotecan and irinotecan. Further

preclinical studies are required to confirm whether topoisomerase I inhibition results in better outcome

for EST tumours but we have shown that targeting telomere biology may lead to novel treatment

regimens for high-risk NB.

142

Chapter 7: Discussion

143

Chapter 7: Discussion

The acquisition of cellular immortality, via activation of a TLM, is currently considered a hallmark of

cancer (Hanahan and Weinberg, 2000; Hanahan and Weinberg, 2011). However, studies of some

cancers including glioblastoma (Hakin-Smith et al., 2003), liposarcoma (Costa et al., 2006; Jeyapalan et

al., 2008), osteosarcoma (Ulaner et al., 2003), and retinoblastoma (Gupta et al., 1996) have reported

that a substantial proportion of tumours are TLM-negative, and the widely-held explanation for this has

been that these are false negatives caused by deficiencies in the standard TLM assays. Our study has

identified a subset of NB tumours that lack telomerase activity, have very long telomeres, and have such

low levels of ALT that they are unable to prevent telomere shortening. Cells derived from such tumours

are capable of long-term proliferation despite ever-shorter telomeres. Subsequent investigations

showed NB EST cells were acutely sensitive to topoisomerase I inhibitors, indicating TLMs are potential

targets for novel NB therapies.

7.1. The ever-shorter telomeres phenotype in human cancer

Telomerase activity was established as a poor prognostic factor in NB over two decades ago (Poremba

et al., 2000; Poremba et al., 1999) and recent studies have utilised telomere length (Onitake et al., 2009),

or ATRX/DAXX mutations (Cheung et al., 2012; Kurihara et al., 2014; Molenaar et al., 2012; Peifer et al.,

2015; Valentijn et al., 2015) to identify ALT tumours. Ours is the first study to utilise C-circles as a

quantifiable marker of ALT activity to determine the prevalence of ALT in metastatic NB. Using this

method, we identified 11% of high-risk NB tumours as ALT-negative/TC≥15. These tumours lacked

telomerase activity, indicating that a subgroup of high-risk NBs lack evidence of a TLM, consistent with

previous studies (Choi et al., 2000; Krams et al., 2001; Poremba et al., 2000; Poremba et al., 1999;

Reynolds et al., 1997). These studies were unable to distinguish among the possibilities that the

apparent lack of significant ALT or telomerase activity was due to: (1) false-negative assays, (2) an as-

yet unidentified ALT mechanism lacking the common phenotypic characteristics of the "classic" ALT

144

mechanism, or (3) a true lack of significant TLM activity in the cells. The only conclusive test to determine

if cells are TLM-negative is to observe telomere length over time, which cannot be done ethically in

human tumour samples as it would require serial samples from the same patient over time in the

absence of treatment. Consequently, cell line models were required to determine which of these

scenarios was true. We present evidence that human cell lines derived from fatal metastatic disease are

capable of proliferating for 500 PDs, despite ever-shorter telomeres.

The observation of the EST phenotype in high-risk NB provides direct evidence that, as

previously postulated (Reddel, 2000), immortalisation is not an absolute requirement of oncogenesis.

Telomerase activity is detectable during the early stages of human embryogenesis however, it is

downregulated in late embryogenesis resulting in telomerase-negative somatic cells (Ulaner and

Giudice, 1997; Wright et al., 1996). NB is an embryonal cancer, and we propose that excessive

telomerase activity during embryogenesis resulted in very long telomeres in the EST progenitor cells

before telomerase activity was downregulated at the end of embryogenesis. The EST progenitor cells

would not require significant upregulation of a TLM to allow extensive proliferation to occur in these

cells although further oncogenic events would be required to form a malignant tumour. Telomere

trimming is a process that regulates telomere length in cells that have been over-lengthened by

telomerase (Pickett et al., 2009). The lack of t-circles, a product of telomere trimming, in LA-N-6 cells

with over-lengthened telomeres due to ectopic telomerase expression suggests that EST cells have a

failure of telomere trimming. T-circles are also detected in cells that have upregulated ALT (Cesare and

Griffith, 2004), however we were unable to detect t-circles either in COG-N-291 clone 4, or in the LA-N-

6 MUT p53 clone that spontaneously activated ALT, further confirming that these cells have a failure of

telomere trimming. This is the first report of a disease that may result from a failure of telomere

trimming, although the mechanism leading to failure of telomere trimming remains to be elucidated.

Whole genome sequencing did not identify genetic events unique to the EST cells and further studies

are required to examine their epigenetic and proteomic profile compared to ALT and telomerase-

positive cells and consequently identify events responsible for the failure of telomere trimming. The

145

failure of telomere trimming in EST cells may be responsible for their sensitivity to topoisomerase I

inhibitors. If this is the case, knockdown of genes associated with telomere trimming would lead to the

increased sensitivity of non-EST cells to topoisomerase I inhibitors, providing further evidence that the

EST cells are a disease resulting from the failure of telomere trimming.

Our study did not identify potential EST cell lines in other tumour types although this is likely

due to the criteria used to identify EST cell lines. The criteria for NB EST may not reflect the phenotype

of EST cells in other tumour types, as NB is a childhood cancer and consequently the tumour progenitor

cells have not undergone many cycles of replication induced telomere shortening. In contrast, the

progenitor cells of adult cancers may have undergone many rounds of cell division, and associated

telomere shortening, before oncogenesis occurs. Cell lines derived from these tumours may not have

very long telomere lengths after the PDs required to derive a cell line from the tumour. Indeed, data

from the Decottignies laboratory, found melanoma cells lacking evidence of a TLM had telomere lengths

at the upper end of the normal range (Viceconte et al., 2017). Another explanation for the lack of EST

cell lines in other tumour types may be the difficulty in deriving cell lines from such tumours. The NB

EST cell lines grow very slowly compared to cell lines with an upregulated TLM and consequently other

EST cell lines may never have been characterised or grown long term in laboratories due to the bias

towards with faster growing cell lines for in vitro experiments. Therefore, it is likely that cell line studies

will underestimate the occurrence of the EST phenotype.

7.2. Targeting telomere biology in the clinic

Since the discovery of telomerase, inhibitors have been developed to target the enzyme translating to

clinical trials in cancers including breast and lung cancer, glioblastoma, and lympho-proliferative

disorders, although to date there is no evidence of their effectiveness in treating malignancies (Arndt

and MacKenzie, 2016). In contrast, ALT inhibitors have yet to enter clinical trials and are currently being

developed in preclinical laboratory models (Deeg et al., 2016; Flynn et al., 2015). High-risk NB patients

have very poor survival rates and novel targets for therapy need to be identified. Our study, in addition

146

to a number of large scale genomic studies (Cheung et al., 2012; Kurihara et al., 2014; Molenaar et al.,

2012; Peifer et al., 2015; Pugh et al., 2013; Valentijn et al., 2015), indicate that telomere biology plays a

significant role in NB pathogenesis and may be a target for novel NB therapies. We have shown that NB

EST cells are highly sensitive to the topoisomerase I inhibitors topotecan and irinotecan and therefore

11% of high-risk NB could be acutely sensitive to upfront treatment with these agents. The identification

of further EST NB cell lines, currently underway through expansion of the cell line screen, will aid in the

identification of other agents that uniquely target these cells. The identification of EST cell lines in other

cancer types will facilitate further studies to determine if sensitivity to topoisomerase I inhibition is a

universal feature of EST cells.

EST cells provide the first evidence of a disease that may result from a deficiency in telomere

trimming. This provides a novel area for drug development as there is currently no therapy to target the

telomere trimming mechanism. The molecular details of the trimming mechanism are still under

investigation which may lead to the identification of novel therapeutic targets.

The development of drugs which target features of telomere biology require appropriate

biomarkers to predict response to therapy. The discovery of malignant and lethal EST cancer cells

illustrates the need to assay for TLMs prior to treatment with drugs that target these mechanisms. The

phenotypic similarity of EST and ALT cells illustrates that care must be taken to correctly define ALT

tumours: ATRX/DAXX mutations are not a universal feature of ALT cells (Lovejoy et al., 2012), telomere

length (as measured by telomere qPCR, TRF analysis or telomere FISH) is insufficient to differentiate ALT

and EST cells, and the presence of low levels of C-circles does not necessarily indicate sufficient ALT

activity to counter the EST phenotype. Therefore, studies that define a molecular profile for the EST cells

will be critical in developing accurate clinical assays to differentiate between EST and ALT cells.

7.3. Conclusion

In conclusion, this study has provided evidence of lethal, malignant human cancers that can proliferate

continuously for hundreds of PDs with ever-shorter telomeres. This indicates that the upregulation of a

147

TLM to confer immortalisation is not an absolute requirement for oncogenesis. Patients with high-risk

NB have a poor survival rate and we need to develop novel therapies to improve the outcome of these

patients. Our results, indicate that telomere biology is a relevant target for novel NB therapies and EST

tumours are potentially very susceptible to treatment with topoisomerase I inhibitors. The similarity of

the EST and ALT phenotypes indicates that rapid and specific assays for TLMs are required to facilitate

the use of TLM targeting inhibitors as anti-cancer therapeutics.

148

Chapter 8: References

149

Chapter 8: References

Achar, Y. J., Balogh, D., and Haracska, L. (2011). Coordinated protein and DNA remodeling by human HLTF on stalled replication fork. Proc Natl Acad Sci U.S.A. 108, 14073-14078. Ahmad, K., and Henikoff, S. (2002). Histone H3 variants specify modes of chromatin assembly. Proc Natl Acad Sci U.S.A. 99, 16477-16484. Akiyama, B. M., Parks, J. W., and Stone, M. D. (2015). The telomerase essential N-terminal domain promotes DNA synthesis by stabilizing short RNA-DNA hybrids. Nucleic Acids Res 43, 5537-5549. Alder, J. K., Chen, J. J. L., Lancaster, L., Danoff, S., Su, S. C., Cogan, J. D., Vulto, I., Xie, M. Y., Qi, X. D., Tuder, R. M., et al. (2008). Short telomeres are a risk factor for idiopathic pulmonary fibrosis. Proc Natl Acad Sci U.S.A. 105, 13051-13056. Alexandrov, L. B., Nik-Zainal, S., Wedge, D. C., Aparicio, S. A., Behjati, S., Biankin, A. V., Bignell, G. R., Bolli, N., Borg, A., Borresen-Dale, A. L., et al. (2013). Signatures of mutational processes in human cancer. Nature 500, 415-421. Allshire, R. C., Dempster, M., and Hastie, N. D. (1989). Human telomeres contain at least three types of G-rich repeat distributed non-randomly. Nucleic Acids Res 17, 4611-4627. Alonso, M. M., Fueyo, J., Yung, W. K., and Gomez-Manzano, C. (2006). E2F1 and telomerase: alliance in the dark side. Cell Cycle 5, 930-935. Alves, D., Li, H. T., Codrington, R., Orte, A., Ren, X. J., Klenerman, D., and Balasubramanian, S. (2008). Single-molecule analysis of human telomerase monomer. Nat Chem Biol 4, 287-289. Ambros, P. F., Ambros, I. M., Brodeur, G. M., Haber, M., Khan, J., Nakagawara, A., Schleiermacher, G., Speleman, F., Spitz, R., London, W. B., et al. (2009). International consensus for neuroblastoma molecular diagnostics: report from the International Neuroblastoma Risk Group (INRG) Biology Committee. Br J Cancer 100, 1471-1482. Amiard, S., Doudeau, M., Pinte, S., Poulet, A., Lenain, C., Faivre-Moskalenko, C., Angelov, D., Hug, N., Vindigni, A., Bouvet, P., et al. (2007). A topological mechanism for TRF2-enhanced strand invasion. Nat Struct Mol Biol 14, 147-154. Anderson, B. H., Kasher, P. R., Mayer, J., Szynkiewicz, M., Jenkinson, E. M., Bhaskar, S. S., Urquhart, J. E., Daly, S. B., Dickerson, J. E., O'Sullivan, J., et al. (2012). Mutations in CTC1, encoding conserved telomere maintenance component 1, cause Coats plus. Nat Genet 44, 338-342. Armanios, M., Chen, J. L., Chang, Y. P. C., Brodsky, R. A., Hawkins, A., Griffin, C. A., Eshleman, J. R., Cohen, A. R., Chakravarti, A., Hamosh, A., and Greider, C. W. (2005). Haploinsufficiency of telomerase reverse transcriptase leads to anticipation in autosomal dominant dyskeratosis congenita. Proc Natl Acad Sci U.S.A. 102, 15960-15964.

150

Armanios, M. Y., Chen, J. J. L., Cogan, J. D., Alder, J. K., Ingersoll, R. G., Markin, C., Lawson, W. E., Xie, M. Y., Vulto, I., Phillips, J. A., et al. (2007). Telomerase mutations in families with idiopathic pulmonary fibrosis. N Engl J Med 356, 1317-1326. Armbruster, B. N., Banik, S. S. R., Guo, C. H., Smith, A. C., and Counter, C. M. (2001). N-terminal domains of the human telomerase catalytic subunit required for enzyme activity in vivo. Mol Cell Biol 21, 7775-7786. Armbruster, B. N., Linardic, C. M., Veldman, T., Bansal, N. P., Downie, D. L., and Counter, C. M. (2004). Rescue of an hTERT mutant defective in telomere elongation by fusion with hPot1. Mol Cell Biol 24, 3552-3561. Arndt, G. M., and MacKenzie, K. L. (2016). New prospects for targeting telomerase beyond the telomere. Nat Rev Cancer 16, 508-532. Arnoult, N., Schluth-Bolard, C., Letessier, A., Drascovic, I., Bouarich-Bourimi, R., Campisi, J., Kim, S. H., Boussouar, A., Ottaviani, A., Magdinier, F., et al. (2010). Replication timing of human telomeres is chromosome arm-specific, influenced by subtelomeric structures and connected to nuclear localization. PLoS Genet 6, e1000920. Arnoult, N., van Beneden, A., and Decottignies, A. (2012). Telomere length regulates TERRA levels through increased trimethylation of telomeric H3K9 and HP1a. Nat Struct Mol Biol 19, 948-956. Arora, R., Lee, Y., Wischnewski, H., Brun, C. M., Schwarz, T., and Azzalin, C. M. (2014). RNaseH1 regulates TERRA-telomeric DNA hybrids and telomere maintenance in ALT tumour cells. Nat Commun 5, 5220-31. Artandi, S. E., Chang, S., Lee, S. L., Alson, S., Gottlieb, G. J., Chin, L., and DePinho, R. A. (2000). Telomere dysfunction promotes non-reciprocal translocations and epithelial cancers in mice. Nature 406, 641-645. Attiyeh, E. F., London, W. B., Mosse, Y. P., Wang, Q., Winter, C., Khazi, D., McGrady, P. W., Seeger, R. C., Look, A. T., Shimada, H., et al. (2005). Chromosome 1p and 11q deletions and outcome in neuroblastoma. N Engl J Med 353, 2243-2253. Avilion, A. A., Piatyszek, M. A., Gupta, J., Shay, J. W., Bacchetti, S., and Greider, C. W. (1996). Human telomerase RNA and telomerase activity in immortal cell lines and tumor tissues. Cancer Res 56, 645-650. Azzalin, C. M., and Lingner, J. (2008). Telomeres: the silence is broken. Cell Cycle 7, 1161-1165. Azzalin, C. M., Reichenbach, P., Khoriauli, L., Giulotto, E., and Lingner, J. (2007). Telomeric repeat containing RNA and RNA surveillance factors at mammalian chromosome ends. Science 318, 798-801. Bachor, C., Bachor, O. A., and Boukamp, P. (1999). Telomerase is active in normal gastrointestinal mucosa and not up-regulated in precancerous lesions. J Cancer Res Clin Oncol 125, 453-460. Bagatell, R., Beck-Popovic, M., London, W. B., Zhang, Y., Pearson, A. D., Matthay, K. K., Monclair, T., Ambros, P. F., and Cohn, S. L. (2009). Significance of MYCN amplification in international neuroblastoma staging system stage 1 and 2 neuroblastoma: a report from the International Neuroblastoma Risk Group database. J Clin Oncol 27, 365-370. Bailey, S. M., Brenneman, M. A., and Goodwin, E. H. (2004). Frequent recombination in telomeric DNA may extend the proliferative life of telomerase-negative cells. Nucleic Acids Res 32, 3743-3751.

151

Baird, D. M., Jeffreys, A. J., and Royle, N. J. (1995). Mechanisms underlying telomere repeat turnover, revealed by hypervariable variant repeat distribution patterns in the human Xp/Yp telomere. EMBO J 14, 5433-5443. Baker, D. L., Schmidt, M. L., Cohn, S. L., Maris, J. M., London, W. B., Buxton, A., Stram, D., Castleberry, R. P., Shimada, H., Sandler, A., et al. (2010). Outcome after reduced chemotherapy for intermediate-risk neuroblastoma. N Engl J Med 363, 1313-1323. Balk, B., Maicher, A., Dees, M., Klermund, J., Luke-Glaser, S., Bender, K., and Luke, B. (2013). Telomeric RNA-DNA hybrids affect telomere-length dynamics and senescence. Nat Struct Mol Biol 20, 1199-1205. Barthel, F. P., Wei, W., Tang, M., Martinez-Ledesma, E., Hu, X., Amin, S. B., Akdemir, K. C., Seth, S., Song, X., Wang, Q., et al. (2017). Systematic analysis of telomere length and somatic alterations in 31 cancer types. Nat Genet 49, 349-357. Bartkova, J., Rezaei, N., Liontos, M., Karakaidos, P., Kletsas, D., Issaeva, N., Vassiliou, L. V., Kolettas, E., Niforou, K., Zoumpourlis, V. C., et al. (2006). Oncogene-induced senescence is part of the tumorigenesis barrier imposed by DNA damage checkpoints. Nature 444, 633-637. Bauer, D. W., and Gall, J. G. (1997). Coiled bodies without coilin. Mol Biol Cell 8, 73-82. Baumann, P., and Cech, T. R. (2001). Pot1, the putative telomere end-binding protein in fission yeast and humans. Science 292, 1171-1175. Baur, J. A., Wright, W. E., and Shay, J. W. (2004). Analysis of mammalian telomere position effect. Meth Mol Biol 287, 121-136. Baur, J. A., Zou, Y., Shay, J. W., and Wright, W. E. (2001). Telomere position effect in human cells. Science 292, 2075-2077. Beausejour, C. M., Krtolica, A., Galimi, F., Narita, M., Lowe, S. W., Yaswen, P., and Campisi, J. (2003). Reversal of human cellular senescence: roles of the p53 and p16 pathways. EMBO J 22, 4212-4222. Bechter, O. E., Zou, Y., Walker, W., Wright, W. E., and Shay, J. W. (2004). Telomeric recombination in mismatch repair deficient human colon cancer cells after telomerase inhibition. Cancer Res 64, 3444-3451. Bell, R. J., Rube, H. T., Kreig, A., Mancini, A., Fouse, S. D., Nagarajan, R. P., Choi, S., Hong, C., He, D., Pekmezci, M., et al. (2015). Cancer. The transcription factor GABP selectively binds and activates the mutant TERT promoter in cancer. Science 348, 1036-1039. Benarroch-Popivker, D., Pisano, S., Mendez-Bermudez, A., Lototska, L., Kaur, P., Bauwens, S., Djerbi, N., Latrick, C. M., Fraisier, V., Pei, B., et al. (2016). TRF2-mediated control of telomere DNA topology as a mechanism for chromosome-end protection. Mol Cell 61, 274-286. Benetti, R., Garcia-Cao, M., and Blasco, M. A. (2007a). Telomere length regulates the epigenetic status of mammalian telomeres and subtelomeres. Nat Genet 39, 243-250.

152

Benetti, R., Gonzalo, S., Jaco, I., Schotta, G., Klatt, P., Jenuwein, T., and Blasco, M. A. (2007b). Suv4-20h deficiency results in telomere elongation and derepression of telomere recombination. J Cell Biol 178, 925-936. Bensaad, K., Tsuruta, A., Selak, M. A., Vidal, M. N., Nakano, K., Bartrons, R., Gottlieb, E., and Vousden, K. H. (2006). TIGAR, a p53-inducible regulator of glycolysis and apoptosis. Cell 126, 107-120. Bernardi, R., and Pandolfi, P. P. (2003). Role of PML and the PML-nuclear body in the control of programmed cell death. Oncogene 22, 9048-9057. Bernardi, R., and Pandolfi, P. P. (2007). Structure, dynamics and functions of promyelocytic leukaemia nuclear bodies. Nat Rev Mol Cell Biol 8, 1006-1016. Bernhardt, S. L., Gjertsen, M. K., Trachsel, S., Moller, M., Eriksen, J. A., Meo, M., Buanes, T., and Gaudernack, G. (2006). Telomerase peptide vaccination of patients with non-resectable pancreatic cancer: a dose escalating phase I/II study. Br J Cancer 95, 1474-1482. Bhattacharyya, S., Keirsey, J., Russell, B., Kavecansky, J., Lillard-Wetherell, K., Tahmaseb, K., Turchi, J. J., and Groden, J. (2009). Telomerase associated protein 1, HSP90 and topoisomerase IIa associate directly with the BLM helicase in immortalized cells using ALT and modulate its helicase activity using telomeric DNA substrates. J Biol Chem 284, 14966-14977. Biedler, J. L., Helson, L., and Spengler, B. A. (1973). Morphology and growth, tumorigenicity, and cytogenetics of human neuroblastoma cells in continuous culture. Cancer Res 33, 2643-2652.

Biedler, J. L., Roffler-Tarlov, S., Schachner, M., Freedman, L. S. (1978). Multiple neurotransmitter synthesis by human neuroblastoma cell lines and clones. Cancer Res. 38, 3751-3757.

Biffi, G., Di Antonio, M., Tannahill, D., and Balasubramanian, S. (2014). Visualization and selective chemical targeting of RNA G-quadruplex structures in the cytoplasm of human cells. Nat Chem 6, 75-80. Biffi, G., Tannahill, D., McCafferty, J., and Balasubramanian, S. (2013). Quantitative visualization of DNA G-quadruplex structures in human cells. Nat Chem 5, 182-186.

Bilaud, T., Brun, C., Ancelin, K., Koering, C. E., Laroche, T., and Gilson, E. (1997). Telomeric localization of TRF2, a novel human telobox protein. Nat Genet 17, 236-239. Binz, N., Shalaby, T., Rivera, P., Shin-Ya, K., and Grotzer, M. A. (2005). Telomerase inhibition, telomere shortening, cell growth suppression and induction of apoptosis by telomestatin in childhood neuroblastoma cells. Eur J Cancer 41, 2873-2881. Blastyak, A., Hajdu, I., Unk, I., and Haracska, L. (2010). Role of double-stranded DNA translocase activity of human HLTF in replication of damaged DNA. Mol Cell Biol 30, 684-693. Bodnar, A. G., Ouellette, M., Frolkis, M., Holt, S. E., Chiu, C. P., Morin, G. B., Harley, C. B., Shay, J. W., Lichtsteiner, S., and Wright, W. E. (1998). Extension of life-span by introduction of telomerase into normal human cells. Science 279, 349-352. Bond, J. A., Haughton, M. F., Rowson, J. M., Smith, P. J., Gire, V., Wynford-Thomas, D., and Wyllie, F. S. (1999). Control of replicative life span in human cells: barriers to clonal expansion intermediate between M1 senescence and M2 crisis. Mol Cell Biol 19, 3103-3114.

153

Bond, J. A., Wyllie, F. S., and Wynford-Thomas, D. (1994). Escape from senescence in human diploid fibroblasts induced directly by mutant p53. Oncogene 9, 1885-1889. Bower, K., Napier, C. E., Cole, S. L., Dagg, R. A., Lau, L. M., Duncan, E. L., Moy, E. L., and Reddel, R. R. (2012). Loss of wild-type ATRX expression in somatic cell hybrids segregates with activation of Alternative Lengthening of Telomeres. PLoS ONE 7, e50062. Bown, N., Cotterill, S., Lastowska, M., O’Neill, S., Pearson, A. D. J., Plantaz, D., Meddeb, M., Danglot, G., Brinkschmidt, C., Christiansen, H., et al. (1999). Gain of chromosome arm 17q and adverse outcome in patients with neuroblastoma. N Engl J Med 340, 1954-1961. Brinkschmidt, C., Poremba, C., Christiansen, H., Simon, R., Schafer, K. L., Terpe, H. J., Lampert, F., Boecker, W., and Dockhorn-Dworniczak, B. (1998). Comparative genomic hybridization and telomerase activity analysis identify two biologically different groups of 4s neuroblastomas. Br J Cancer 77, 2223-2229. Britt-Compton, B., Capper, R., Rowson, J., and Baird, D. M. (2009). Short telomeres are preferentially elongated by telomerase in human cells. FEBS Lett 583, 3076-3080. Broccoli, D., Smogorzewska, A., Chong, L., and de Lange, T. (1997). Human telomeres contain two distinct Myb-related proteins, TRF1 and TRF2. Nat Genet 17, 231-235. Broccoli, D., Young, J. W., and de Lange, T. (1995a). Telomerase activity in normal and malignant hematopoietic cells. Proc Natl Acad Sci USA 92, 9082-9086. Brock, G. J., Charlton, J., and Bird, A. (1999). Densely methylated sequences that are preferentially localized at telomere-proximal regions of human chromosomes. Gene 240, 269-277. Brodeur, G. M., Green, A. A., Hayes, F. A., Williams, K. J., Williams, D. L., and Tsiatis, A. A. (1981). Cytogenetic features of human neuroblastomas and cell lines. Cancer Res 41, 4678-4686. Brodeur, G. M., Pritchard, J., Berthold, F., Carlsen, N. L. T., Castel, V., Castleberry, R. P., Debernardi, B., Evans, A. E., Favrot, M., Hedborg, F., et al. (1993). Revisions of the international criteria for neuroblastoma diagnosis, staging, and response to treatment. J Clin Oncol 11, 1466-1477. Brodeur, G. M., Seeger, R. C., Schwab, M., Varmus, H. E., and Bishop, J. M. (1984). Amplification of N-myc in untreated human neuroblastomas correlates with advanced disease stage. Science 224, 1121-1124. Brown, J. P., Wei, W., and Sedivy, J. M. (1997). Bypass of senescence after disruption of p21CIP1/WAF1 gene in normal diploid human fibroblasts. Science 277, 831-834. Brunsvig, P. F., Kyte, J. A., Kersten, C., Sundstrum, S., Muller, M., Nyakas, M., Hansen, G. L., Gaudernack, G., and Aamdal, S. (2011). Telomerase peptide vaccination in NSCLC: a phase II trial in stage III patients vaccinated after chemoradiotherapy and an 8-year update on a phase I/II trial. Clin Cancer Res 17, 6847-6857. Bryan, T. M., Englezou, A., DallaPozza, L., Dunham, M. A., and Reddel, R. R. (1997). Evidence for an alternative mechanism for maintaining telomere length in human tumors and tumor-derived cell lines. Nat Med 3, 1271-1274.

154

Bryan, T. M., Englezou, A., Gupta, J., Bacchetti, S., and Reddel, R. R. (1995). Telomere elongation in immortal human cells without detectable telomerase activity. EMBO J 14, 4240-4248. Bryan, T. M., Goodrich, K. J., and Cech, T. R. (2000). A mutant of Tetrahymena telomerase reverse transcriptase with increased processivity. J Biol Chem 275, 24199-24207. Buanes, T., Maurel, J., Liauw, W., Hebbar, M., and Nemunaitis, J. (2009). A randomized phase III study of gemcitabine (G) versus GV1001 in sequential combination with G in patients with unresectable and metastatic pancreatic cancer (PC). J Clin Oncol 27, 4601-4601. Burgess, D. J., Doles, J., Zender, L., Xue, W., Ma, B., McCombie, W. R., Hannon, G. J., Lowe, S. W., and Hemann, M. T. (2008). Topoisomerase levels determine chemotherapy response in vitro and in vivo. Proc Nat Acad Sci USA 105, 9053-9058. Calado, R. T., Brudno, J., Mehta, P., Kovacs, J. J., Wu, C., Zago, M. A., Chanock, S. J., Boyer, T. D., and Young, N. S. (2011). Constitutional telomerase mutations are genetic risk factors for cirrhosis. Hepatology 53, 1600-1607. Cao, Y., Bryan, T. M., and Reddel, R. R. (2008a). Increased copy number of the TERT and TERC telomerase subunit genes in cancer cells. Cancer Sci 99, 1092-1099. Cao, Y., Huschtscha, L. I., Nouwens, A. S., Pickett, H. A., Neumann, A. A., Chang, A. C., Toouli, C. D., Bryan, T. M., and Reddel, R. R. (2008b). Amplification of telomerase reverse transcriptase gene in human mammary epithelial cells with limiting telomerase RNA expression levels. Cancer Res 68, 3115-3123. Capasso, M., Devoto, M., Hou, C., Asgharzadeh, S., Glessner, J. T., Attiyeh, E. F., Mosse, Y. P., Kim, C., Diskin, S. J., Cole, K. A., et al. (2009). Common variations in BARD1 influence susceptibility to high-risk neuroblastoma. Nat Genet 41, 718-723. Capper, R., Britt-Compton, B., Tankimanova, M., Rowson, J., Letsolo, B., Man, S., Haughton, M., and Baird, D. M. (2007). The nature of telomere fusion and a definition of the critical telomere length in human cells. Genes Dev 21, 2495-2508. Carol, H., Houghton, P. J., Morton, C. L., Kolb, E. A., Gorlick, R., Reynolds, C. P., Kang, M. H., Maris, J. M., Keir, S. T., Watkins, A., et al. (2010). Initial testing of topotecan by the pediatric preclinical testing program. Pediatr Blood Cancer 54, 707-715. Carr-Wilkinson, J., O’Toole, K., Wood, K. M., Challen, C. C., Baker, A. G., Board, J. R., Evans, L., Cole, M., Cheung, N. K., Boos, J., et al. (2010). High frequency of p53/MDM2/p14ARF pathway abnormalities in relapsed neuroblastoma. Clin Cancer Res 16, 1108-1118. Castel, V., Tovar, J. A., Costa, E., Cuadros, J., Ruiz, A., Rollan, V., Ruiz-Jimenez, J. I., Perez-Hernandez, R., and Canete, A. (2002). The role of surgery in stage IV neuroblastoma. J Pediatr Surg 37, 1574-1578. Cawthon, R. M. (2002). Telomere measurement by quantitative PCR. Nucleic Acids Res 30, e47. Celli, G. B., and de Lange, T. (2005). DNA processing is not required for ATM-mediated telomere damage response after TRF2 deletion. Nat Cell Biol 7, 712-718. Cerone, M. A., Londono-Vallejo, J. A., and Bacchetti, S. (2001). Telomere maintenance by telomerase and by recombination can coexist in human cells. Hum Mol Gen 10, 1945-1952.

155

Cesare, A. J., and Griffith, J. D. (2004). Telomeric DNA in ALT cells is characterized by free telomeric circles and heterogeneous t-loops. Mol Cell Biol 24, 9948-9957. Cesare, A. J., Hayashi, M. T., Crabbe, L., and Karlseder, J. (2013). The telomere deprotection response is functionally distinct from the genomic DNA damage response. Mol Cell 51, 141-155. Cesare, A. J., Kaul, Z., Cohen, S. B., Napier, C. E., Pickett, H. A., Neumann, A. A., and Reddel, R. R. (2009). Spontaneous occurrence of telomeric DNA damage response in the absence of chromosome fusions. Nat Struct Mol Biol 16, 1244-1251. Cesare, A. J., and Reddel, R. R. (2010). Alternative lengthening of telomeres: models, mechanisms and implications. Nat Rev Genet 11, 319-330. Chanan-Khan, A. A., Munshi, N. C., Hussein, M. A., Elias, L., Benedetti, F., Smith, J., Khor, S. P., and Huff, C. A. (2008). Results of a phase I study of GRN163L, a direct inhibitor of telomerase, in patients with relapsed and refractory multiple myeloma (MM). Blood 112, 1263-1263. Chang, B. D., Swift, M. E., Shen, M., Fang, J., Broude, E. V., and Roninson, I. B. (2002). Molecular determinants of terminal growth arrest induced in tumor cells by a chemotherapeutic agent. Proc Natl Acad Sci USA 99, 389-394. Chastain, M., Zhou, Q., Shiva, O., Whitmore, L., Jia, P., Dai, X., Huang, C., Fadri-Moskwik, M., Ye, P., and Chai, W. (2016). Human CST facilitates genome-wide RAD51 recruitment to GC-Rich repetitive sequences in response to replication stress. Cell Rep 16, 1300-1314. Chawla, R., Redon, S., Raftopoulou, C., Wischnewski, H., Gagos, S., and Azzalin, C. M. (2011). Human UPF1 interacts with TPP1 and telomerase and sustains telomere leading-strand replication. EMBO J 30, 4047-4058. Chen, C., Hong, Y. K., Ontiveros, S. D., Egholm, M., and Strauss, W. M. (1999). Single base discrimination of CENP-B repeats on mouse and human Chromosomes with PNA-FISH. Mamm Genome 10, 13-18. Chen, J. L., Blasco, M. A., and Greider, C. W. (2000). Secondary structure of vertebrate telomerase RNA. Cell 100, 503-514. Chen, X., Bahrami, A., Pappo, A., Easton, J., Dalton, J., Hedlund, E., Ellison, D., Shurtleff, S., Wu, G., Wei, L., et al. (2014). Recurrent somatic structural variations contribute to tumorigenesis in pediatric osteosarcoma. Cell Rep 7, 104-112. Chen, Y., Deng, Z., Jiang, S., Hu, Q., Liu, H., Songyang, Z., Ma, W., Chen, S., and Zhao, Y. (2015). Human cells lacking coilin and Cajal bodies are proficient in telomerase assembly, trafficking and telomere maintenance. Nucleic Acids Res 43, 385-395. Chen, Y., Takita, J., Choi, Y. L., Kato, M., Ohira, M., Sanada, M., Wang, L., Soda, M., Kikuchi, A., Igarashi, T., et al. (2008). Oncogenic mutations of ALK kinase in neuroblastoma. Nature 455, 971-974. Chen, Y. J., Hakin-Smith, V., Teo, M., Xinarianos, G. E., Jellinek, D. A., Carroll, T., McDowell, D., MacFarlane, M. R., Boet, R., Baguley, B. C., et al. (2006). Association of mutant TP53 with alternative lengthening of telomeres and favorable prognosis in glioma. Cancer Res 66, 6473-6476.

156

Chen, Z., Trotman, L. C., Shaffer, D., Lin, H. K., Dotan, Z. A., Niki, M., Koutcher, J. A., Scher, H. I., Ludwig, T., Gerald, W., et al. (2005). Crucial role of p53-dependent cellular senescence in suppression of Pten-deficient tumorigenesis. Nature 436, 725-730. Cheng, C., Shtessel, L., Brady, M. M., and Ahmed, S. (2012). Caenorhabditis elegans POT-2 telomere protein represses a mode of alternative lengthening of telomeres with normal telomere lengths. Proc Natl Acad Sci USA 109, 7805-7810. Cheung, N. K., Heller, G., Kushner, B. H., Burch, L., and O’Reilly, R. J. (1991). Stage IV neuroblastoma more than 1 year of age at diagnosis: major response to chemotherapy and survival durations correlated strongly with dose intensity. Prog Clin Biol Res 366, 567-573. Cheung, N. K., Zhang, J., Lu, C., Parker, M., Bahrami, A., Tickoo, S. K., Heguy, A., Pappo, A. S., Federico, S., Dalton, J., et al. (2012). Association of age at diagnosis and genetic mutations in patients with neuroblastoma. JAMA 307, 1062-1071. Cheutin, T., McNairn, A. J., Jenuwein, T., Gilbert, D. M., Singh, P. B., and Misteli, T. (2003). Maintenance of stable heterochromatin domains by dynamic HP1 binding. Science 299, 721-725. Cho, N. W., Dilley, R. L., Lampson, M. A., and Greenberg, R. A. (2014). Interchromosomal homology searches drive directional ALT telomere movement and synapsis. Cell 159, 108-121. Choi, L. M., Kim, N. W., Zuo, J. J., Gerbing, R., Stram, D., Lukens, J. N., Matthay, K. K., Seeger, R. C., and Reynolds, C. P. (2000). Telomerase activity by TRAP assay and telomerase RNA (hTR) expression are predictive of outcome in neuroblastoma. Med Pediatr Oncol 35, 647-650. Chong, L., van Steensel, B., Broccoli, D., Erdjument-Bromage, H., Hanish, J., Tempst, P., and de Lange, T. (1995). A human telomeric protein. Science 270, 1663-1667. Chow, T. T., Zhao, Y., Mak, S. S., Shay, J. W., and Wright, W. E. (2012). Early and late steps in telomere overhang processing in normal human cells: the position of the final RNA primer drives telomere shortening. Genes Dev 26, 1167-1178. Christiansen, M., Stevnsner, T., Bohr, V. A., Clark, B. F., and Rattan, S. I. (2000). Gene-specific DNA repair of pyrimidine dimers does not decline during cellular aging in vitro. Exp Cell Res 256, 308-314. Chung, Y. L., and Tsai, T. Y. (2009). Promyelocytic leukemia nuclear bodies link the DNA damage repair pathway with hepatitis B virus replication: implications for hepatitis B virus exacerbation during chemotherapy and radiotherapy. Mol Cancer Res 7, 1672-1685. Cibulskis, K., Lawrence, M. S., Carter, S. L., Sivachenko, A., Jaffe, D., Sougnez, C., Gabriel, S., Meyerson, M., Lander, E. S., and Getz, G. (2013). Sensitive detection of somatic point mutations in impure and heterogeneous cancer samples. Nat Biotech 31, 213-219. Ciccarone, V. Spengler, B. A., Meyers, M. B., Biedler, J. L., Ross, R. A. (1989). Phenotypic diversification in human neuroblastoma cells: expression of distinct neural crest lineages. Cancer Res 49, 219-225. Clynes, D., Jelinska, C., Xella, B., Ayyub, H., Scott, C., Mitson, M., Taylor, S., Higgs, D. R., and Gibbons, R. J. (2015). Suppression of the alternative lengthening of telomere pathway by the chromatin remodelling factor ATRX. Nat Commun 6, 7538-49.

157

Cohen, S. B., Graham, M. E., Lovrecz, G. O., Bache, N., Robinson, P. J., and Reddel, R. R. (2007). Protein composition of catalytically active human telomerase from immortal cells. Science 315, 1850-1853. Cohen, S. B., and Reddel, R. R. (2008). A sensitive direct human telomerase activity assay. Nat Methods 5, 355-360. Cohn, S. L., Pearson, A. D., London, W. B., Monclair, T., Ambros, P. F., Brodeur, G. M., Faldum, A., Hero, B., Iehara, T., Machin, D., et al. (2009). The International Neuroblastoma Risk Group (INRG) classification system: an INRG Task Force report. J Clin Oncol 27, 289-297. Coleman, J., Baird, D. M., and Royle, N. J. (1999). The plasticity of human telomeres demonstrated by a hypervariable telomere repeat array that is located on some copies of 16p and 16q. Hum Mol Genet 8, 1637-1646. Compton, S. A., Choi, J. H., Cesare, A. J., Ozgur, S., and Griffith, J. D. (2007). Xrcc3 and Nbs1 are required for the production of extrachromosomal telomeric circles in human alternative lengthening of telomere cells. Cancer Res 67, 1513-1519. Cong, Y. S., Wen, J., and Bacchetti, S. (1999). The human telomerase catalytic subunit hTERT: organization of the gene and characterization of the promoter. Hum Mol Genet 8, 137-142. Cong, Y. S., Wright, W. E., and Shay, J. W. (2002). Human telomerase and its regulation. Microbiol Mol Biol Rev 66, 407-425.

Conomos, D., Reddel, R. R., and Pickett, H. A. (2014). NuRD-ZNF827 recruitment to telomeres creates a molecular scaffold for homologous recombination. Nat Struct Mol Biol 21, 760-770.

Conomos, D., Stutz, M. D., Hills, M., Neumann, A. A., Bryan, T. M., Reddel, R. R., and Pickett, H. A. (2012). Variant repeats are interspersed throughout the telomeres and recruit nuclear receptors in ALT cells. J Cell Biol 199, 893-906. Corvi, R., Amler, L. C., Savelyeva, L., Gehring, M., and Schwab, M. (1994). MYCN is retained in single copy at chromosome 2 band p23-24 during amplification in human neuroblastoma cells. Proc Nat Acad Sci USA 91, 5523-5527. Costa, A., Daidone, M. G., Daprai, L., Villa, R., Cantu, S., Pilotti, S., Mariani, L., Gronchi, A., Henson, J. D., Reddel, R. R., and Zaffaroni, N. (2006). Telomere maintenance mechanisms in liposarcomas: association with histologic subtypes and disease progression. Cancer Res 66, 8918-8924. Cote, J., Quinn, J., Workman, J. L., and Peterson, C. L. (1994). Stimulation of GAL4 derivative binding to nucleosomal DNA by the yeast SWI.SNF complex. Science 265, 53-60. Counter, C. M., Avilion, A. A., LeFeuvre, C. E., Stewart, N. G., Greider, C. W., Harley, C. B., and Bacchetti, S. (1992). Telomere shortening associated with chromosome instability is arrested in immortal cells which express telomerase activity. EMBO J 11, 1921-1929. Counter, C. M., Gupta, J., Harley, C. B., Leber, B., and Bacchetti, S. (1995). Telomerase activity in normal leukocytes and in hematologic malignancies. Blood 85, 2315-2320.

158

Counter, C. M., Hahn, W. C., Wei, W., Dickinson Caddle, S., Beijersbergen, R. L., Lansdorp, P. M., Sedivy, J. M., and Weinberg, R. A. (1998a). Dissociation among in vitro telomerase activity, telomere maintenance, and cellular immortalization. Proc Natl Acad Sci USA 95, 14723-14728. Counter, C. M., Meyerson, M., Eaton, E. N., Ellisen, L. W., Caddle, S. D., Haber, D. A., and Weinberg, R. A. (1998b). Telomerase activity is restored in human cells by ectopic expression of hTERT (hEST2), the catalytic subunit of telomerase. Oncogene 16, 1217-1222. Counter, C. M., Meyerson, M., Eaton, E. N., and Weinberg, R. A. (1997). The catalytic subunit of yeast telomerase. Proc Natl Acad Sci USA 94, 9202-9207. Cox, K. E., Marechal, A., and Flynn, R. L. (2016). SMARCAL1 Resolves Replication Stress at ALT Telomeres. Cell Rep 14, 1032-1040. Crabbe, L., Verdun, R. E., Haggblom, C. I., and Karlseder, J. (2004). Defective telomere lagging strand synthesis in cells lacking WRN helicase activity. Science 306, 1951-1953. Croteau, D. L., Popuri, V., Opresko, P. L., and Bohr, V. A. (2014). Human RecQ helicases in DNA repair, recombination, and replication. Annu Rev Biochem 83, 519-552. D’Adda di Fagagna, F., Reaper, P. M., Clay-Farrace, L., Fiegler, H., Carr, P., von Zglinicki, T., Saretzki, G., Carter, N. P., and Jackson, S. P. (2003). A DNA damage checkpoint response in telomere-initiated senescence. Nature 426, 194-198. D’Angio, G., Evans, A., and Koop, C. E. (1971). Special pattern of widespread neuroblastoma with a favourable prognosis. Lancet 297, 1046-1049. De La Fuente, R., Viveiros, M. M., Wigglesworth, K., and Eppig, J. J. (2004). ATRX, a member of the SNF2 family of helicase/ATPases, is required for chromosome alignment and meiotic spindle organization in metaphase II stage mouse oocytes. Dev Biol 272, 1-14. De Lange, T. (2004). T-loops and the origin of telomeres. Nat Rev Mol Cell Biol 5, 323-329. Deeg, K. I., Chung, I., Bauer, C., and Rippe, K. (2016). Cancer cells with alternative lengthening of telomeres do not display a general hypersensitivity to ATR inhibition. Front Oncol 6, doi: 10.3389/fonc.2016.00186. Dejardin, J., and Kingston, R. E. (2009). Purification of proteins associated with specific genomic loci. Cell 136, 175-186. Dellaire, G., and Bazett-Jones, D. P. (2004). PML nuclear bodies: dynamic sensors of DNA damage and cellular stress. Bio Essays 26, 963-977. Dellaire, G., Ching, R. W., Ahmed, K., Jalali, F., Tse, K. C., Bristow, R. G., and Bazett-Jones, D. P. (2006). Promyelocytic leukemia nuclear bodies behave as DNA damage sensors whose response to DNA double-strand breaks is regulated by NBS1 and the kinases ATM, Chk2, and ATR. J Cell Biol 175, 55-66. Denchi, E. L., and de Lange, T. (2007). Protection of telomeres through independent control of ATM and ATR by TRF2 and POT1. Nature 448, 1068-1071.

159

Deng, Z., Glousker, G., Molczan, A., Fox, A. J., Lamm, N., Dheekollu, J., Weizman, O. E., Schertzer, M., Wang, Z., Vladimirova, O., et al. (2013). Inherited mutations in the helicase RTEL1 cause telomere dysfunction and Hoyeraal-Hreidarsson syndrome. Proc Natl Acad Sci USA 110, E3408-E3416. Deng, Z., Norseen, J., Wiedmer, A., Riethman, H., and Lieberman, P. M. (2009). TERRA RNA binding to TRF2 facilitates heterochromatin formation and ORC recruitment at telomeres. Mol Cell 35, 403-413. Deng, Z., Wang, Z., Stong, N., Plasschaert, R., Moczan, A., Chen, H. S., Hu, S., Wikramasinghe, P., Davuluri, R. V., Bartolomei, M. S., et al. (2012). A role for CTCF and cohesin in subtelomere chromatin organization, TERRA transcription, and telomere end protection. EMBO J 31, 4165-4178. Di Micco, R., Fumagalli, M., Cicalese, A., Piccinin, S., Gasparini, P., Luise, C., Schurra, C., Garre’, M., Nuciforo, P. G., Bensimon, A., et al. (2006). Oncogene-induced senescence is a DNA damage response triggered by DNA hyper-replication. Nature 444, 638-642. Dilley, R. L. and Greenberg, R. A. (2015). Alternative telomere maintenance and cancer. Trends Cancer 1, 145-156. Dilley, R. L., Verma, P., Cho, N. W., Winters, H. D., Wondisford, A. R., and Greenberg, R. A. (2016). Break-induced telomere synthesis underlies alternative telomere maintenance. Nature 539, 54-58. Dimitrova, N., Chen, Y. C., Spector, D. L., and de Lange, T. (2008). 53BP1 promotes non-homologous end joining of telomeres by increasing chromatin mobility. Nature 456, 524-528. Dimri, G. P., Itahana, K., Acosta, M., and Campisi, J. (2000). Regulation of a senescence checkpoint response by the E2F1 transcription factor and p14ARF tumor suppressor. Mol Cell Biol 20, 273-285. DiPersio, J. F., Collins, R. H., Blum, W., Devetten, M. P., Stiff, P., Elias, L., Reddy, A., Smith, J. A., and Khoury, H. J. (2009). Immune responses in AML patients following vaccination with GRNVAC1, autologous RNA transfected dendritic cells expressing telomerase catalytic subunit hTERT. Blood 114, 262-262. Diskin, S. J., Capasso, M., Schnepp, R. W., Cole, K. A., Attiyeh, E. F., Hou, C., Diamond, M., Carpenter, E. L., Winter, C., Lee, H., et al. (2012). Common variation at 6q16 within HACE1 and LIN28B influences susceptibility to neuroblastoma. Nat Genet 44, 1126-1130. Diskin, S. J., Hou, C., Glessner, J. T., Attiyeh, E. F., Laudenslager, M., Bosse, K., Cole, K., Mosse, Y. P., Wood, A., Lynch, J. E., et al. (2009). Copy number variation at 1q21.1 associated with neuroblastoma. Nature 459, 987-991. Doksani, Y., and de Lange, T. (2016). Telomere-internal double-strand breaks are repaired by homologous recombination and PARP1/Lig3-dependent end-joining. Cell Rep 17, 1646-1656. Doksani, Y., Wu, J. Y., de Lange, T., and Zhuang, X. (2013). Super-resolution fluorescence imaging of telomeres reveals TRF2-dependent T-loop formation. Cell 155, 345-356. Drachtman, R. A., and Alter, B. P. (1992). Dyskeritosis-congenita- clinical and genetic-heterogeneity- report of a new case and review of the literature. Am J Pediatr Hematol Oncol 14, 297-304.

160

Drane, P., Ouararhni, K., Depaux, A., Shuaib, M., and Hamiche, A. (2010). The death-associated protein DAXX is a novel histone chaperone involved in the replication-independent deposition of H3.3. Genes Dev 24, 1253-1265. Drosopoulos, W. C., Kosiyatrakul, S. T., and Schildkraut, C. L. (2015). BLM helicase facilitates telomere replication during leading strand synthesis of telomeres. J Cell Biol 210, 191-208. Drosopoulos, W. C., Kosiyatrakul, S. T., Yan, Z., Calderano, S. G., and Schildkraut, C. L. (2012). Human telomeres replicate using chromosome-specific, rather than universal, replication programs. J Cell Biol 197, 253-266. Du, L., Liu, L., Zhang, C., Cai, W., Wu, Y., Wang, J., and Lv, F. (2014). Role of surgery in the treatment of patients with high-risk neuroblastoma who have a poor response to induction chemotherapy. J Pediatr Surg 49, 528-533. Duncan, E. L., Whitaker, N. J., Moy, E. L., and Reddel, R. R. (1993). Assignment of SV40-immortalized cells to more than one complementation group for immortalization. Exp Cell Res 205, 337-344. Dunham, M. A., Neumann, A. A., Fasching, C. L., and Reddel, R. R. (2000). Telomere maintenance by recombination in human cells. Nat Genet 26, 447-450. Eleveld, T. F., Oldridge, D. A., Bernard, V., Koster, J., Daage, L. C., Diskin, S. J., Schild, L., Bentahar, N. B., Bellini, A., Chicard, M., et al. (2015). Relapsed neuroblastomas show frequent RAS-MAPK pathway mutations. Nat Genet 47, 864-871. Eid, R., Demattei, M. V., Episkopou, H., Auge-Gouillou, C., Decottignies, A., Grandin, N., and Charbonneau, M. (2015). Genetic inactivation of ATRX leads to a decrease in the amount of telomeric cohesin and of telomere transcription in human glioma cells. Mol Cell Biol 35, 2818-2830. Ellis, N. A., Groden, J., Ye, T. Z., Straughen, J., Lennon, D. J., Ciocci, S., Proytcheva, M., and German, J. (1995). The blooms-syndrome gene-product is homologous to REQ helicases. Cell 83, 655-666. Elsasser, S. J., Noh, K. M., Diaz, N., Allis, C. D., and Banaszynski, L. A. (2015). Histone H3.3 is required for endogenous retroviral element silencing in embryonic stem cells. Nature 522, 240-244. Else, T., Giordano, T. J., and Hammer, G. D. (2008). Evaluation of telomere length maintenance mechanisms in adrenocortical carcinoma. J Clin Endocrinol Metab 93, 1442-1449. Episkopou, H., Draskovic, I., van Beneden, A., Tilman, G., Mattiussi, M., Gobin, M., Arnoult, N., Londono-Vallejo, A., and Decottignies, A. (2014). Alternative Lengthening of Telomeres is characterized by reduced compaction of telomeric chromatin. Nucleic Acids Res 42, 4391-4405. Errington, T. M., Fu, D., Wong, J. M. Y., and Collins, K. (2008). Disease-associated human telomerase RNA variants show loss of function for telomere synthesis without dominant-negative interference. Mol Cell Biol 28, 6510-6520. Fan, Q., Zhang, F., Barrett, B., Ren, K., and Andreassen, P. R. (2009). A role for monoubiquitinated FANCD2 at telomeres in ALT cells. Nucleic Acids Res 37, 1740-1754.

161

Farooqi, A. S., Dagg, R. A., Choi, L. M., Shay, J. W., Reynolds, C. P., and Lau, L. M. (2014). Alternative lengthening of telomeres in neuroblastoma cell lines is associated with a lack of MYCN genomic amplification and with p53 pathway aberrations. J Neurooncol 119, 17-26. Fasching, C. L., Bower, K., and Reddel, R. R. (2005). Telomerase-independent telomere length maintenance in the absence of alternative lengthening of telomeres-associated promyelocytic leukemia bodies. Cancer Res 65, 2722-2729. Fasching, C. L., Neumann, A. A., Muntoni, A., Yeager, T. R., and Reddel, R. R. (2007). DNA damage induces alternative lengthening of telomeres (ALT)-associated promyelocytic leukemia bodies that preferentially associate with linear telomeric DNA. Cancer Res 67, 7072-7077. Felsenfeld, G., and Groudine, M. (2003). Controlling the double helix. Nature 421, 448-453. Feng, J., Funk, W. D., Wang, S. S., Weinrich, S. L., Avilion, A. A., Chiu, C. P., Adams, R. R., Chang, E., Allsopp, R. C., Yu, J. H., et al. (1995). The RNA component of human telomerase. Science 269, 1236-1241. Ferbeyre, G., De Stanchina, E., Querido, E., Baptiste, N., Prives, C., and Lowe, S. W. (2000). PML is induced by oncogenic ras and promotes premature senescence. Genes Dev 14, 2015-2027. Flynn, R. L., Centore, R. C., O’Sullivan, R. J., Rai, R., Tse, A., Songyang, Z., Chang, S., Karlseder, J., and Zou, L. (2011). TERRA and hnRNPA1 orchestrate an RPA-to-POT1 switch on telomeric single-stranded DNA. Nature 471, 532-536. Flynn, R. L., Cox, K. E., Jeitany, M., Wakimoto, H., Bryll, A. R., Ganem, N. J., Bersani, F., Pineda, J. R., Suva, M. L., Benes, C. H., et al. (2015). Alternative lengthening of telomeres renders cancer cells hypersensitive to ATR inhibitors. Science 347, 273-277. Fredriksson, N. J., Ny, L., Nilsson, J. A., and Larsson, E. (2014). Systematic analysis of noncoding somatic mutations and gene expression alterations across 14 tumor types. Nat Genet 46, 1258-1263. Frescas, D., and de Lange, T. (2014a). Binding of TPP1 to TIN2 is required for POT1a,b-mediated telomere protection. J Biol Chem 289, 24180-24187. Frescas, D., and de Lange, T. (2014b). TRF2-tethered TIN2 can mediate telomere protection by TPP1/POT1. Mol Cell Biol 34, 1349-1362. Fu, X. H., Duan, Y. M., Liu, Y. T., Cai, C., Meng, F. L., and Zhou, J. Q. (2014). Telomere recombination preferentially occurs at short telomeres in telomerase-null type II survivors. PloS ONE 9, e90644. Ganot, P., CaizerguesFerrer, M., and Kiss, T. (1997). The family of box ACA small nucleolar RNAs is defined by an evolutionarily conserved secondary structure and ubiquitous sequence elements essential for RNA accumulation. Genes Dev 11, 941-956. Garaventa, A., Luksch, R., Biasotti, S., Severi, G., Pizzitola, M. R., Viscardi, E., Prete, A., Mastrangelo, S., Podda, M., Haupt, R., and De Bernardi, B. (2003). A phase II study of topotecan with vincristine and doxorubicin in children with recurrent/refractory neuroblastoma. Cancer 98, 2488-2494. Garcia, I., Mayol, G., Rodríguez, E., Suñol, M., Gershon, T. R., Ríos, J., Cheung, N. K. V., Kieran, M. W., George, R. E., Perez-Atayde, A. R., et al. (2010). Expression of the neuron-specific protein CHD5 is an independent marker of outcome in neuroblastoma. Mol Cancer, 9, 277-291.

162

Garcia-Cao, M., O’Sullivan, R., Peters, A., Jenuwein, T., and Blasco, M. A. (2004). Epigenetic regulation of telomere length in mammalian cells by the Suv39h1 and Suv39h2 histone methyltransferases. Nature Genetics 36, 94-99. Gellert, M., Lipsett, M. N., and Davies, D. R. (1962). Helix formation by guanylic acid. Proc Natl Acad Sci USA 48, 2013-2018. George, R. E., London, W. B., Cohn, S. L., Maris, J. M., Kretschmar, C., Diller, L., Brodeur, G. M., Castleberry, R. P., and Look, A. T. (2005). Hyperdiploidy plus nonamplified MYCN confers a favorable prognosis in children 12 to 18 months old with disseminated neuroblastoma: a Pediatric Oncology Group study. J Clin Oncol 23, 6466-6473. George, R. E., Sanda, T., Hanna, M., Frohling, S., Luther, W., Zhang, J., Ahn, Y., Zhou, W., London, W. B., McGrady, P., et al. (2008). Activating mutations in ALK provide a therapeutic target in neuroblastoma. Nature 455, 975-978. Gibbons, R. J., McDowell, T. L., Raman, S., O’Rourke, D. M., Garrick, D., Ayyub, H., and Higgs, D. R. (2000). Mutations in ATRX, encoding a SWI/SNF-like protein, cause diverse changes in the pattern of DNA methylation. Nature Genetics 24, 368-371. Gibbons, R. J., Picketts, D. J., Villard, L., and Higgs, D. R. (1995). Mutations in a putative global transcriptional regulator cause X-linked mental-retardation with alpha-thalassemia (ATR-X syndrome). Cell 80, 837-845. Gilbert, D. E., and Feigon, J. (1999). Multistranded DNA structures. Curr Opin Struct Biol 9, 305-314. Gilson, E., and Londono-Vallejo, A. (2007). Telomere length profiles in humans: all ends are not equal. Cell Cycle 6, 2486-2494. Girardi, A. J., Jensen, F. C., and Koprowsk.H (1965). SV40-induced transformation of human diploid cells- crisis and recovery. J Cell Comp Physiol 65, 69-84. Gire, V., and Wynford-Thomas, D. (1998). Reinitiation of DNA synthesis and cell division in senescent human fibroblasts by microinjection of anti-p53 antibodies. Mol Cell Biol 18, 1611-1621. Goldberg, A. D., Banaszynski, L. A., Noh, K. M., Lewis, P. W., Elsaesser, S. J., Stadler, S., Dewell, S., Law, M., Guo, X. Y., Li, X., et al. (2010). Distinct factors control histone variant H3.3 localization at specific genomic regions. Cell 140, 678-691. Gomez, S., Castellano, G., Mayol, G., Sunol, M., Queiros, A., Bibikova, M., Nazor, K. L., Loring, J. F., Lemos, I., Rodriguez, E., et al. (2015). DNA methylation fingerprint of neuroblastoma reveals new biological and clinical insights. Epigenomics 7, 1137-1153. Gong, Y., and de Lange, T. (2010). A Shld1-controlled POT1a provides support for repression of ATR signaling at telomeres through RPA exclusion. Mol Cell 40, 377-387. Gonzalo, S., Jaco, I., Fraga, M. F., Chen, T. P., Li, E., Esteller, M., and Blasco, M. A. (2006). DNA methyltransferases control telomere length and telomere recombination in mammalian cells. Nat Cell Biol 8, 416-U466.

163

Gottschling, D. E., Aparicio, O. M., Billington, B. L., and Zakian, V. A. (1990). Position effect at S. cerevisiae telomeres: reversible repression of Pol II transcription. Cell 63, 751-762. Greaves, M. (1996). Is telomerase activity in cancer due to selection of stem cells and differentiation arrest? Trends Genet 12, 127-128. Greider, C. W., and Blackburn, E. H. (1985). Identification of a specific telomere terminal transferase-activity in tetrahymena extracts. Cell 43, 405-413. Greider, C. W., and Blackburn, E. H. (1989). A telomeric sequence in the RNA of Tetrahymena telomerase required for telomere repeat synthesis. Nature 337, 331-337. Griffith, J. D., Comeau, L., Rosenfield, S., Stansel, R. M., Bianchi, A., Moss, H., and de Lange, T. (1999). Mammalian telomeres end in a large duplex loop. Cell 97, 503-514. Grobelny, J. V., Godwin, A. K., and Broccoli, D. (2000). ALT-associated PML bodies are present in viable cells and are enriched in cells in the G(2)/M phase of the cell cycle. J Cell Sci 113, 4577-4585. Grobelny, J. V., Kulp-McEliece, M., and Broccoli, D. (2001). Effects of reconstitution of telomerase activity on telomere maintenance by the alternative lengthening of telomeres (ALT) pathway. Hum Mol Gen 10, 1953-1961. Gu, P., Min, J. N., Wang, Y., Huang, C., Peng, T., Chai, W., and Chang, S. (2012). CTC1 deletion results in defective telomere replication, leading to catastrophic telomere loss and stem cell exhaustion. EMBO J 31, 2309-2321. Guilleret, I., Yan, P., Guillou, L., Braunschweig, R., Coindre, J. M., and Benhattar, J. (2002). The human telomerase RNA gene (hTERC) is regulated during carcinogenesis but is not dependent on DNA methylation. Carcinogenesis 23, 2025-2030. Guo, C., White, P. S., Weiss, M. J., Hogarty, M. D., Thompson, P. M., Stram, D. O., Gerbing, R., Matthay, K. K., Seeger, R. C., Brodeur, G. M., and Maris, J. M. (1999). Allelic deletion at 11q23 is common in MYCN single copy neuroblastomas. Oncogene 18, 4948-4957. Guo, T., Kouvonen, P., Koh, C. C., Gillet, L. C., Wolski, W. E., Rost, H. L., Rosenberger, G., Collins, B. C., Blum, L. C., Gillessen, S., et al. (2015). Rapid mass spectrometric conversion of tissue biopsy samples into permanent quantitative digital proteome maps. Nat Med 21, 407-413. Guo, Y., Kartawinata, M., Li, J., Pickett, H. A., Teo, J., Kilo, T., Barbaro, P. M., Keating, B., Chen, Y., Tian, L., et al. (2014). Inherited bone marrow failure associated with germline mutation of ACD, the gene encoding telomere protein TPP1. Blood 124, 2767-2774. Gupta, J., Han, L. P., Wang, P., Gallie, B. L., and Bacchetti, S. (1996). Development of retinoblastoma in the absence of telomerase activity. J Natl Cancer Inst 88, 1152-1157. Hahn, W. C., Counter, C. M., Lundberg, A. S., Beijersbergen, R. L., Brooks, M. W., and Weinberg, R. A. (1999). Creation of human tumour cells with defined genetic elements. Nature 400, 464-468. Hakin-Smith, V., Jellinek, D. A., Levy, D., Carroll, T., Teo, M., Timperley, W. R., McKay, M. J., Reddel, R. R., and Royds, J. A. (2003). Alternative lengthening of telomeres and survival in patients with glioblastoma multiforme. Lancet 361, 836-838.

164

Hanahan, D., and Weinberg, R. A. (2000). The hallmarks of cancer. Cell 100, 57-70. Hanahan, D., and Weinberg, R. A. (2011). Hallmarks of cancer: the next generation. Cell 144, 646-674. Hansen, R. S., Wijmenga, C., Luo, P., Stanek, A. M., Canfield, T. K., Weemaes, C. M., and Gartler, S. M. (1999). The DNMT3B DNA methyltransferase gene is mutated in the ICF immunodeficiency syndrome. Proc Nat Acad Sci USA 96, 14412-14417. HarleBachor, C., and Boukamp, P. (1996). Telomerase activity in the regenerative basal layer of the epidermis in human skin and in immortal and carcinoma-derived skin keratinocytes. Proc Nat Acad Sci USA 93, 6476-6481. Harley, C. B., Futcher, A. B., and Greider, C. W. (1990). Telomeres shorten during ageing of human fibroblasts. Nature 345, 458-460. Hastie, N. D., Dempster, M., Dunlop, M. G., Thompson, A. M., Green, D. K., and Allshire, R. C. (1990). Telomere reduction in human colorectal carcinoma and with ageing. Nature 346, 866-868. Hayflick, L. (1965). The limited in vitro lifetime of human diploid cell strains. Exp Cell Res 37, 614-636. Hayflick, L., and Moorhead, P. S. (1961). The serial cultivation of human diploid cell strains. Exp Cell Res 25, 585-621. He, D. L., Mu, Z. M., Le, X. F., Hsieh, J. T., Pong, R. C., Chung, L. W., and Chang, K. S. (1997). Adenovirus-mediated expression of PML suppresses growth and tumorigenicity of prostate cancer cells. Cancer Res 57, 1868-1872. Heaphy, C. M., de Wilde, R. F., Jiao, Y., Klein, A. P., Edil, B. H., Shi, C., Bettegowda, C., Rodriguez, F. J., Eberhart, C. G., Hebbar, S., et al. (2011a). Altered telomeres in tumors with ATRX and DAXX mutations. Science 333, 425. Heaphy, C. M., Subhawong, A. P., Hong, S. M., Goggins, M. G., Montgomery, E. A., Gabrielson, E., Netto, G. J., Epstein, J. I., Lotan, T. L., Westra, W. H., et al. (2011b). Prevalence of the alternative lengthening of telomeres telomere maintenance mechanism in human cancer subtypes. Am J Path 179, 1608-1615. Heiss, N. S., Knight, S. W., Vulliamy, T. J., Klauck, S. M., Wiemann, S., Mason, P. J., Poustka, A., and Dokal, I. (1998). X-linked dyskeratosis congenita is caused by mutations in a highly conserved gene with putative nucleolar functions. Nat Genet 19, 32-38. Hemann, M. T., Strong, M. A., Hao, L. Y., and Greider, C. W. (2001). The shortest telomere, not average telomere length, is critical for cell viability and chromosome stability. Cell 107, 67-77. Henras, A., Henry, Y., Bousquet-Antonelli, C., Noaillac-Depeyre, J., Gelugne, J. P., and Caizergues-Ferrer, M. (1998). Nhp2p and Nop10p are essential for the function of H/ACA snoRNPs. EMBO J 17, 7078-7090. Henson, J. D., Cao, Y., Huschtscha, L. I., Chang, A. C., Au, A. Y., Pickett, H. A., and Reddel, R. R. (2009). DNA C-circles are specific and quantifiable markers of alternative-lengthening-of-telomeres activity. Nat Biotechnol 27, 1181-1185.

165

Henson, J. D., Hannay, J. A., McCarthy, S. W., Royds, J. A., Yeager, T. R., Robinson, R. A., Wharton, S. B., Jellinek, D. A., Arbuckle, S. M., Yoo, J. Y., et al. (2005). A robust assay for alternative lengthening of telomeres in tumors shows the significance of alternative lengthening of telomeres in sarcomas and astrocytomas. Clin Cancer Res 11, 217-225. Henson, J. D., Lau, L. M., Koch, S., Martin La Rotta, N., Dagg, R. A., and Reddel, R. R. (2017). The C-Circle Assay for alternative-lengthening-of-telomeres activity. Methods 114, 74-84. Henson, J. D., Neumann, A. A., Yeager, T. R., and Reddel, R. R. (2002). Alternative lengthening of telomeres in mammalian cells. Oncogene 21, 598-610. Henson, J. D., and Reddel, R. R. (2010). Assaying and investigating Alternative Lengthening of Telomeres activity in human cells and cancers. FEBS Lett 584, 3800-3811. Hiyama, E., Hiyama, K., Ohtsu, K., Yamaoka, H., Ichikawa, T., Shay, J. W., and Yokoyama, T. (1997). Telomerase activity in neuroblastoma: is it a prognostic indicator of clinical behaviour? Eur J Cancer 33, 1932-1936. Hiyama, E., Hiyama, K., Yokoyama, T., Matsuura, Y., Piatyszek, M. A., and Shay, J. W. (1995a). Correlating telomerase activity levels with human neuroblastoma outcomes. Nat Med 1, 249-255. Hiyama, E., Tatsumoto, N., Kodama, T., Hiyama, K., Shay, J. W., and Yokoyama, T. (1996). Telomerase activity in human intestine. Int J Oncol 9, 453-458. Hiyama, K., Hirai, Y., Kyoizumi, S., Akiyama, M., Hiyama, E., Piatyszek, M. A., Shay, J. W., Ishioka, S., and Yamakido, M. (1995b). Activation of telomerase in human-lymphocytes and hematopoietic progenitor cells. J Immunol 155, 3711-3715. Ho, C. Y., Murnane, J. P., Yeung, A. K., Ng, H. K., and Lo, A. W. (2008). Telomeres acquire distinct heterochromatin characteristics during siRNA-induced RNA interference in mouse cells. Curr Biol 18, 183-187. Horikawa, I., Cable, P. L., Afshari, C., and Barrett, J. C. (1999a). Cloning and characterization of the promoter region of human telomerase reverse transcriptase gene. Cancer Res 59, 826-830. Horn, S., Figl, A., Rachakonda, P. S., Fischer, C., Sucker, A., Gast, A., Kadel, S., Moll, I., Nagore, E., Hemminki, K., et al. (2013). TERT promoter mutations in familial and sporadic melanoma. Science 339, 959-961. Hossain, S., Singh, S., and Lue, N. F. (2002). Functional analysis of the C-terminal extension of telomerase reverse transcriptase — A putative “Thumb” domain. J Biol Chem 277, 36174-36180. Houghtaling, B. R., Cuttonaro, L., Chang, W., and Smith, S. (2004). A dynamic molecular link between the telomere length regulator TRF1 and the chromosome end protector TRF2. Curr Biol 14, 1621-1631. Houghton, P. J., Lock, R., Carol, H., Morton, C. L., Gorlick, R., Anders Kolb, E., Keir, S. T., Reynolds, C. P., Kang, M. H., Maris, J. M., et al. (2012). Testing of the topoisomerase 1 inhibitor Genz-644282 by the pediatric preclinical testing program. Pediatr Blood Cancer 58, 200-209. Hsiang, Y. H., Hertzberg, R., Hecht, S., and Liu, L. F. (1985). Camptothecin induces protein-linked DNA breaks via mammalian DNA topoisomerase I. J Biol Chem 260, 14873-14878.

166

Hsiang, Y. H., Lihou, M. G., and Liu, L. F. (1989). Arrest of replication forks by drug-stabilized topoisomerase I-DNA cleavable complexes as a mechanism of cell killing by camptothecin. Cancer Res 49, 5077-5082. Hu, J., Hwang, S. S., Liesa, M., Gan, B., Sahin, E., Jaskelioff, M., Ding, Z., Ying, H., Boutin, A. T., Zhang, H., et al. (2012). Antitelomerase therapy provokes ALT and mitochondrial adaptive mechanisms in cancer. Cell 148, 651-663. Huang, C., Dai, X., and Chai, W. (2012). Human Stn1 protects telomere integrity by promoting efficient lagging-strand synthesis at telomeres and mediating C-strand fill-in. Cell Res 22, 1681-1695. Huang, F. W., Hodis, E., Xu, M. J., Kryukov, G. V., Chin, L., and Garraway, L. A. (2013). Highly recurrent TERT promoter mutations in human melanoma. Science 339, 957-959. Huschtscha, L. I., and Holliday, R. (1983). Limited and unlimited growth of SV40-transformed cells from human diploid MRC-5 fibroblasts. J Cell Sci 63, 77-99. Huschtscha, L. I., Noble, J. R., Neumann, A. A., Moy, E. L., Barry, P., Melki, J. R., Clark, S. J., and Reddel, R. R. (1998). Loss of p16INK4 expression by methylation is associated with lifespan extension of human mammary epithelial cells. Cancer Res 58, 3508-3512. Ichikawa, Y., Morohashi, N., Nishimura, Y., Kurumizaka, H., and Shimizu, M. (2014). Telomeric repeats act as nucleosome-disfavouring sequences in vivo. Nucleic Acids Res 42, 1541-1552. Ip, S. C., Rass, U., Blanco, M. G., Flynn, H. R., Skehel, J. M., and West, S. C. (2008). Identification of Holliday junction resolvases from humans and yeast. Nature 456, 357-361. Ishii, Y., Tsuyama, N., Maeda, S., Tahara, H., and Ide, T. (1999). Telomerase activity in hybrids between telomerase-negative and telomerase-positive immortal human cells is repressed in the different complementation groups but not in the same complementation group of immortality. Mech Ageing Dev 110, 175-193. Jackson, S. P., and Bartek, J. (2009). The DNA-damage response in human biology and disease. Nature 461, 1071-1078. Jady, B. E., Darzacq, X., Tucker, K. E., Matera, A. G., Bertrand, E., and Kiss, T. (2003). Modification of Sm small nuclear RNAs occurs in the nucleoplasmic Cajal body following import from the cytoplasm. EMBO J 22, 1878-1888. Jafri, M. A., Ansari, S. A., Alqahtani, M. H., and Shay, J. W. (2016). Roles of telomeres and telomerase in cancer, and advances in telomerase-targeted therapies. Genome Med 8, doi: 10.1186/s13073-016-0324-x. Janoueix-Lerosey, I., Lequin, D., Brugieres, L., Ribeiro, A., de Pontual, L., Combaret, V., Raynal, V., Puisieux, A., Schleiermacher, G., Pierron, G., et al. (2008). Somatic and germline activating mutations of the ALK kinase receptor in neuroblastoma. Nature 455, 967-970. Jeyapalan, J. N., Mendez-Bermudez, A., Zaffaroni, N., Dubrova, Y. E., and Royle, N. J. (2008). Evidence for alternative lengthening of telomeres in liposarcomas in the absence of ALT-associated PML bodies. Int J Cancer 122, 2414-2421.

167

Jeyapalan, J. N., Varley, H., Foxon, J. L., Pollock, R. E., Jeffreys, A. J., Henson, J. D., Reddel, R. R., and Royle, N. J. (2005). Activation of the ALT pathway for telomere maintenance can affect other sequences in the human genome. Hum Mol Gen 14, 1785-1794. Jiang, W. Q., and Ringertz, N. (1997). Altered distribution of the promyelocytic leukemia-associated protein is associated with cellular senescence. Cell Growth Differ 8, 513-522. Jiang, W. Q., Zhong, Z. H., Henson, J. D., Neumann, A. A., Chang, A. C., and Reddel, R. R. (2005). Suppression of alternative lengthening of telomeres by Sp100-mediated sequestration of MRE11/RAD50/NBS1 complex. Mol Cell Biol 25, 2708-2721. Jiang, W. Q., Zhong, Z. H., Henson, J. D., and Reddel, R. R. (2007). Identification of candidate alternative lengthening of telomeres genes by methionine restriction and RNA interference. Oncogene 26, 4635-4647. Jiang, W. Q., Zhong, Z. H., Nguyen, A., Henson, J. D., Toouli, C. D., Braithwaite, A. W., and Reddel, R. R. (2009). Induction of alternative lengthening of telomeres-associated PML bodies by p53/p21 requires HP1 proteins. J Cell Biol 185, 797-810. Jiao, Y., Killela, P. J., Reitman, Z. J., Rasheed, A. B., Heaphy, C. M., de Wilde, R. F., Rodriguez, F. J., Rosemberg, S., Oba-Shinjo, S. M., Marie, S. K., et al. (2012). Frequent ATRX, CIC, FUBP1 and IDH1 mutations refine the classification of malignant gliomas. Oncotarget 3, 709-722. Jiao, Y. C., Shi, C. J., Edil, B. H., de Wilde, R. F., Klimstra, D. S., Maitra, A., Schulick, R. D., Tang, L. H., Wolfgang, C. L., Choti, M. A., et al. (2011). DAXX/ATRX, MEN1, and mTOR pathway genes are frequently altered in pancreatic neuroendocrine tumors. Science 331, 1199-1203. Johnson, J. E., Varkonyi, R. J., Schwalm, J., Cragle, R., Klein-Szanto, A., Patchefsky, A., Cukierman, E., von Mehren, M., and Broccoli, D. (2005). Multiple mechanisms of telomere maintenance exist in liposarcomas. Clin Cancer Res 11, 5347-5355. Jones, S., Zhang, X., Parsons, D. W., Lin, J. C., Leary, R. J., Angenendt, P., Mankoo, P., Carter, H., Kamiyama, H., Jimeno, A., et al. (2008). Core signaling pathways in human pancreatic cancers revealed by global genomic analyses. Science 321, 1801-1806. Kaneko, Y., Kanda, N., Maseki, N., Sakurai, M., Tsuchida, Y., Takeda, T., Okabe, I., and Sakurai, M. (1987). Different karyotypic patterns in early and advanced stage neuroblastomas. Cancer Res 47, 311-318. Karlseder, J., Hoke, K., Mirzoeva, O. K., Bakkenist, C., Kastan, M. B., Petrini, J. H., and de Lange, T. (2004). The telomeric protein TRF2 binds the ATM kinase and can inhibit the ATM-dependent DNA damage response. PloS Biol 2, E240. Karlseder, J., Smogorzewska, A., and de Lange, T. (2002). Senescence induced by altered telomere state, not telomere loss. Science 295, 2446-2449. Kaul, Z., Cesare, A. J., Huschtscha, L. I., Neumann, A. A., and Reddel, R. R. (2012). Five dysfunctional telomeres predict onset of senescence in human cells. EMBO Rep 13, 52-59. Kawanishi, S., and Oikawa, S. (2004). Mechanism of telomere shortening by oxidative stress. Ann NY Acad Sci 1019, 278-284.

168

Keshelava, N., Seeger, R. C., Groshen, S., and Reynolds, C. P. (1998). Drug resistance patterns of human neuroblastoma cell lines derived from patients at different phases of therapy. Cancer Res 58, 5396-5405. Keshelava, N., Zuo, J. J., Chen, P., Waidyaratne, S. N., Luna, M. C., Gomer, C. J., Triche, T. J., and Reynolds, C. P. (2001). Loss of p53 function confers high-level multidrug resistance in neuroblastoma cell lines. Cancer Res 61, 6185-6193. Khoury, H. J., Collins, R. H., Blum, W., Maness, L., Stiff, P., Kelsey, S. M., Reddy, A., Smith, J. A., and DiPersio, J. F. (2010). Prolonged administration of the telomerase vaccine GRNVAC1 is well tolerated and appears to be associated with, favorable outcomes In high-risk acute myeloid leukemia (AML). Blood 116, 904-904. Kile, A. C., Chavez, D. A., Bacal, J., Eldirany, S., Korzhnev, D. M., Bezsonova, I., Eichman, B. F., and Cimprich, K. A. (2015). HLTF’s Ancient HIRAN Domain Binds 3’ DNA Ends to Drive Replication Fork Reversal. Mol Cell 58, 1090-1100. Killoran, M. P., and Keck, J. L. (2006). Sit down, relax and unwind: structural insights into RecQ helicase mechanisms. Nucleic Acids Res 34, 4098-4105. Kim, N. W., Piatyszek, M. A., Prowse, K. R., Harley, C. B., West, M. D., Ho, P. L., Coviello, G. M., Wright, W. E., Weinrich, S. L., and Shay, J. W. (1994). Specific association of human telomerase activity with immortal cells and cancer. Science 266, 2011-2015. Kim, N. W., and Wu, F. (1997). Advances in quantification and characterization of telomerase activity by the telomeric repeat amplification protocol (TRAP). Nucleic Acids Res 25, 2595-2597. Kim, S. H., Beausejour, C., Davalos, A. R., Kaminker, P., Heo, S. J., and Campisi, J. (2004). TIN2 mediates functions of TRF2 at human telomeres. J Biol Chem 279, 43799-43804. Kim, S. H., Kaminker, P., and Campisi, J. (1999). TIN2, a new regulator of telomere length in human cells. Nat Genet 23, 405-412. Kipling, D. (1995). Telomerase: immortality enzyme or oncogene? Nat Genet 9, 104-106. Knight, S. W., Heiss, N. S., Vulliamy, T. J., Aalfs, C. M., McMahon, C., Richmond, P., Jones, A., Hennekam, R. C. M., Poustka, A., Mason, P. J., and Dokal, I. (1999). Unexplained aplastic anaemia, immunodeficiency, and cerebellar hypoplasia (Hoyeraal-Hreidarsson syndrome) due to mutations in the dyskeratosis congenita gene, DKC1. Br J Haematol 107, 335-339. Kocak, H., Ballew, B. J., Bisht, K., Eggebeen, R., Hicks, B. D., Suman, S., O’Neil, A., Giri, N., Maillard, I., Alter, B. P., et al. (2014). Hoyeraal-Hreidarsson syndrome caused by a germline mutation in the TEL patch of the telomere protein TPP1. Genes Dev 28, 2090-2102. Kornberg, R. D. (1974). Chromatin structure- repeating units of histones and DNA. Science 184, 868-871. Kornberg, R. D., and Thomas, J. O. (1974). Chromatin structure- oligomers of histones. Science 184, 865-868. Krams, M., Claviez, A., Heidorn, K., Krupp, G., Parwaresch, R., Harms, D., and Rudolph, P. (2001). Regulation of telomerase activity by alternate splicing of human telomerase reverse transcriptase mRNA in a subset of neuroblastomas. Am J Pathol 159, 1925-1932.

169

Kreilmeier, T., Mejri, D., Hauck, M., Kleiter, M., and Holzmann, K. (2016). Telomere Transcripts Target Telomerase in Human Cancer Cells. Genes 7, e46. Kumakura, S., Tsutsui, T. W., Yagisawa, J., Barrett, J. C., and Tsutsui, T. (2005). Reversible conversion of immortal human cells from telomerase-positive to telomerase-negative cells. Cancer Res 65, 2778-2786. Kurihara, S., Hiyama, E., Onitake, Y., Yamaoka, E., and Hiyama, K. (2014). Clinical features of ATRX and DAXX mutated neuroblastoma. J Pediatr Surg 49, 1835-1838. Kurth, I., and Gautier, J. (2010). Origin-dependent initiation of DNA replication within telomeric sequences. Nucleic Acids Res 38, 467-476. Kushner, B. H., Gilbert, F., and Helson, L. (1986). Familial neuroblastoma. Case reports, literature review, and etiologic considerations. Cancer 57, 1887-1893. Kushner, B. H., Kramer, K., Modak, S., and Cheung, N. K. (2006). Irinotecan plus temozolomide for relapsed or refractory neuroblastoma. J Clin Oncol 24, 5271-5276. Kuzminov, A. (2001). Single-strand interruptions in replicating chromosomes cause double-strand breaks. Proc Natl Acad Sci USA 98, 8241-8246. Kyte, J. A. (2009). Cancer vaccination with telomerase peptide GV1001. Expert Opin Investig Drugs 18, 687-694. Lackner, D. H., Raices, M., Maruyama, H., Haggblom, C., and Karlseder, J. (2012). Organismal propagation in the absence of a functional telomerase pathway in Caenorhabditis elegans. EMBO J 31, 2024-2033. Lam, Y. C., Akhter, S., Gu, P., Ye, J., Poulet, A., Giraud-Panis, M. J., Bailey, S. M., Gilson, E., Legerski, R. J., and Chang, S. (2010). SNMIB/Apollo protects leading-strand telomeres against NHEJ-mediated repair. EMBO J 29, 2230-2241. Lansdorp, P. M., Poon, S., Chavez, E., Dragowska, V., Zijlmans, M., Bryan, T., Reddel, R., Egholm, M., Bacchetti, S., and Martens, U. (1998). Telomeres in the haemopoietic system. In Telomeres and Telomerase, D.J. Chadwick, and G. Cardew, eds. (Chichester: John Wiley & Sons Ltd), pp. 209-218. Lau, L. M., Dagg, R. A., Henson, J. D., Au, A. Y., Royds, J. A., and Reddel, R. R. (2013). Detection of alternative lengthening of telomeres by telomere quantitative PCR. Nucleic Acids Res 41, e34. Lau, L. M. S., and Irwin, M. S. (2017). Neuroblastoma. eLS, 1-8. Laud, P. R., Multani, A. S., Bailey, S. M., Wu, L., Ma, J., Kingsley, C., Lebel, M., Pathak, S., DePinho, R. A., and Chang, S. (2005). Elevated telomere-telomere recombination in WRN-deficient, telomere dysfunctional cells promotes escape from senescence and engagement of the ALT pathway. Genes Dev 19, 2560-2570. Lee, S. S., Bohrson, C., Pike, A. M., Wheelan, S. J., and Greider, C. W. (2015). ATM kinase is required for telomere elongation in mouse and human cells. Cell Rep 13, 1623-1632.

170

Lee, J. C., Jeng, Y. M., Liau, J. Y., Tsai, J. H., Hsu, H. H., and Yang, C. Y. (2015). Alternative lengthening of telomeres and loss of ATRX are frequent events in pleomorphic and dedifferentiated liposarcomas. Mod Pathol 28, 1064-1073. Lee, J. H., and Paull, T. T. (2007). Activation and regulation of ATM kinase activity in response to DNA double-strand breaks. Oncogene 26, 7741-7748. Lehman, T. A., Modali, R., Boukamp, P., Stanek, J., Bennett, W. P., Welsh, J. A., Metcalf, R. A., Stampfer, M. R., Fusenig, N., Rogan, E. M., and Harris, C. C. (1993). P53 mutations in human immortalized epithelial cell lines. Carcinogenesis 14, 833-839. Lejnine, S., Makarov, V. L., and Langmore, J. P. (1995). Conserved nucleoprotein structure at the ends of vertebrate and invertebrate chromosomes. Proc Natl Acad Sci USA 92, 2393-2397. Lendvay, T. S., Morris, D. K., Sah, J., Balasubramanian, B., and Lundblad, V. (1996). Senescence mutants of Saccharomyces cerevisiae with a defect in telomere replication identify three additional EST genes. Genetics 144, 1399-1412. Levy, M. Z., Allsopp, R. C., Futcher, A. B., Greider, C. W., and Harley, C. B. (1992). Telomere end-replication problem and cell aging. J Mol Biol 225, 951-960. Lewis, P. W., Elsaesser, S. J., Noh, K. M., Stadler, S. C., and Allis, C. D. (2010). Daxx is an H3.3-specific histone chaperone and cooperates with ATRX in replication-independent chromatin assembly at telomeres. Proc Natl Acad Sci USA 107, 14075-14080. Li, B., Oestreich, S., and de Lange, T. (2000). Identification of human Rap1: implications for telomere evolution. Cell 101, 471-483. Li, J. S., Miralles Fuste, J., Simavorian, T., Bartocci, C., Tsai, J., Karlseder, J., and Lazzerini Denchi, E. (2017). TZAP: A telomere-associated protein involved in telomere length control. Science 355, 638-641. Li, T. K., Houghton, P. J., Desai, S. D., Daroui, P., Liu, A. A., Hars, E. S., Ruchelman, A. L., LaVoie, E. J., and Liu, L. F. (2003). Characterization of ARC-111 as a novel topoisomerase I-targeting anticancer drug. Cancer Res 63, 8400-8407. Lia, G., Praly, E., Ferreira, H., Stockdale, C., Tse-Dinh, Y. C., Dunlap, D., Croquette, V., Bensimon, D., and Owen-Hughes, T. (2006). Direct observation of DNA distortion by the RSC complex. Mol Cell 21, 417-425. Lin, A. W., Barradas, M., Stone, J. C., van Aelst, L., Serrano, M., and Lowe, S. W. (1998). Premature senescence involving p53 and p16 is activated in response to constitutive MEK/MAPK mitogenic signaling. Genes Dev 12, 3008-3019. Lin, H. K., Chen, Z., Wang, G., Nardella, C., Lee, S. W., Chan, C. H., Yang, W. L., Wang, J., Egia, A., Nakayama, K. I., et al. (2010). Skp2 targeting suppresses tumorigenesis by Arf-p53-independent cellular senescence. Nature 464, 374-379. Lindner, S., Bachmann, H. S., Odersky, A., Schaefers, S., Klein-Hitpass, L., Hero, B., Fischer, M., Eggert, A., Schramm, A., and Schulte, J. H. (2015). Absence of telomerase reverse transcriptase promoter mutations in neuroblastoma. Biomed Rep 3, 443-446.

171

Lindsey, J., McGill, N. I., Lindsey, L. A., Green, D. K., and Cooke, H. J. (1991). In vivo loss of telomeric repeats with age in humans. Mutat Res 256, 45-48. Liu, D., O’Connor, M. S., Qin, J., and Songyang, Z. (2004a). Telosome, a mammalian telomere-associated complex formed by multiple telomeric proteins. J Biol Chem 279, 51338-51342. Liu, D., Safari, A., O’Connor, M. S., Chan, D. W., Laegeler, A., Qin, J., and Songyang, Z. (2004b). PTOP interacts with POT1 and regulates its localization to telomeres. Nat Cell Biol 6, 673-680. Liu, K., Schoonmaker, M. M., Levine, B. L., June, C. H., Hodes, R. J., and Weng, N. P. (1999). Constitutive and regulated expression of telomerase reverse transcriptase (hTERT) in human lymphocytes. FASEB J 13, A619-A619. Liu, L., Bailey, S. M., Okuka, M., Munoz, P., Li, C., Zhou, L. J., Wu, C., Czerwiec, E., Sandler, L., Seyfang, A., et al. (2007). Telomere lengthening early in development. Nat Cell Biol 9, 1436-41. Liu, Y., and West, S. C. (2004). Happy Hollidays: 40th anniversary of the Holliday junction. Nat Rev Mol Cell Biol 5, 937-944. Loayza, D., Parsons, H., Donigian, J., Hoke, K., and de Lange, T. (2004). DNA binding features of human POT1: a nonamer 5’-TAGGGTTAG-3’ minimal binding site, sequence specificity, and internal binding to multimeric sites. J Biol Chem 279, 13241-13248. London, W. B., Castel, V., Monclair, T., Ambros, P. F., Pearson, A. D., Cohn, S. L., Berthold, F., Nakagawara, A., Ladenstein, R. L., Iehara, T., and Matthay, K. K. (2011). Clinical and biologic features predictive of survival after relapse of neuroblastoma: a report from the International Neuroblastoma Risk Group project. J Clin Oncol 29, 3286-3292. London, W. B., Castleberry, R. P., Matthay, K. K., Look, A. T., Seeger, R. C., Shimada, H., Thorner, P., Brodeur, G., Maris, J. M., Reynolds, C. P., and Cohn, S. L. (2005). Evidence for an age cutoff greater than 365 days for neuroblastoma risk group stratification in the Children’s Oncology Group. J Clin Oncol 23, 6459-6465. Londono-Vallejo, J. A., Der-Sarkissian, H., Cazes, L., Bacchetti, S., and Reddel, R. R. (2004). Alternative lengthening of telomeres is characterized by high rates of telomeric exchange. Cancer Res 64, 2324-2327. Look, A. T., Hayes, F. A., Shuster, J. J., Douglass, E. C., Castleberry, R. P., Bowman, L. C., Smith, E. I., and Brodeur, G. M. (1991). Clinical relevance of tumor cell ploidy and N-myc gene amplification in childhood neuroblastoma: a Pediatric Oncology Group study. J Clin Oncol 9, 581-591. Lopez de Silanes, I., Grana, O., Luigia De Bonis, M. L., Dominguez, O., Pisano, D. G., and Blasco, M. A. (2014). Identification of TERRA locus unveils a telomere protection role through association to nearly all chromosomes. Nat Commun 5, 4723. Lopez de Silanes, I., Stagno d’Alcontres, M., and Blasco, M. A. (2010). TERRA transcripts are bound by a complex array of RNA-binding proteins. Nat Commun 1, 33. Lovejoy, C. A., Li, W. D., Reisenweber, S., Thongthip, S., Bruno, J., de Lange, T., De, S., Petrini, J. H. J., Sung, P. A., Jasin, M., et al. (2012). Loss of ATRX, genome instability, and an altered DNA damage response are hallmarks of the alternative lengthening of telomeres pathway. PloS Genetics 8, 16.

172

Lu, R., Pal, J., Buon, L., Nanjappa, P., Shi, J., Fulciniti, M., Tai, Y.T., Guo, L., Yu, M., Gryaznov, S., et al. (2014). Targeting homologous recombination and telomerase in Barrett’s adenocarcinoma: impact on telomere maintenance, genomic instability and tumor growth. Oncogene 33, 1495-1505. Luciani, J. J., Depetris, D., Usson, Y., Metzler-Guillemain, C., Mignon-Ravix, C., Mitchell, M. J., Megarbane, A., Sarda, P., Sirma, H., Moncla, A., et al. (2006). PML nuclear bodies are highly organised DNA-protein structures with a function in heterochromatin remodelling at the G2 phase. J Cell Sci 119, 2518-2531. Lundberg, G., Sehic, D., Lansberg, J. K., Ora, I., Frigyesi, A., Castel, V., Navarro, S., Piqueras, M., Martinsson, T., Noguera, R., and Gisselsson, D. (2011). Alternative lengthening of telomeres—an enhanced chromosomal instability in aggressive non-MYCN amplified and telomere elongated neuroblastomas. Genes Chromosomes Cancer 50, 250-262. Lundblad, V., and Blackburn, E. H. (1993). An alternative pathway for yeast telomere maintenance rescues est1- senescence. Cell 73, 347-360. Lundblad, V., and Szostak, J. W. (1989). A mutant with a defect in telomere elongation leads to senescence in yeast. Cell 57, 633-643. Lustig, A. J. (2003). Clues to catastrophic telomere loss in mammals from yeast telomere rapid deletion. Nat Rev Genet 4, 916-923. Mac, S. M., D’Cunha, C. A., and Farnham, P. J. (2000). Direct recruitment of N-myc to target gene promoters. Mol Carcinog 29, 76-86. Makarov, V. L., Hirose, Y., and Langmore, J. P. (1997). Long G tails at both ends of human chromosomes suggest a C strand degradation mechanism for telomere shortening. Cell 88, 657-666. Makarov, V. L., Lejnine, S., Bedoyan, J., and Langmore, J. P. (1993). Nucleosomal organization of telomere-specific chromatin in rat. Cell 73, 775-787. Mallette, F. A., Gaumont-Leclerc, M. F., and Ferbeyre, G. (2007). The DNA damage signaling pathway is a critical mediator of oncogene-induced senescence. Genes Dev 21, 43-48. Marion, R. M., Strati, K., Li, H., Tejera, A., Schoeftner, S., Ortega, S., Serrano, M., and Blasco, M. A. (2009). Telomeres acquire embryonic stem cell characteristics in induced pluripotent stem cells. Cell Stem Cell 4, 141-154. Maris, J. M. (2010). Recent advances in neuroblastoma. N Engl J Med 362, 2202-2211. Maris, J. M., Hogarty, M. D., Bagatell, R., and Cohn, S. L. (2007). Neuroblastoma. Lancet 369, 2106-2120. Maris, J. M., Kyemba, S. M., Rebbeck, T. R., White, P. S., Sulman, E. P., Jensen, S. J., Allen, C., Biegel, J. A., and Brodeur, G. M. (1997). Molecular genetic analysis of familial neuroblastoma. Eur J Cancer 33, 1923-1928. Maris, J. M., Mosse, Y. P., Bradfield, J. P., Hou, C., Monni, S., Scott, R. H., Asgharzadeh, S., Attiyeh, E. F., Diskin, S. J., Laudenslager, M., et al. (2008). Chromosome 6p22 locus associated with clinically aggressive neuroblastoma. N Engl J Med 358, 2585-2593.

173

Maris, J. M., Weiss, M. J., Mosse, Y., Hii, G., Guo, C., White, P. S., Hogarty, M. D., Mirensky, T., Brodeur, G. M., Rebbeck, T. R., et al. (2002). Evidence for a hereditary neuroblastoma predisposition locus at chromosome 16p12-13. Cancer Res 62, 6651-6658. Marrone, A., Walne, A., Tamary, H., Masunari, Y., Kirwan, M., Beswick, R., Vulliamy, T., and Dokal, I. (2007). Telomerase reverse-transcriptase homozygous mutations in autosomal recessive dyskeratosis congenita and Hoyeraal-Hreidarsson syndrome. Blood 110, 4198-4205. Martinez, P., Thanasoula, M., Carlos, A. R., Gomez-Lopez, G., Tejera, A. M., Schoeftner, S., Dominguez, O., Pisano, D. G., Tarsounas, M., and Blasco, M. A. (2010). Mammalian Rap1 controls telomere function and gene expression through binding to telomeric and extratelomeric sites. Nat Cell Biol 12, 768-780. Martinez, P., Thanasoula, M., Munoz, P., Liao, C., Tejera, A., McNees, C., Flores, J. M., Fernandez-Capetillo, O., Tarsounas, M., and Blasco, M. A. (2009). Increased telomere fragility and fusions resulting from TRF1 deficiency lead to degenerative pathologies and increased cancer in mice. Genes Dev 23, 2060-2075. Mason, J. M., and Biessmann, H. (1995). The unusual telomeres of Drosophila. Trends Genet 11, 58-62. Matsuo, T., Shay, J. W., Wright, W. E., Hiyama, E., Shimose, S., Kubo, T., Sugita, T., Yasunaga, Y., and Ochi, M. (2009). Telomere-maintenance mechanisms in soft-tissue malignant fibrous histiocytomas. J Bone Joint Surg Am 91, 928-937. Matthay, K. K., Quach, A., Huberty, J., Franc, B. L., Hawkins, R. A., Jackson, H., Groshen, S., Shusterman, S., Yanik, G., Veatch, J., et al. (2009a). Iodine-131—metaiodobenzylguanidine double infusion with autologous stem-cell rescue for neuroblastoma: a new approaches to neuroblastoma therapy phase I study. J Clin Oncol 27, 1020-1025. Matthay, K. K., Reynolds, C. P., Seeger, R. C., Shimada, H., Adkins, E. S., Haas-Kogan, D., Gerbing, R. B., London, W. B., and Villablanca, J. G. (2009b). Long-term results for children with high-risk neuroblastoma treated on a randomized trial of myeloablative therapy followed by 13-cis-retinoic acid: a children’s oncology group study. J Clin Oncol 27, 1007-1013. Matthay , K. K., Villablanca , J. G., Seeger , R. C., Stram , D. O., Harris , R. E., Ramsay , N. K., Swift , P., Shimada , H., Black , C. T., Brodeur , G. M., et al. (1999). Treatment of high-risk neuroblastoma with intensive chemotherapy, radiotherapy, autologous bone marrow transplantation, and 13-cis-Retinoic Acid. N Engl J Med 341, 1165-1173. Mattsson, K., Pokrovskaja, K., Kiss, C., Klein, G., and Szekely, L. (2001). Proteins associated with the promyelocytic leukemia gene product (PML)-containing nuclear body move to the nucleolus upon inhibition of proteasome-dependent protein degradation. Proc Natl Acad Sci USA 98, 1012-1017. McEachern, M. J., and Blackburn, E. H. (1996). Cap-prevented recombination between terminal telomeric repeat arrays (telomere CPR) maintains telomeres in Kluyveromyces lactis lacking telomerase. Genes Dev 10, 1822-1834. McEachern, M. J., and Haber, J. E. (2006). Break-induced replication and recombinational telomere elongation in yeast. Annu Rev Biochem 75, 111-135.

174

Mender, I., Gryaznov, S., and Shay, J. W. (2015). A novel telomerase substrate precursor rapidly induces telomere dysfunction in telomerase positive cancer cells but not telomerase silent normal cells. Oncoscience 2, 693-695. Meyerson, M., Counter, C. M., Eaton, E. N., Ellisen, L. W., Steiner, P., Dickinson Caddle, S., Ziaugra, L., Beijersbergen, R. L., Davidoff, M. J., Liu, Q., et al. (1997). hEST2, the putative human telomerase catalytic subunit gene, is up-regulated in tumor cells and during immortalization. Cell 90, 785-795. Michaloglou, C., Vredeveld, L. C., Soengas, M. S., Denoyelle, C., Kuilman, T., van der Horst, C. M., Majoor, D. M., Shay, J. W., Mooi, W. J., and Peeper, D. S. (2005). BRAFE600-associated senescence-like cell cycle arrest of human naevi. Nature 436, 720-724. Mitchell, J. R., Wood, E., and Collins, K. (1999). A telomerase component is defective in the human disease dyskeratosis congenita. Nature 402, 551-555. Molenaar, C., Wiesmeijer, K., Verwoerd, N. P., Khazen, S., Eils, R., Tanke, H. J., and Dirks, R. W. (2003). Visualizing telomere dynamics in living mammalian cells using PNA probes. EMBO J 22, 6631-6641. Molenaar, J. J., Koster, J., Zwijnenburg, D. A., van Sluis, P., Valentijn, L. J., van der Ploeg, I., Hamdi, M., van Nes, J., Westerman, B. A., van Arkel, J., et al. (2012). Sequencing of neuroblastoma identifies chromothripsis and defects in neuritogenesis genes. Nature 483, 589-593. Monclair, T., Brodeur, G. M., Ambros, P. F., Brisse, H. J., Cecchetto, G., Holmes, K., Kaneko, M., London, W. B., Matthay, K. K., Nuchtern, J. G., et al. (2009). The International Neuroblastoma Risk Group (INRG) staging system: an INRG Task Force report. J Clin Oncol 27, 298-303. Montero, J. J., Lopez de Silanes, I., Grana, O., and Blasco, M. A. (2016). Telomeric RNAs are essential to maintain telomeres. Nat Commun 7, 12534. Montgomery, E., Argani, P., Hicks, J. L., DeMarzo, A. M., and Meeker, A. K. (2004). Telomere lengths of translocation-associated and nontranslocation-associated sarcomas differ dramatically. Am J Pathol 164, 1523-1529. Morgenstern, J. P., and Land, H. (1990). Advanced mammalian gene transfer: high titre retroviral vectors with multiple drug selection markers and a complementary helper-free packaging cell line. Nucleic Acids Res 18, 3587-3596. Moriarty, T. J., Huard, S., Dupuis, S., and Autexier, C. (2002). Functional multimerization of human telomerase requires an RNA interaction domain in the N terminus of the catalytic subunit. Mol Cell Biol 22, 1253-1265. Morin, G. B. (1989). The human telomere terminal transferase enzyme is a ribonucleoprotein that synthesizes TTAGGG repeats. Cell 59, 521-529. Mosse, Y. P., Laudenslager, M., Khazi, D., Carlisle, A. J., Winter, C. L., Rappaport, E., and Maris, J. M. (2004). Germline PHOX2B mutation in hereditary neuroblastoma. Am J Hum Genet 75, 727-730. Mosse, Y. P., Laudenslager, M., Longo, L., Cole, K. A., Wood, A., Attiyeh, E. F., Laquaglia, M. J., Sennett, R., Lynch, J. E., Perri, P., et al. (2008). Identification of ALK as a major familial neuroblastoma predisposition gene. Nature 455, 930-935.

175

Mosse, Y. P., Lim, M. S., Voss, S. D., Wilner, K., Ruffner, K., Laliberte, J., Rolland, D., Balis, F. M., Maris, J. M., Weigel, B. J., et al. (2013). Safety and activity of crizotinib for paediatric patients with refractory solid tumours or anaplastic large-cell lymphoma: a Children’s Oncology Group phase 1 consortium study. Lancet Oncol 14, 472-480. Mosse, Y. P., Lipsitz, E., Fox, E., Teachey, D. T., Maris, J. M., Weigel, B., Adamson, P. C., Ingle, M. A., Ahern, C. H., and Blaney, S. M. (2012). Pediatric phase I trial and pharmacokinetic study of MLN8237, an investigational oral selective small-molecule inhibitor of Aurora kinase A: a Children’s Oncology Group Phase I Consortium study. Clin Cancer Res 18, 6058-6064. Moyzis, R. K., Buckingham, J. M., Cram, L. S., Dani, M., Deaven, L. L., Jones, M. D., Meyne, J., Ratliff, R. L., and Wu, J. R. (1988). A highly conserved repetitive DNA-sequence, (TTAGGG)N, present at the telomeres of human-chromosomes. Proc Natl Acad Sci USA 85, 6622-6626. Muntoni, A., Neumann, A. A., Hills, M., and Reddel, R. R. (2009). Telomere elongation involves intra-molecular DNA replication in cells utilizing alternative lengthening of telomeres. Hum Mol Gen 18, 1017-1027. Murnane, J. P., and Sabatier, L. (2004). Chromosome rearrangements resulting from telomere dysfunction and their role in cancer. Bio Essays 26, 1164-1174. Murnane, J. P., Sabatier, L., Marder, B. A., and Morgan, W. F. (1994). Telomere dynamics in an immortal human cell line. EMBO J 13, 4953-4962. Murphy, D. M., Buckley, P. G., Bryan, K., Das, S., Alcock, L., Foley, N. H., Prenter, S., Bray, I., Watters, K. M., Higgins, D., and Stallings, R. L. (2009). Global MYCN transcription factor binding analysis in neuroblastoma reveals association with distinct E-box motifs and regions of DNA hypermethylation. PloS One 4, e8154. Nabetani, A., and Ishikawa, F. (2009). Unusual telomeric DNAs in human telomerase-negative immortalized cells. Mol Cell Biol 29, 703-713. Nakamura, A. J., Chiang, Y. J., Hathcock, K. S., Horikawa, I., Sedelnikova, O. A., Hodes, R. J., and Bonner, W. M. (2008). Both telomeric and non-telomeric DNA damage are determinants of mammalian cellular senescence. Epigenetics Chromatin 1, 6. Nakamura, T. M., Morin, G. B., Chapman, K. B., Weinrich, S. L., Andrews, W. H., Lingner, J., Harley, C. B., and Cech, T. R. (1997). Telomerase catalytic subunit homologs from fission yeast and human. Science 277, 955-959. Napier, C. E., Huschtscha, L. I., Harvey, A., Bower, K., Noble, J. R., Hendrickson, E. A., and Reddel, R. R. (2015). ATRX represses alternative lengthening of telomeres. Oncotarget 6, 16543-16558. Natarajan, S., Groff-Vindman, C., and McEachern, M. J. (2003). Factors influencing the recombinational expansion and spread of telomeric tandem arrays in Kluyveromyces lactis. Eukaryotic Cell 2, 1115-1127. Natarajan, S., and McEachern, M. J. (2002). Recombinational telomere elongation promoted by DNA circles. Mol Cell Biol 22, 4512-4521. Nergadze, S. G., Farnung, B. O., Wischnewski, H., Khoriauli, L., Vitelli, V., Chawla, R., Giulotto, E., and Azzalin, C. M. (2009). CpG-island promoters drive transcription of human telomeres. RNA 15, 2186-2194.

176

Neumann, A. A., Watson, C. M., Noble, J. R., Pickett, H. A., Tam, P. P., and Reddel, R. R. (2013). Alternative lengthening of telomeres in normal mammalian somatic cells. Genes Dev 27, 18-23. Nevo, I., Sagi-Assif, O., Botzer, L. E., Amar, D., Maman, S., Kariv, N., Leider-Trejo L. E., Savelyeve L., Schwab M., Yron, I., and Witz, I. P. (2008). Generation and characterisation of novel local and metastatic human neuroblastoma variants. Neoplasia 10, 817-827. Ng, L. J., Cropley, J. E., Pickett, H. A., Reddel, R. R., and Suter, C. M. (2009). Telomerase activity is associated with an increase in DNA methylation at the proximal subtelomere and a reduction in telomeric transcription. Nucleic Acids Res 37, 1152-1159. Nguyen le, B., Diskin, S. J., Capasso, M., Wang, K., Diamond, M. A., Glessner, J., Kim, C., Attiyeh, E. F., Mosse, Y. P., Cole, K., et al. (2011). Phenotype restricted genome-wide association study using a gene-centric approach identifies three low-risk neuroblastoma susceptibility Loci. PloS Genet 7, e1002026. Nickerson, H. J., Matthay, K. K., Seeger, R. C., Brodeur, G. M., Shimada, H., Perez, C., Atkinson, J. B., Selch, M., Gerbing, R. B., Stram, D. O., and Lukens, J. (2000). Favorable biology and outcome of stage IV-S neuroblastoma with supportive care or minimal therapy: a Children’s Cancer Group study. J Clin Oncol 18, 477-486. Novakova, Z., Hubackova, S., Kosar, M., Janderova-Rossmeislova, L., Dobrovolna, J., Vasicova, P., Vancurova, M., Horejsi, Z., Hozak, P., Bartek, J., and Hodny, Z. (2010). Cytokine expression and signaling in drug-induced cellular senescence. Oncogene 29, 273-284. O’Loghlen, A., Martin, N., Krusche, B., Pemberton, H., Alonso, M. M., Chandler, H., Brookes, S., Parrinello, S., Peters, G., and Gil, J. (2015). The nuclear receptor NR2E1/TLX controls senescence. Oncogene 34, 4069-4077. O’Sullivan, R. J., Arnoult, N., Lackner, D. H., Oganesian, L., Haggblom, C., Corpet, A., Almouzni, G., and Karlseder, J. (2014). Rapid induction of alternative lengthening of telomeres by depletion of the histone chaperone ASF1. Nat Struct Mol Biol 21, 167-174. O’Sullivan, R. J., Kubicek, S., Schreiber, S. L., and Karlseder, J. (2010). Reduced histone biosynthesis and chromatin changes arising from a damage signal at telomeres. Nat Struct Mol Biol 17, 1218-1225. Ogino, H., Nakabayashi, K., Suzuki, M., Takahashi, E., Fujii, M., Suzuki, T., and Ayusawa, D. (1998). Release of telomeric DNA from chromosomes in immortal human cells lacking telomerase activity. Biochemical and Biophysical Research Communications 248, 223-227. Ohali, A., Avigad, S., Ash, S., Goshen, Y., Luria, D., Feinmesser, M., Zaizov, R., and Yaniv, I. (2006). Telomere length is a prognostic factor in neuroblastoma. Cancer 107, 1391-1399. Okamoto, A., Demetrick, D. J., Spillare, E. A., Hagiwara, K., Hussain, S. P., Bennett, W. P., Forrester, K., Gerwin, B., Serrano, M., Beach, D. H., and Harris, C. C. (1994). Mutations and altered expression of p16INK4 in human cancer. Proc Natl Acad Sci USA 91, 11045-11049. Okamoto, K., Bartocci, C., Ouzounov, I., Diedrich, J. K., Yates, J. R., III, and Denchi, E. L. (2013). A two-step mechanism for TRF2-mediated chromosome-end protection. Nature 494, 502-505.

177

Olovnikov, A. M. (1971). Principle of marginotomy in template synthesis of polynucleotides. Dokl Akad Nauk SSSR 201, 1496-1499. Omori, Y., Nakayama, F., Li, D., Kanemitsu, K., Semba, S., Ito, A., and Yokozaki, H. (2009). Alternative lengthening of telomeres frequently occurs in mismatch repair system-deficient gastric carcinoma. Cancer Sci 100, 413-418. Onitake, Y., Hiyama, E., Kamei, N., Yamaoka, H., Sueda, T., and Hiyama, K. (2009). Telomere biology in neuroblastoma: telomere binding proteins and alternative strengthening of telomeres. J Pediatr Surg 44, 2258-2266. Opresko, P. L., von Kobbe, C., Laine, J. P., Harrigan, J., Hickson, I. D., and Bohr, V. A. (2002). Telomere binding protein TRF2 binds to and stimulates the Werner and Bloom syndrome helicases. J Biol Chem 277, 41110-41119. Padovan-Merhar, O. M., Raman, P., Ostrovnaya, I., Kalletla, K., Rubnitz, K. R., Sanford, E. M., Ali, S. M., Miller, V. A., Mosse, Y. P., Granger, M. P., et al. (2016). Enrichment of Targetable Mutations in the Relapsed Neuroblastoma Genome. PloS Genet 12, e1006501. Paeschke, K., Capra, J. A., and Zakian, V. A. (2011). DNA replication through G-quadruplex motifs is promoted by the Saccharomyces cerevisiae Pif1 DNA helicase. Cell 145, 678-691. Paeschke, K., Juranek, S., Simonsson, T., Hempel, A., Rhodes, D., and Lipps, H. J. (2008). Telomerase recruitment by the telomere end binding protein-b facilitates G-quadruplex DNA unfolding in ciliates. Nat Struct Mol Biol 15, 598-604. Paeschke, K., Simonsson, T., Postberg, J., Rhodes, D., and Lipps, H. J. (2005). Telomere end-binding proteins control the formation of G-quadruplex DNA structures in vivo. Nat Struct Mol Biol 12, 847-854. Park, J. R., Scott, J. R., Stewart, C. F., London, W. B., Naranjo, A., Santana, V. M., Shaw, P. J., Cohn, S. L., and Matthay, K. K. (2011). Pilot Induction Regimen Incorporating Pharmacokinetically Guided Topotecan for Treatment of Newly Diagnosed High-Risk Neuroblastoma: A Children’s Oncology Group Study. J Clin Oncol 29, 4351-4357. Park, K. H., Rha, S. Y., Kim, C. H., Kim, T. S., Yoo, N. C., Kim, J. H., Roh, J. K., Noh, S. H., Min, J. S., Lee, K. S., et al. (1998). Telomerase activity and telomere lengths in various cell lines: Changes of telomerase activity can be another method for chemosensitivity evaluation. International Journal of Oncology 13, 489-495. Parkinson, E. K. (1996). Do telomerase antagonists represent a novel anti-cancer strategy? BrJCancer 73, 1-4.

Parsons, D. W., Li, M., Zhang, X., Jones, S., Leary, R. J., Lin, J. C., Boca, S. M., Carter, H., Samayoa, J., Bettegowda, C., et al. (2011). The genetic landscape of the childhood cancer medulloblastoma. Science 331, 435-439. Peifer, M., Hertwig, F., Roels, F., Dreidax, D., Gartlgruber, M., Menon, R., Kramer, A., Roncaioli, J. L., Sand, F., Heuckmann, J. M., et al. (2015). Telomerase activation by genomic rearrangements in high-risk neuroblastoma. Nature 526, 700-704.

178

Pekmezci, M., Rice, T., Molinaro, A. M., Walsh, K. M., Decker, P. A., Hansen, H., Sicotte, H., Kollmeyer, T. M., McCoy, L. S., Sarkar, G., et al. (2017). Adult infiltrating gliomas with WHO 2016 integrated diagnosis: additional prognostic roles of ATRX and TERT. Acta Neuropathol. DOI: 10.1007/s00401-017-1690-1 Peng, Y., Mian, I. S., and Lue, N. F. (2001). Analysis of telomerase processivity: Mechanistic similarity to HIV-1 reverse transcriptase and role in telomere maintenance. Molecular Cell 7, 1201-1211. Pepe, A., and West, S. C. (2014). MUS81-EME2 promotes replication fork restart. Cell Rep 7, 1048-1055. Perrem, K., Bryan, T. M., Englezou, A., Hackl, T., Moy, E. L., and Reddel, R. R. (1999). Repression of an alternative mechanism for lengthening of telomeres in somatic cell hybrids. Oncogene 18, 3383-3390. Perrem, K., Colgin, L. M., Neumann, A. A., Yeager, T. R., and Reddel, R. R. (2001). Coexistence of alternative lengthening of telomeres and telomerase in hTERT-transfected GM847 cells. Mol Cell Biol 21, 3862-3875. Peters, A. H., O’Carroll, D., Scherthan, H., Mechtler, K., Sauer, S., Schofer, C., Weipoltshammer, K., Pagani, M., Lachner, M., Kohlmaier, A., et al. (2001). Loss of the Suv39h histone methyltransferases impairs mammalian heterochromatin and genome stability. Cell 107, 323-337. Pezzolo, A., Pistorio, A., Gambini, C., Haupt, R., Ferraro, M., Erminio, G., De Bernardi, B., Garaventa, A., and Pistoia, V. (2015). Intratumoral diversity of telomere length in individual neuroblastoma tumors. Oncotarget 6, 7493-7503. Pfeiffer, V., Crittin, J., Grolimund, L., and Lingner, J. (2013). The THO complex component Thp2 counteracts telomeric R-loops and telomere shortening. EMBO J 32, 2861-2871. Piatyszek, M. A., Kim, N. W., Weinrich, S. L., Hiyama, K., Hiyama, E., Wright, W. E., and Shay, J. W. (1995). Detection of telomerase activity in human cells and tumors by a telomeric repeat amplification protocol (TRAP). Methods Cell Sci 17, 1-15. Pickett, H. A., Cesare, A. J., Johnstone, R. L., Neumann, A. A., and Reddel, R. R. (2009). Control of telomere length by a trimming mechanism that involves generation of t-circles. EMBO J 28, 799-809. Pickett, H. A., Henson, J. D., Au, A. Y., Neumann, A. A., and Reddel, R. R. (2011). Normal mammalian cells negatively regulate telomere length by telomere trimming. Hum Mol Genet 20, 4684-4692. Pickett, H. A., and Reddel, R. R. (2012). The role of telomere trimming in normal telomere length dynamics. Cell Cycle 11, 1309-1315. Pickett, H. A., and Reddel, R. R. (2015). Molecular mechanisms of activity and derepression of alternative lengthening of telomeres. Nat Struct Mol Biol 22, 875-880. Picketts, D. J., Higgs, D. R., Bachoo, S., Blake, D. J., Quarrell, O. W. J., and Gibbons, R. J. (1996). ATRX encodes a novel member of the SNF2 family of proteins: Mutations point to a common mechanism underlying the ATR-X syndrome. Hum Mol Gen 5, 1899-1907. Plantaz, D., Mohapatra, G., Matthay, K. K., Pellarin, M., Seeger, R. C., and Feuerstein, B. G. (1997). Gain of chromosome 17 is the most frequent abnormality detected in neuroblastoma by comparative genomic hybridization. Am J Pathol 150, 81-89.

179

Pogo, B. G. T., Allfrey, V. G., and Mirsky, A. E. (1966). RNA Synthesis and histone acetylation during course of gene activation in lymphocytes. Proc Natl Acad Sci USA 55, 805-12. Polvi, A., Linnankivi, T., Kivela, T., Herva, R., Keating, J. P., Makitie, O., Pareyson, D., Vainionpaa, L., Lahtinen, J., Hovatta, I., et al. (2012). Mutations in CTC1, encoding the CTS telomere maintenance complex component 1, cause cerebroretinal microangiopathy with calcifications and cysts. Am J Hum Genet 90, 540-549. Pontecorvo, G. (1944). Structure of heterochromatin. Nature 153, 365-367. Poremba, C., Scheel, C., Hero, B., Christiansen, H., Schaefer, K. L., Nakayama, J., Berthold, F., Juergens, H., Boecker, W., and Dockhorn-Dworniczak, B. (2000). Telomerase activity and telomerase subunits gene expression patterns in neuroblastoma: a molecular and immunohistochemical study establishing prognostic tools for fresh-frozen and paraffin-embedded tissues. J Clin Oncol 18, 2582-2592. Poremba, C., Willenbring, H., Hero, B., Christiansen, H., Schafer, K. L., Brinkschmidt, C., Jurgens, H., Bocker, W., and Dockhorn-Dworniczak, B. (1999). Telomerase activity distinguishes between neuroblastomas with good and poor prognosis. Ann Oncol 10, 715-721. Porro, A., Feuerhahn, S., Reichenbach, P., and Lingner, J. (2010). Molecular dissection of telomeric repeat-containing RNA biogenesis unveils the presence of distinct and multiple regulatory pathways. Mol Cell Biol 30, 4808-4817. Potts, P. R., and Yu, H. T. (2007). The SMC5/6 complex maintains telomere length in ALT cancer cells through SUMOylation of telomere-binding proteins. Nat Struct Mol Biol 14, 581-590. Poulet, A., Buisson, R., Faivre-Moskalenko, C., Koelblen, M., Amiard, S., Montel, F., Cuesta-Lopez, S., Bornet, O., Guerlesquin, F., Godet, T., et al. (2009). TRF2 promotes, remodels and protects telomeric Holliday junctions. EMBO J 28, 641-651. Pricolo, V. E., Finkelstein, S. D., Wu, T. T., Keller, G., Bakker, A., Swalsky, P. A., and Bland, K. I. (1996). Prognostic value of TP53 and k-ras-2 mutational analysis in stage III carcinoma of the colon. Am J Surg 171, 41-46. Pryor, J. M., Waters, C. A., Aza, A., Asagoshi, K., Strom, C., Mieczkowski, P. A., Blanco, L., and Ramsden, D. A. (2015). Essential role for polymerase specialization in cellular nonhomologous end joining. Proc Natl Acad Sci USA 112, E4537-4545. Pugh, T. J., Morozova, O., Attiyeh, E. F., Asgharzadeh, S., Wei, J. S., Auclair, D., Carter, S. L., Cibulskis, K., Hanna, M., Kiezun, A., et al. (2013). The genetic landscape of high-risk neuroblastoma. Nat Genet 45, 279-284. Rai, R., Zheng, H., He, H., Luo, Y., Multani, A., Carpenter, P. B., and Chang, S. (2010). The function of classical and alternative non-homologous end-joining pathways in the fusion of dysfunctional telomeres. EMBO J 29, 2598-2610. Ramirez, R. D., Wright, W. E., Shay, J. W., and Taylor, R. S. (1997). Telomerase activity concentrates in the mitotically active segments of human hair follicles. J Invest Dermatol 108, 113-117. Rausch, T., Zichner, T., Schlattl, A., Stutz, A. M., Benes, V., and Korbel, J. O. (2012). DELLY: structural variant discovery by integrated paired-end and split-read analysis. Bioinformatics 28, i333-i339.

180

Reddel, R. R. (2000). The role of senescence and immortalization in carcinogenesis. Carcinogenesis 21, 477-484.

Reynolds, C. P., Brodeur, G. M., Tomayko, M. M., Donner, L., Helson, L., Seeger, R. C., Triche, T. .J. (1988). Biological classification of cell lines derived from human extra-cranial neural tumors. Prog Clin Biol Res. 271, 291-306.

Reynolds, C. P., Zuo, J. J., Kim, N. W., Wang, H., Lukens, J. N., Matthay, K. K., and Seeger, R. C. (1997). Telomerase expression in primary neuroblastomas. Eur J Cancer 33, 1929-1931. Riha, K., McKnight, T. D., Griffing, L. R., and Shippen, D. E. (2001). Living with genome instability: plant responses to telomere dysfunction. Science 291, 1797-1800. Ritchie, K., Seah, C., Moulin, J., Isaac, C., Dick, F., and Berube, N. G. (2008). Loss of ATRX leads to chromosome cohesion and congression defects. J Cell Biol 180, 315-324. Rivera, T., Haggblom, C., Cosconati, S., and Karlseder, J. (2017). A balance between elongation and trimming regulates telomere stability in stem cells. Nat Struct Mol Biol 24, 30-39. Robles, S. J., and Adami, G. R. (1998). Agents that cause DNA double strand breaks lead to p16INK4a enrichment and the premature senescence of normal fibrolasts. Oncogene 16, 1113-1123. Rogan, E. M., Bryan, T. M., Hukku, B., Maclean, K., Chang, A. C., Moy, E. L., Englezou, A., Warneford, S. G., Dalla-Pozza, L., and Reddel, R. R. (1995). Alterations in p53 and p16INK4 expression and telomere length during spontaneous immortalization of Li-Fraumeni syndrome fibroblasts. Mol Cell Biol 15, 4745-4753. Roos, R. A., Spengler, B. A., Biedler, J. L. (1983). Coordinate morphological and biochemical interconversion of human neuroblastoma cells. J Natl Cancer Inst 71, 741-747. Roth, A., Harley, C. B., and Baerlocher, G. M. (2010). Imetelstat (GRN163L)--telomerase-based cancer therapy. Recent Results Cancer Res 184, 221-234. Roumelioti, F. M., Sotiriou, S. K., Katsini, V., Chiourea, M., Halazonetis, T. D., and Gagos, S. (2016). Alternative lengthening of human telomeres is a conservative DNA replication process with features of break-induced replication. EMBO Rep 17, 1731-1737. Ruden, M., and Puri, N. (2013). Novel anticancer therapeutics targeting telomerase. Cancer Treat Rev 39, 444-456. Sadic, D., Schmidt, K., Groh, S., Kondofersky, I., Ellwart, J., Fuchs, C., Theis, F. J., and Schotta, G. (2015). Atrx promotes heterochromatin formation at retrotransposons. EMBO Rep 16, 836-850. Saha, A., Wittmeyer, J., and Cairns, B. R. (2002). Chromatin remodeling by RSC involves ATP-dependent DNA translocation. Genes Dev 16, 2120-2134. Saha, A., Wittmeyer, J., and Cairns, B. R. (2005). Chromatin remodeling through directional DNA translocation from an internal nucleosomal site. Nat Struct Mol Biol 12, 747-755.

181

Saharia, A., and Stewart, S. A. (2009). FEN1 contributes to telomere stability in ALT-positive tumor cells. Oncogene 28, 1162-1167. Saharia, A., Teasley, D. C., Duxin, J. P., Dao, B., Chiappinelli, K. B., and Stewart, S. A. (2010). FEN1 ensures telomere stability by facilitating replication fork re-initiation. J Biol Chem 285, 27057-27066. Sanders, R. P., Drissi, R., Billups, C. A., Daw, N. C., Valentine, M. B., and Dome, J. S. (2004). Telomerase expression predicts unfavorable outcome in osteosarcoma. J Clin Oncol 22, 3790-3797. Sarek, G., Vannier, J. B., Panier, S., Petrini, J. H., and Boulton, S. J. (2015). TRF2 recruits RTEL1 to telomeres in S phase to promote T-loop unwinding. Mol Cell 57, 1-14. Sarkar, J., Wan, B., Yin, J., Vallabhaneni, H., Horvath, K., Kulikowicz, T., Bohr, V. A., Zhang, Y., Lei, M., and Liu, Y. (2015). SLX4 contributes to telomere preservation and regulated processing of telomeric joint molecule intermediates. Nucleic Acids Res 43, 5912-5923. Sauerwald, A., Sandin, S., Cristofari, G., Scheres, S. H. W., Lingner, J., and Rhodes, D. (2013). Structure of active dimeric human telomerase. Nat Struct Mol Biol 20, 454-460. Sausen, M., Leary, R. J., Jones, S., Wu, J., Reynolds, C. P., Liu, X., Blackford, A., Parmigiani, G., Diaz, L. A., Jr., Papadopoulos, N., et al. (2013). Integrated genomic analyses identify ARID1A and ARID1B alterations in the childhood cancer neuroblastoma. Nat Genet 45, 12-17. Savage, S. A., Giri, N., Baerlocher, G. M., Orr, N., Lansdorp, P. M., and Alter, B. P. (2008). TINF2, a component of the shelterin telomere protection complex, is mutated in dyskeratosis congenita. Am J Hum Genet 82, 501-509. Scarpa, A., Chang, D. K., Nones, K., Corbo, V., Patch, A. M., Bailey, P., Lawlor, R. T., Johns, A. L., Miller, D. K., Mafficini, A., et al. (2017). Whole-genome landscape of pancreatic neuroendocrine tumours. Nature 543, 65-71. Scheel, C., Schaefer, K. L., Jauch, A., Keller, M., Wai, D., Brinkschmidt, C., van Valen, F., Boecker, W., Dockhorn-Dworniczak, B., and Poremba, C. (2001). Alternative lengthening of telomeres is associated with chromosomal instability in osteosarcomas. Oncogene 20, 3835-3844. Schleiermacher, G., Janoueix-Lerosey, I., Ribeiro, A., Klijanienko, J., Couturier, J., Pierron, G., Mosseri, V., Valent, A., Auger, N., Plantaz, D., et al. (2010). Accumulation of segmental alterations determines progression in neuroblastoma. J Clin Oncol 28, 3122-3130. Schleiermacher, G., Javanmardi, N., Bernard, V., Leroy, Q., Cappo, J., Rio Frio, T., Pierron, G., Lapouble, E., Combaret, V., Speleman, F., et al. (2014). Emergence of new ALK mutations at relapse of neuroblastoma. J Clin Oncol 32, 2727-2734. Schmidt, M. L., Lal, A., Seeger, R. C., Maris, J. M., Shimada, H., O'Leary, M., Gerbing, R. B., and Matthay, K. K. (2005). Favorable prognosis for patients 12 to 18 months of age with stage 4 nonamplified MYCN neuroblastoma: a Children's Cancer Group Study. J Clin Oncol 23, 6474-6480. Schmitt, C. A., Fridman, J. S., Yang, M., Lee, S., Baranov, E., Hoffman, R. M., and Lowe, S. W. (2002). A senescence program controlled by p53 and p16INK4A contributes to the outcome of cancer therapy. Cell 109, 335-346.

182

Schneiderman, J. I., Sakai, A., Goldstein, S., and Ahmad, K. (2009). The XNP remodeler targets dynamic chromatin in Drosophila. Proc Natl Acad Sci USA 106, 14472-14477. Schoeftner, S., and Blasco, M. A. (2008). Developmentally regulated transcription of mammalian telomeres by DNA-dependent RNA polymerase II. Nat Cell Biol 10, 228-236. Schramm, A., Koster, J., Assenov, Y., Althoff, K., Peifer, M., Mahlow, E., Odersky, A., Beisser, D., Ernst, C., Henssen, A. G., et al. (2015). Mutational dynamics between primary and relapse neuroblastomas. Nat Genet 47, 872-877. Schubeler, D., MacAlpine, D. M., Scalzo, D., Wirbelauer, C., Kooperberg, C., van Leeuwen, F., Gottschling, D. E., O'Neill, L. P., Turner, B. M., Delrow, J., et al. (2004). The histone modification pattern of active genes revealed through genome-wide chromatin analysis of a higher eukaryote. Genes Dev 18, 1263-1271. Schwab, M., Varmus, H. E., Bishop, J. M., Grzeschik, K. H., Naylor, S. L., Sakaguchi, A. Y., Brodeur, G., and Trent, J. (1984). Chromosome localization in normal human cells and neuroblastomas of a gene related to c-myc. Nature 308, 288-291. Schwartzentruber, J., Korshunov, A., Liu, X. Y., Jones, D. T., Pfaff, E., Jacob, K., Sturm, D., Fontebasso, A. M., Quang, D. A., Tonjes, M., et al. (2012). Driver mutations in histone H3.3 and chromatin remodelling genes in paediatric glioblastoma. Nature 482, 226-231. Sedelnikova, O. A., Horikawa, I., Zimonjic, D. B., Popescu, N. C., Bonner, W. M., and Barrett, J. C. (2004). Senescing human cells and ageing mice accumulate DNA lesions with unrepairable double-strand breaks. Nat Cell Biol 6, 168-170. Seeger, R. C., Brodeur, G. M., Sather, H., Dalton, A., Siegel, S. E., Wong, K. Y., and Hammond, D. (1985). Association of multiple copies of the N-myc oncogene with rapid progression of neuroblastomas. N Engl J Med 313, 1111-1116. Seimiya, H., Muramatsu, Y., Ohishi, T., and Tsuruo, T. (2005). Tankyrase 1 as a target for telomere-directed molecular cancer therapeutics. Cancer Cell 7, 25-37. Sen, D., and Gilbert, W. (1988). Formation of parallel four-stranded complexes by guanine-rich motifs in DNA and its implications for meiosis. Nature 334, 364-366. Serrano, M., Lin, A. W., McCurrach, M. E., Beach, D., and Lowe, S. W. (1997). Oncogenic ras provokes premature cell senescence associated with accumulation of p53 and p16INK4a. Cell 88, 593-602. Sfeir, A., and de Lange, T. (2012). Removal of shelterin reveals the telomere end-protection problem. Science 336, 593-597. Sfeir, A., Kabir, S., van Overbeek, M., Celli, G. B., and de Lange, T. (2010). Loss of Rap1 induces telomere recombination in the absence of NHEJ or a DNA damage signal. Science 327, 1657-1661. Sfeir, A., Kosiyatrakul, S. T., Hockemeyer, D., MacRae, S. L., Karlseder, J., Schildkraut, C. L., and de Lange, T. (2009). Mammalian telomeres resemble fragile sites and require TRF1 for efficient replication. Cell 138, 90-103.

183

Shaw, V., Naisbitt, D., Costello, E., Farrell, J., Park, B. K., Neoptolemos, J., and Middleton, G. (2010a). TeloVac trial translational studies: investigation of the immune response to GV1001. Immunology 131, 164-164. Shaw, V. E., Naisbitt, D. J., Costello, E., Greenhalf, W., Park, B. K., Neoptolemos, J. P., and Middleton, G. W. (2010b). Current status of GV1001 and other telomerase vaccination strategies in the treatment of cancer. Expert Rev Vaccines 9, 1007-1016. Shay, J. W., and Bacchetti, S. (1997). A survey of telomerase activity in human cancer. Eur J Cancer 33, 787-791. Shay, J. W., and Keith, W. N. (2008). Targeting telomerase for cancer therapeutics. Br J Cancer 98, 677-683. Shay, J. W., Pereirasmith, O. M., and Wright, W. E. (1991). A role for both Rband p53 in the regulation of human cellular senescence. Exp Cell Res 196, 33-39. Shay, J. W., Tomlinson, G., Piatyszek, M. A., and Gollahon, L. S. (1995). Spontaneous in vitro immortalization of breast epithelial cells from a patient with Li-Fraumeni syndrome. Mol Cell Biol 15, 425-432. Shay, J. W., and Wright, W. E. (1996). The reactivation of telomerase activity in cancer progression. Trends Genet 12, 129-131. Sheu, Y. J., Kinney, J. B., Lengronne, A., Pasero, P., and Stillman, B. (2014). Domain within the helicase subunit Mcm4 integrates multiple kinase signals to control DNA replication initiation and fork progression. Proc Natl Acad Sci USA 111, E1899-1908. Sheu, Y. J., Kinney, J. B., and Stillman, B. (2016). Concerted activities of Mcm4, Sld3, and Dbf4 in control of origin activation and DNA replication fork progression. Genome Res 26, 315-330. Shimada, H., Ambros, I. M., Dehner, L. P., Hata, J., Joshi, V. V., Roald, B., Stram, D. O., Gerbing, R. B., Lukens, J. N., Matthay, K. K., and Castleberry, R. P. (1999). The International Neuroblastoma Pathology Classification (the Shimada system). Cancer 86, 364-372. Shimada, H., Umehara, S., Monobe, Y., Hachitanda, Y., Nakagawa, A., Goto, S., Gerbing, R. B., Stram, D. O., Lukens, J. N., and Matthay, K. K. (2001). International neuroblastoma pathology classification for prognostic evaluation of patients with peripheral neuroblastic tumors: a report from the Children's Cancer Group. Cancer 92, 2451-2461. Simon, T., Haberle, B., Hero, B., von Schweinitz, D., and Berthold, F. (2013). Role of surgery in the treatment of patients with stage 4 neuroblastoma age 18 months or older at diagnosis. J Clin Oncol 31, 752-758. Simon, T., Hero, B., Faldum, A., Handgretinger, R., Schrappe, M., Klingebiel, T., and Berthold, F. (2011). Long term outcome of high-risk neuroblastoma patients after immunotherapy with antibody ch14.18 or oral metronomic chemotherapy. BMC Cancer 11, 21. Simon, T., Langler, A., Berthold, F., Klingebiel, T., and Hero, B. (2007). Topotecan and etoposide in the treatment of relapsed high-risk neuroblastoma: results of a phase 2 trial. J Pediatr Hematol Oncol 29, 101-106.

184

Smogorzewska, A., Karlseder, J., Holtgreve-Grez, H., Jauch, A., and de Lange, T. (2002). DNA ligase IV-dependent NHEJ of deprotected mammalian telomeres in G1 and G2. Curr Biol 12, 1635-1644. Soler, D., Genesca, A., Arnedo, G., Egozcue, J., and Tusell, L. (2005). Telomere dysfunction drives chromosomal instability in human mammary epithelial cells. Genes Chromosomes Cancer 44, 339-350. Spitz, R., Hero, B., Ernestus, K., and Berthold, F. (2003). Deletions in chromosome arms 3p and 11q are new prognostic markers in localized and 4s neuroblastoma. Clin Cancer Res 9, 52-58. Stagno d'Alcontres, M., Mendez-Bermudez, A., Foxon, J. L., Royle, N. J., and Salomoni, P. (2007). Lack of TRF2 in ALT cells causes PML-dependent p53 activation and loss of telomeric DNA. J Cell Biol 179, 855-867. Stansel, R. M., de Lange, T., and Griffith, J. D. (2001). T-loop assembly in vitro involves binding of TRF2 near the 3' telomeric overhang. EMBO J 20, 5532-5540. Stephens, P. J., Greenman, C. D., Fu, B., Yang, F., Bignell, G. R., Mudie, L. J., Pleasance, E. D., Lau, K. W., Beare, D., Stebbings, L. A., et al. (2011). Massive genomic rearrangement acquired in a single catastrophic event during cancer development. Cell 144, 27-40. Stern, J. L., Zyner, K. G., Pickett, H. A., Cohen, S. B., and Bryan, T. M. (2012). Telomerase Recruitment Requires both TCAB1 and Cajal Bodies Independently. Mol Cell Biol 32, 2384-2395. Stuart, B. D., Choi, J., Zaidi, S., Xing, C., Holohan, B., Chen, R., Choi, M., Dharwadkar, P., Torres, F., Girod, C. E., et al. (2015). Exome sequencing links mutations in PARN and RTEL1 with familial pulmonary fibrosis and telomere shortening. Nat Genet 47, 512-517. Stewart, J. A., Wang, F., Chaiken, M. F., Kasbek, C., Chastain, P. D., Wright, W. E., and Price, C. M. (2012). Human CST promotes telomere duplex replication and general replication restart after fork stalling. EMBO J 31, 3537-3549. Strother, D. R., London, W. B., Schmidt, M. L., Brodeur, G. M., Shimada, H., Thorner, P., Collins, M. H., Tagge, E., Adkins, S., Reynolds, C. P., et al. (2012). Outcome after surgery alone or with restricted use of chemotherapy for patients with low-risk neuroblastoma: results of Children's Oncology Group study P9641. J Clin Oncol 30, 1842-1848. Subhawong, A. P., Heaphy, C. M., Argani, P., Konishi, Y., Kouprina, N., Nassar, H., Vang, R., and Meeker, A. K. (2009). The alternative lengthening of telomeres phenotype in breast carcinoma is associated with HER-2 overexpression. Mod Pathol 22, 1423-1431. Sundquist, W. I., and Klug, A. (1989). Telomeric DNA dimerizes by formation of guanine tetrads between hairpin loops. Nature 342, 825-829. Takai, H., Smogorzewska, A., and de Lange, T. (2003). DNA damage foci at dysfunctional telomeres. Curr Biol 13, 1549-1556. Takai, K. K., Kibe, T., Donigian, J. R., Frescas, D., and de Lange, T. (2011). Telomere protection by TPP1/POT1 requires tethering to TIN2. Mol Cell 44, 647-659.

185

Takakura, M., Kyo, S., Kanaya, T., Hirano, H., Takeda, J., Yutsudo, M., and Inoue, M. (1999). Cloning of human telomerase catalytic subunit (hTERT) gene promoter and identification of proximal core promoter sequences essential for transcriptional activation in immortalized and cancer cells. Cancer Res 59, 551-557. Tan, A., Abecasis, G. R., and Kang, H. M. (2015). Unified representation of genetic variants. Bioinformatics 31, 2202-2204. Tanaka, M., Kyo, S., Takakura, M., Kanaya, T., Sagawa, T., Yamashita, K., Okada, Y., Hiyama, E., and Inoue, M. (1998). Expression of telomerase activity in human endometrium is localized to epithelial glandular cells and regulated in a menstrual phase-dependent manner correlated with cell proliferation. Am J Pathol 153, 1985-1991. Teixeira, M. T., Arneric, M., Sperisen, P., and Lingner, J. (2004). Telomere length homeostasis is achieved via a switch between telomerase- extendible and -nonextendible states. Cell 117, 323-335. Temime-Smaali, N., Guittat, L., Wenner, T., Bayart, E., Douarre, C., Gomez, D., Giraud-Panis, M. J., Londono-Vallejo, A., Gilson, E., Amor-Gueret, M., and Riou, J. F. (2008). Topoisomerase IIIa is required for normal proliferation and telomere stability in alternative lengthening of telomeres. EMBO J 27, 1513-1524. Thanasoula, M., Escandell, J. M., Martinez, P., Badie, S., Munoz, P., Blasco, M. A., and Tarsounas, M. (2010). p53 prevents entry into mitosis with uncapped telomeres. Curr Biol 20, 521-526. Tokutake, Y., Matsumoto, T., Watanabe, T., Maeda, S., Tahara, H., Sakamoto, S., Niida, H., Sugimoto, M., Ide, T., and Furuichi, Y. (1998). Extra-chromosome telomere repeat DNA in telomerase-negative immortalized cell lines. Biochem Biophys Res Commun 247, 765-772. Tommerup, H., Dousmanis, A., and Delange, T. (1994). Unusual chromatin in human telomeres. Mol Cell Biol 14, 5777-5785. Tong, A. S., Stern, J. L., Sfeir, A., Kartawinata, M., de Lange, T., Zhu, X. D., and Bryan, T. M. (2015). ATM and ATR signalling regulate the recruitment of human telomerase to telomeres. Cell Rep 13, 1633-1646. Topcu, Z., Nickles, K., Davis, C., and McEachern, M. J. (2005). Abrupt disruption of capping and a single source for recombinationally elongated telomeres in Kluyveromyces lactis. Proc Natl Acad Sci USA 102, 3348-3353. Trochet, D., Bourdeaut, F., Janoueix-Lerosey, I., Deville, A., de Pontual, L., Schleiermacher, G., Coze, C., Philip, N., Frebourg, T., Munnich, A., et al. (2004). Germline mutations of the paired-like homeobox 2B (PHOX2B) gene in neuroblastoma. Am J Hum Genet 74, 761-764. Tsang, A. R., Wyatt, H. D. M., Ting, N. S. Y., and Beattie, T. L. (2012). hTERT mutations associated with idiopathic pulmonary fibrosis affect telomerase activity, telomere length, and cell growth by distinct mechanisms. Aging Cell 11, 482-490. Tsutsumimoto T., Williams, P., Yoneda, T. (2014). The SK-N-AS human neuroblastoma cell line develops osteolytic bone metastases with increased angiogenesis and COX-2 expression. J Bone Onc 3, 67-76.

186

Tummala, H., Walne, A., Collopy, L., Cardoso, S., de la Fuente, J., Lawson, S., Powell, J., Cooper, N., Foster, A., Mohammed, S., et al. (2015). Poly(A)-specific ribonuclease deficiency impacts telomere biology and causes dyskeratosis congenita. J Clin Invest 125, 2151-2160.

Tweddle, D. A., Malcolm, A. J., Bown, N., Pearson, A. D., and Lunec, J. (2001). Evidence for the development of p53 mutations after cytotoxic therapy in a neuroblastoma cell line. Cancer Res 61, 8-13. Ulaner, G. A., and Giudice, L. C. (1997). Developmental regulation of telomerase activity in human fetal tissues during gestation. Mol Hum Reprod 3, 769-773. Ulaner, G. A., Hoffman, A. R., Otero, J., Huang, H. Y., Zhao, Z., Mazumdar, M., Gorlick, R., Meyers, P., Healey, J. H., and Ladanyi, M. (2004). Divergent patterns of telomere maintenance mechanisms among human sarcomas: sharply contrasting prevalence of the alternative lengthening of telomeres mechanism in Ewing's sarcomas and osteosarcomas. Genes Chromosomes Cancer 41, 155-162. Ulaner, G. A., Hu, J. F., Vu, T. H., Giudice, L. C., and Hoffman, A. R. (2001). Tissue-specific alternate splicing of human telomerase reverse transcriptase (hTERT) influences telomere lengths during human development. Int J Cancer 91, 644-649. Ulaner, G. A., Huang, H. Y., Otero, J., Zhao, Z., Ben-Porat, L., Satagopan, J. M., Gorlick, R., Meyers, P., Healey, J. H., Huvos, A. G., et al. (2003a). Absence of a telomere maintenance mechanism as a favorable prognostic factor in patients with osteosarcoma. Cancer Res 63, 1759-1763. Uringa, E. J., Lisaingo, K., Pickett, H. A., Brind'amour, J., Rohde, J. H., Zelensky, A., Essers, J., and Lansdorp, P. M. (2012). RTEL1 contributes to DNA replication, repair and telomere maintenance. Mol Biol Cell 23, 2782-2792. Valentijn, L. J., Koster, J., Zwijnenburg, D. A., Hasselt, N. E., van Sluis, P., Volckmann, R., van Noesel, M. M., George, R. E., Tytgat, G. A., Molenaar, J. J., and Versteeg, R. (2015). TERT rearrangements are frequent in neuroblastoma and identify aggressive tumors. Nat Genet 47, 1411-1414. van den Bosch, M., Bree, R. T., and Lowndes, N. F. (2003). The MRN complex: coordinating and mediating the response to broken chromosomes. EMBO Rep 4, 844-849. van Noesel, M. M., Hahlen, K., Hakvoort-Cammel, F. G., and Egeler, R. M. (1997). Neuroblastoma 4S: a heterogeneous disease with variable risk factors and treatment strategies. Cancer 80, 834-843. Van Roy, N., Laureys, G., Van Gele, M., Opdenakker, G., Miura, R., van der Drift, P., Chan, A., Versteeg, R., and Speleman, F. (1997). Analysis of 1;17 translocation breakpoints in neuroblastoma: implications for mapping of neuroblastoma genes. E J Cancer 33, 1974-1978. van Steensel, B., Smogorzewska, A., and de Lange, T. (1998). TRF2 protects human telomeres from end-to-end fusions. Cell 92, 401-413. Vannier, J. B., Pavicic-Kaltenbrunner, V., Petalcorin, M. I., Ding, H., and Boulton, S. J. (2012). RTEL1 dismantles T loops and counteracts telomeric G4-DNA to maintain telomere integrity. Cell 149, 795-806. Vannier, J. B., Sandhu, S., Petalcorin, M. I., Wu, X., Nabi, Z., Ding, H., and Boulton, S. J. (2013). RTEL1 is a replisome-associated helicase that promotes telomere and genome-wide replication. Science 342, 239-242.

187

Varley, H., Pickett, H. A., Foxon, J. L., Reddel, R. R., and Royle, N. J. (2002). Molecular characterization of inter-telomere and intra-telomere mutations in human ALT cells. Nat Genet 30, 301-305. Venteicher, A. S., Abreu, E. B., Meng, Z. J., McCann, K. E., Terns, R. M., Veenstra, T. D., Terns, M. P., and Artandi, S. E. (2009). A human telomerase holoenzyme protein required for Cajal body localization and telomere synthesis. Science 323, 644-648. Venteicher, A. S., Meng, Z. J., Mason, P. J., Veenstra, T. D., and Artandi, S. E. (2008). Identification of ATPases pontin and reptin as telomerase components essential for holoenzyme assembly. Cell 132, 945-957. Vera, E., Canela, A., Fraga, M. F., Esteller, M., and Blasco, M. A. (2008). Epigenetic regulation of telomeres in human cancer. Oncogene 27, 6817-6833. Verdun, R. E., and Karlseder, J. (2006). The DNA damage machinery and homologous recombination pathway act consecutively to protect human telomeres. Cell 127, 709-720. Vergnaud, G., and Denoeud, F. (2000). Minisatellites: mutability and genome architecture. Genome Res 10, 899-907. Viceconte, N., Dheur, M.S., Majerova, E., Pierreux, C.E., Baurain, J.F., van Baren, N., and Decottignies, A. (2017). Highly aggressive metastatic melanoma cells unable to maintain telomere length. Cell Reports 19, In press. Villa, R., Daidone, M. G., Motta, R., Venturini, L., De Marco, C., Vannelli, A., Kusamura, S., Baratti, D., Deraco, M., Costa, A., et al. (2008). Multiple mechanisms of telomere maintenance exist and differentially affect clinical outcome in diffuse malignant peritoneal mesothelioma. Clin Cancer Res 14, 4134-4140. Vogan, K., Bernstein, M., Leclerc, J. M., Brisson, L., Brossard, J., Brodeur, G. M., Pelletier, J., and Gros, P. (1993). Absence of p53 gene mutations in primary neuroblastomas. Cancer Res 53, 5269-5273. Vogelstein, B., Papadopoulos, N., Velculescu, V. E., Zhou, S., Diaz, L. A., Jr., and Kinzler, K. W. (2013). Cancer genome landscapes. Science 339, 1546-1558. Vogt, M., Haggblom, C., Yeargin, J., Christiansen-Weber, T., and Haas, M. (1998). Independent induction of senescence by p16INK4a and p21CIP1 in spontaneously immortalized human fibroblasts. Cell Growth Differ 9, 139-146. Voon, H. P., Hughes, J. R., Rode, C., De La Rosa-Velazquez, I. A., Jenuwein, T., Feil, R., Higgs, D. R., and Gibbons, R. J. (2015). ATRX plays a key role in maintaining silencing at interstitial heterochromatic loci and imprinted genes. Cell Rep 11, 405-418. Vulliamy, T., Marrone, A., Dokal, I., and Mason, P. J. (2002). Association between aplastic anaemia and mutations in telomerase RNA. Lancet 359, 2168-2170. Vulliamy, T., Marrone, A., Goldman, F., Dearlove, A., Bessler, M., Mason, P. J., and Dokal, I. (2001a). The RNA component of telomerase is mutated in autosomal dominant dyskeratosis congenita. Nature 413, 432-435.

188

Vulliamy, T. J., Knight, S. W., Mason, P. J., and Dokal, I. (2001b). Very short telomeres in the peripheral blood of patients with X-linked and autosomal dyskeratosis congenita. Blood Cells Mol Dis 27, 353-357. Wada, R. K., Seeger, R. C., Brodeur, G. M., Einhorn, P. A., Rayner, S. A., Tomayko, M. M., and Reynolds, C. P. (1993). Human neuroblastoma cell lines that express N-myc without gene amplification. Cancer 72, 3346-3354. Wan, B., Yin, J., Horvath, K., Sarkar, J., Chen, Y., Wu, J., Wan, K., Lu, J., Gu, P., Yu, E. Y., et al. (2013). SLX4 assembles a telomere maintenance toolkit by bridging multiple endonucleases with telomeres. Cell Rep 4, 861-869. Wang, J., Xie, L. Y., Allan, S., Beach, D., and Hannon, G. J. (1998). Myc activates telomerase. Genes Dev 12, 1769-1774. Wang, K., Diskin, S. J., Zhang, H., Attiyeh, E. F., Winter, C., Hou, C., Schnepp, R. W., Diamond, M., Bosse, K., Mayes, P. A., et al. (2011). Integrative genomics identifies LMO1 as a neuroblastoma oncogene. Nature 469, 216-220. Wang, R. C., Smogorzewska, A., and de Lange, T. (2004). Homologous recombination generates T-loop-sized deletions at human telomeres. Cell 119, 355-368. Watkins, N. J., Gottschalk, A., Neubauer, G., Kastner, B., Fabrizio, P., Mann, M., and Luhrmann, R. (1998). Cbf5p, a potential pseudouridine synthase, and Nhp2p, a putative RNA-binding protein, are present together with Gar1p in all H BOX/ACA-motif snoRNPs and constitute a common bipartite structure. RNA 4, 1549-1568. Watson, J. M., and Shippen, D. E. (2007). Telomere rapid deletion regulates telomere length in Arabidopsis thaliana. Mol Cell Biol 27, 1706-1715. Weinrich, S. L., Pruzan, R., Ma, L., Ouellette, M., Tesmer, V. M., Holt, S. E., Bodnar, A. G., Lichtsteiner, S., Kim, N. W., Trager, J. B., et al. (1997). Reconstitution of human telomerase with the template RNA component hTR and the catalytic protein subunit hTRT. Nat Genet 17, 498-502. Weiss, W. A., Aldape, K., Mohapatra, G., Feuerstein, B. G., and Bishop, J. M. (1997). Targeted expression of MYCN causes neuroblastoma in transgenic mice. EMBO J 16, 2985-2995. Wen, J. P., Cong, Y. S., and Bacchetti, S. (1998). Reconstitution of wild-type or mutant telomerase activity in telomerase-negative immortal human cells. Hum Mol Gen 7, 1137-1141. Wenz, C., Enenkel, B., Amacker, M., Kelleher, C., Damm, K., and Lingner, J. (2001). Human telomerase contains two cooperating telomerase RNA molecules. EMBO J 20, 3526-3534. Whitaker, N. J., Bryan, T. M., Bonnefin, P., Chang, A. C., Musgrove, E. A., Braithwaite, A. W., and Reddel, R. R. (1995). Involvement of RB-1, p53, p16INK4 and telomerase in immortalisation of human cells. Oncogene 11, 971-976. Whittle, S. B., Reyes, S., Du, M., Gireud, M., Zhang, L., Woodfield, S. E., Ittmann, M., Scheurer, M. E., Bean, A. J., and Zage, P. E. (2016). A Polymorphism in the FGFR4 Gene Is Associated With Risk of Neuroblastoma and Altered Receptor Degradation. J Pediatr Hematol Oncol 38, 131-138.

189

Wilson, J. S., Tejera, A. M., Castor, D., Toth, R., Blasco, M. A., and Rouse, J. (2013). Localization-dependent and -independent roles of SLX4 in regulating telomeres. Cell Rep 4, 853-860. Wilstermann, A. M., and Osheroff, N. (2001). Base excision repair intermediates as topoisomerase II poisons. J Biol Chem 276, 46290-46296. Wong, J. M., and Collins, K. (2006). Telomerase RNA level limits telomere maintenance in X-linked dyskeratosis congenita. Genes Dev 20, 2848-2858. Wong, L. H., McGhie, J. D., Sim, M., Anderson, M. A., Ahn, S., Hannan, R. D., George, A. J., Morgan, K. A., Mann, J. R., and Choo, K. H. A. (2010). ATRX interacts with H3.3 in maintaining telomere structural integrity in pluripotent embryonic stem cells. Genome Res 20, 351-360. Wright, W. E., Piatyszek, M. A., Rainey, W. E., Byrd, W., and Shay, J. W. (1996a). Telomerase activity in human germline and embryonic tissues and cells. Dev Genet 18, 173-179. Wright, W. E., Tesmer, V. M., Liao, M. L., and Shay, J. W. (1999). Normal human telomeres are not late replicating. Exp Cell Res 251, 492-499. Wu, C. H., van Riggelen, J., Yetil, A., Fan, A. C., Bachireddy, P., and Felsher, D. W. (2007). Cellular senescence is an important mechanism of tumor regression upon c-Myc inactivation. Proc Natl Acad Sci USA 104, 13028-13033. Wu, G. K., Lee, W. H., and Chen, P. L. (2000). NBS1 and TRF1 colocalize at promyelocytic leukemia bodies during late S/G(2) phases in immortalized telomerase-negative cells - Implication of NBS1 in alternative lengthening of telomeres. J Biol Chem 275, 30618-30622. Wu, K. J., Grandori, C., Amacker, M., Simon-Vermot, N., Polack, A., Lingner, J., and Dalla-Favera, R. (1999). Direct activation of TERT transcription by c-MYC. Nat Genet 21, 220-224. Wu, L., Multani, A. S., He, H., Cosme-Blanco, W., Deng, Y., Deng, J. M., Bachilo, O., Pathak, S., Tahara, H., Bailey, S. M., et al. (2006). Pot1 deficiency initiates DNA damage checkpoint activation and aberrant homologous recombination at telomeres. Cell 126, 49-62. Wu, N., Kong, X. D., Ji, Z. J., Zeng, W. H., Potts, P. R., Yokomori, K., and Yu, H. T. (2012a). Scc1 sumoylation by Mms21 promotes sister chromatid recombination through counteracting Wapl. Genes Dev 26, 1473-1485. Wu, P., Takai, H., and de Lange, T. (2012b). Telomeric 3' overhangs derive from resection by Exo1 and Apollo and fill-in by POT1b-associated CST. Cell 150, 39-52. Wu, P., van Overbeek, M., Rooney, S., and de Lange, T. (2010). Apollo contributes to G overhang maintenance and protects leading-end telomeres. Mol Cell 39, 606-617. Wu, W. Q., Hou, X. M., Li, M., Dou, S. X., and Xi, X. G. (2015). BLM unfolds G-quadruplexes in different structural environments through different mechanisms. Nucleic Acids Res 43, 4614-4626. Xia, J. Q., Peng, Y., Mian, I. S., and Lue, N. F. (2000). Identification of functionally important domains in the N-terminal region of telomerase reverse transcriptase. Mol Cell Biol 20, 5196-5207.

190

Xu, Y., Suzuki, Y., Ito, K., and Komiyama, M. (2010). Telomeric repeat-containing RNA structure in living cells. Proc Natl Acad Sci USA 107, 14579-14584. Xue, Y., Gibbons, R., Yan, Z., Yang, D., McDowell, T. L., Sechi, S., Qin, J., Zhou, S., Higgs, D., and Wang, W. (2003). The ATRX syndrome protein forms a chromatin-remodeling complex with Daxx and localizes in promyelocytic leukemia nuclear bodies. Proc Natl Acad Sci USA 100, 10635-10640. Yamada, T., Yoshimura, H., Shimada, R., Hattori, M., Eguchi, M., Fujiwara, T. K., Kusumi, A., and Ozawa, T. (2016). Spatiotemporal analysis with a genetically encoded fluorescent RNA probe reveals TERRA function around telomeres. Sci Rep 6, 38910. Yan, P., Benhattar, J., Coindre, J. M., and Guillou, L. (2002). Telomerase activity and hTERT mRNA expression can be heterogeneous and does not correlate with telomere length in soft tissue sarcomas. I J Cancer 98, 851-856. Yanik, G. A., Parisi, M. T., Shulkin, B. L., Naranjo, A., Kreissman, S. G., London, W. B., Villablanca, J. G., Maris, J. M., Park, J. R., Cohn, S. L., et al. (2013). Semiquantitative mIBG scoring as a prognostic indicator in patients with stage 4 neuroblastoma: a report from the Children's oncology group. J Nucl Med 54, 541-548. Yashima, K., Maitra, A., Rogers, B. B., Timmons, C. F., Rathi, A., Pinar, H., Wright, W. E., Shay, J. W., and Gazdar, A. F. (1998). Expression of the RNA component of telomerase during human development and differentiation. Cell Growth Differ 9, 805-813. Ye, J., Lenain, C., Bauwens, S., Rizzo, A., Saint-Leger, A., Poulet, A., Benarroch, D., Magdinier, F., Morere, J., Amiard, S., et al. (2010). TRF2 and apollo cooperate with topoisomerase 2a to protect human telomeres from replicative damage. Cell 142, 230-242. Ye, J. Z., and de Lange, T. (2004). TIN2 is a tankyrase 1 PARP modulator in the TRF1 telomere length control complex. Nat Genet 36, 618-623. Ye, J. Z., Hockemeyer, D., Krutchinsky, A. N., Loayza, D., Hooper, S. M., Chait, B. T., and de Lange, T. (2004a). POT1-interacting protein PIP1: a telomere length regulator that recruits POT1 to the TIN2/TRF1 complex. Genes Dev 18, 1649-1654. Ye, J. Z. S., Donigian, J. R., van Overbeek, M., Loayza, D., Luo, Y., Krutchinsky, A. N., Chait, B. T., and de Lange, T. (2004b). TIN2 binds TRF1 and TRF2 simultaneously and stabilizes the TRF2 complex on telomeres. J Biol Chem 279, 47264-47271. Ye, K., Schulz, M. H., Long, Q., Apweiler, R., and Ning, Z. (2009). Pindel: a pattern growth approach to detect break points of large deletions and medium sized insertions from paired-end short reads. Bioinformatics 25, 2865-2871. Yeager, T. R., Neumann, A. A., Englezou, A., Huschtscha, L. I., Noble, J. R., and Reddel, R. R. (1999). Telomerase-negative immortalized human cells contain a novel type of promyelocytic leukemia (PML) body. Cancer Res 59, 4175-4179. Yehezkel, S., Segev, Y., Viegas-Pequignot, E., Skorecki, K., and Selig, S. (2008). Hypomethylation of subtelomeric regions in ICF syndrome is associated with abnormally short telomeres and enhanced transcription from telomeric regions. Hum Mol Genet 17, 2776-2789.

191

Yu, A. L., Gilman, A. L., Ozkaynak, M. F., London, W. B., Kreissman, S. G., Chen, H. X., Smith, M., Anderson, B., Villablanca, J. G., Matthay, K. K., et al. (2010). Anti-GD2 antibody with GM-CSF, interleukin-2, and isotretinoin for neuroblastoma. N Engl J Med 363, 1324-1334. Yu, C. E., Oshima, J., Fu, Y. H., Wijsman, E. M., Hisama, F., Alisch, R., Matthews, S., Nakura, J., Miki, T., Ouais, S., et al. (1996). Positional cloning of the Warner's syndrome gene. Science 272, 258-262. Yu, T. Y., Kao, Y. W., and Lin, J. J. (2014). Telomeric transcripts stimulate telomere recombination to suppress senescence in cells lacking telomerase. Proc Natl Acad Sci USA 111, 3377-3382. Yui, J., Chiu, C. P., and Lansdorp, P. M. (1998). Telomerase activity in candidate stem cells from fetal liver and adult bone marrow. Blood 91, 3255-3262. Zaug, A. J., Podell, E. R., and Cech, T. R. (2005). Human POT1 disrupts telomeric G-quadruplexes allowing telomerase extension in vitro. Proc Natl Acad Sci USA 102, 10864-10869. Zeng, S., Xiang, T., Pandita, T. K., Gonzalez-Suarez, I., Gonzalo, S., Harris, C. C., and Yang, Q. (2009). Telomere recombination requires the MUS81 endonuclease. Nat Cell Biol 11, 616-623. Zeng, S., and Yang, Q. (2009). The MUS81 endonuclease is essential for telomerase negative cell proliferation. Cell Cycle 8, 2157-2160. Zhang, A., Zheng, C., Lindvall, C., Hou, M., Ekedahl, J., Lewensohn, R., Yan, Z., Yang, X., Henriksson, M., Blennow, E., et al. (2000). Frequent amplification of the telomerase reverse transcriptase gene in human tumors. Cancer Res 60, 6230-6235. Zhao, W., and Sung, P. (2015). Significance of ligand interactions involving Hop2-Mnd1 and the RAD51 and DMC1 recombinases in homologous DNA repair and XX ovarian dysgenesis. Nucleic Acids Res 43, 4055-4066. Zheng, P., Guo, Y., Niu, Q., Levy, D. E., Dyck, J. A., Lu, S., Sheiman, L. A., and Liu, Y. (1998). Proto-oncogene PML controls genes devoted to MHC class I antigen presentation. Nature 396, 373-376. Zhong, S., Salomoni, P., Ronchetti, S., Guo, A., Ruggero, D., and Pandolfi, P. P. (2000). Promyelocytic leukemia protein (PML) and Daxx participate in a novel nuclear pathway for apoptosis. J Exp Med 191, 631-640. Zhong, Z. H., Jiang, W. Q., Cesare, A. J., Neumann, A. A., Wadhwa, R., and Reddel, R. R. (2007). Disruption of telomere maintenance by depletion of the MRE11/RAD50/NBS1 complex in cells that use alternative lengthening of telomeres. J Biol Chem 282, 29314-29322. Zijlmans, J. M., Martens, U. M., Poon, S. S., Raap, A. K., Tanke, H. J., Ward, R. K., and Lansdorp, P. M. (1997). Telomeres in the mouse have large inter-chromosomal variations in the number of T2AG3 repeats. Proc Natl Acad Sci USA 94, 7423-7428.

Zou, L., and Elledge, S. J. (2003). Sensing DNA damage through ATRIP recognition of RPA-ssDNA complexes. Science 300, 1542-1548.

192

Appendices

193

Appendix I: Information Relating to Chapter 2

ATRX and DAXX sequencing was performed with the primers listed in Table A1.1. and A1.2., respectively.

The PCR conditions are listed in the subsequent tables.

Table A1.1. Primers used to Sanger sequence ATRX.

Exon PCR

product size

M13 primer Other primer PCR

Program Taq used in

PCR

35 552 ATGGTCCTGTGAATGCCATC GGCATTTAAGGGGACCAAAC 1 Taq Platinum (Invitrogen)

34 339 ACCTTGGGAAATCCCGAATA CAATGACTATCCATCCCTCCA 1 Taq Platinum (Invitrogen)

33 237 GTTGGCAAATGGAAGGATTC AGTAGGGGGTGGAGGGTACA 2 Taq Platinum (Invitrogen)

32 353 GGGTGAAAAGGGTGTTTTGT

T GCATAGGGAACCCTCAACAA 3

HotStar Taq (Qiagen)

31 372 GGTTTTAGTTTCTAGTACAGT

TGACCA GGGGAATGTGTTCCTAAAACC 1

Taq Platinum (Invitrogen)

30 500 GCAAAATTGCTGATGAGTTTT

T CATTTTATTATCCTTGAAAAAT

TCTGA 1


29 405 AAGAAATGAATTCTCTGAACT

CTTGA CCAACTTTGTTTCCCTCTCTG 1


28 329 TGATGAGCAAGGTGGAAAAT

C TGACACTGTTTTGCAACCTGA 1


27 313 AAATCCTGCTGGGATTTTTG GGGTAGTTTTGTTTCTTTTGTT

GC 1


26 392 CCCCATGGGTAGGTCTTTTT TTGCTTGTATTGGCCTAGCA 1 Taq Platinum (Invitrogen)

24-25 554 TTCCTCAGTCCTTCCTCAGC CCCCAAATACCAGAGAGCAC 3 HotStar Taq

(Qiagen)

23 289 GCTTCTCTACACTGCCAAAAG

TG TTCTGCTTCCAATAGATGCTTT 1


22 387 TTGTGGGTTTAGAAAGGGTA

AA TGCAAAACTGAAAAAGAACA

ACA 1


21 367 TGAGCATTTCATTGGGGAAT TGAAAGAGCGGGAAAGAAAA 1 Taq Platinum (Invitrogen)

20 449 TTAACCAAATACGGGAGCAG

A TTTCACAGCAGACTAAGATGA

ACC 1


19 576 GGCAAGAGGGATTAAAAGAT

GA TGGCGACATTAAGGGTGATT 1


18 387 TTGGAAATTCTGGCCGTTTA TTCCCACTGAAATATGCATCA

C 1


17 418 TCTTCAGCCCCTACGACTGT GAAGGAAAGTCCCCCTGTTC 1 Taq Platinum (Invitrogen)

16 379 CAATTGGATTTGTGGTGTGG CCACCCCACTCACCAATTTA 1 Taq Platinum (Invitrogen)

194

15 503 TCTTCCACCTTTTCCTGCTG AGGCTGGGTGTGTTGACTC 3 HotStar Taq

(Qiagen)

14 398 TGGAACAGAGAGGTAACAGC

A AACAAACCTCCCCTCAGGAT 1


13 245 TGCTCTGTTTTAATGTCGAGT

CA TGAAGGCATGGTCATTCAGA 1


12 314 CAGCTTCCCAAAGTGCTAGG CGAGGCATTTTAAAGGCTGA 3 HotStar Taq

(Qiagen)

11 391 TCTATTGGCACATTTATTTCT TTGGCCTCCCAAAGTCCTGAG

ATT 1


10 343 TTTGGAGTCCAGAGTTTAGA

CC AACTTGCAGGAAGACTGTGA

GCGA 1


9(g) 493 CATCTGATGCTGAGGAAAGT

TCTG GAGATCCCTGATACTGAATAC

TAGC 1


9(f) 649 TGAATCTTCATCTGATGGCAC

TGA TTTCTGTTCATCGCTGCTTCCC

TC 2


9(e) 640 AGGAATGGATAATCAAGGGC

ACA TCCTTTCCCTGTTGACTTCTCA

GC 1


9(d) 655 GGATAAGCGTAATTCTTCTGA

CAGTGC AGCACTTGCTTGCTGCTTCTTA

GG 1


9(c) 777 CCGGTGGTGAACATAAGAAA

TCTG AACTGTGACTCATCCTGCTCA

CCT 4


9(b) 663 CTTGTTCAGTTCCACTGCTGC

CAT CCTGTTCTGGCTCTGTAACCT

ACT 1


9(a) 742 CCAATGCAAGATGAGCCTTC GAGTAAGCAGATGACCTAAA

TTACCAC 1


8 226 CACACCAGTGTCCTGGAGAT

TT AGGAAACACTGAATGTTAGCT

CATCT 1


7 415 TGCCAAGGTTGTCATGTGCTT

AG GAAGTCTTCCAAGGGCAGAT

ACCA 1


6 276 CCAGCAATGTTGGCTTTATCT

GAACTG AAGCACATCCGATTTTCCAA 1


5 348 TTCCTTGTTGAGACCCACTGC

TCA GCCATGTTTGGTCGTTTGTAC

ATAGT 1


4 219 GCTAATTGTAGGGATGCCGT

TTCG CTCAGAATAGTGGTTGACATG

AGTTCAG 1


3 259 AGTGTGAGAATGGGTTTGTG

GAGT TGGGTATCAGTAGCCTTCGAC

ACA 1

HotStar Taq (Qiagen)

2 424 GGGCTTCTATAAAGCTTGCTA

ATCTGTC ACACCCACAACTGTAACATTT

CCC 1


1 418 TGTGCTTTGGAGGAGGTAGC

CAAT TAAGCAACACACAGGCCTAAC

CCA 1


M13 primer: refers to the addition of the M13 sequence (5’ -GTAAAACGACGGCCAGT- 3’) at the 5’ end of the

listed primer.

195

Table A1.2. Primers used to Sanger sequence DAXX.

Exon PCR

product size

M13 primers Other primers PCR

Program PCR Master Mix

8 409 GTGCCACATCCTGTCTCTTCC GGGACAGCTAATGCCAATCTG 5 Taq Platinum (Invitrogen)

7 404 AAGAGACAGGATGTGGCACG GTCTGCTGGGAGAGACTGGAC 2 Taq Platinum (Invitrogen)

6(b) 466 TCTCCCAGCAGACTCAGTTCC CAAAGGACGCATAGTGTCACC 2 Taq Platinum (Invitrogen)

6(a) 534 CAAGGGAACATTCTCCTCACC CGCCTCCATTGAAGGAAGTAG 1 Taq Platinum (Invitrogen)

5 383 GAGTCCAGGTTGACTGATGGG GAAAGGTTTCAAACAGGTGGC 2 Taq Platinum (Invitrogen)

4 397 ATGTCAGGTATGAGGCGGATG CATCAGTCAACCTGGACTCCC 2 Taq Platinum (Invitrogen)

3(d) 576 GTCAGAGCACTCAGCCCTTG GTAAGCTGATCCGCCTCTTTG 2 Taq Platinum (Invitrogen)

3(c) 543 TAACCCTCCCACACACCTCTC TGGCAGCCAAAGTTGTAGATG 1 Taq Platinum (Invitrogen)

3(b) 553 CGCCTGTTAACCTCTGGGTAG CATTCCTCTATAACCGGCAGC 1 Taq Platinum (Invitrogen)

3(a) 502 CAGAGGAAGCAGTAGTTCGGG AGGTGTGTGGGAGGGTTATTC 6 Taq Platinum (Invitrogen)

2 443 GGGTTAGTGGGAAAGAAAGG

AC GGGCTGGATGTTACTGAAACC 6


196

Table A1.3. PCR cycling conditions for program 1.





Extension 70°C 1 min




1 cycle Extension 72°C 10 mins











197





Annealing

58.5°C

-0.5°C from

annealing temp

every 3 cycles

45 sec
















198





















199

Appendix II: Data Pertaining to Chapter 4

Table A2.1. Characteristics of high-risk NB ALT tumours (n=36).

Sample

ID

Gen

der

MYCN

Age

Dx

(Yr)

Outcome

(Yr)

Telomere

Content

(Arbitrary

Unit)

Telomere

Content

Group

C-circle

Assay

Product

(Arbitrary

Unit)

C-circle

Assay

Classification

TRF

(kb)

Telomerase

Activity

CHW 21 F NA 4.49

DOD

(2.96yr) 68.7 long 106 + ND -

CHW 27 F NA 4.04

DOD

(2.1yr) 19.1 long 43.0 + ND +

CHW 3 F NA 3.65

DOD

(2.62yr) 16.7 long 41.0 + 28.3 ND

NB 157 M NA 4.24

DOD

(3.6yr) 72.1 long 134 + ND ND

NB 31 F NA 2.78

DOD

(4.24yr) 60.5 long 1311 + ND ND

NB 71 M NA 4.08

DOD

(1.32yr) 43.5 long 38.7 + ND ND

NB 74 F NA 3.44

OS

(2.77yr) 27.9 long 666 + ND ND

NB 8 F NA 5.41

DOD

(1.63yr) 20.2 long 249 + ND ND

NB 92 F NA 4.49

DOD

(2.96yr) 75.7 long 54.7 + ND ND

PAHSVL M NA 6.7

DOD

(7.62yr) 16.02 long 111 + 11.0 -

PAIHWT F NA 4.2

DOD

(4.27yr) 28.27 long 129 + 11.1 +

PAISZV M NA 5.1

OS

(5.35yr) 65.89 long 125 + 22.0 -

PAIUTE M NA 5.5

DOD

(4.01yr) 75.32 long 14.8 + 22.0 +

PAPKXS M NA 6.98

OS

(5.4yr) 17.57 long 15.1 + 18.4 +

PAPNHR M NA 3.6

OS

(5.08yr) 15.92 long 36.0 + 1.9 -

PAPTAN F NA 4.0

OS

(5.61yr) 26.45 long 141 + 19.9 -

PAPUWY

M

NA

5.4

DOD

(2.98yr)

23.85

long

16.0

+

19.3

+

PARACS F NA 3.2

OS

(3.61yr) 15.03 long 341 + ND ND

200

PARASL M NA 4.4

DOD

(0.53yr) 34.04 long 25.0 + 24.1 +

PARBGT F NA 2.6

DOD

(2.74yr) 29.58 long 14.0 + ND ND

PARKNP M NA 8.8

DOD

(1.75yr) 20.87 long 1149 + 20.2 -

PARYM

N M NA 4.4

DOD

(2.95yr) 42.07 long 462 + ND ND

PASAAN F NA 4.2

OS

(3.76yr) 16.39 long 348 + 24.8 +

PASJRH F NA 7.04

DOD

(3.33yr) 21.82 long 26.3 + 23.1 +

PASPIJ F NA 8.2

OS

(2.81yr) 18.86 long 11.2 + 29.2 -

PASRTR F NA 4.4

OS

(2.6yr) 18.08 long 7.6 + ND ND

PASVYG M NA 5.1

OS

(2.3yr) 23.94 long 45.8 + ND ND

CHW 24 F NA 2.69

DOD

(5.03yr) 14.1 short 249 + ND +

CHW 25 F NA 3.59

OS

(11.72yr) 12.7 short 111 + ND -

PALRGK M NA 5.4

DOD

(2.52yr) 13.84 short 104 + 17.0 +

PAMHM

K M NA 5.7

DOD

(3.18yr) 13.61 short 47.5 + 18.3 -

PANLET M NA 5.4

DOD

(3.32yr) 8.07 short 29.5 + 9.0 +

PANRVJ F NA 13.1

OS

(6.19yr) 5.30 short 41.7 + 9.8 -

PANUIF M NA 6.1

OS

(6.22yr) 7.21 short 14.5 + ND ND

PARVLK M NA 16.5

DOD

(2.36yr) 7.91 short 219 + 12.7 -

PASWLY F NA 2.7

OS

(2.72yr) 12.17 short 166 + 14.6 +

F = female NA = Not Amplified DOD = Died of Disease

M = male Yr = year OS = Overall survival

A= Amplified

ND = not determined

DX = Diagnosis

201

Table A2.2. Characteristics of high-risk MYCN amplified NB tumours (n=55).

Sample

ID Gen

der

MYCN

Age

Dx

(yr)

Outcome

(yr)

Telomere

Content

(Arbitrary

Unit)

Telomere

Content

Group

C-circle

Assay

Product

(Arbitrary

Unit)

C-circle

Assay

Classification

TRF

(kb)

Telomerase

Activity

CHW 7 F A 1.71

OS

(7.33yr) 18.2 long 1.4 - ND ND

NB 114 M A 1.73

DOD

(1.28yr) 18.1 long 0.0 - ND ND

NB 195 M A 2.27

DOD

(1.28yr) 23.6 long 0.0 - ND ND

NB 45 F A 3.75

DOD

(1.56yr) 20.4 long 0.0 - ND ND

PAKPHB M A 0.4

OS

(4.25yr) 35.25 long 0.0 - ND ND

PAPWFY F A 2.1

DOD

(2.75yr) 25.55 long 0.0 - ND ND

PARYXW F A 6.0

DOD

(1.17yr) 43.20 long 1.5 - ND ND

CHW 12 M A 1.78

DOD

(1.64yr) 10.8 short 0.0 - 14.9 ND

CHW 13 M A 0.78

DOD

(0.44yr) 6.5 short 0.0 - 10.4 ND

CHW 15 F A 1.96

DOD

(0.87yr) 4.7 short 0.0 - 8.6 ND

CHW 16 F A 2.19

OS

(5.54yr) 7.3 short 0.1 - 11.4 ND

CHW 2 F A 1.59

OS

(7.41yr) 9.1 short 1.3 - 11.9 ND

CHW 20 F A 2.51

OS

(4.98yr) 11.1 short 0.0 - ND ND

CHW 8 F A 1.32

OS

(5.62yr) 3.4 short 0.0 - 11.7 ND

NB 149 F A 1.11

OS

(8.33yr) 2.5 short 0.6 - ND ND

NB 166 F A 5.43

DOD

(1.09yr) 13.4 short 0.0 - ND ND

NB 169 F A 0.44

DOD

(0.66yr) 13.2 short 0.0 - ND ND

NB 171 M A 2.93

DOD

(0.61yr) 7.6 short 0.0 - ND ND

NB 172 F A 2.39

DOD

(0.65yr) 3.4 short 0.0 - ND ND

NB 23

F

A

2.01

OS

(9.33yr)

7.3

short

0.3

-

ND

ND

202

NB 40 F A 0.64

DOD

(0.05yr) 2.9 short 1.6 - ND ND

NB 43 F A 5.81

DOD

(0.86yr) 12.3 short 0.5 - ND ND

NB 44 F A 1.55

OS

(6.76yr) 3.3 short 0.0 - ND ND

NB 48 F A 0.73

DOD

(0.69yr) 9.7 short 0.0 - ND ND

NB 51 M A 1.22

DOD

(0.95yr) 2.5 short 0.0 - ND ND

NB 53 F A 1.51

DOD

(2.15yr) 3.0 short 0.3 - ND ND

NB 56 M A 1.38

DOD

(1.26yr) 8.0 short 0.0 - ND ND

NB 6 F A 1.41

DOD

(0.5yr) 14.0 short 0.0 - ND ND

NB 98 M A 0.91

DOD

(0.63yr) 10.0 short 0.0 - ND ND

PAKNYZ F A 1.7

DOD

(0.41yr) 4.44 short 0.0 - ND ND

PAKPXS M A 3.0

DOD

(0.07yr) 2.53 short 0.12 - ND ND

PALHHT F A 1.6

OS

(9.97yr) 2.09 short 0.27 - ND ND

PALUVT F A 2.4

DOD

(3.18yr) 4.17 short 0.72 - ND ND

PALZMB F A 0.8

DOD

(0.53yr) 2.29 short 0.18 - ND ND

PAMRAA F A 0.4

DOD

(0.5yr) 5.04 short 0.0 - ND ND

PANHRZ 1 A 4.1

OS

(6.86yr) 1.82 short 0.42 - ND ND

PANLTR F A 1.2

DOD

(0.41yr) 9.62 short 1.5 - ND ND

PAPRHX F A 10.1

DOD

(1.01yr) 5.30 short 0.82 - ND ND

PAPRPR M A 1.7

DOD

(4.32yr) 2.31 short 0.19 - ND ND

PAPRXW F A 2.4

OS

(5.62yr) 2.03 short 0.0 - ND ND

PARELJ F A 0.3

OS

(4.3yr) 6.75 short 0.26 - ND ND

PARETE

F

A

1.9

DOD

(0.7yr)

4.47

short

0.02

-

ND

ND

203



A= Amplified

ND = not determined

DX = Diagnosis

PARHDE F A 2.3

DOD

(1.3yr) 5.79 short 0.41 - ND ND

PARSCY M A 1.4

DOD

(0.64yr) 9.62 short 1.1 - ND ND

PARSUF F A 1.3

DOD

(1.02yr) 1.51 short 0.07 - ND ND

PARVVM F A 0.9

DOD

(0.83yr) 4.89 short 0.0 - ND ND

PARXBV M A 3.6

DOD

(1.32yr) 8.25 short 0.0 - ND ND

PARYRE M A 3.2

OS

(4.11yr) 4.38 short 0.29 - ND ND

PASBTL F A 1.3

DOD

(0.61yr) 3.80 short 0.42 - ND ND

PASFKX F A 0.7

OS

(3.01yr) 2.10 short 0.23 - ND ND

PASLXS M A 2.4

DOD

(0.33yr) 2.38 short 0.24 - ND ND

PASTGD F A 2.5

DOD

(1.5yr) 4.12 short 0.43 - ND ND

PASWFB M A 2.0

DOD

(0.2yr) 2.10 short 0.54 - ND ND

PASYIP F A 2.3

DOD

(0.6yr) 3.07 short 0.86 - ND ND

PASZPI F A 1.8

OS

(2.3yr) 9.61 short 0.32 - ND ND

204

Table A2.3. Characteristics of high-risk ALT-negative/long telomere NB tumours (n=17).

Sample

ID Gen

der

MYCN

Age

Dx

(yr)

Outcome

(yr)

Telomere

Content

(Arbitrary

Unit)

Telomere

Content

Group

C-circle

Assay

Product

(Arbitrary

Unit)

C-circle

Assay

Classification

TRF

(kb)

Telomerase

Activity

CHW 11 F NA 3.81

OS

(14.54yr) 22.3 long 3.8 - 24.3 -

CHW 9 F NA 4.67

DOD

(2.78yr) 21.1 long 2.3 - 36.3 -

NB 128 F NA 4.45

DOD

(1.74yr) 27.3 long 0.0 - ND ND

NB 19 F NA 3.29

OS

(11.98yr) 16.1 long 0.0 - ND ND

NB 3 F NA 3.05

DOD

(1.27yr) 19.4 long 0.0 - ND ND

NB 36 F NA 5.65

OS

(9.49yr) 15.2 long 0.0 - ND ND

NB 4 F NA 3.83

OS

(10.63yr) 73.5 long 0.0 - ND ND

NB 60 F NA 1.26

OS

(7.38yr) 18.3 long 0.5 - ND ND

NB 70 F NA 2.43

DOD

(3.71yr) 36.8 long 0.0 - ND ND

NB 95 M NA 5.30

OS

(12.5yr) 17.8 long 1.4 - ND ND

PAIDDG F NA 9.4

DOD

(2.5yr) 31.64 long 5.7 - ND ND

PAIFXV M NA 5.5

DOD

(3.04yr) 20.68 long 1.5 - 18.7 -

PALPYT F NA 5.8

OS

(9.75yr) 50.67 long 0.0 - ND ND

PAMFUX M NA 3.6

DOD

(4.52yr) 24.22 long 2.7 - ND ND

PAMTPS F NA 11.2

DOD

(5.23yr) 18.08 long 4.0 - ND ND

PARXFT F NA 5.1

OS

(2.05yr) 69.95 long 6.6 - 24.5 -

PATHVK M NA 5.8

OS

(2.0yr) 52.55 long 0.0 - ND ND



A= Amplified

ND = not determined

DX = Diagnosis

205

Table A2.4. Characteristics of high-risk MYCN non-amplified/short telomere NB tumours (n=41).

Sample

ID Gen

der

MYCN

Age

Dx

(yr)

Outcome

(yr)

Telomere

Content

(Arbitrary

Unit)

Telomere

Content

Group

C-circle

Assay

Product

(Arbitrary

Unit)

C-circle

Assay

Classification

TRF

(kb)

Telomerase

Activity

CHW 22 M NA 2.00

OS

(15.93yr) 2.9 short 1.5 - ND +

CHW 23 F NA 1.47

OS

(11.06yr) 2.5 short 0.2 - ND +

CHW 26 F NA 1.25

OS

(9.7yr) 4.2 short 0.0 - ND +

CHW 4 F NA 3.69

DOD

(2.47yr) 7.1 short 1.0 - 13.2 ND

NB 112 M NA 1.99

OS

(5.48yr) 7.4 short 5.0 - ND ND

NB 12 F NA 2.12

OS

(3.67yr) 9.4 short 0.5 - ND ND

NB 140 F NA 3.46

DOD

(0.78yr) 6.6 short 1.4 - ND ND

NB 17 M NA 3.59

DOD

(0.6yr) 5.7 short 1.4 - ND ND

NB 174 F NA 3.44

DOD

(1.07yr) 13.8 short 0.8 - ND ND

NB 198 F NA 4.18

DOD

(0.37yr) 2.7 short 0.0 - ND ND

NB 216 F NA 1.97

OS

(4.65yr) 6.1 short 0.0 - ND ND

NB 217 F NA 2.88

DOD

(0.97yr) 9.4 short 0.0 - ND ND

NB 226 M NA 3.99

DOD

(3.2yr) 5.9 short 1.3 - ND ND

NB 24 M NA 2.41

DOD

(1.68yr) 9.1 short 1.5 - ND ND

NB 25 M NA 6.63

DOD

(0.67yr) 5.4 short 0.0 - ND ND

NB 65 M NA 2.72

DOD

(5.71yr) 6.2 short 0.8 - ND ND

NB 77 F NA 1.55

DOD

(2.42yr) 6.3 short 1.8 - ND ND

NB 78 F NA 1.78

OS

(3.17yr) 4.6 short 0.0 - ND ND

PAHVCS M NA 1.2

OS

(5.52yr) 7.17 short 1.1 - 8.5 +

206

PAHXUD

M

NA

1.4

DOD

(3.24yr) 5.10 short 0.0 - 6.6 +

PAILRI M NA 1.2

OS

(8.25yr) 3.70 short 0.0 - 9.5 +

PALKNC M NA 1.0

OS

(1.77yr) 3.26 short 0.0 - 9.1 +

PALSRF F NA 1.0

OS

(8.96yr) 3.44 short 0.0 - 10.2 -

PAMHFI F NA 1.1

OS

(5.91yr) 6.20 short 0.0 - 8.7 -

PAMPXA F NA 1.9

OS

(7.39yr) 3.64 short 0.20 - ND ND

PAMRTG F NA 1.4

OS

(7.65yr) 8.86 short 1.5 - ND ND

PAMYBA F NA 12.6

DOD

(1.48yr) 3.63 short 0.34 - ND ND

PANHVF F NA 6.6

DOD

(3.56yr) 0.93 short 0.0 - 4.1 +

PAPFSL M NA 6.0

DOD

(0.61yr) 2.87 short 0.0 - 9.4 +

PAPMUT F NA 2.7

OS

(5.25yr) 5.30 short 1.1 - ND ND

PAPRGH M NA 1.2

OS

(5.14yr) 4.60 short 0.0 - 6.5 -

PAPZFW F NA 3.7

OS

(4.61yr) 2.13 short 0.80 - ND ND

PARADX F NA 4.4

DOD

(0.5yr) 5.39 short 0.32 - ND ND

PARGIW F NA 3.2

OS

(4.69yr) 2.37 short 0.56 - 9.1 +

PARNNG F NA 3.7

OS

(4.65yr) 3.69 short 0.0 - ND ND

PARRLH M NA 3.6

DOD

(1.48yr) 4.27 short 0.06 - ND ND

PASHVB M NA 5.1

OS

(3.17yr) 7.28 short 0.0 - 12.1 +

PASJNY M NA 3.4

DOD

(1.22yr) 5.41 short 0.0 - 7.9 +

PASLUP M NA 4.5

DOD

(2.53yr) 2.28 short 0.01 - 5.5 +

PASRII M NA 2.3

DOD

(1.8yr) 5.04 short 0.59 - ND ND

PASUCB F NA 2.8

OS

(2.45yr) 2.98 short 0.0 - 13.8 -

207



A= Amplified

ND = not determined

DX = Diagnosis

208

Table A2.5. Genes examined by whole genome sequencing.

Name Entrez ID Summary Synonym

ABL1 25

Protein tyrosine kinase involved in a

variety of cellular processes, including

cell division, DNA damage response,

adhesion, differentiation, and response

to stress, SWI/SNF complex JTK7, P150

ACD 65057 Shelterin protein TINT1, TPP1

ACTL6A 86

Required for SMARCA4/BRG1/BAF190A

containing remodelling complex BAF

with chromatin/nuclear matrix. BAF53A, INO80K

ACTL6B 51412 Role in remodelling mononucleosomes BAF53B

AIM2 9447

Recognises cytosolic dsDNA, putative

role in tumorigenic reversion and may

control cell proliferation. PYHIN4

AKT1 207

Regulates many processes including

metabolism, proliferation, cell survival,

growth and angiogenesis.

ALKBH 8846 DNA repair gene

ALKBH2 121642 DNA repair gene

APEX1 328

Role in the cellular response to

oxidative stress.

APITD1 378708

Involved in DNA damage and repair

(involved in Fanconi anaemia)

APTX 54840 Editing and processing nucleases aprataxin

ARID1A 8289 SWI/SNF complex SMARCF, C1orf4

ARID1B 57492 Involved in chromatin remodelling

ARID3A 1820 Transcription factor

209

ASF1A 25842 Histone chaperone HAsf1, HCIA, HSPC146

ASF1B 55723

Member of the H3/H4 family of histone

chaperone proteins HAsf1b

ASH1L 55870 Histone methyltransferase

ASH1, KMT2H,

KIAA1420

ASH2L 9070

Component of the Set1/Ash2 histone

methyltransferase (HMT) complex ASH2L1, Bre2

ASXL1 171023

Transcription coactivator activity,

chromatin modifier KIAA0978, MDS, BOPS

ATM 472 DNA damage response ATA, ATDC, ATC, ATD

ATP5C1 509 Subunit of mitochondrial ATP synthase. ATP5CL1, ATP5C

ATR 545 Conserved DNA damage response gene MEC1, FRP1

ATRIP 84126 Conserved DNA damage response gene AGS1

ATRX 546 Chromatin Modifier/epigenetic

remodeller RAD54, JMS, MRX52

BARD1 580

DNA damage repair, ubiquitination and

transcriptional regulation

BAZ1A 11177

Chromatin Modifier/epigenetic

remodeller WCRF18, HACF10

BAZ1B 9031


remodeller

WSTF, WBSCR10,

WBSCR9

BCCIP 56647 DNA repair and cell cycle TOK1

BCL2 596 Apoptosis Bcl-2, PPP1R50

BLM 641 DNA helicase RECQL3, RECQ2

BMI1 648


remodeller PCGF4, RNF51

210

BRCA1 672

Role in maintaining genomic stability,

and it also acts as a tumour suppressor. FANCS

BRCA2 675

Involved in double-strand break repair

and/or homologous recombination. FANCD1

BRD2 6046

Chromatin Modifier, transcriptional

regulator KIAA9001, RING3

BRD4 23476 Chromatin/epigenetic remodeller HUNKI, MCAP

BRINP1 1620

Involved in cell cycle and cell death

pathways

DBC1, DBCCR1,

FAM5A

BRIP1 83990 DNA-dependent ATPase FANCJ

BTAF1 9044 Regulates transcription MOT1

CABIN1 23523

Involved in replication-independent

chromatin assembly. PPP3IN, KIAA0330

CARM1 10498 Chromatin regulation PRMT4

CBX1 10951 Component of heterochromatin. CBX, M31, HP1Hsbeta

CBX2 84733 Involved in chromatin regulation CDCA6, SRXY5

CBX3 11335

Binds DNA and is a component of

heterochromatin.

CBX5 23468 Component of heterochromatin HP1A

CCAR2 23468

Protein is enriched in the

heterochromatin and associated with

centromeres. HEL25

CCNH 902 Transcription P34, P37, CycH, CAK

CCNO 10309 Cell cycle CCNU, UDG2, CILD29

CCNT1 904 Transcription HIVE1, CCNT, CYCT1

CDC25A 993 Cell cycle CDC25A2

211

CDC25B 994 Cell cycle CDC25HU2

CDK2 1017 Cell cycle P33(CDK2)

CDK7 1022

Cell cycle, transcription initiating, DNA

repair gene CAK, STK1

CDKN1A 1026 Cell cycle, DNA repair gene

CDKN1, P21, WAF1,

MDA-6, CAP20

CENPA 1058 Chromatin CENP-A

CENPT 80152 Chromatin C16orf56, ICEN22

CEP164 22897

Involved in microtubule organization,

DNA damage response, and

chromosome segregation.

Cep164,

NPHP15, KIAA1052

CHAF1A 10036

Involved in DNA replication and DNA

repair. CAF1

CHD1 1105


remodeller CHD-1

CHD2 1106


remodeller CHD-2, EEOC

CHD3 1107

NuRD (nucleosome remodelling and

histone deacetylation)

Mi2-ALPHA, ZFH, CHD-

3

CHD4 1108

NuRD (nucleosome remodelling and

histone deacetylation) Mi2-BETA, CHD-4

CHD7 55636

Chromatin regulator, transcription

regulator CRG, KAL5

CHD8 57680 Chromatin remodeller HELSNF1, AUTS18

CHEK1 1111 Conserved DNA damage response gene CHK1

CHEK2 11200 Conserved DNA damage response gene RAD53, CHK2

CHFR 55743 Cell Cycle RNF116, RNF196

212

CHTF18 63922 Cell replication

C16orf41, RUVBL,

CHL12

CLK2 1196 Transcription

CLOCK 9575 Transcription KAT13D, KIAA0334

CLSPN 63967 Cell cycle, DNA damage

CREBBP 1387

Chromatin regulator, transcription

factor RSTS, KAT3A

CTBP1 1487 Transcription regulator BARS

CTCF 10664 Chromatin regulator MRD21

CTCFL 140690 DNA binding protein CT27, HMGB1L1

CTDP1 9150 Involved in initiation of translation CCFDN, FCP1

CTR9 9646 Chromatin regulation SH2BP1, TSBP, P150

DAXX 1616 Chromatin remodeller DAP6, EAP1, BING2

DBF4B 80174 Roll in DNA replication and proliferation

ASKL1, DRF1, CHIFB,

ZDBF1B

DCLRE1A 9937

Required for DNA inter-strand cross-link

repair and cell cycle arrest

SNM1, PSO2, HSNM1,

HSNM1A, KIAA0086

DCLRE1B 64858

Involved in t-loop formation, telomere

replication and DNA damage

SNM1B, APOLLO,

HSNM1B

DCLRE1C 64421 Involved in DNA damage repair

SCIDA, ARTEMIS,

HSNM1C, DCLREC1C

DDB1 1642 Required for DNA repair

DDBA, XPCE, XAP1,

UV-DDB1

DDB2 1643 Required for DNA repair DDBB, XPE, UV-DDB2

DHX29 54505

RNA helicase involved in translation

initiation. DDX29

213

DHX36 170506

Role in transcriptional regulation and

mRNA stability.

DDX36, MLEL1, G4R1,

RHAU, KIAA1488

DHX58 79132 Recognises ssRNA, dsRNA LGP2, RLR

DDX60 55601 Binds ssRNA, dsRNA and dsDNA

DHX9 1660 Functions as a transcriptional activator. DDX9, LKP, RHA, NDH2

DKC1 1736 Component of telomerase

DKC, NOLA4, CBF5,

NAP57, Dyskerin

DNMT1 1786

Chromatin regulator, methylates CpG

residues.

DNMT, MCMT, AIM,

ADCADN, HSN1E

DNMT3A 1788

DNA methyltransferase, NuRD

associated TBRS

DNMT3B 1789

DNA methyltransferase, NuRD

associated M.HsaIIIB, ICF1

DNTT 1791 DNA polymerase TDT

DR1 1810 Chromatin regulator NC2B

E2F1 1869 Transcription activator RBBP3, RBAP1, E2F-1

E2F2 1870 Transcription factor, cell cycle

E2F3 1871

Transcription factor, also involved in cell

cycle and DNA repair KIAA0075

E2F4 1874

Transcription factor, also involved in cell

cycle and DNA repair

P107/P130-Binding

Protein

ECT2 1894 Involved in cell cycle ARHGEF31

EGF 1950 Involved in cell growth and proliferation HOMG4, URG

EHMT2 10919

Methyltransferase that methylates

lysine residues of histone H3. C6orf30, BAT8

EID3 493861

Involved in repair of DNA double-strand

breaks by homologous recombination NSE4B

214

ELP3 55140 Chromatin remodelling/regulation HELP3, KAT9

EME1 146956

Homologous recombination, interacts

with MUS81 to form a DNA structure-

specific endonuclease SLX2A, MMS4

EME2 197342

Homologous recombination, interacts

with MUS81 to form a DNA structure-

specific endonuclease SLX2B, Gs125

ENDOV 284131 Editing and processing RNAs

EP300 2033 histone acetyltransferase, remodeller P300, RSTS2, KAT3B

ERCC1 2067 Involved in DNA repair RAD10, UV20, COFS4

ERCC2 2068

Transcription factor also involved in

DNA repair

XPD, TTD1, COFS2,

EM9

ERCC3 2071

DNA helicase and transcription factor

also involved in DNA repair

RAD25, GTF2H, BTF2,

TTD2, XPB

ERCC4 2072 Involved in DNA repair XPF, RAD1, FANCQ,

XFEPS, XPF, ERCC11

ERCC5 2073 Involved in DNA repair

ERCM2, XPGC, COFS3,

UVDR, XPG

ERCC6 2074 Involved in DNA repair

CKN2, RAD26, ARMD5,

UVSS1, COFS

ERCC8 1161 Involved in DNA repair CKN1, UVSS2

ERI1 90459

RNA exonuclease, involved in histone

RNA degradation THEX1, HEXO

EWSR1 2130 Transcription factor- repressor

EXO1 9156 DNA exonuclease HEX1, EXOI

EZH2 2146

Chromatin remodeller and transcription

repressor

215

FAAP20 199990 Involved in DNA damage repair C1orf86, FP7162

FAAP24 91442 Involved in DNA damage repair C19orf40

FAAP100 80233 Involved in Fanconi anaemia DNA

damage response C17orf70

FAN1 22909 Editing and processing nucleases MTMR15

FANCA 2175 Involved in DNA repair FACA, FANCH

FANCB 2187 Involved in DNA repair

FANCC 2176 Involved in DNA repair FACC

FANCD2 2177 Involved in DNA repair FACD, FANCD

FANCE 2178 Involved in DNA repair FACE

FANCF 2188 Involved in DNA repair

FANCG 2189 Involved in DNA repair XRCC9

FANCI 55215 Involved in DNA repair KIAA1794

FANCL 55120 Involved in DNA repair PHF9, POG

FANCM 57697 Involved in DNA repair KIAA1596, FAAP250

FBL 2091

Methyltransferase that has the ability to

methylate both RNAs and proteins. RNU3IP1

FBXO18 84893 Involved in homologous recombination HFBH1

FEN1 2237 Involved in DNA repair DNase IV, RAD2

Foxp1 27086 NuRD associated, transcription

HSPC215,

QRF1, 12CC4, HFKH1B

Foxp2 93986 NuRD associated, transcription

TNRC10,

SPCH1, CAGH44

Foxp4 116113

NuRD associated, transcriptional

repressor HFKHLA, FKHLA

216

FSBP 100861412 Transcriptional repressor

FUS 2521 Chromatin regulator

ALS6, ETM4, FUS1,

POMP75, TLS

GAR1 54433 Involved in telomerase NOLA1

GEN1 48654

Homologous recombination,

Endonuclease which resolves Holliday

junctions

GET4 51608 Post translational trafficking C7orf20

GMNN 51053 Involved in cell cycle regulation MGORS6

GNL3 26354 Involved in cell proliferation

E2IG3, NNP47, NS,

C77032

GTF2B 2959 Transcription factor S300-II, TFIIB, TF2B

GTF2F1 2962

Transcription initiation factor that binds

to RNA polymerase II

RAP74, TF2F1, TFIIF,

BTF4

GTF2H1 2965 Transcription factor BTF2, TFIIH, TFB1, P62

GTF2H2 2966 Transcription factor

T-BTF2P44, TFIIH,

BTF2, P44

GTF2H3 2967 Transcription factor TFB4, TFIIH, BTF2, P34

GTF2H4 2968 Transcription factor TFB2, TFIIH, P52

H2AFX 3014 Chromatin Structure H2AX

H2AFY 9555 Chromatin Structure H2AF12M, MH2A1

H2AFZ 3015 Chromatin Structure H2AZ

HAT1 8520 Involved in nucleosome assembly KAT1

HDAC1 3065

Responsible for the deacetylation of

lysine residues on the N-terminal part

of the core histones RPD3L1, GON-10, HD1

217

HDAC10 83933



of the core histones

HDAC2 3066




YAF1, HD2, RPD3, YY1-

Associated Factor 1

HDAC3 8841




HDAC4 9759




HDAC5 10014




HD5, KIAA0600, NY-

CO-9

HDAC6 10013




HDAC7 51564




HELLS 3070 Chromatin regulation LSH, ICF4

HELQ 113510

DNA-dependent ATPase and 5 to 3 DNA

helicase. HEL308

HELZ 9931

Helicase that plays a role in RNA

metabolism

KIAA0054,

DHRC, HUMORF5

HES1 3280 Transcriptional repressor HRY, HL, HES-1

218

HEXIM1 10614

Transcriptional regulator which

functions as a general RNA polymerase

II transcription inhibitor. HIS1, EDG1, CLP1

HIC1 3090 Transcriptional repressor ZNF901, ZBTB29

HIRA 7290


remodeller TUPLE1, DGCR1, HIR

HIST1H1A 3024 Replication Dependent Histone H1F1, H1.1, H1a

HIST1H1B 3009

Replication Dependent Histone H1F5, H1.5, H1b, H1s-

3

HIST1H1C 3006 Replication Dependent Histone H1F2, H1.2, H1s-1, H1c

HIST1H1D 3007

Replication Dependent Histone H1F3, H1.3, H1d, H1s-

2

HIST1H1E 3008

Replication Dependent Histone H1F4, H1.4, H1e, H1s-

4

HIST1H1PS1 387325 Replication Dependent Histone DJ34B20.16, H1F6P

HIST1H1PS2 10338 Replication Dependent Histone H3FEP, PH3/e

HIST1H1T 3010 Replication Dependent Histone H1FT, H1t

HIST1H2AA 221613

Replication Dependent Histone BA317E16.2, H2AFR,

H2AA, TH2A

HIST1H2AB 8335 Replication Dependent Histone H2AFM, H2A/m

HIST1H2AC 8334 Replication Dependent Histone H2AFL

HIST1H2AD 3013 Replication Dependent Histone H2AFG, H2A/g, H2A.3

HIST1H2AE 3012 Replication Dependent Histone H2AFA, H2A/a, H2A.1

HIST1H2AG 8969

Replication Dependent Histone H2AFP, pH2A/f,

H2A/p, H2A.1b

HIST1H2AH 85235

Replication Dependent Histone H2AFALii, dJ86C11.1,

H2A/S

219

HIST1H2AI 8329 Replication Dependent Histone H2AFC, H2A/c

HIST1H2AJ 8331 Replication Dependent Histone H2AFE, H2A/E

HIST1H2AK 8330 Replication Dependent Histone H2AFD, H2A/d

HIST1H2AL 8332

Replication Dependent Histone H2AFI, H2A/I,

dJ193B12.9

HIST1H2AM 8336 Replication Dependent Histone H2AFN, H2A/n, H2A.1

HIST1H2BA 255626

Replication Dependent Histone bA317E16.3, STBP,

TSH2B, H2BFU

HIST1H2BB 3018 Replication Dependent Histone H2BFF, H2B/f

HIST1H2BC 8347 Replication Dependent Histone H2BFL, H2B/l, H2B.1

HIST1H2BD 8347 Replication Dependent Histone H2BFB, H2B/b

HIST1H2BE 8344 Replication Dependent Histone H2BFH, H2B/h, H2B.h

HIST1H2BF 8343 Replication Dependent Histone H2BFG, H2B/g

HIST1H2BG 8339 Replication Dependent Histone H2BFA, H2B/a, H2B.1A

HIST1H2BH 8345 Replication Dependent Histone H2BFJ, H2B/j

HIST1H2BI 8346 Replication Dependent Histone H2BFK, H2B/k

HIST1H2BJ 8970 Replication Dependent Histone H2BFR, H2B/r

HIST1H2BK 85236 Replication Dependent Histone H2BFT, H2BFAiii

HIST1H2BL 8340

Replication Dependent Histone H2BFC, H2B/c,

dJ97D16.4

HIST1H2BM 8342

Replication Dependent Histone H2BFE, H2B/e,

dJ160A22.3

HIST1H2BN 8341 Replication Dependent Histone H2BFD, H2B/d

HIST1H2BO 8348 Replication Dependent Histone H2BFN, H2B/n, H2B.2

HIST1H3A 8350 Replication Dependent Histone H3FA, H3/A

220

HIST1H3B 8358 Replication Dependent Histone H3FL, H3/l

HIST1H3C 8352 Replication Dependent Histone H3FC, H3/c, H3.1

HIST1H3D 8351 Replication Dependent Histone H3FB, H3/b,

HIST1H3E 8353 Replication Dependent Histone H3FD, H3/d, H3.1

HIST1H3F 8968 Replication Dependent Histone H3FI, H3/i

HIST1H3G 8355 Replication Dependent Histone H3FH, H3/h

HIST1H3H 8357 Replication Dependent Histone H3FK, H3/k, H3F1K

HIST1H3I 8354 Replication Dependent Histone H3FF, H3/f, H3.f

HIST1H3J 8356 Replication Dependent Histone H3FJ, H3/j

HIST1H4A 8359 Replication Dependent Histone H4FA

HIST1H4B 8366 Replication Dependent Histone H4FI, H4/I

HIST1H4C 8364

Replication Dependent Histone H4FG, H4/g,

dJ221C16.1

HIST1H4D 8360 Replication Dependent Histone H4FB, H4/b

HIST1H4E 8367 Replication Dependent Histone H4FJ, H4/j

HIST1H4F 8361 Replication Dependent Histone H4FC, H4/c, H4

HIST1H4G 8369 Replication Dependent Histone H4FL, H4/l

HIST1H4H 8365 Replication Dependent Histone H4FH, H4/h

HIST1H4I 8294 Replication Dependent Histone H4FM, H4/m

HIST1H4J 8363 Replication Dependent Histone H4FE, H4/e, H4F2iv

HIST1H4K 8362

Replication Dependent Histone H4FD, H4/d, H4F2iii,

dJ160A22.1

HIST1H4L 8368 Replication Dependent Histone H4FK, H4.k, H4/k

HIST2H2AA3 8337

Replication Dependent Histone H2AFO, HIST2H2AA,

H2A.2, H2A/q

221

HIST2H2AA4 723790

Replication Dependent Histone H2A/r, H2BFQ, H2B/q,

H2B.1

HIST2H2AB 317772 Replication Dependent Histone H2AB

HIST2H2AC 8338 Replication Dependent Histone H2A, H2AFQ, H2A/q

HIST2H2BA 337875 Replication Dependent Histone

HIST2H2BB 338391 Replication Dependent Histone

HIST2H2BC 337873 Replication Dependent Histone H2B/t, HIST2H2BD

HIST2H2BD 337874 Replication Dependent Histone H2BFO, H2B/s, H2B/o

HIST2H2BE 8349

Replication Dependent Histone H2B, H2BQ, H2BFQ,

H2BGL105

HIST2H2BF 440689 Replication Dependent Histone

HIST2H3A 333932 Replication Dependent Histone H3/N, H3/O

HIST2H3C 126961 Replication Dependent Histone H3/M, H3, H3.2

HIST2H3D 653604 Replication Dependent Histone

HIST2H4A 8370

Replication Dependent Histone H4F2, H4FN, HIST2H4,

H4/n

HIST2H4B 554313 Replication Dependent Histone H4/o

HIST3H2A 92815 Replication Dependent Histone MGC3165

HIST3H2BA 337872 Replication Dependent Histone

HIST3H2BB 128312 Replication Dependent Histone

HIST3H3 8290 Replication Dependent Histone H3FT, H3t, H3/g, H3.4

HIST4H4 121504 Replication Dependent Histone MGC24116

HLTF 6596

SWI/SNF family, helicase and ubiquitin

ligase functions SMARCA3

222

HMGA1 3159 Transcription

HMGIY, HMGA1A,

HMG-R

HMGA2 8091 Transcription

HMGIC, LIPO, BABL,

STQTL9

HMGB1 3146

Involved in transcription and chromatin

remodelling HMG1, SBP-1, HMG1

HMGB2 3148


remodelling HMG2

HMGN1 3150


remodelling HMG14

HMGN2 3151


remodelling HMG17

HNRNPA0 10949 RNA processing HNRPA0

HNRNPA1 3178 RNA processing

HNRPA1, IBMPFD3,

ALS19, ALS20, UP 1

HNRNPA2B1 3181 RNA processing

HNRPA2B1, IBMPFD2,

HNRPA2, HNRPB1,

RNPA2

HNRNPD 3184

Involved in RNA processing and DNA

replication

AUF1, HNRPD, P37,

HnRNPD0, HNRPD

HSP90AA1 3320

Involved in cell cycle and signal

transduction

HSPC1, HSPCA, LAP2,

EL52, Hsp90

HSPA1L 3305 Protein stabilization HSP70T

HUS1 3364 Role in DNA repair

IDH1 3417 Chromatin regulation

IDPC, IDCD, HEL-216,

PICD

IDH2 3418 Chromatin regulation

IDPM, IDHM, D2HGA2,

IDH

223

IFIH1 64135 RNA helicase

MDA5, IDDM19,

IDDM19, RH116, AGS7

IGF1 3479 Growth factor and replication IGFI, IBP1, IGF-I, MGF

IKBKAP 8518


remodelling

DYS, ELP1, IKAP, P150,

IKI3, DYS, FD

INO80 54617

DNA helicase and transcription factor

also involved in DNA repair INOC1, KIAA1259

INO80C 125476

Involved in transcriptional regulation,

DNA replication and DNA repair. C18orf37

INO80E 283899


DNA replication and DNA repair. CCDC95

ISG20 3669

Exoribonuclease that acts on single-

stranded RNA CD25, HEM45

KAT2A 2648

Histone acetyltransferase that

promotes transcriptional activation. GCN5L2, STAF97

KAT2B 8850

Histone acetyltransferase that

promotes transcriptional activation.

PCAF, CAF, Lysine

Acetyltransferase 2B

KAT5 10524 Transcriptional activation

HTATIP, TIP60,

HTATIP, ESA1, PLIP,

ZC2HC5

KDM1A 23028 Histone demethylase, NuRD associated

lysine (K)-specific

demethylase

1A (LSD1)

KDM3B 51780 Demethylates Lys-9 of histone H3

C5orf7, JMJD1B,

KIAA1082, NET22

KDM4A 9682

Demethylates Lys-9 and Lys-36 residues

of histone H3

JMJD2A, JHDM3A,

KIAA0677, TDRD14A

224

KDM4B 23030 Demethylates Lys-9 of histone H3

JMJD2B, KIAA0876,

TDRD14B, JHDM3B

KDM4C 23081

Demethylates Lys-9 and Lys-36 residues

of histone H3

JMJD2C, TDRD14C,

KIAA0780, GASC1,

JHDM3C

KDM5A 5927 Demethylates Lys-4 of histone H3

RBBP2, JARID1A,

RBBP2

KDM5B 10765

Demethylates Lys-4 of histone H3

JARID1B, RBP2-H1,

PLU-1, CT31, PUT1,

RBBP2H1A, PPP1R98

KDM5C 8242 Demethylates Lys-4 of histone H3

SMCX, JARID1C,

MRX13, MRXJ,

MRXSCJ, XE169,

DXS1272E

KDM6B 23135

Histone demethylase, demethylates

Lys-27 of histone H3

KMT2B

9757

Methylates Lys-4 of histone H3

MLL4, MLL1B, CXXC10,

KIAA0304, TRX2,

WBP7

KMT2D 8085 Methylates Lys-4 of histone H3

(H3K4me).

MLL2, TNRC21,

AAD10, KABUK1,

CAGL114, ALR

KMT2E 55904

Mono- and di-methylates Lys-4 of

histone H3 (H3K4me1 and H3K4me2)

MLL5, NKp44L,

HDCMC04P

KMT5A 387893

Monomethylates both histones and

non-histone proteins, involved in

mitosis

SETD8, H4-K20-

Specific Histone

Methyltransferase

225

KMT5B 51111 Trimethylates Lys-20 of histone H4.

SUV420H1, Lysine-

Specific

Methyltransferase 5B

KTM5C 84787 Histone methyltransferase

SUV420H2, Lysine (K)-

Specific

Methyltransferase 5C

KRAS 3845 Cell proliferation

KRIT1 889 Cell proliferation CCM1, CaM

LIG1 3978 DNA repair

LIG3 3980 DNA repair LIG2

LIG4 3981 DNA repair LIG4S

MAD2L2 10459 Cell cycle and DNA repair REV7, POLZ2, MAD2B

MAVS 57506 Detect intracellular dsRNA

VISA, IPS1, KIAA1271,

CARDIF

MBD1 4152

Transcriptional corepressor and

coactivator, Chromatin

Modifier/epigenetic remodeller

MBD2 8932


coactivator, NuRD complex

DMTase, NY-CO-41,

demethylase

MBD3 53615



MBD4 8930


coactivator

MCM2 4171 DNA replication

CCNL1, CDCL1,

MITOTIN, D3S3194,

KIAA0030


RLFB, HCC5, P1-

MCM3, P102

226

MCM4 4173 Initiation of DNA replication CDC21

MCM5 4174 Cell cycle CDC46

MCM6 4175 Initiation of DNA replication


MCM2, CDC47,

P1CDC47, PPP1R104,

PNAS146, P85MCM

MCPH1 79648 DNA damage response BRIT1, MCT

MCRS1 10445 Transcription regulator

MSP58, P78, ICP22BP,

INO80Q

MDC1 9656 Cell cycle and DNA damage response NFBD1, KIAA0170

MECP2 4204 Mediates transcriptional expression

RTT, MRX16, MRX79,

AUTSX3, RTS, MRXSL

MED12 9968 Transcription

TNRC11, FGS1,

ARC240, CAGH45,

HOPA, MED12S

MEN1 4221 Transcriptional regulator SCG2, Menin

MGMT 4255

Protein catalyses transfer of methyl

groups from O(6)-alkylguanine and

other methylated moieties of the DNA

to its own molecule, which repairs the

toxic lesions.

O6-Methylguanine-

DNA

Methyltransferase

MKI67 4288 Cell proliferation MIB-1, KIA, PPP1R105

MLH1 4292 DNA repair

FCC2, HMLH1, HNPCC,

COCA2

MLLT1 4298 Transcription regulator

YEATS1, LTG19, ENL,

CTC-503J8.6

MNAT1 4331 Transcription regulator

CAP35, RNF66, MAT1,

P36, TFB3

227

MPG 4350 DNA repair

ADPG, AAG, MDG,

APNG, PIG16, PIG11,

CRA36.1

MPLKIP 136647 Cell cycle TTDN1, C7orf11

MRE11A 4361

Component of the MRN complex, role

in double-strand break repair, DNA

recombination, maintenance of

telomere integrity and meiosis. MRE11

MSH2 4436

Post-replicative DNA mismatch repair

system

MSH3 4437 DNA repair

MRP1, DUP, DUC1,

DUG

MSH4 4438 Involved in meiotic recombination.

MSH5 4439 Involved in meiotic recombination. MUTSH5, NG23, G7

MSH6 2956 DNA repair

GTBP, HNPCC5,

HMSH6, HSAP, P160,

GTMBP

MTA1 9112



p70, MTA1L1, PID,

KIAA1264

MTA2 9219



p70, MTA1L1, PID,

KIAA1265

MTA3 57504



p70, MTA1L1, PID,

KIAA1266

MTF2 22823 Transcriptional activator

M96, TDRD19A,

DJ976O13.2, PCL2

MUS81 80198

DNA repair and homologous

recombination SLX3

MUTYH 4595 DNA repair HMYH

228

MYC 4609 Transcription factor

C-Myc, MYCC, MRTL,

BHLHe39

NAA10 8260

Catalytic subunit of the N-terminal

acetyltransferase A (NatA) complex

ARD1, ARD1A, TE2,

NATD, OGDNS,

DXS707, MCOPS1

NABP1 64859 DNA repair and cell cycle

SSB2, OBFC2A, SOSS-

B2

NABP2 79035 DNA repair and cell cycle

SSB1, OBFC2B,

LP3587, SOSS-B1

NBS1 4683

Component of MRN complex, DNA

repair NBS, NBN, ATV, P95

NCAPG 64151 Involved in meiosis

YCG1, CHCG, HCAP-G,

NYMEL3, NY-MEL-3,

CAPG

NCL 4691

Chromatin decondensation by binding

H1

NCOA1 8648 Involved in transcription

F-SRC-1, BHLHe42,

KAT13A, NCoA-1, SRC-

1, RIP160

NCOA3 8202 Chromatin Modifier

NCOR1 9611 Chromatin Modifier

NCOR2 9612 transcriptional regulator, promoting

chromatin condensation

Ndc80 10403 Involved in cell cycle

KNTC2, HEC, KNTC2,

TID3

NELFCD 51497 Transcription TH1L, HSPC130, NELFD

NFRKB 4798

Involved in transcriptional regulation

and DNA repair INO80G

229

NHEJ1 79840 DNA repair XLF, XRCC4-Like Factor

NHP2 55651 Involved in trafficking hTR NOLA2, DKCB2, NHP2P

NOP10 55505 Involved in trafficking hTR NOLA3, DKCB1

NSMCE2 286053

Component of the SMC5-SMC6

complex, a complex involved in DNA

double-strand break repair by

homologous recombination. C8orf36

NSMCE3 56160 DNA repair

NDNL2, MAGEG1,

HCA4, NSE3

NSMCE4A 54780 DNA repair C10orf86, NSE4A

NTHL1 4913 DNA repair NTH1, FAP3, OCTS3

NUTM1 256646 Chromatin regulation

C15orf55, FAM22H,

NUT

OBFC1 79991 DNA replication RPA-32, STN1, AAF44

OGG1 4968 DNA repair genes

MMH, HOGG1, OGH1,

MUTM

ORC1 4998 DNA replication

ORC1L, PARC1,

HSORC1

ORC2 4999 DNA replication ORC2L

ORC3 23595 DNA replication ORC3L, LATHEO, LAT


ORC5 5001 DNA replication

ORC5L, ORC5P,

ORC5T, PPP1R117


PABPC1 26986 RNA processing

PAB1, PABPC2,

PABPL1

PAF1 54623 Transcription PD2

230

PALB2 79728 DNA repair FANCN, PNCA3

PAPOLG 64895

Editing and processing nucleases, 3'

mRNA polyadenylation PAP2, PAPG

PARP1 142 DNA damage response

ADPRT1, PARP, PPOL,

ARTD1


ADPRTL2, ADPRTL3,

ARTD2, PARP-2,

PADPRT-2


ADPRTL1, KIAA0177,

VAULT3, VWA5C,

P193, PH5P, PARP-4

PAX8 7849 Transcription factor

PAXIP1 22976

Involved in DNA damage response and

transcriptional regulation

PAXIP1L, TNRC2,

PACIP1, CAGF29,

CAGF28, PAXIP1L

PCNA 5111 DNA polymerase

PER1 5187 Transcriptional repressor PER, KIAA0482, RIGUI

PES1 23481

Involved in cell proliferation and RNA

processing PES

PGBD3 267004 Transcription

PHF1 5252 Transcriptional repressor

HPCl1, PCL1,

TDRD19C, MTF2L2

PHF2 5253 Lysine demethylase KIAA0662, JHDM1E

PHF20 51230 Transcriptional regulator

C20orf104, GLEA2,

HCA58, NZF, TZP

PHF20L1 51105 Involved in chromatin regulation

URLC1, CGI-72,

TDRD20B

231

PIF1 80119 DNA helicase C15orf20, PIF

PINX1 54984

Involved in chromosome segregation

and TRF1 and TERT accumulation in

nucleus

LPTL, LPTL,

PIN2/TERF1

Interacting,

Telomerase Inhibitor 1

PKMYT1 9088 Cell cycle PPP1R126, MyT1

PLK1 5347 Cell cycle PLK, STPK13, EC 2.7.11

PML 5371

Involved in tumour suppression,

transcriptional regulation, apoptosis,

senescence, DNA damage response, and

viral defence mechanisms.

PP8675, TRIM19,

RNF71, MYL

PMS1 5378 DNA repair

PMSL1, HNPCC3,

HPMS1, MLH2

PMS2 5395 DNA repair

PMSL2, HNPCC4,

PMS2CL, MLH4

POLA1 5422 DNA polymerase POLA, NSX, P180

POLA2 23649 DNA replication

POLB 5423 DNA polymerase

POLD1 5424 DNA polymerase

POLD, CDC2, CRCS10,

MDPL

POLD2 5425 Subunit of DNA polymerase

POLD3 10714 Subunit of DNA polymerase

p66, p68, KIAA0039,

PPP1R128

POLD4 57804 Subunit of DNA polymerase P12, POLDS

POLE 5426 Subunit of DNA polymerase POLE1, FILS, CRCS12

POLE2 5427 Subunit of DNA polymerase DPE2

232

POLE3 54107

Role in allowing polymerase epsilon to

carry out its replication and/or repair

function- chromatin remodelling P17, YBL1, CHARAC17

POLE4 56655

Role in allowing polymerase epsilon to

carry out its replication and/or repair

function- chromatin remodelling P12, YHHQ1

POLG 5428 Mitochondrial DNA polymerase

POLG1, POLGA, MDP1,

SANDO, MIRAS, SCAE,

PEO

POLH 5429 DNA polymerase RAD30A, XPV

POLI 11201 DNA polymerase RAD30B, RAD3OB

POLK 51426 DNA polymerase

DINB1, POLQ, DINB1,

DINP

POLL 27343 DNA polymerase BETAN, POLKAPPA

POLM 27434

DNA polymerase, involved in repair of

DNA double-strand breaks by non-

homologous end joining

POLN 353497 DNA polymerase POL4P

POLQ 10721

DNA polymerase that promotes

microhomology-mediated end-joining

POLR2A 5430 RNA polymerase II

POLR2B 5431 RNA polymerase subunit

POL2RB, HRPB140,

RPB2

POLR2C 5432 RNA polymerase subunit RPB3, HRPB33

POLR2D 5433 RNA polymerase subunit HSRBP4, RPB16, RBP4

POLR2F 5435 RNA polymerase subunit

POLRF, RPABC2, RPB6,

RPC15

233

POLR2G 5436 RNA polymerase subunit

RPB19, RPB7, HRPB19,

HsRPB7

POLR2H 5437 RNA polymerase subunit RPB17, RPABC3

POLR2I 5438 RNA polymerase subunit RPB9, RPB14.5

POLR2J 5439 RNA polymerase subunit

RPB11, HRPB14,

POLR2J1

POLR2K 5440 Subunit of RNA polymerase II RPB12, RPABC4

POLR2L 5441 RNA polymerase subunit RPB10, RPABC5

POLR3A 11128

Catalytic component of RNA

polymerase III

RPC1, HLD7, RPC155,

ADDH

POT1 25913 Shelterin complex GLM9, CMM10

PPARG 5468 Transcription factor NR1C3, GLM1, CIMT1

PPP1CA 5499 Involved in cell division PPP1A

PPP1CB 5500 Involved in cell division PP1B

PPP1CC 5501 Involved in cell division PP1C

PPP1R10 5514

Involved in cell cycle progression, DNA

repair and apoptosis

CAT53, PP1R10,

PNUTS, FB19, P99

PPP2R1A 5518

Involved in the negative control of cell

growth and division. MRD36, PR65A

PPP2R1B 5519

Involved in the negative control of cell

growth and division. PR65B

PPP2R2A 5520 Cell division and growth

PRDM16 63976

Transcriptional regulator

PFM13, MEL1,

KIAA1675, CMD1LL,

LVNC8

234

PRDM2 7799

Histone methyltransferase that

specifically methylates Lys-9 of histone

H3

PRIM1 5557

Polymerase that synthesizes small RNA

primers for the Okazaki fragments

made during discontinuous DNA

replication.

P49, DNA Primase

Subunit 48

PRIM2 5558

Polymerase that synthesizes small RNA

primers for the Okazaki fragments

made during discontinuous DNA

replication. PRIM2A, P58

PRKCA 5578

Involved in cell cycle checkpoint and

transcription regulation PKCA, AAG6

PRKCB 5579

Involved in cell cycle checkpoint and

transcription regulation

PRKCB2, PKCB,

PRKCB1

PRKDC 5591

DNA-dependent protein kinase involved

in DNA repair

HYRC, HYRC1, XRCC7,

DNAPK

PRMT1 3276 Arginine methyltransferase

HRMT1L2, IR1B4,

ANM1, HCP1

PRMT2 3275 Methylates H4 HRMT1L1

PRMT3 10196

Methylates (mono and asymmetric

dimethylation) the guanidino nitrogens

of arginyl residues in some proteins. HRMT1L3

PRMT5 10419 Chromatin regulator SKB1, HRMT1L5

PRMT6 55170 Methyltransferase activity HRMT1L6

PRPF19 27339

Involved in pre-mRNA splicing and DNA

repair.

PSO4, PRP19,

NMP200, UBOX4

PSIP1 11168 Transcriptional coactivator

PSIP2, DFS70, LEDGF,

P75, P52

235

PTGES3 10728 Involved in transcriptional regulation CPGES, TEBP, P23

PURA 5813 Transcriptional activator

MRD31, PUR1, PUR-

ALPHA

PYGO1 26108 Involved in signal transduction through

the Wnt pathway.

RAD1 5810 Involved in DNA damage response REC1, HRAD1

RAD17 5884

Involved in cell growth, maintenance of

chromosomal stability, and ATR-

dependent checkpoint activation upon

DNA damage. RAD24, CCYC, R24L

RAD18 56852

Involved in ubiquitination and DNA

damage repair RNF73

RAD21 5885

Involved in cell cycle, DNA repair and

apoptosis.

CDLS4, SCC1, MCD,

NXP1 1

RAD23B 5887 DNA repair gene P58

RAD50 10111

Component of the MRN complex, which

plays a central role in double-strand

break (DSB) repair, DNA recombination,

maintenance of telomere integrity and

meiosis. NBSLD

RAD51 5888

Homologous recombination DNA

damage response

RAD51A, RECA, BRCC5,

FANCR, HsT16930,

MRMV2

RAD51AP1 10635 Involved in DNA damage response PIR51

RAD51B 5890

Involved in DNA damage repair via

homologous recombination RAD51L1, REC2

RAD51C 5889


homologous recombination FANCO, BROVCA3

236

RAD51D 5892


homologous recombination

RAD51L3, BROVCA4,

TRAD, R51H3

RAD52 5893

Involved in double-stranded break

repair.

RAD54B 25788

Involved in DNA repair and mitotic

recombination. RDH54

RAD54L 8438

Involved in DNA repair and mitotic

recombination. RAD54A, HR54

RAD9A 5883 Involved in DNA damage response RAD9

RAP1A 5906

Regulates signalling pathways that

affect cell proliferation and adhesion RAP1

RAPGEF1 2889

Involved in signalling cascade that

induces apoptosis GRF2, C3G

RASSF1 11186

Involved in cell cycle and cell death

pathways

RDA32,123F2,

NORE2A, REH3P21

RB1 5925

Involved in chromatin regulation, cell

cycle and is a tumour suppressor gene OSRC

RBBP4 5928

Involved in histone acetylation and

chromatin assembly. Component NuRD RbAp48

RBBP5 5929

Involved in regulating gene induction

and H3 Lys-4 methylation RBQ3, SWD

RBBP7 5931

Core histone-binding subunit, NuRD

complex RbAp46

RBBP8 5932 DNA damage repair CtIP, SCKL2

RBL1 5933

Involved in cell division and

heterochromatin formation

RBL2 5934

Involved in cell division and

heterochromatin formation

237

RDM1 201299

May confer resistance to the antitumor

agent cisplatin. Binds to DNA and RNA. RAD52B

RECQL 5965 DNA helicase RECQ1

RECQL4 9401 DNA-dependent ATPase

RECQL5 9400

DNA helicase, role in DNA replication,

transcription and repair.

RELA 5970 Chromatin remodeller NFKB3

REV1 51455

Deoxycytidyl transferase involved in

DNA repair. REV1L

REV3L 5980

Interacts with MAD2L2 to form the

error prone DNA polymerase zeta

involved in translesion DNA synthesis. POLZ

RFC1 5981

Component of a complex that possesses

DNA-dependent ATPase activity

RFC2 5982 Component of a complex that possesses


RFC3 5983



RFC4 5984



RFC5 5985



RIF1 55183 Conserved DNA damage response gene

RARRES3 5920 Tumour suppressor or growth regulator. RIG1, TIG3

RING1 6015 Involved in chromatin regulation

RMI1 80010

Involved in the dissolution of double

Holliday junctions

238

RMI2 116028 Involved in homologous recombination C16orf75

RNF168 165918

Involved in ubiquitination and DNA

damage repair

RNF2 6045 Chromatin modifier


RNF4 6047

Chromatin modifier, regulates

degradation of PML


RNF8 9025 Involved in DNA damage response

RPA1 6117

Involved in DNA replication and damage

response

RPA2 6118


response

RPA3 6119


response

RPA4 29935

Binds ssDNA and probably plays a role

in DNA repair.

RPAIN 84268 Participates in DNA metabolism RIP, HRIP

RRP8 23378 Chromatin regulator KIAA0409, NML

RTEL1 51750

TP-dependent DNA helicase implicated

in telomere-length regulation, DNA

repair and the maintenance of genomic

stability.

C20orf41, NHL,

DKCA4, DKCB5,

PFBMFT3

RUVBL1 8607

DNA-dependent ATPase and DNA

helicase activities, involved in chromatin

modification

TIP49, PONTIN, ECP54,

TIH1

239

RUVBL2 10856

DNA-dependent ATPase and DNA

helicase activities, involved in chromatin

modification

TIP48, REPTIN, ECP51,

TIH2

SART1 9092 Role in mRNA splicing

HOMS1, Snu66,

SNRNP110, Ara1

SATB1 6304 Chromatin remodeller

SETD7 80854

Histone methyltransferase that

specifically monomethylates Lys-4 of

histone H3 SET9, SET7, KMT7

SETDB1 9869

Regulates histone methylation, gene

silencing, and transcriptional

repression-trimethylates Lys-9 of

histone H3

SETMAR 6419 DNA repair METNASE, Mar1

SFR1 119392

Required for double-strand break repair

via homologous recombination C10orf78, MEIR5

SGO1 151648

Role in chromosome cohesion during

mitosis

SGOL1, CAID, NY-BR-

85, SGO

SHFM1 7979 Involved in DNA damage response

SHFD1, DSS1, SHSF1,

SEM1, ECD

SHPRH 257218

E3 ubiquitin-protein ligase involved in

DNA repair.

SIN3A 25942 Acts as a transcriptional repressor.

SIN3B 23309

Acts as a transcriptional repressor,

NuRD associated

SIRT1 23411

Transcriptional regulator involved in cell

cycle, response to DNA damage,

metabolism, apoptosis and autophagy. Sirtuin 1

240

SIRT2 22933 NAD-dependent protein deacetylase SIR2L

SIRT3 23410 NAD-dependent protein deacetylase

SIRT5 23408

NAD-dependent lysine demalonylase,

desuccinylase and deglutarylase

SIRT6 51548 NAD-dependent protein deacetylase.

SIRT7 51547

AD-dependent protein deacetylase that

specifically mediates deacetylation of

histone H3 at Lys-18

SLX1A 548593 Involved in DNA damage repair GIYD1

SLX1B 79008 Involved in DNA damage repair GIYD2

SLX4 84464

Structure-specific endonuclease

subunit.

MUS312, FANCP,

BTBD12

SMAD3 4088 Transcription factor

SMARCA1 6594 Involved in chromatin remodelling.

SNF2L1, SNF2L, SNF2-

Like 1

SMARCA2 6595

SWI/SNF complex, transcription

activator

SNF2L2, SNF2-Alpha,

BAF190B

SMARCA4 6597 SWI/SNF complex, transcription

activator

SMARCAD1 56916 SNF protein, required for DNA repair

and heterochromatin organization.

HEL1, ETL1, ADERM,

ATP-Dependent

Helicase 1

SMARCB1 6598 SWI/SNF complex, chromatin

remodeller

SNF5L1, INI1, SNF5,

HSNF5, BAF47

SMARCC1 6599 Involved in chromatin remodelling.

CRACC1, BAF155,

SWI3

SMARCC2 6601 Involved in chromatin remodelling. CRACC2, BAF170

241

SMARCD1 6602 Involved in chromatin remodelling. CRACD1, BAF60A

SMARCD2 6603 Involved in chromatin remodelling. CRACD2, BAF60B

SMARCD3 6604 Involved in chromatin remodelling. CRACD3, BAF60C

SMC1A 8243

Involved in chromosome cohesion

during cell cycle and in DNA repair.

SMC1L1, CDLS2,

DXS423E

SMC2 10592

Cell cycle, DNA replication and DNA

repair SMC2L1, CAP-E

SMC3 9126


repair CSPG6

SMC4 10051


repair SMC4L1, CAP-C

SMC5 23137

Involved in DNA double-strand breaks

by homologous recombination. SMC5L1

SMC6 79677

Involved in DNA double-strand breaks

by homologous recombination. SMC6L1

SMG1 23049

RNA degradation and DNA damage

response

SMG5 23381

Involved in nonsense-mediated mRNA

decay, telomerase associated protein Est1p-Like Protein B

SMG6 23293

Involved in nonsense-mediated mRNA

decay

C17orf31, EST1-Like

Protein A

SMG7 9887

Plays a role in nonsense-mediated

mRNA decay.

C1orf16, EST1-Like

Protein C

SMUG1 23583 DNA repair gene FDG

SMYD2 56950

Methylates both histones and non-

histone proteins, including p53/TP53

and RB1.

KMT3C, ZMYND14,

HSKM-B

242

SP1 6667

Chromatin regulator, DNA damage

response

SP100 6672 Component of PML body

SP110 3431 Transcription factor IFI41, IFI75, VODI

SPO11 23626 Required for meiotic recombination

SPATA43, TOPVIA,

CT35

SPRTN 83932 DNA repair

c1orf124, PRO4323,

DVC1

SRCAP 10847 Chromatin regulator

SSB 6741 Involved in RNA metabolism LARP3

SSBP1 6742

involved in mitochondrial DNA

replication, binds ssDNA SSBP, SOSS-B1, MtSSB

SSRP1 6749 Chromatin remodeller

FACT, T160, SSRP1,

T160

SSU72 29101 Role in RNA processing and termination. HSPC182, PNAS-120

STAG1 10274 DNA replication SCC3A, SA1

STAG2 10735


remodeller SCC3B, SA2

STRA13 201254

Involved in DNA damage repair and

genome maintenance. CENPX, MHF2, MHF2

SUN1 23353

Involved in telomere attachment to

nuclear envelope and gametogenesis. UNC84A, KIAA0810

SUPT16H 11198 Chromatin remodeller

CDC68, SPT16, SPT16,

FACTP140

SUPT5H 6829

Involved in mRNA processing and

transcription elongation SPT5H

243

SUV39H1 6839 Chromatin remodeller

SUV39H, HTDG,

KMT1A, MG44,

Histone H3-K9

Methyltransferase 1

SUV39H2 79723 Chromatin remodeller

KMT1B, Histone H3-K9

Methyltransferase 2

SUZ12 23512 Chromatin remodeller CHET9, JJAZ1

SWI5 375757 Involved in homologous recombination C9orf119, SAE3

SYMPK 8189

Involved in histone mRNA 3-end

processing. SYM, SPK

TAF1 6872 Transcription and phosphorylation

DYT3, CCGS, CCG1,

BA2R, TAF2A

TBK1 29110 Ubiquitination NAK, T2K

TBP 6908 Transcription TF2D, GTF2D, SCA17

TCEA1 6917

Assembly of RNA Polymerase-II

Initiation Complex TFIIS, GTF2S

TCEB3 6924 Transcription TCEB3A

TDG 6996 Chromatin Structure and Modification

TDP1 55775 DNA repair gene

TDRD1 56165 piRNA metabolic process

TDRD10 126668

Nucleic acid binding and nucleotide

binding.

TDRD12 91646 ATP-dependent RNA helicase activity. ECAT8

TDRD3 81550

poly(A) RNA binding and chromatin

binding.

TDRD5 163589 Involved in DNA integrity TUDOR3

244

TDRD6 221400

Involved in proper precursor and

mature miRNA expression

SPATA36, TDR2,

BA446F17.4

TDRD7 23424 Post-transcriptional regulation CATC4, TRAP

TDRD9 122402

Nucleic acid binding and helicase

activity. C14orf75, NET54

TDRKH 11022 Nucleic acid binding and RNA binding. TDRD2

TELO2 9894 Regulator of the DNA damage response TEL2, CLK2, HCLK2

TEP1 7011 Telomerase TP1, TLP1, P240

TERC 7012 Telomerase TRC3, DKCA1, TR

TERF1 7013 Shelterin complex TRF1, TRBF1, PIN2

TERF2 7014 Shelterin complex TRF2, TRBF2

TERF2IP 54386

Shelterin complex and as a transcription

regulator.

RAP1, TERF2

Interacting Protein

TERT 7015 Telomerase

TCS1, EST2, TP2,

DKCA2, TRT

TET1 80312 Chromatin Modifier/epigenetic

remodeller, DNA demethylation CXXC6

TET2 54790 Chromatin Modifier/epigenetic

remodeller, DNA demethylation KIAA1546

TFAM 7019

Mitochondrial transcription regulation,

replication and repair. TCF6, TCF6L2

TGFB1 7040

Controls proliferation, differentiation,

adhesion, migration and other functions TGFB, DPD1

TIAL1 7073

RNA binding protein involved in

translational control, splicing and

apoptosis. TIAR, TCBP

245

TICAM1 148022

Protein kinase binding and signal

transducer activity. TRIF

TINF2 26277 Shelterin complex

TIN2, DKCA3, TERF1

(TRF1)-Interacting

Nuclear Factor 2

TMEM173 340061

Sensor of cytosolic DNA from bacteria

and viruses

STING, ERIS, HMITA,

MITA, SAVI, NET23

TMEM201 199953 Mitosis SAMP1, NET5

TMPO 7112

Nuclear organisation and DNA

replication LAP2

TNKS 8658

Wnt signalling pathway, telomerase and

vesicle trafficking. TIN1, TANK1, PARP5A

TNKS2 80351

Wnt signalling pathway, telomerase and

vesicle trafficking.

TNKS-2, TANK2,

PARP5B

TOP1 7150 Involved in DNA transcription TOPI

TOP2A 7153

Involved in DNA replication and

transcription TOP2

TOP2B 7155


transcription Topo II Beta

TOP3A 7156 Involved in DNA replication Topo III-Alpha

TOP3B 8940


transcription TOP3B1

TOPBP1 11073 Conserved DNA damage response gene TOP2BP1

TP53 7157

Conserved DNA damage response gene,

induces growth arrest or apoptosis

TP53BP1 7158 Conserved DNA damage response gene 53BP1

246

TP53I13 90313 Tumour suppressor

TP53 INDUCED

PROTEIN 13

TP53I3 9540 Member of TP53 signalling pathway

TP53 INDUCED

PROTEIN

TREX1 11277 Editing and processing nucleases DNase III

TREX2 11219 Editing and processing nucleases

TRIM28 10155


remodeller RNF96, KAP1, TIF1B

TRIM32 22954 E3 ubiquitin ligase activity. HT2A, LGMD2H

TRIM33 51592 E3 ubiquitin-protein ligase. TIF1G, RFG7

TRIM56 81844

poly(A) RNA binding and ubiquitin-

protein transferase activity. RNF109

TRIP13 9319


remodeller

TRRAP 8295


remodeller TRA1, STAF40, PAF400

TTI1 9675 Regulator of the DNA damage response.

SMG10, KIAA0406,

TELO2 Interacting

Protein 1

TTI2 80185 Regulator of the DNA damage response.

C8orf41, MRT39,

TELO2 Interacting

Protein 2

TUBA1B 10376 Chromatin, cell cycle, apoptosis Tubulin

TYMP 1890


remodeller

UBA52 7311

Ubiquitin gene, Ubiquitin A-52 Residue

Ribosomal Protein Fusion Product 1 RPL40

247

UBB 7314 Ubiquitin gene, ubiquitin B HEL-S-50

UBC 7316 Ubiquitin gene, ubiquitin C HMG20

UBE2A 7319 Ubiquitination and modification RAD6A

UBE2B 7320 Ubiquitination and modification RAD6B

UBE2N 7334 Ubiquitination and modification UBC13

UBE2T 29089

DNA damage repair and Fanconi

anaemia FANCT

UBE2V2 7336 Ubiquitination and modification MMS2

UBR5 51366 Transcriptional regulation

UHRF1 29128


remodeller

UIMC1 51720 DNA repair

RAP80, X2HRIP110,

RXRIP110

UPF1 5976

RNA-dependent helicase, involved in

decay of mRNA containing premature

stop codons RENT1, NORF1

USP1 7398

Negative regulator of DNA damage

repair HUBP

VCP 7415

Related to cell cycle and DNA damage

repair

WDR48 57599

Regulator of deubiquitinating

complexes. UAF1, P80

WDR77 79084


remodeller MEP50, P44

WEE1 7465 Cell cycle

WRAP53 55135 Telomerase and Cajal bodies TCAB1, DKCB3

WRN 7486 DNA helicase RECQL2, RECQ3

248

WRNIP1 56897 DNA synthesis

XAB2 56949 DNA repair gene HCNP, SYF1

XPA 7507 DNA repair gene XP1, XPAC

XPC 7508 DNA repair gene

XPCC, P125, RAD4,

XP3

XRCC1 7515 DNA repair gene RCC

XRCC2 7516 Homologous recombination RAD51-Like

XRCC3 7517 Homologous recombination RAD51-Like, CMM6

XRCC4 7518 DNA repair gene

XRCC5 7520 DNA repair gene

KU80, KUB2, Ku86,

NFIV, KARP1

XRCC6 2547

Single-stranded DNA-dependent ATP-

dependent helicase, involved in DNA

non-homologous end joining. G22P1, KU70

XRCC6P2 389901 DNA repair gene

ZBTB32 27033

Transcription regulation and DNA

binding (involved in Fanconi anaemia) ZNF538

ZBTB44 29068 Transcription regulation ZNF851

ZBTB48 3104

Nucleic acid binding and transcription

factor activity HKR3, ZNF855, TZAP

ZCCHC7 84186 RNA degradation

ZMYM2 7750 Transcription factor ZNF198

ZNHIT4 83444


DNA replication and probably DNA

repair.

INO80B

ZSWIM7 125150 Involved in homologous recombination SWS1

249

Table A2.6. Genetic events identified by whole genome sequencing.

Sample ID

Gene Symbol C

hro

mo

som

e

Variation Type

Gene Region Start site End site

Refer-ence Allele

Alter-native Allele

Allelic Fracti-

on Protein Variant

LA-N-6 AIM2 1 SNV:DEL Exon chr1:

159032486 chr1:

159032486 65.38

CHLA-90 ATRX X SV:DEL

chrx: 76935119

chrx: 76959029

PARKNP ATRX X SV:DEL

chrx: 76924445

chrx: 77028694

PAISZV ATRX X SV:DEL

chrx: 76937155

chrx: 76983145

PAPTAN BARD1 2 SNV:DEL Exon chr2:

215645502 chr2:

215645522 42.86

PARXFT BARD1 2 SNV:DEL Exon chr2:

215645502 chr2:

215645522 45.45

PARGIW BRIP1 17 SV:TRA Intron chr17:

59796638 chr2:

14401098

SK-N-BE2c CARM1 19 SNV Exon chr19:

11031414 chr19:

11031414 C A 46.67 P472T

PAIFXV CCNT1 12 SV:DEL

chr2: 25957192

chr12: 104379378

SH-SY5Y CHEK2 22 SNV:DEL Exon chr22:

29091856 chr22:

29091856 75

CHLA-90 CREBBP 16 SV:DUP Intron chr16:

3885945 chr16:

3919341

COG-N-291 DDX60 7 SV:TRA Intron chr7:

116809191

COG-N-291 E2F2 1 SV:DEL

chr1: 3801505

chr1: 30723742

LA-N-6 EME2 16 SNV:DEL Exon chr16:

1823389 chr16:

1823389 43.48

PAPTAN FOXP1 3 SNV

Intron/base before

exon chr3:

71408396 chr3:

71408396 C T 46.67

COG-N-291 GEN1 2 SV:DEL

chr2: 1485200

chr2: 27254414

PARGIW HIST1H1B 6 SNV:DEL Exon chr6:

27834678 chr6:

27834692 38.46

PAISZV HIST2H2BC 1 SV:DEL

chr1: 110246334

chr1: 181216287

COG-N-291 HLTF 3 SNV Exon chr3:

148789089 chr3:

148789089 C A 61.54 D282Y

PARXFT IDH1 2 SNV:DEL Promoter chr2:

209120302 chr2:

209120302 35

PARGIW INO80C 18 SNV:DEL Promoter;

5'UTR chr18:

33077852 chr18:

33077859 55.56

PARXFT KDM6B 17 SNV:DEL Exon chr17:

7751858 chr17:

7751863 54.55

SH-SY5Y KRAS 12 SNV Exon chr12:

25398284 chr12:

25398284 C A 45.45 G12V

COG-N-291 MCM4 8 SNV Exon chr8:

48875559 chr8:

48875559 T G 45.83 F218V

250

CHW_11 MCM6 2 SNV Exon chr2:

136624255 chr2:

136624255 A T 52 I220N

SH-SY5Y MRE11A 11 SNV Exon chr11:

94226952 chr11:

94226952 C G 56.25

PARKNP MSH2 2 SNV:DEL Exon chr2:

47693814 chr2:

47693815 69.23

SK-N-FI NCL 2 SNV:DEL Exon chr2:

232325414 chr2:

232325416 57.89

COG-N-291 NCL 2 SNV:DEL Exon chr2:

232325414 chr2:

232325414 48.15

PAIFXV NCL 2 SNV:DEL Exon chr2:

232325414 chr2:

232325414 100

PAIFXV NCL 2 SNV:DEL Exon chr2:

232326655 chr2:

232326655 39.47

PAIFXV NCOA3 20 SNV:DEL Exon chr20:

46279814 chr20:

46279822 44.44

PARGIW NCOA3 20 SNV:DEL Exon chr20:

46279863 chr20:

46279865 100

PAISZV NCOR1 17 SV:DEL

chr17: 16095144

chr17: 16095626

PAPTAN NCOR2 12 SNV:DEL Exon chr12:

124887058 chr12:

124887069 63.64

PAPFSL NSMCE2 8 SNV:DEL Exon chr8:

126114595 chr8:

126114595 66.67

LA-N-6 POLM 7 SV:DEL

chr7: 31199193

chr7: 64005420

PAIFXV POLQ 3 SNV:DEL Exon chr3:

121208703 chr3:

121208705 50

PAIFXV POLR2A 17 SNV Exon chr17:

7405325 chr17:

7405325 G A 22.22 S819N

SK-N-FI PPP2R2A 8 SNV:DEL Intron chr8:

26150637 chr8:

26150637 60

SK-N-FI PRDM2 1 SNV:DEL Intron chr1:

14074949 chr1:

14074950 57.14

SK-N-BE2c PRMT2 21 SNV Intron chr21:

48056789 chr21:

48056789 C A 40

SK-N-BE2c PRMT5 14 SNV Intron chr14:

23393931 chr14:

23393931 G T 14.81

PARKNP RAD17 5 SNV:DEL Intron chr5:

68667048 chr5:

68667050 46.67

PAPFSL RAD23B 9 SNV:DEL Intron chr9:

110046745 chr9:

110046747 60

SH-SY5Y RAD23B 9 SNV:DEL Intron chr9:

110046745 chr9:

110046747 100

SH-SY5Y RAD51B 14 SV:INV Intron chr14:

68907987 chr14:

69297996

PARGIW RB1 13 SNV:DEL Exon chr13:

48878084 chr13:

48878092 40

PARGIW RBBP8 18 SNV:DEL Intron chr18:

20513542 chr18:

20513549 64.71

PARGIW RBL1 20 SV:TRA Intron chr20:

35627929

PAPFSL RECQL4 8 SNV Exon chr8:

145738660 chr8:

145738660 C T 30.77 V802M

SH-SY5Y RECQL5 17 SNV Exon chr17: chr17: G A 80 R175C

251

73658807 73658807

PARGIW RIF1 2 SNV:DEL Exon chr2:

152320880 chr8:

152320882 23.08

PAISZV SETDB1 1 SNV Exon chr1:

150934631 chr1:

150934631 C A 29.03 S1052*

PAPTAN SMAD3 15 SV:DEL Intron chr15:

67404674 chr15:

67405604

PARKNP SMARCA2 9 SV:DEL Intron chr9:

2147643 chr9:

2151529

SH-SY5Y SMARCA4 19 SNV Exon chr19:

11134251 chr19:

11134251 C T 44.44 R973W

SK-N-FI SMARCA4 19 SNV Exon chr19:

11170813 chr19:

11170813 C T 100

R1587*; R1590*; R1653*; R1621*; R1588*; R1591*

SH-SY5Y SMC3 10 SNV:DEL Splice Site;

Intron chr10:

112360304 chr10:

112360305 60

SK-N-BE2c SMG1 16 SNV Exon chr16:

18827823 chr16:

18827823 C A 36.36 S3368I

LA-N-6 SP1 12 SNV Exon chr12:

53777044 chr12:

53777044 T C 46.15

L431P; L438P; L390P

SK-N-BE2c SRCAP 19 SV:TRA Intron chr19:

2599286

CHLA-90 STAG1 3 SV:DEL

chr3: 135906165

chr3: 136313178

COG-N-291 TCEB3 1 SV:DEL

chr1: 30723742

PARKNP TDRD12 19 SNV Exon chr19:

33222697 chr19:

33222697 G A 45.83 D31N

SH-SY5Y TERT 5 SNV Promoter chr5:

1295228 chr5:

1295228 G A 60

PAPTAN TMEM201 1 SNV Exon chr1:

9671877 chr1:

9671877 C G 80 S611C

CHLA-90 TP53 17 SNV Exon chr17:

7577082 chr17:

7577082 C T 100

E127K; E247K; E154K; E286K

SK-N-FI TP53 17 SNV Exon chr17:

7577544 chr17:

7577544 A C 100

M246R; M114R; M207R; M87R

SK-N-BE2c TP53 17 SNV Exon chr17:

7578526 chr17:

7578526 C A 100

C96F; C3F;

C135F

CHLA-90 TP53 17 SNV:DEL Intron chr17:

7588679 chr17:

7588679 100

SH-SY5Y TRRAP 7 SNV Exon chr7:

98581778 chr7:

98581778 G T 28.57 G3004W; G3033W

SH-SY5Y TTI2 8 SNV Exon chr8:

33364825 chr8:

33364825 C A 52.63 L283F

PAPTAN UIMC1 5 SV:TRA Intron chr5:

176387600

252

SK-N-BE2c VCP 9 SNV Exon chr9:

35064279 chr9:

35064279 C A 37.5 E194*

PAPFSL WRNIP1 6 SNV:DEL Exon chr6:

2766363 chr6:

2766374 37.5

CHW_11 ZMYM2 13 SNV Exon chr13:

20580560 chr13:

20580560 G T 32 S449I

SNV, single nucleotide variation; SNV:DEL, deletion of 1-20 bp; SV:DEL, structural variation: deletion; SV:TRA, structural variation: translocation; SV:INV, structural variation: inversion.

THE EXTENSIVE PROLIFERATION OF HUMAN CANCER ...

Documents

Transcript of THE EXTENSIVE PROLIFERATION OF HUMAN CANCER ...