Syndecan-1 regulates v 5 integrin activity in B82L fibroblasts

2445Research Article

IntroductionExtracellular matrix proteins interact with a number of cellsurface adhesion receptors, stimulating signaling cascades thatregulate gene expression, proliferation, differentiation, cellshape and motility (Lukashev and Werb, 1998). Most matrixproteins contain binding domains for members of the integrinfamily of heterodimeric adhesion receptors in tandem withheparin-binding domains (HBDs) that mediate interactionswith cell surface proteoglycans. Although much study hasfocused on understanding the roles of integrins in transmittingsignals from the extracellular matrix to the cell interior(Giancotti and Ruoslahti, 1999), relatively little is known aboutthe roles of cell surface proteoglycans in these processes.However, several reports suggest that the proteoglycans, andespecially the syndecans, collaborate with integrins to formadhesion signaling complexes (Beauvais et al., 2004; Beauvaisand Rapraeger, 2003; Beauvais and Rapraeger, 2004;Couchman et al., 2001; Thodeti et al., 2003; Woods andCouchman, 2001).

Members of the syndecan family of cell surfaceproteoglycans are expressed on all adherent cells and engagematrix proteins including fibronectin (FN), vitronectin (VN),thrombospondin, laminin and fibrillar collagens via heparansulfate (HS)-glycosaminoglycan (GAG) chains attached tothe syndecan ectodomains (Couchman et al., 2001). This

engagement communicates to the cell via functional domainswithin the syndecan core protein (Beauvais et al., 2004;Beauvais and Rapraeger, 2004; Couchman, 2003; Couchmanet al., 2001; Tkachenko et al., 2005). Several studies havecharacterized functional sequences within the syndecancytoplasmic domains. Molecules that interact with thesyndecan cytoplasmic domains include signaling moleculessuch as PKC�, phosphatidylinositol (4,5)-bisphosphate andSrc (Kinnunen et al., 1998; Oh et al., 1997a) and scaffoldingproteins, including ezrin, syntenin and CASK (Granes et al.,2000; Grootjans et al., 1997; Hsueh et al., 1998). Other workhas demonstrated that the syndecan extracellular andtransmembrane domains also play important roles in theregulation of cell shape (Beauvais and Rapraeger, 2003;Kusano et al., 2004; Liu et al., 1998; McQuade and Rapraeger,2003; Munesue et al., 2002; Park et al., 2002; Tkachenko andSimons, 2002). The mechanisms by which these domainsregulate cell morphology are unknown, although theypresumably interact with partners that modulate cellularsignaling pathways.

One technique for testing syndecan-dependent regulation ofcell morphology is to plate cells on syndecan-specificantibodies. This technique targets a single syndecan familymember, compared with plating cells on matrix ligands thatengage multiple families of cell surface receptors, including

B82L mouse fibroblasts respond to fibronectin orvitronectin via a syndecan-1-mediated activation of the��v��5 integrin. Cells attached to syndecan-1-specificantibody display only filopodial extension. However, thesyndecan-anchored cells extend lamellipodia when theantibody-substratum is supplemented with serum, or lowconcentrations of adsorbed vitronectin or fibronectin, thatare not sufficient to activate the integrin when plated alone.Integrin activation is blocked by treatment with (Arg-Gly-Asp)-containing peptides and function-blocking antibodiesthat target ��v integrins, as well as by siRNA-mediatedsilencing of ��5 integrin expression. In addition, ��v��5-mediated cell attachment and spreading on highconcentrations of vitronectin is blocked by competitionwith recombinant syndecan-1 ectodomain core protein andby downregulation of mouse syndecan-1 expression bymouse-specific siRNA. Taking advantage of the species-

specificity of the siRNA, rescue experiments in whichhuman syndecan-1 constructs are expressed trace theactivation site to the syndecan-1 ectodomain. Moreover,both full-length mouse and human syndecan-1 co-immunoprecipitate with the ��5 integrin subunit, but fail todo so if the syndecan is displaced by competition withsoluble, recombinant syndecan-1 ectodomain. These resultssuggest that the ectodomain of the syndecan-1 core proteincontains an active site that assembles into a complex withthe ��v��5 integrin and regulates ��v��5 integrin activity.

Supplementary material available online athttp://jcs.biologists.org/cgi/content/full/119/12/2445/DC1

Key words: Syndecan-1, �v�5 integrin, Cell adhesion, Extracellularmatrix, Vitronectin, Proteoglycan

Summary

Syndecan-1 regulates ��v��5 integrin activity in B82LfibroblastsKyle J. McQuade1,*, DeannaLee M. Beauvais2,*, Brandon J. Burbach2 and Alan C. Rapraeger1,2,3,‡

Graduate Programs in 1Cellular and Molecular Biology, 2Molecular and Cellular Pharmacology and the 3Department of Pathology andLaboratory Medicine, University of Wisconsin-Madison, Madison, WI 53706, USA*These authors contributed equally to this work‡Author for correspondence (e-mail: [email protected])

Accepted 7 March 2006Journal of Cell Science 119, 2445-2456 Published by The Company of Biologists 2006doi:10.1242/jcs.02970

Jour

nal o

f Cel

l Sci

ence

2446

multiple syndecans. When transfected to express syndecan-1(Sdc1), proteoglycan-deficient Raji cells gain the ability tobind to Sdc1 antibody and spread on Sdc1 antibody-coatedsurfaces in two phases that depend on the syndecantransmembrane and ectodomains, respectively (Lebakken etal., 2000; Lebakken and Rapraeger, 1996; McQuade andRapraeger, 2003). Colon carcinoma cells spread when platedon antibodies specific to syndecan-2 (Sdc2) (Park et al., 2002).When grown on serum-coated substrata, these cells exhibit ahighly spread morphology, but revert to a rounded morphologywhen treated with recombinant Sdc2 ectodomain, suggestingan important role for this region of the core protein. Similarly,T lymphocytes extend filopodia when plated on a substratumcomprised of antibody directed against the syndecan-4ectodomain (Yamashita et al., 1999). Thus, antibody ligationof syndecans can trigger signaling leading to cell spreading,although the mechanisms of signaling are not clear.

Some studies demonstrate that the cellular response to theextracellular matrix involves engagement and cooperativesignaling between the integrins and syndecans. One of the firstdescriptions of this came from fibroblasts plated on fragmentsof FN. Although cells spread when plated on the cell-binding(e.g. integrin-binding) domain of FN, which binds the �5�1integrin, they fail to form focal adhesions unless syndecan-4(Sdc4) is also ligated by either adding the HBD-FN or Sdc4-specific antibody (Saoncella et al., 1999; Woods andCouchman, 2000; Woods et al., 1986). Engagement of Sdc4appears to stimulate Sdc4 oligomerization, and activation ofPKC�, a signal required for the assembly of focal contacts andstress fibers (Oh et al., 1997a; Oh et al., 1997b; Oh et al., 1998).Recent work indicates that this mechanism involves Sdc4working in concert with the �5�1 integrin (Mostafavi-Pour etal., 2003). In a similar mechanism, mesenchymal cells bind thedisintegrin domain of ADAM-12 via �1 integrins and interactwith the cysteine-rich domain of ADAM-12 via Sdc4 (Iba etal., 2000); cells that overexpress Sdc4 display increased levelsof activated �1 integrin (Thodeti et al., 2003), an activity thatrequires the Sdc4 cytoplasmic domain and PKC�.

Sdc2 also cooperates with integrins during focal adhesionassembly. Lewis lung carcinoma cells require both �5�1integrin and a cell surface proteoglycan to form stress fibersand focal adhesions when plated on FN. When Sdc2 expressionlevels are reduced by treatment with anti-sense RNA, theability of these cells to form focal adhesions is impaired(Kusano et al., 2000). Although the mechanism by which Sdc2stimulates the formation of focal adhesion is unknown, thissuggests that Sdc2 and Sdc4 share overlapping roles and/orcooperate in the regulation of focal adhesion formation(Kusano et al., 2004).

Recent work from our laboratory has demonstrated a cruciallink between Sdc1 and �v�3 integrin on carcinoma cells(Beauvais et al., 2004; Beauvais and Rapraeger, 2003).Ligation of Sdc1 via its ectodomain to either an antibodysubstratum or a matrix ligand leads to activation of the �v�3integrin. Anchorage solely via the syndecan to antibody causesthe cells to spread utilizing signaling from the activated �v�3integrin despite the fact that the integrin itself is not engagedby a ligand. On an �v�3-specific matrix ligand, such as VN,�v�3-dependent cell spreading and cell migration is blocked byshort-interfering RNA (siRNA) blockade of Sdc1 expression,or by competition with recombinant Sdc1 ectodomain (S1ED).

Journal of Cell Science 119 (12)

The activity of other integrins, such as the �5�1 or �v�1integrins, is not affected by these treatments. Moreover, thesiRNA blockade of endogenous human Sdc1 activity can bereversed by expression of a glycosylphosphatidylinositol-linked mouse Sdc1 ectodomain (mS1ED), albeit theectodomain must retain its HS chains, presumably to engagethe matrix. This suggests that this domain of the core proteinof the proteoglycan mediates its association into a cell surfacecomplex that regulates �v�3 activity.

Here, we describe similar techniques to examine the role ofSdc1 in adhesion signaling of mouse B82L fibroblasts. We findthat anchorage of Sdc1 by syndecan-specific antibody primesthe cells to respond to low concentrations of VN or FN,concentrations that would otherwise fail to trigger a cellularresponse. Although integrin inhibitory peptides and antibodiesdemonstrate a role for an �v-containing integrin, the cells donot express the �v�3 integrin. Rather, they express �v�5 – aclosely related but distinct family member. siRNA blockade of�5-subunit expression confirms that �v�5 is the target of Sdc1.Regulation of �v�5 integrin activity does not require the HS-GAG chains of Sdc1 – something that distinguishes Sdc1-mediated regulation of the �v�5 integrin from its regulation of�v�3. However, interactions of the ectodomain of the coreprotein of Sdc1 are required for the regulation of both integrinheterodimers because activity is blocked by competition withS1ED protein and by selective downregulation of Sdc1expression by siRNA. These data extend the emerging role ofSdc1 as a regulator of integrin activation.

ResultsSdc1 mediates spreading in B82L fibroblastsB82L mouse fibroblasts express approximately equal amountsof Sdc1 and Sdc4, and a lesser amount of Sdc2 (Ott andRapraeger, 1998). In this work, we questioned the potentialsignaling activity of Sdc1 during B82L-cell adhesion andspreading. Although Sdc1 binds to matrix ligands via its HS-GAG chains, these matrix ligands are likely to bind othersyndecans and integrins, thus confusing the adhesion assay.Therefore, the cells were plated on a nitrocellulose substratumcoated with mouse Sdc1-specific antibody mAb 281.2. Within15-20 minutes of plating, 60-90% of the adherent cells extendnumerous filopodia up to 20 �m from the cell body (Fig. 1C).This response is specific for Sdc1, because cells plated onantibody against Sdc4, which is expressed at equivalent levelson these cells, bind via Sdc4 but fail to spread (Fig. 1E).

The filopodial extension observed upon Sdc1 ligation is onlya partial spreading response compared with the response ofcells grown in serum. Indeed, adding 10% serum to the platingmedium induces cells adherent to mAb 281.2 to spread moreextensively (Fig. 1D). This response is specific for Sdc1,because cells adhering to Sdc4-specific antibody (Fig. 1F) orplated on non-specific antibody (Fig. 1B) fail to spread inresponse to serum.

Sdc1 ligation enhances cell spreading on low levels ofVN and FNAlthough the nitrocellulose substratum coated with antibody isblocked with BSA, it appears that small amounts of matrixligand in serum are sufficiently adsorbed to the substratum tostimulate signaling through an integrin that is activated whenSdc1 is ligated. Indeed, when antibody-coated and blocked

Jour

nal o

f Cel

l Sci

ence

2447Syndecan-1 regulates �v�5 integrin

substrata are pre-incubated with serum and then washed priorto the addition of cells, complete spreading still occurs (datanot shown), duplicating the spreading response seen in thepresence of serum (cf. Fig. 1D).

To directly test whether small amounts of VN and FN arecapable of modulating cell spreading, B82L fibroblasts were

added to wells on which Sdc1 antibody was co-coated withlimiting dilutions of VN (Fig. 2) and FN (see Fig. S1 insupplementary material). In the absence of Sdc1-specificantibody, B82L-cell binding and spreading requires relativelyhigh plating concentrations of VN (5 �g/ml) or FN (60 �g/ml).Even a twofold reduction in this amount completely abolishesbinding (data not shown). However, cells in which Sdc1 isengaged by plating on mAb 281.2 (which normally inducesfilopodial extension) will spread with a fusiform morphologywhen as little as 0.2 �g/ml VN or 1 �g/ml FN, a level that byitself is insufficient to sustain adhesion, is co-plated with theantibody.

One possible explanation for increased sensitivity to thesematrix ligands is that the Sdc1 bound to antibody simplytethers cells to the substratum and facilitates their interactionwith low levels of matrix ligands to which cells would normallynot adhere. To test this possibility, cells were plated onsubstrata co-coated with an antibody directed against theectodomain of Sdc4, a syndecan that is expressed at equallevels to Sdc1 (Ott and Rapraeger, 1998). Because of theiranchorage to the antibody, cell binding is seen either withantibody alone or with the mixed antibody and matrix ligandsubstrata (Fig. 2 and supplementary material Fig. S1).However, the cells fail to spread on Sdc4 antibody alone orwhen the antibody is supplemented with low concentrations ofVN or FN. They spread only when VN or FN reaches aconcentration that promotes adhesion and spreading on itsown, e.g. 5 �g/ml VN and 60 �g/ml FN (Fig. 2 andsupplementary material Fig. S1). This demonstrates thatanchorage to the substratum by itself is insufficient for thematrix-dependent spreading response, and suggests that Sdc1ligation is required to ‘activate’ B82L cells to interact with andrespond to low levels of VN and FN.

Response to VN and FN requires the �v�5 integrinThe classical receptors for VN and FN are members of theintegrin family of heterodimeric adhesion receptors. Interactionsbetween integrins and these extracellular matrix proteins aremediated largely by Arg-Gly-Asp (RGD)-sequences found

Fig. 1. Sdc1 mediates cell spreading in B82L fibroblasts. B82L cellswere plated on nitrocellulose coated with 60 �g/ml non-immunemouse IgG (A,B), 60 �g/ml mAb 281.2 (C,D) or 200 �g/ml S4EDpAb (E,F). Fetal bovine serum (FBS) (10%) was added to cellsplated in B, D and F. Cells were incubated for 2 hours then fixed withparaformaldehyde and stained with Rhodamine-conjugatedphalloidin. Bar, 50 �m.

Fig. 2. Vitronectin inducescomplete spreading of B82Lfibroblasts. B82L cells wereplated on wells co-coated withincreasing amounts of VN and60 �g/ml mAb 281.2, 150�g/ml S4ED pAb or in theabsence of antibody. Cells wereallowed to spread 2 hoursbefore fixation and labelingwith Rhodamine-phalloidin.Bar, 50 �m.

Jour

nal o

f Cel

l Sci

ence

2448

within many matrix proteins. Indeed, the spreading of B82L cellson either VN or FN alone, or on a mixed substratum with Sdc1-specific antibody, is blocked by RGD-containing peptides,including the cycloRGDfV peptide (Aumailley et al., 1991;Brooks et al., 1996) known to specifically target �v-containingintegrins (see Fig. S2 in supplementary material). Similar results(data not shown) are obtained by treating cells with mAbH9.2B8, an antibody that blocks mouse �v integrin function(Moulder et al., 1991). The �v�1 and �v�3 integrins areexpressed on fibroblasts and are well-known to act as VN or FNreceptors (Sanders et al., 1998). The �v�5 integrin has also beenshown to be involved in fibroblast cell spreading on VN and FN(Pasqualini et al., 1993; van Leeuwen et al., 1996), although itsrecognition of FN is more controversial. Analysis of integrinexpression of the B82L cells by flow cytometry shows that theyexpress the �v integrin subunit, but relatively low amounts of the�1 integrin subunit and little or no �3 (Fig. 3A). Furthermore,B82L fibroblasts treated with �1 or �3 integrin inhibitoryantibodies, mAb HM�1-1 (Noto et al., 1995) or mAb 2C9.G2(Yasuda et al., 1995), respectively, or with both antibodiestogether, show no effect on adhesion or spreading on Sdc1antibody plus VN or FN or on high concentrations of matrixligand alone (data not shown).

These data suggest the �v�5 integrin as a candidate for Sdc1regulation. Unfortunately, neither inhibitory antibodies to the

mouse �5 subunit nor antibodies amenable for use in flowcytometry are currently available. However, Ab1926 binds thecytoplasmic domain of the �5 subunit and western blot analysisof B82L cell lysates shows expression of this integrin subunit(Fig. 3B). To test the role of the �v�5 integrin in Sdc1-regulatedcell spreading, an siRNA oligonucleotide specific for themouse �5 subunit was used to block �v�5 integrin expression.Transfection of cells with this siRNA reduces expression of�v-containing integrin by approximately 90%, as shown bymonitoring �v integrin expression by flow cytometry (Fig. 3A).This correlates with a similar reduction in �5 subunitexpression upon treatment with a range of siRNAconcentrations on western blots (Fig. 3B,C). The siRNA hasno effect on expression of mouse Sdc1 or that of other integrin�-subunits (Fig. 3A). Finally, it is observed that cells treatedwith 800 nM siRNA to block expression of �5 integrin fail torespond to either VN or FN when plated on these ligandstogether with Sdc1 antibody, even at high concentrations ofVN or FN that are sufficient to promote cell spreadingwithout Sdc1 antibody (Fig. 3D and supplementary materialFig. S3). Cells plated on Sdc1 antibody alone, which normallyextend filopodia (Fig. 1C), continue to do so despite theblockade of �5 integrin expression (inset, Fig. 3D), whichindicates that the �v�5 integrin is not required for thisspreading response.


Fig. 3. siRNA blockade of �5-subunit expression blockssyndecan-induced cellspreading. (A) Suspended cellsare analyzed by flow-cytometry with antibodiescapable of recognizing mouse�1 (HM�1-1), �3 (2C9.G2) or�v (H9.2B8) integrin subunits,mAb 281.2 specific for mouseSdc1, or nonspecific IgGcontrol (gray fill). Cells treatedwith �5-integrin-specific orcontrol siRNA are compared.(B) Representative westernblot of lysates of cells treatedwith 0, 200, 400, 600 or 800nM �5-specific siRNA andprobed for expression of �5-integrin subunit. FAKexpression levels are shown asa loading control. (C)Quantification (± s.e.) ofrelative �5 integrin subunitexpression from duplicate blotsas described in (B). (D) B82Lcells were plated on wellscoated with 60 �g/ml mAb281.2 and increasing amountsof VN after treatment with �5-integrin-specific or controlsiRNA. Cells were allowed tospread 2 hours before fixationand labeling with Rhodamine-phalloidin. Bar, 50 �m.

Jour

nal o

f Cel

l Sci

ence


�v�5-dependent cell attachment and spreading requiresthe Sdc1 ectodomain but not its HS-GAG chainsThe loss of Sdc1-regulated cell spreading in cells transfectedwith �5 siRNA indicates that the �v�5 integrin is the �v-bearingintegrin targeted by the syndecan. To test what domain(s) ofthe syndecan is required for this activity, endogenous mouseSdc1 expression was silenced with mouse-specific siRNA

(directed against the 3�-untranslated region) and subsequentlyreplaced either by expression of human Sdc1 constructs ora mouse Sdc1 construct, comprised of GPI-linked mouseSdc1 ectodomain alone (GPI-mS1ED) that lacks the siRNA-targeting sequence (Fig. 4 and supplementary material Fig.S4). Transfection with siRNA efficiently silences endogenousmouse Sdc1 by ~98% as indicated by FACS (Fig. 4A and

Fig. 4. Downregulation of mouse Sdc1 expression by siRNA blocks�v�5-dependent cell attachment and spreading on vitronectin. FACSor immunoblot analysis for (A,F) mouse Sdc1 (mAb 281.2), (B) �vintegrin subunit (mAb H9.2B8), (C) mouse Sdc4 (mAb KY8.2), (D)human Sdc1 (mAb B-B4) and (E) FcRecto-hS1 chimera (FITC-conjugated hIgG) expression against isotype IgG controls (red fill) invector NEO (A-C), human Sdc1 (D), FcRecto-hS1 (E) and GPI-mS1ED(F) expressing B82L cells 48 hours after transfection with either 600nM control (Control) or mouse Sdc1-specific siRNA (siRNA). (G)B82LNEO empty vector-transfected control cells and B82L cellsexpressing human Sdc1, the FcRecto-hS1 or GPI-mS1ED chimerawere transfected with control or mouse Sdc1-specific siRNA and seeded on wells coated with either 5 �g/ml VN alone or a mixed substratumof VN plus 60 �g/ml of antibody directed against mouse Sdc1 (281.2), human Sdc1 (B-B4) or the FcRecto-hS1 chimera (hIgG). Cells wereincubated at 37°C for 2 hours, fixed and stained with Rhodamine-conjugated phalloidin. Bar, 50 �m.

Jour

nal o

f Cel

l Sci

ence

2450

supplementary material Fig. S4A) and western blot analysis(Fig. 4F). Importantly, the mouse Sdc1 siRNA does not affectthe expression of �v�5, as indicated by western blotting (datanot shown) and FACS analysis of the �v integrin subunit (Fig.4B), and does not affect the expression of endogenous mouseSdc4 (Fig. 4C) or the ectopic human Sdc1 (Fig. 4D-E andsupplementary material Fig. S4B-C) and GPI-mS1ED (Fig.4F) constructs. These results suggest that the siRNA is bothspecies and syndecan-type specific.

In contrast to parental or control siRNA-transfected cells,B82L vector-control cells (NEO) transfected with mouse Sdc1-siRNA fail to attach and spread to wells coated with either5 �g/ml of VN alone (Fig. 4G, right column) or a mixedsubstratum of 5 �g/ml of VN plus 60 �g/ml of mAb 281.2 (Fig.4G, left column). The failure of these cells to even engage themixed substratum clearly indicates the efficient blockade ofmouse Sdc1 expression by siRNA. It is unlikely that the mouseSdc1-siRNA treatment has any non-specific cellular effectssince spreading on VN alone or on a mixed substratum of VNplus Sdc1 antibody (60 �g/ml mAb B-B4) is specificallyrescued by the expression of full-length human Sdc1 (hS1,Fig. 4G). Notice that B82L-hS1 cell spreading on VN aloneis indistinguishable from either parental or NEO cells.Intriguingly, similar rescue was observed in cells expressinghuman Sdc1 mutants, hS1pLeuTM and hS1�cyto (see Fig. S4Din supplementary material), indicating that neither thetransmembrane nor the cytoplasmic domain of the syndecan isrequired for the spreading response. This was further confirmedwith cells that express GPI-linked Sdc1 ectodomain alone (GPI-mS1ED, Fig. 4G). Cells expressing this chimera recoverspreading on a VN substratum, either in the presence or absence

of Sdc1 antibody. However, cells expressing the FcRecto-hS1chimera – a construct in which the ectodomain of syndecan isreplaced by that of the human Fc� receptor Ia (FcRecto-hS1, Fig.4G) – fail to recover spreading, regardless of whether the cellsare plated on VN alone or VN is supplemented with 60 �g/mlof hIgG to engage the FcRecto-hS1 construct. These resultssuggest that �v�5 integrin activity depends on Sdc1 expressionand that the ectodomain of syndecan is both necessary andsufficient to regulate such activity.

The regulation of �v�3 integrin activity by Sdc1 on matrixligands has been shown to require syndecan engagement of thematrix via its HS chains (Beauvais et al., 2004). To test theGAG requirement for �v�5 activity, cells were pretreated for 2hours with HS-specific and chondroitin-sulfate-specific lyasesand plated in the presence of these enzymes (Fig. 5). TreatedB82L cells fail to bind HBD-FN (used as a test for the efficacyof GAG removal) whereas untreated cells bind and rapidlyextend filopodia, assuming morphologies similar to that seenwhen cells are bound to a Sdc1 antibody substratum (Fig.5A,B). However, GAG removal has no effect on the filopodialextension or complete cell spreading observed either on Sdc1antibody alone (Fig. 5C-E), antibody mixed with lowconcentrations of VN (Fig. 5F-H) or FN (Fig. 5H), or highconcentrations of VN (Fig. 5I-K) or FN alone (Fig. 5K).

The failure of GAG removal to affect the Sdc1-dependentcell spreading suggests that signaling leading to spreadingrelies on an interaction with the syndecan core protein. To testthis, B82L cells were plated on 5 �g/ml VN in the presence ofa recombinant GST fusion protein containing either theectodomain of mouse Sdc1 (GST-mS1ED) or human Sdc1(GST-hS1ED; data not shown). Because the fusion protein is


Fig. 5. GAG chains are not required for filopodialextension or complete B82L cell spreading. B82Lcells were detached using EDTA and treated insuspension either without (A,C,F,I) or with acombination of heparinases I and III andchondroitin ABC lyases (B,D,G,J) for 2 hoursbefore plating on 200 �g/ml HBD-FN (A,B), 60�g/ml mAb 281.2 (C,D), 60 �g/ml plus 1 �g/mlVN (F,G) or 5 �g/ml VN (I,J). Quantification oftreated (white bars) or untreated (gray bars) cellextension of filopodia on 60 �g/ml mAb 281.2 (E)or complete cell spreading on mAb 281.2supplemented with 1 �g/ml VN or 3 �g/ml FN(H) or complete cell spreading on 5 �g/ml VN or60 �g/ml FN (K) is also shown. Bar, 50 �m.

Jour

nal o

f Cel

l Sci

ence


derived from bacteria, it does not contain attached GAG chains.GST-mS1ED and hS1ED display similar activity; competitionoccurs at the lowest concentration tested (1 �M) withincreasing blockade of cell attachment and spreading over aconcentration range of 1-30 �M of S1ED (Fig. 6A,B). Similarresults are obtained with GST-mS1ED and B82L-hS1 cellsattached to a mixed substratum of mAb B-B4 and 1 �g/ml VN(data not shown). Notice that, mS1ED is not recognized by thehuman specific mAb B-B4 and thus does not compete forhuman Sdc1 engagement of the antibody substratum.Moreover, the fusion protein has no effect on the ability of

these cells to extend filopodia when plated on an antibodysubstratum alone (data not shown). Competition with 30 �MGST alone is without effect in all cases, as is competition withidentical concentrations of recombinant GST-mS4EDindicating that competition for syndecan-regulated �v�5activity is S1ED-specific.

Further, immunoprecipitation of Sdc1 (Fig. 7C) withmonoclonal antibodies directed against endogenous mouseSdc1 (281.2) or ectopically expressed human Sdc1 constructs(B-B4) reveals �5 integrin (Fig. 7A,B) in the immunecomplexes isolated from B82L-NEO, B82L-hS1, B82L-hS1pLeuTM and B82L-hS1�cyto cell lysates. Similar results wereobtained with an affinity-purified pan-syndecan antibody that

Fig. 6. B82L-cell spreading on VN is blocked by recombinant S1ED.(A) B82L fibroblasts were plated on 5 �g/ml VN in the absence ofother treatment, or in the presence of 30 �M GST, 1-30 �M GST-mS1ED or 30 �M GST-mS4ED (inset), then fixed and stained withRhodamine-phalloidin for visualization. (B) Quantification of celladhesion in triplicate samples (± s.e.) plated either with no additions,or concentrations of GST-mS1ED ranging from 0-30 �M. Bar, 50 �m.

Fig. 7. Co-immunoprecipitation of �5 integrin with Sdc1 requires theSdc1 ectodomain. Western blots probed with rabbit polyclonal �5integrin (A,B), pan-syndecan or S1ED (C) antibody for detection of�5 integrin and Sdc1, respectively, in immune complexes isolatedafter immunoprecipitation of full-length mouse Sdc1 (mAb 281.2),human Sdc1 constructs (mAb B-B4) and FcRecto-hS1 chimera (mAb10.1) from pre-cleared B82L whole-cell lysates. In S1ED-competition experiments (A), 30 �M soluble GST, GST-mS1ED(with mAb B-B4) or GST-hS1ED (with mAb 281.2) was added tothe reaction mixture. Provided as a reference is a methanolprecipitation (MeOH) of 300 �g of whole-cell lysate. �5 integrinimmunoblotting reveals a 110 kDa band, under reduced conditions,detectable in the mouse Sdc1 and select human Sdc1 (hS1, pLTM,�cyto), but not FcRecto-hS1 chimera immunoprecipitates orimmunoprecipitates isolated with antibody isotype control IgG:mouse IgG1 (mIgG) for mAbs B-B4 and 10.1 and rat IgG2A (rIgG)for mAb 281.2.

Jour

nal o

f Cel

l Sci

ence

2452

recognizes the ten C-terminal amino acids of Sdc1 with theexception of hS1�cyto, which lacks these amino acids (data notshown). �5 integrin is not detectable in mAb B-B4 isolatedimmune complexes from B82L-NEO cells that are notexpressing human Sdc1 (data not shown) nor in isotype IgGcontrols (Fig. 7A,B, mIgG and rIgG). Moreover, �5 integrin isnot present in immune complexes isolated from B82L-NEOcell lysates using mAb KY8.2 (Fig. 7A) – an antibody directedagainst mouse Sdc4 (Yamashita et al., 1999). These resultsindicate that Sdc1 and the �5 integrin are present in a cellsurface complex and Sdc1-specific association within thiscomplex is conserved between mouse and human. By contrast,�5 integrin is not detectable with immunoprecipitated FcRecto-hS1 chimera isolated by mAb 10.1 (Fig. 7B,C), human IgG orpan-syndecan antibody (data not shown) from FcRecto-hS1-expressing cells, but is associated with the endogenous mouseSdc1 immunoprecipitated with mAb 281.2 (Fig. 7B). Thissupports the conclusion that association of the syndecan withthe �5 integrin depends on the Sdc1 ectodomain. To test thismore directly, the immunoprecipitations were conducted withspecies-specific Sdc1 antibody in the presence of 30 �M GST-S1ED protein (competitive inhibitor of the integrin activation)from the opposite species (e.g. mS1ED with human-specific B-B4 and hS1ED with mouse-specific 281.2 to avoid recognitionby the antibody). This demonstrates that GST-S1ED proteinefficiently disrupts the association of the �5 integrin with Sdc1(Fig. 7A, S1ED). Addition of GST alone is without effect (Fig.7A, GST). These results suggest that the inhibition observedin the VN cell spreading assays upon treatment with solubleS1ED protein (Fig. 6) is due to perturbation of the associationof �v�5 integrins with cell surface Sdc1 leading to a loss inintegrin activity.

DiscussionThe �v�5 integrin is expressed on a variety of tissues and celltypes, including endothelia, epithelia and fibroblasts (Felding-Habermann and Cheresh, 1993; Pasqualini et al., 1993). It isclosely related to the �v�3 integrin (56.1 % identity and 83.5%homology between the two integrin �-subunits) but isdistinguished from the �v�3 by divergent sites near its ligand-binding domain and within the C-terminus of its cytoplasmicdomain (McLean et al., 1990). It has a role in matrix adhesionto VN, FN, SPARC and bone sialoprotein (Plow et al., 2000)and is implicated in the invasion of gliomas and metastaticcarcinoma cells (Brooks et al., 1997; Jones et al., 1997; Tonnet al., 1998), the latter especially to bone (De et al., 2003). Asecond major role is in endocytosis, including endocytosis ofVN (Memmo and McKeown-Longo, 1998; Panetti andMcKeown-Longo, 1993; Panetti et al., 1995), the engulfmentof apoptotic cells by phagocytes (Albert et al., 2000) andparticipation in the internalization of shed outer rod segmentsin the retinal pigmented epithelium (Finnemann, 2003a;Finnemann, 2003b; Hall et al., 2003). A third major role is ingrowth-factor-induced angiogenesis, where cooperativesignaling by the �v�5 integrin and growth factors regulatesendothelial cell proliferation and survival. Angiogenesispromoted by VEGF and TGF� in human umbilical-veinendothelial cells relies on signaling together with the �v�5integrin, whereas FGF-2 and tumor necrosis factor-�collaborate with the �v�3 integrin (Eliceiri and Cheresh, 1999;Friedlander et al., 1995).

Several studies have demonstrated that members of thesyndecan family of cell adhesion receptors cooperate withintegrins to mediate signals that regulate cytoskeletalrearrangements and cell shape. Work from this laboratory hasdescribed a prominent role for Sdc1 in regulating the activityof the �v�3 integrin in MDA-MB-231 and MDA-MB-435breast carcinoma cells (Beauvais et al., 2004; Beauvais andRapraeger, 2003). Although the mechanism remains unclear, aregion of the Sdc1 ectodomain appears to regulate the activestate and signaling of the integrin. Experiments presented heredescribe a similar mechanism by which Sdc1 regulates theactivity of the �v�5 integrin in murine B82L fibroblasts. Thesecells are particularly useful for this study because they expressa limited repertoire of integrin receptors, dominated by the�v�5 integrin.

Ligation of Sdc1 alone, using a substratum consisting ofsyndecan-specific antibody or the HBD-FN, leads to B82L-celladhesion but incomplete cell spreading, e.g. the extension offilopodia, suggesting that ligation of the syndecan alonegenerates a signal. Prior work with Sdc1 expressed in Rajilymphoid cells demonstrated that ligation of Sdc1 generatestwo phases of signaling. The first results in formation of abroad lamellipodium and depends on the Sdc1 transmembranedomain; the second induces cell polarization, an activity thattraces to the Sdc1 ectodomain (McQuade and Rapraeger,2003). Like the Raji cell-signaling responses, the Sdc1-mediated filopodial extension seen here does not require theSdc1 cytoplasmic tail (data not shown) and appears to beintegrin-independent. It is not blocked by treatment of the cellswith RGD peptides, soluble S1ED protein, which perturbs asyndecan-integrin interaction, or siRNA-targeted silencing ofintegrin expression. However, providing trace amounts of VNor FN to B82L cells already anchored to a Sdc1 antibodyreveals an integrin-related activity of the syndecan, namely,extensive cell spreading via syndecan-regulated signaling ofthe �v�5 integrin. These data might help explain the apparentlink between Sdc1 and �v�5-dependent turnover of VN(Wilkins-Port et al., 2003). The regulation of integrin activityby Sdc1 might occur either by altering integrin activationand/or by altering integrin signaling in response to the ligand(i.e. post-receptor occupancy events). Integrin activation or‘priming’ (Carman and Springer, 2003) is classically definedas adopting the conformation necessary to bind ligand, often aresponse to inside-out signaling. However, the integrin can alsobe regulated by lateral interactions with other membraneproteins. Examples of receptors that regulate integrin activationthrough lateral interactions include uPAR/CD87 andIAP/CD47, which regulate �v�3- and �v�5-binding to VN andadhesion-dependent signaling events, tetraspanins, andchondroitin sulfate proteoglycan NG2, which interacts with the�4�1 integrin (Dedhar, 1999; Iida et al., 1998; Iida et al., 2001;Kugler et al., 2003; Porter and Hogg, 1998). Integrin activationis also enhanced by its binding to matrix ligand, whichstimulates ‘outside-in’ signals necessary for cell spreading.These include activation of FAK, Rho GTPases, PI3-kinase andother pathways (Carman and Springer, 2003; Dedhar, 1999;Liddington and Ginsberg, 2002).

In the B82L fibroblasts, it is envisioned that the syndecanassembles into a cell surface signaling complex that isnecessary for �v�5 integrin signaling (Fig. 8), although it is notentirely clear what other receptors, if any, are in the complex.


Jour

nal o

f Cel

l Sci

ence


What are the features of this complex? One feature is thatanchorage of the syndecan to the substratum appears to lowerthe threshold for integrin activation by VN or FN. Thus, if Sdc1is engaged by antibody, then low concentrations of matrixligand appear sufficient to activate the integrin and lead tosignaling. The simplest explanation would be that the syndecansimply anchors the cell to the substratum so that the integrincan engage the limited amounts of matrix ligand. However, thisexplanation appears to be ruled out by the fact that engagementof Sdc4 with antibody, which also anchors the cells to thesubstratum, does not result in �v�5 integrin-dependentsignaling. Alternatively, it is possible that the specificity arisesfrom Sdc1 and �v�5 integrin being in a complex together, suchthat anchorage of Sdc1 clusters the integrin as well as bringingit into close apposition to the matrix ligands – a contention

strongly supported by the immunoprecipitation data presentedhere. As such, cells adhering via Sdc4 are presumably notprimed to bind VN and FN, because Sdc4, which possesses avery different ectodomain (both in size and sequence) relativeto Sdc1, fails to interact with the integrin.

A second feature is that the syndecan HS chains are notrequired for integrin activation, either on syndecan antibody oron matrix ligand. The syndecan HS chains, at least on the B82Lcells, do not appear to bind VN or FN sufficiently well for thecells to strongly adhere, and cell binding occurs only atsufficiently high matrix concentrations for the integrin tobecome engaged. Here, the high concentration of matrix ligandcan presumably bind and activate the integrin and triggeroutside-in signaling. Nonetheless, this signaling also requiresSdc1, because the third feature of this complex is that the

Fig. 8. Model of Sdc1-regulated �v�5-integrin signaling.

Jour

nal o

f Cel

l Sci

ence

2454

integrin-mediated cell adhesion and spreading on these matrixligands is blocked by recombinant S1ED and by selectivedownregulation of Sdc1 expression with siRNA. Integrin-mediated cell spreading on VN is rescued in mouse Sdc1-siRNA transfected cells by expression of full-length humanSdc1 or GPI-mS1ED, which contains only the Sdc1ectodomain, but not by a Sdc1 mutant lacking its ectodomain(FcRecto-hS1). Moreover, immunoprecipitation of the syndecanbrings down �5 integrin with full-length Sdc1, either mouse orhuman, but not with FcRecto-hS1, despite the fact that thischimera retains the human Sdc1 transmembrane andcytoplasmic domains.

These features suggest that the syndecan and the integrin arein a complex together and that interactions of the Sdc1ectodomain within the complex, which can be disrupted bysoluble S1ED or by siRNA-mediated removal of the syndecanfrom the cell surface, are necessary for �v�5-integrin signaling.Whether the interaction of the syndecan with the integrin isdirect or indirect is not yet known, but it is known thatsequences within the �5 ectodomain regulate integrin post-ligand-binding signaling events (Filardo et al., 1996). Thissuggests that �v�5-dependent cellular responses depend onsignals transmitted by the syndecan as a laterally associatedprotein, to include the activation of PKC, which is required for�v�5-dependent cell spreading and migration (Klemke et al.,1994; Lewis et al., 1996; Yebra et al., 1995) and endocytosisof VN (Panetti et al., 1995).

This model is similar to the regulation of the �v�3 integrinin mammary carcinoma cells (Beauvais et al., 2004), but hastwo significant differences. First, activation of the �v�3 integrinby Sdc1 requires that the Sdc1 ectodomain is engaged, eitherdirectly to antibody or via its HS chains to a matrix ligand.Surprisingly, ligation of the syndecan alone is sufficient toactivate �v�3, but activation of the integrin is specific for Sdc1,because it cannot be recapitulated by adhesion of the cells viaSdc4. Heparinase removal of the HS chains (unpublished data)or expression of a Sdc1 mutant lacking HS chains prevents�v�3 signaling when mammary carcinoma cells are plated onVN. By contrast, �v�5 activation in B82L cells still occurson VN after removal of the HS chains of syndecan withheparinases. In this case, ligation of the syndecan is renderedmoot for the simple reason that Sdc1 is probably constitutivelyassociated with the �5 integrin and it is this association thatappears important for �v�5-dependent signaling. Therefore,regardless of whether one or both receptors engage thesubstratum, engagement of one is sufficient to localize theother into the signaling complex via an ectodomain interaction.In the case of �v�3-integrin signaling, however, engagement ofthe syndecan to the substratum is probably required to bringthe syndecan and integrin together in a complex. Second,anchorage of the Sdc1 alone to the substratum, e.g. to a Sdc1-specific antibody, is sufficient to activate signaling from the�v�3 integrin in mammary carcinoma cells, whereas the �v�5integrin on B82L fibroblasts does not signal upon syndecanengagement unless the integrin is also provided with a ligand.This suggests that the �v�3 integrin in epithelial cells does notneed to perform an adhesion role per se, but transduces signalswhen activated by syndecan engagement. The integrin couldcontribute by directly assembling into a signaling complexwith the syndecan or could act as a downstream effector thatrelays signals required to reorganize the cytoskeleton. An

opposite result is observed for the �v�5 integrin in B82L cells.Here, the syndecan does not need to perform an adhesion role,but does need to be in a complex with the �v�5 integrin in orderfor the integrin to engage the matrix and transduce signals.Association of the integrin with the syndecan via theectodomain may be required for the integrin to adopt an activeconformation, to localize the integrin to a particular membranemicrodomain and/or to associate with certain downstreameffectors. Although these differences may be subtle, they mayprovide insight into different mechanisms by which thesyndecan regulates these two related integrins.

Materials and MethodsCell culture and molecular biologyB82L mouse fibroblasts (provided by Paul Bertics, University of Wisconsin-Madison) were cultured in Dulbecco’s modified Eagle’s medium (DMEM)supplemented with 10% FBS, 4 mM L-glutamine and antibiotics, as previouslydescribed (Ott and Rapraeger, 1998). Human Sdc1 cDNA was provided by MarkkuJalkanen (University of Turku, Finland) in pBGS. The coding sequence was PCRamplified from pBGS, cloned into the KpnI and XhoI sites of pcDNA3 (Invitrogen)and verified by sequencing. Human Sdc1 mutants in pcDNA3, including FcRecto-hS1 (a chimera comprised of the ectodomain of human IgG Fc� receptor Ia/CD64fused to the transmembrane and cytoplasmic domains of human Sdc1), hS1�cyto

(lacking the 33 C-terminal amino acids) and hS1pLeuTM (transmembrane domainreplaced with leucine residues), were constructed with human-specific primersand/or methods previously described (McQuade and Rapraeger, 2003). GPI-mS1ED(Liu et al., 1998), a chimera comprised of the ectodomain of mouse Sdc1 fused tothe glycosylphosphatidylinositol (GPI) tail of rat glypican-1, in pcDNA3 wasgenerously provided by Ralph Sanderson (University of Arkansas for MedicalSciences, Little Rock, AR). Cells were transfected with pcDNA3 alone, human Sdc1expression constructs or GPI-mS1ED using LipofectAMINE (Invitrogen) and thehighest 10% of cells immunoreactive for mAb B-B4 (full-length hS1, hS1�cyto andhS1pLeuTM), mAb 281.2 (GPI-mS1ED) and mAb 10.1 (FcRecto-hS1) were sorted byflow cytometry. After sorting, the cells were maintained in medium containing 300�g/ml geneticin (Gibco BRL). Cells were passaged 1:20 every 3 days and grownto 60-80% confluency for experiments.

Cell-spreading assaysCell-spreading assays were performed with modification to our previous procedures(Lebakken and Rapraeger, 1996). Briefly, ligands were applied to nitrocellulose-coated ten-well slides (Erie Scientific) and incubated for 1-2 hours at 37°C. Ligandsused in this study include the Sdc1-specific mAb 281.2 (Jalkanen et al., 1985) andmAb B-B4 (Serotec), an affinity-purified rabbit polyclonal antibody (S4ED pAb)generated against the mouse Sdc4 ectodomain (amino acids 1-120) fused to the C-terminus of glutathione-S-transferase (GST-mS4ED; (McFall and Rapraeger, 1998),human plasma VN and FN and recombinant HBD-FN. A GST fusion proteinconsisting of either mouse or human S1ED (mS1ED, amino acids 1-233 or hS1ED,amino acids 1-232) was also used as a competitor in cell adhesion studies (Beauvaisand Rapraeger, 2003; McFall and Rapraeger, 1998). Slides were blocked with 1%heat-denatured bovine serum albumin (hdBSA) for a minimum of 30 minutes at37°C. B82L cells were detached from the substratum using 5 mM EDTA in Tris-buffered saline and resuspended in HEPES-buffered culture medium containing0.1% hdBSA or, in appropriate experiments, 10% FBS. Cells were plated at adensity of 15,000 cells per well and allowed to attach and spread for 2 hours priorto fixation in 4% paraformaldehyde in CMF-PBS. For fluorescence microscopy,fixed cells were permeabilized in 0.2% Triton X-100, labeled with Rhodamine-conjugated phalloidin and analyzed with a Nikon Microphot-FX microscope(Nikon, Inc.) equipped with a cooled CCD camera and Image-Pro Plus software(Media Cybernetics). Cells extending five or more fingerlike projections werescored as extending filopodia, whereas cells spreading with a diameter of at least25 �m and without filopodia were scored as completely spread. Spreading wasquantified from a minimum of triplicate wells and is shown as the mean ± standarderror (s.e.). For antibody and mS1ED inhibition experiments, cells were pre-incubated 10 minutes before plating in the presence of the inhibitor.

siRNA design and transfectionsiRNAs against the mouse �5 integrin subunit (GenBankTM accession numberNM_010580.1, nucleotide annotation 269CAGGGCTCAACATATGCACTA289) andmouse Sdc1 (GenBankTM accession number NM_011519.1, nucleotide annotation1660GAGGTCTACTTTAGACAACTT1680) were designed by Ambion, Inc. (Austin,TX) in accordance with a Cenix BioScience algorithm. For transfection, mouse �5

siRNA at 200-800 nM or mouse Sdc1 siRNA at 600 nM were added to 2.5�105

cells plated in 35-mm wells using LipofectAMINE2000 at a ratio of 1:1 (�g siRNA:�l LipofectAMINE2000) for the �5 siRNA or a ratio of 1:4 for the mouse Sdc1


Jour

nal o

f Cel

l Sci

ence


siRNA diluted in Opti-MEM I transfection medium (Invitrogen) lacking serum andantibiotics. Control cells were transfected with a control oligonucleotide providedby the siRNA manufacturer. At 4 hours after transfection, each well wassupplemented with 3 ml of complete growth medium; at 24 hours post-transfectionthe cells were lifted in trypsin and expanded in 100-mm tissue-culture plates. Cellswere harvested 48 hours after transfection and 5�104 cell equivalents in Laemmlisample buffer electrophoresed per lane under non-reducing conditions on a 7.5%Laemmli gel, transferred to ImmobilonP (Millipore) and probed with 1:1000 rabbitpolyclonal �5 antibody (Ab1926, Chemicon) or 1:200 rabbit anti-FAK antibody(FAK A-17, Santa Cruz Biologicals) followed by an AP-conjugated anti-rabbitsecondary antibody. Alternatively, cohorts were detached with EDTA, resuspendedin 100 �l HEPES-buffered DME supplemented with 10% FBS and subjected toFACS analysis using anti-integrin (BDBiosciences) mAb H9.2B8 to detect �v,HM�1-1 to detect �1 and 2C9.G2 to detect �3 followed by a FITC-conjugated anti-Armenian hamster secondary antibody or anti-syndecan mAbs 281.2 or KY8.2 withan Alexa-Fluor-488-conjugated anti-rat secondary, mAb B-B4 with an Alexa-Fluor-488-conjugated anti-mouse secondary IgG and FITC-conjugated human IgG (hIgG)to detect mouse Sdc1, mouse Sdc4, human Sdc1 constructs and the FcRecto-hS1chimera, respectively. Cells were analyzed at the University of WisconsinComprehensive Cancer Center Flow Cytometry Facility using a FACSCaliburbenchtop cytometer (BDBiosciences). Cell-scatter and propidium-iodide (Sigma, 1�g/sample) staining profiles were used to gate live, single-cell events for dataanalysis.

Co-immunoprecipitation assaysAntibodies used to isolate Sdc1 include an affinity-purified pan-syndecan antibodygenerated in rabbit against the ten C-terminal amino acids of Sdc1 (Reiland et al.,1996) and mAbs 281.2 (Jalkanen et al., 1985) and B-B4 (Wijdenes et al., 1996)specific for the ectodomains of mouse and human Sdc1, respectively. MonoclonalAb KY8.2 (generously provided by Paul W. Kincade, Oklahoma Medical ResearchFoundation) was used to isolate mouse Sdc4. Monoclonal Ab 10.1 (Santa CruzBiotechnology) or human IgG (Jackson ImmunoResearch), which recognize theectodomain of CD64/Fc�RIa, was used to isolate the FcRecto-hS1 chimera. Cells (3-5�106/ml) were washed and then lysed in lysis buffer containing 50 mM HEPES,150 mM NaCl, 10 mM EDTA, 1% Triton X-100, 0.25% sodium deoxycholate and1:100 dilution of protease inhibitor cocktail set III (Calbiochem) for 20 minutes onice. Insoluble cell debris was removed by centrifugation at 20,000 g for 15 minutesat 4°C. Cell lysates (2 mg protein per reaction determined by Pierce BCA Assayper reaction) were pre-cleared using 50 �g/ml antibody isotype-matched IgG (rabbitIgG for pan-syndecan, rat IgG2A for 281.2 and KY8.2 and mouse IgG1 for B-B4and 10.1) and 100 �l of GammaBind Sepharose (Amersham Biosciences). Pre-cleared lysates were then incubated at 4°C overnight with either 10 �g/ml of anti-syndecan antibody (pan, mAbs 281.2, B-B4 or KY8.2) or 30 �g/ml anti-Fc�RIaantibody (mAb 10.1 or human IgG). For S1ED-competition experiments, 30 �Msoluble GST (negative control) or GST-S1ED protein was added to the pre-clearedlysates in conjunction with anti-Sdc1 antibody. Immune complexes wereprecipitated with 50 �l of GammaBind Sepharose, washed with lysis buffer lackingdetergents and extracted in Laemmli sample buffer. For methanol precipitates, 300�g of total protein was precipitated overnight at –20°C in 2.5 volumes of methanol.Precipitates were washed once with 0.5 ml acetone (chilled to –20°C) and allowedto dry for 15 minutes at room temperature. Soluble material was resuspended in 50�l of heparitinase buffer (50 mM HEPES, 50 mM NaOAc, 150 mM NaCl, 5 mMCaCl2, pH 6.5) with 2.4�10-3 IU/ml heparitinase (IBEX Technologies, Inc.) and0.1 conventional units/ml chondroitin ABC lysase (ICN Biochemicals) for 4 hoursat 37°C (with fresh enzymes added after 2 hours) to remove GAG side chains.Samples were resolved by electrophoresis under reduced conditions on a 7.5%Laemmli gel, transferred to ImmobilonP and probed with rabbit polyclonal �5

integrin (1:1000), mS1ED or pan-syndecan (1 �g/ml) antibody followed by an AP-conjugated anti-rabbit secondary. Visualization of immunoreactive bands wasperformed using ECF reagent (Amersham Pharmacia) and scanned on a StormPhosphoImager (Molecular Dynamics).

This work was supported by NIH grants HD21881 and CA109010to A.R. and a training grant stipend (T32 GM08688) to D.M.B. It wasaided by the core facilities of the University of WisconsinComprehensive Cancer Center, supported by NIH P30-CA14520. Theauthors thank Deane Mosher and Donna Pesciotta-Peters forgenerously providing matrix ligands used in this study. The technicalsupport and purification of antibodies provided by Andrea McWhorteris gratefully acknowledged.

ReferencesAlbert, M. L., Kim, J. I. and Birge, R. B. (2000). alphavbeta5 integrin recruits the CrkII-

Dock180-rac1 complex for phagocytosis of apoptotic cells. Nat. Cell Biol. 2, 899-905.Aumailley, M., Gurrath, M., Muller, G., Calvete, J., Timpl, R. and Kessler, H. (1991).

Arg-Gly-Asp constrained within cyclic pentapeptides. Strong and selective inhibitorsof cell adhesion to vitronectin and laminin fragment P1. FEBS Lett. 291, 50-54.

Beauvais, D. M. and Rapraeger, A. C. (2003). Syndecan-1-mediated cell spreadingrequires signaling by alphavbeta3 integrins in human breast carcinoma cells. Exp. CellRes. 286, 219-232.

Beauvais, D. M. and Rapraeger, A. C. (2004). Syndecans in tumor cell adhesion andsignaling. Reprod. Biol. Endocrinol. 2, 3.

Beauvais, D. M., Burbach, B. J. and Rapraeger, A. C. (2004). The syndecan-1ectodomain regulates alphavbeta3 integrin activity in human mammary carcinomacells. J. Cell Biol. 167, 171-181.

Brooks, P. C., Stromblad, S., Sanders, L. C., von Schalscha, T. L., Aimes, R. T.,Stetler-Stevenson, W. G., Quigley, J. P. and Cheresh, D. A. (1996). Localization ofmatrix metalloproteinase MMP-2 to the surface of invasive cells by interaction withintegrin alpha v beta 3. Cell 85, 683-693.

Brooks, P. C., Klemke, R. L., Schon, S., Lewis, J. M., Schwartz, M. A. and Cheresh,D. A. (1997). Insulin-like growth factor receptor cooperates with integrin alpha v beta5 to promote tumor cell dissemination in vivo. J. Clin. Invest. 99, 1390-1398.

Carman, C. V. and Springer, T. A. (2003). Integrin avidity regulation: are changes inaffinity and conformation underemphasized? Curr. Opin. Cell Biol. 15, 547-556.

Couchman, J. R. (2003). Syndecans: proteoglycan regulators of cell-surfacemicrodomains? Nat. Rev. Mol. Cell Biol. 4, 926-937.

Couchman, J. R., Chen, L. and Woods, A. (2001). Syndecans and cell adhesion. Int.Rev. Cytol. 207, 113-150.

De, S., Chen, J., Narizhneva, N. V., Heston, W., Brainard, J., Sage, E. H. and Byzova,T. V. (2003). Molecular pathway for cancer metastasis to bone. J. Biol. Chem. 278,39044-39050.

Dedhar, S. (1999). Integrins and signal transduction. Curr. Opin. Hematol. 6, 37-43.Eliceiri, B. P. and Cheresh, D. A. (1999). The role of alphav integrins during

angiogenesis: insights into potential mechanisms of action and clinical development.J. Clin. Invest. 103, 1227-1230.

Felding-Habermann, B. and Cheresh, D. A. (1993). Vitronectin and its receptors. Curr.Opin. Cell Biol. 5, 864-868.

Filardo, E. J., Deming, S. L. and Cheresh, D. A. (1996). Regulation of cell migrationby the integrin beta subunit ectodomain. J. Cell Sci. 109, 1615-1622.

Finnemann, S. C. (2003a). Focal adhesion kinase signaling promotes phagocytosis ofintegrin-bound photoreceptors. EMBO J. 22, 4143-4154.

Finnemann, S. C. (2003b). Role of alphavbeta5 integrin in regulating phagocytosis bythe retinal pigment epithelium. Adv. Exp. Med. Biol. 533, 337-342.

Friedlander, M., Brooks, P. C., Shaffer, R. W., Kincaid, C. M., Varner, J. A. andCheresh, D. A. (1995). Definition of two angiogenic pathways by distinct alpha vintegrins. Science 270, 1500-1502.

Giancotti, F. G. and Ruoslahti, E. (1999). Integrin signaling. Science 285, 1028-1032.Granes, F., Urena, J. M., Rocamora, N. and Vilaro, S. (2000). Ezrin links syndecan-2

to the cytoskeleton. J. Cell Sci. 113, 1267-1276.Grootjans, J. J., Zimmermann, P., Reekmans, G., Smets, A., Degeest, G., Durr, J.

and David, G. (1997). Syntenin, a PDZ protein that binds syndecan cytoplasmicdomains. Proc. Natl. Acad. Sci. USA 94, 13683-13688.

Hall, M. O., Abrams, T. A. and Burgess, B. L. (2003). Integrin alphavbeta5 is notrequired for the phagocytosis of photoreceptor outer segments by cultured retinalpigment epithelial cells. Exp. Eye Res. 77, 281-286.

Hsueh, Y. P., Yang, F. C., Kharazia, V., Naisbitt, S., Cohen, A. R., Weinberg, R. J.and Sheng, M. (1998). Direct interaction of CASK/LIN-2 and syndecan heparansulfate proteoglycan and their overlapping distribution in neuronal synapses. J. CellBiol. 142, 139-151.

Iba, K., Albrechtsen, R., Gilpin, B., Frohlich, C., Loechel, F., Zolkiewska, A.,Ishiguro, K., Kojima, T., Liu, W., Langford, J. K. et al. (2000). The cysteine-richdomain of human ADAM 12 supports cell adhesion through syndecans and triggerssignaling events that lead to beta1 integrin-dependent cell spreading. J. Cell Biol. 149,1143-1156.

Iida, J., Meijne, A. M., Oegema, T. R., Jr, Yednock, T. A., Kovach, N. L., Furcht, L.T. and McCarthy, J. B. (1998). A role of chondroitin sulfate glycosaminoglycanbinding site in alpha4beta1 integrin-mediated melanoma cell adhesion. J. Biol. Chem.273, 5955-5962.

Iida, J., Pei, D., Kang, T., Simpson, M. A., Herlyn, M., Furcht, L. T. and McCarthy,J. B. (2001). Melanoma chondroitin sulfate proteoglycan regulates matrixmetalloproteinase-dependent human melanoma invasion into type I collagen. J. Biol.Chem. 276, 18786-18794.

Jalkanen, M., Nguyen, H., Rapraeger, A., Kurn, N. and Bernfield, M. (1985). Heparansulfate proteoglycans from mouse mammary epithelial cells: localization on the cellsurface with a monoclonal antibody. J. Cell Biol. 101, 976-984.

Jones, J., Watt, F. M. and Speight, P. M. (1997). Changes in the expression of alpha vintegrins in oral squamous cell carcinomas. J. Oral Pathol. Med. 26, 63-68.

Kinnunen, T., Kaksonen, M., Saarinen, J., Kalkkinen, N., Peng, H. B. and Rauvala,H. (1998). Cortactin-Src kinase signaling pathway is involved in N-syndecan-dependent neurite outgrowth. J. Biol. Chem. 273, 10702-10708.

Klemke, R. L., Yebra, M., Bayna, E. M. and Cheresh, D. A. (1994). Receptor tyrosinekinase signaling required for integrin alpha v beta 5-directed cell motility but notadhesion on vitronectin. J. Cell Biol. 127, 859-866.

Kugler, M. C., Wei, Y. and Chapman, H. A. (2003). Urokinase receptor and integrininteractions. Curr. Pharm. Des. 9, 1565-1574.

Kusano, Y., Oguri, K., Nagayasu, Y., Munesue, S., Ishihara, M., Saiki, I., Yonekura,H., Yamamoto, H. and Okayama, M. (2000). Participation of syndecan 2 in theinduction of stress fiber formation in cooperation with integrin alpha5beta1: structural

Jour

nal o

f Cel

l Sci

ence

2456

characteristics of heparan sulfate chains with avidity to COOH-terminal heparin-binding domain of fibronectin. Exp. Cell Res. 256, 434-444.

Kusano, Y., Yoshitomi, Y., Munesue, S., Okayama, M. and Oguri, K. (2004).Cooperation of syndecan-2 and syndecan-4 among cell surface heparan sulfateproteoglycans in the actin cytoskeletal organization of Lewis lung carcinoma cells. J.Biochem. 135, 129-137.

Lebakken, C. S. and Rapraeger, A. C. (1996). Syndecan-1 mediates cell spreading intransfected human lymphoblastoid (Raji) cells. J. Cell Biol. 132, 1209-1221.

Lebakken, C. S., McQuade, K. J. and Rapraeger, A. C. (2000). Syndecan-1 signalsindependently of beta1 integrins during Raji cell spreading. Exp. Cell Res. 259, 315-325.

Lewis, J. M., Cheresh, D. A. and Schwartz, M. A. (1996). Protein kinase C regulatesalpha v beta 5-dependent cytoskeletal associations and focal adhesion kinasephosphorylation. J. Cell Biol. 134, 1323-1332.

Liddington, R. C. and Ginsberg, M. H. (2002). Integrin activation takes shape. J. CellBiol. 158, 833-839.

Liu, W., Litwack, E. D., Stanley, M. J., Langford, J. K., Lander, A. D. and Sanderson,R. D. (1998). Heparan sulfate proteoglycans as adhesive and anti-invasive molecules.Syndecans and glypican have distinct functions. J. Biol. Chem. 273, 22825-22832.

Lukashev, M. E. and Werb, Z. (1998). ECM signalling: orchestrating cell behaviour andmisbehaviour. Trends Cell Biol. 8, 437-441.

McFall, A. J. and Rapraeger, A. C. (1998). Characterization of the high affinity cell-binding domain in the cell surface proteoglycan syndecan-4. J. Biol. Chem. 273, 28270-28276.

McLean, J. W., Vestal, D. J., Cheresh, D. A. and Bodary, S. C. (1990). cDNA sequenceof the human integrin beta 5 subunit. J. Biol. Chem. 265, 17126-17131.

McQuade, K. J. and Rapraeger, A. C. (2003). Syndecan-1 transmembrane andextracellular domains have unique and distinct roles in cell spreading. J. Biol. Chem.278, 46607-46615.

Memmo, L. M. and McKeown-Longo, P. (1998). The alphavbeta5 integrin functions asan endocytic receptor for vitronectin. J. Cell Sci. 111, 425-433.

Mostafavi-Pour, Z., Askari, J. A., Parkinson, S. J., Parker, P. J., Ng, T. T. andHumphries, M. J. (2003). Integrin-specific signaling pathways controlling focaladhesion formation and cell migration. J. Cell Biol. 161, 155-167.

Moulder, K., Roberts, K., Shevach, E. M. and Coligan, J. E. (1991). The mousevitronectin receptor is a T cell activation antigen. J. Exp. Med. 173, 343-347.

Munesue, S., Kusano, Y., Oguri, K., Itano, N., Yoshitomi, Y., Nakanishi, H.,Yamashina, I. and Okayama, M. (2002). The role of syndecan-2 in regulation ofactin-cytoskeletal organization of Lewis lung carcinoma-derived metastatic clones.Biochem. J. 363, 201-209.

Noto, K., Kato, K., Okumura, K. and Yagita, H. (1995). Identification and functionalcharacterization of mouse CD29 with a mAb. Int. Immunol. 7, 835-842.

Oh, E. S., Woods, A. and Couchman, J. R. (1997a). Multimerization of the cytoplasmicdomain of syndecan-4 is required for its ability to activate protein kinase C. J. Biol.Chem. 272, 11805-11811.

Oh, E. S., Woods, A. and Couchman, J. R. (1997b). Syndecan-4 proteoglycan regulatesthe distribution and activity of protein kinase C. J. Biol. Chem. 272, 8133-8136.

Oh, E. S., Woods, A., Lim, S. T., Theibert, A. W. and Couchman, J. R. (1998).Syndecan-4 proteoglycan cytoplasmic domain and phosphatidylinositol 4,5-bisphosphate coordinately regulate protein kinase C activity. J. Biol. Chem. 273, 10624-10629.

Ott, V. L. and Rapraeger, A. C. (1998). Tyrosine phosphorylation of syndecan-1 and -4cytoplasmic domains in adherent B82 fibroblasts. J. Biol. Chem. 273, 35291-35298.

Panetti, T. S. and McKeown-Longo, P. J. (1993). The alpha v beta 5 integrin receptorregulates receptor-mediated endocytosis of vitronectin. J. Biol. Chem. 268, 11492-11495.

Panetti, T. S., Wilcox, S. A., Horzempa, C. and McKeown-Longo, P. J. (1995). Alpha

v beta 5 integrin receptor-mediated endocytosis of vitronectin is protein kinase C-dependent. J. Biol. Chem. 270, 18593-18597.

Park, H., Kim, Y., Lim, Y., Han, I. and Oh, E. S. (2002). Syndecan-2 mediates adhesionand proliferation of colon carcinoma cells. J. Biol. Chem. 277, 29730-29736.

Pasqualini, R., Bodorova, J., Ye, S. and Hemler, M. E. (1993). A study of the structure,function and distribution of beta 5 integrins using novel anti-beta 5 monoclonalantibodies. J. Cell Sci. 105, 101-111.

Plow, E. F., Haas, T. A., Zhang, L., Loftus, J. and Smith, J. W. (2000). Ligand bindingto integrins. J. Biol. Chem. 275, 21785-21788.

Porter, J. C. and Hogg, N. (1998). Integrins take partners: cross-talk between integrinsand other membrane receptors. Trends Cell. Biol. 8, 390-396.

Reiland, J., Ott, V. L., Lebakken, C. S., Yeaman, C., McCarthy, J. and Rapraeger,A. C. (1996). Pervanadate activation of intracellular kinases leads to tyrosinephosphorylation and shedding of syndecan-1. Biochem. J. 319, 39-47.

Sanders, R. J., Mainiero, F. and Giancotti, F. G. (1998). The role of integrins intumorigenesis and metastasis. Cancer Invest. 16, 329-344.

Saoncella, S., Echtermeyer, F., Denhez, F., Nowlen, J. K., Mosher, D. F., Robinson,S. D., Hynes, R. O. and Goetinck, P. F. (1999). Syndecan-4 signals cooperatively withintegrins in a Rho-dependent manner in the assembly of focal adhesions and actin stressfibers. Proc. Natl. Acad. Sci. USA 96, 2805-2810.

Thodeti, C. K., Albrechtsen, R., Grauslund, M., Asmar, M., Larsson, C., Takada, Y.,Mercurio, A. M., Couchman, J. R. and Wewer, U. M. (2003). ADAM12/syndecan-4 signaling promotes beta 1 integrin-dependent cell spreading through protein kinaseCalpha and RhoA. J. Biol. Chem. 278, 9576-9584.

Tkachenko, E. and Simons, M. (2002). Clustering induces redistribution of syndecan-4core protein into raft membrane domains. J. Biol. Chem. 277, 19946-19951.

Tkachenko, E., Rhodes, J. M. and Simons, M. (2005). Syndecans: new kids on thesignaling block. Circ. Res. 96, 488-500.

Tonn, J. C., Wunderlich, S., Kerkau, S., Klein, C. E. and Roosen, K. (1998). Invasivebehaviour of human gliomas is mediated by interindividually different integrin patterns.Anticancer Res. 18, 2599-2605.

van Leeuwen, R. L., Yoshinaga, I. G., Akasaka, T., Dekker, S. K., Vermeer, B. J. andByers, H. R. (1996). Attachment, spreading and migration of melanoma cells onvitronectin. The role of alpha V beta 3 and alpha V beta 5 integrins. Exp. Dermatol.5, 308-315.

Wijdenes, J., Vooijs, W. C., Clement, C., Post, J., Morard, F., Vita, N., Laurent, P.,Sun, R. X., Klein, B. and Dore, J. M. (1996). A plasmocyte selective monoclonalantibody (B-B4) recognizes syndecan-1. Br. J. Haematol. 94, 318-323.

Wilkins-Port, C. E., Sanderson, R. D., Tominna-Sebald, E. and McKeown-Longo, P.J. (2003). Vitronectin’s basic domain is a syndecan ligand which functions in trans toregulate vitronectin turnover. Cell Commun. Adhes. 10, 85-103.

Woods, A. and Couchman, J. R. (2000). Integrin modulation by lateral association. J.Biol. Chem. 275, 24233-24236.

Woods, A. and Couchman, J. R. (2001). Syndecan-4 and focal adhesion function. Curr.Opin. Cell Biol. 13, 578-583.

Woods, A., Couchman, J. R., Johansson, S. and Hook, M. (1986). Adhesion andcytoskeletal organisation of fibroblasts in response to fibronectin fragments. EMBO J.5, 665-670.

Yamashita, Y., Oritani, K., Miyoshi, E. K., Wall, R., Bernfield, M. and Kincade, P.W. (1999). Syndecan-4 is expressed by B lineage lymphocytes and can transmit a signalfor formation of dendritic processes. J. Immunol. 162, 5940-5948.

Yasuda, M., Hasunuma, Y., Adachi, H., Sekine, C., Sakanishi, T., Hashimoto, H., Ra,C., Yagita, H. and Okumura, K. (1995). Expression and function of fibronectinbinding integrins on rat mast cells. Int. Immunol. 7, 251-258.

Yebra, M., Filardo, E. J., Bayna, E. M., Kawahara, E., Becker, J. C. and Cheresh,D. A. (1995). Induction of carcinoma cell migration on vitronectin by NF-kappa B-dependent gene expression. Mol. Biol. Cell 6, 841-850.


Jour

nal o

f Cel

l Sci

ence

Syndecan-1 regulates v 5 integrin activity in B82L fibroblasts

Documents

Transcript of Syndecan-1 regulates v 5 integrin activity in B82L fibroblasts