1

Cell, Volume 136

Supplemental Data

Two Novel GPCR-Type G Proteins Are

Abscisic Acid Receptors in Arabidopsis Sona Pandey, David C. Nelson, and Sarah M. Assmann

Supplemental Experimental Procedures

Identification of GTG1 and GTG2 genes.

We did a preliminary screen of GPCR-like proteins in Arabidopsis based on Kim et al., (2000).

This preliminary screen identified a large number of transmembrane proteins. Nine proteins were

selected from this group of proteins that showed obvious similarity to human GPCRs or GPCR-

like proteins. We focused further on GTG proteins due to their very high similarity with human

GPR89, and their evolutionary conservation. Since the GTG1 and GTG2 genes showed high

sequence similarity with each other, a double mutant of these two genes was also used for ABA

sensitivity assays.

Seed germination assays.

Seeds used for germination assays were all from seed lots produced and harvested from plants

grown under identical conditions. Seeds were stored at 4oC and germination experiments were

performed with seed lots that were 1 month, 3 months or 1 year old. At least one hundred seeds

from each genotype, wild-type Ws, gtg1, gtg2 single mutants, gtg1 gtg2 double mutants and gtg1

gtg2 double mutant complemented with GTG1 or GTG2 gene, were plated on the 0.5 X MS

media, 1% sucrose and 0.8% agar with 1 μM ABA (AG Scientific, San Diego, CA) or solvent

(ethanol) control. All the genotypes were plated on the same plate for efficient comparison.

Seeds were stratified at 4oC in the dark for 48 h, and germinated at 22°C, in 16 h light/8 h dark

conditions. Germination is defined as protrusion of radicle (1 mm in length). Number of

germinated seeds was recorded after placing seed in light for 48 h and is expressed as percentage

of total seeds.

2

Expression analysis by quantitative PCR.

Seed of wild type Ws, single gtg1 and gtg2, double gtg1 gtg2 and double gtg1 gtg2 mutant

complemented with GTG1 or GTG2 genes of identical age were plated on 0.5x MS media, 1%

sucrose and 0.8% agar. Seeds were stratified for 2 days at 4oC in darkness, followed by 7 days of

vertical growth in growth chamber under long day conditions (16 h light/8 h dark). Seedlings

were then transferred to liquid MS media, supplemented with 50 μM ABA (or solvent control)

for 1 h with gentle shaking. After treatment, tissue was frozen in liquid N2 and RNA was isolated

from the frozen tissue using Trizol reagent (Invitrogen) following the manufacturer’s

instructions. RNA was further purified using the Qiagen RNAeasy mini kit. One μg of RNA was

used for cDNA synthesis using SuperscriptIII cDNA synthesis kit (Invitrogen). Real time

quantitative PCR were performed using gene specific primers and iQ SYBR Green Master Mix

(BioRad). The experiment was repeated thrice and data were averaged. Actin2/8 gene was used

as an internal normalization control. Fold change in gene expression were calculated using the

ΔΔCt values.

Purification of AtGTG1, AtGTG2, AtGPA1, AtGPA1(Q22L) and HsGPR89.

Full length GTG1, GTG2 and GPA1 were amplified from Arabidopsis seedling cDNA using

gene specific primers and human GPR89 was obtained from Invitrogen. AtGPA1(Q22L) cDNA

was kindly provided by Dr. Alan Jones (University of North Carolina). The cDNAs were cloned

into the pENTR11 vector (Invitrogen, CA, USA). The cloned inserts were confirmed by

sequencing. The clones were transferred into the pDEST17 destination vector containing His-

epitope tag (Invitrogen) by LR recombination reaction as per the manufacturer’s instructions.

The constructs were transformed into BL21-AI cells (Invitrogen). Two hundred and fifty mL of

log-phase grown bacterial culture was used for each purification. Protein expression was induced

with 0.2% arabinose, for 3 hours at 37oC. Cells were collected by centrifugation at 8,000 x g for

15 minutes at 4oC. GPA1 and GPA1(Q22L) was purified using B-PER 6xHis fusion protein

purification kit (Pierce, IL USA) following the manufacturer’s instructions. GTG1, GTG2 and

GPR89 proteins were purified using the B-PER 6xHis fusion protein purification kit with the

following modifications. The cells were resuspended in 10 mL of B-PER reagent (Pierce)

containing 1% Tween 20, 0.25% NP-40 and EDTA-free complete protease inhibitors (Roche,

USA), and incubated at RT for 20 minutes. The lysate was spun at 15,000 x g at 4oC for 15

3

minutes to remove cell debris and the cleared supernatant was loaded on a Ni-NTA column (1

mL packed volume), pre-equilibrated with B-PER reagent. The unbound fractions were passed

through the column twice. The column was washed with wash buffer 1 (50 mM Tris, 200 mM

NaCl, 15 mM imidazol, 10% glycerol, 0.25% Tween 20, pH 7.5) five times with three column

volumes each and with wash buffer 2 (50 mM Tris-HCl, 300 mM NaCl, 30 mM imidazol, 12%

glycerol, 0.25% Tween 20, pH 7.0) three times with 3 column volumes each. The proteins were

eluted with 5 mL of elution buffer (50 mM Tris-HCl, 300 mM NaCl, 300 mM imidazol, 12%

glycerol, 100 ng/mL unsaturated phosphatidyl choline (UPC, Avanti Polar Lipids) 0.1% Tween

20 and 1 x EDTA-free complete protease inhibitor) in 1 mL fractions. The fractions were further

loaded on the Extracti-Gel D detergent removing gel column (Pierce) and the proteins were

purified according to manufacturer’s instructions. Eluted proteins were stored as aliquots of 200

μL each at -80oC. Protein estimation was performed by densitometric scanning of CBB stained

gels. Known amount of protein standards were loaded on the same gel for effective comparison

of proteins. Quantification of protein bands was performed using PDquest software.

Split Ubiquitin Interaction and In Vivo Co-immunoprecipitation Assays.

Split ubiquitin vectors and interaction assay have been described previously (Ludwig et al.,

2003; Obrdlik et al., 2004). Briefly, full length GTG1, GTG2 and GPA1 were cloned in CUb, NUbG and NUbWT vectors by mating based in vivo recombination cloning. Interaction was

determined by growth on minimal media lacking Leu, Trp, His and Ade but containing 1 mM

methionine and also by X-gal filter assay (Pandey and Assmann 2004; Obrdlik et al., 2004).

Twelve-day-old seedlings of Ws, gtg1gtg2, gtg1gtg2:GTG1-FLAG and gtg1gtg2:GTG2-FLAG

were used as the source of proteins for in planta pull down assays. Five g of seedling tissue was

ground to a fine powder in the presence of liquid N2. The frozen powder was mixed with 3

volumes of extraction buffer A (50 mM Tris-HCl, pH 7.5, 150 mM sucrose, 1 mM PMSF, 0.1%

Triton X-100, and 1x EDTA-free complete protease inhibitor cocktail) and ground further at 4oC.

The slurry was centrifuged at 12,000 x g for 30 min at 4°C. The supernatants containing total

protein were centrifuged further at 100,000 x g at 4oC for 1 h to separate total microsomal

fractions (pellet) and soluble fractions. The pellet was re-suspended in extraction buffer B (50

mM Tris-HCl, pH 7.5, 300 mM sucrose, 1 mM PMSF, 0.1% Triton X-100, and 1x EDTA-free

complete protease inhibitor cocktail). Protein concentrations in the extracts were measured by the

4

Bradford (1976) assay (Bio-Rad) and were adjusted to 1.2 mg/mL. The Catch and Release

system (Upstate, VA, USA) was used for immuno-precipitation assays. Five hundred μg of total

microsomal proteins, 3 μg FLAG antibodies, and 10 μL of affinity ligand were added to the

column and the columns were incubated at 4oC, on a rotatory shaker, overnight. The washing and

elution of the bound proteins were done according to the manufacturer’s instructions. Eluted

proteins were run on SDS-PAGE, immuno-blotted and probed with GPA1 antibodies as

described in Pandey and Assmann (2004).

Phosphate Assay.

GTPase activity of purified proteins was independently assayed using the ENZchek Phosphate

assay kit (Invitrogen). The assay was performed according to the manufacturer’s instructions

using the enzyme standard provided with the assay kit (purine nucleoside phosphorylase) or

purified recombinant GPA1, GTG1, GTG2 and human GPR89 in the presence of 200 μM GTP.

Phosphate production was recorded as change in absorbance at 360 nm.

Radiolabeled [35S]GTPγS binding assay.

Purified GTG1, GTG2, GPA1 and CaGPA1 (1 μg each) were diluted in 200 μL of reaction

buffer (50 mM Tris-HCl, pH 8, 10 mM MgCl2, 1 mM DTT, 100 ng/mL UPC and 1x EDTA-free

complete protease inhibitor cocktail) with ABA (10 μM) or equimolar concentration of EtOH

(solvent). The samples were incubated at 30°C and the reaction was started by adding 0.2 μM

[35S]GTPγS. Aliquots (30 μL) were collected in new tubes at four different time points (5, 15, 45,

120 minutes) and 1 mL of ice cold wash buffer (20 mM Tris-HCl, pH 8, 100 mM NaCl, 25 mM

MgCl2) was added to the tubes to stop the reaction. The tubes were stored on ice. The reaction

mixture was then filtered using a vacuum attachment, through nitrocellulose membranes

(Protron, Whatman Inc. NJ, USA) prewashed with 3 mL of ice cold wash buffer. The filters were

washed three times with 3 mL of ice cold wash buffer each, and dried on 3M filter papers. Bound

radioactivity was measured using a liquid scintillation counter in 5 mL of Optiphase HiSafe 3

(Perkin Elmer, MA, USA).

5

[α-32P]GTP-hydrolysis assay.

Purified GTG1, GTG2, GPA1 and CaGPA1 (1 μg each) were diluted in 200 μL of reaction

buffer (50 mM Tris-HCl, pH 8, 10 mM MgCl2, 1 mM DTT, 100 ng/mL UPC and 1x EDTA-free

complete protease inhibitor cocktail) with ABA (10 μM) or equimolar concentration of EtOH

(solvent). The samples were incubated at 30°C and the reaction was started by adding 20 pmol of

[α-32P]GTP. Aliquots (10 μL) were collected in new tubes at four different time points (5, 15, 45,

90 minutes) and 10 μL of EDTA (0.5M) was added to the tubes to stop the reaction. The tubes

were stored on ice. One μL of sample was spotted on the PEI-cellulose TLC plates and plates

were allowed to dry. The spotting was repeated two more times. TLC plates were run in

KH2PO4, (0.5 M, pH 3.4) solution and dried. The plates were exposed to a phosphorimager

screen overnight and scanned.

Endogenous ABA-level Measurements.

Endogenous ABA levels were measured in 2-week-old seedlings of Ws and gtg1 gtg2 double

mutants by competitive ELISA using the Phytodetek ABA test kit (Agdia Inc., IN, USA)

according to the manufacturer’s instructions.

Transient expression assay in Arabidopsis mesophyll protoplasts.

GTG1 and GTG2 were cloned in a modified pEarleyGate 102 vector (Earley et al., 2006) by LR

recombination to produce C-terminal GFP fusion proteins. The modified vector was constructed

by replacing the CFP of original pEarleyGate 102 with eGFP and adding a stop codon so that the

HA-tag is not translated (a kind gift from Dr. Gabriele Monshausen, University of Wisconsin,

Madison). Mesophyll cell protoplasts were isolated from 4 week old Arabidopsis leaves

essentially according to Tiwari et al. (2006). DNA was isolated using an Endo free plasmid mini

kit (Qiagen, CA) and transfected using the poly ethylene glycol method according to Sheen

(2001) and Tiwari et al. (2006). At least 105 protoplasts were transfected for each assay (GTG1,

GTG2 or vector plasmids). Protoplasts were incubated at 22oC for 18-24h in darkness before

confocal microscopy. The protoplasts expressing fusion protein were visualized using an

Olympus FV1000 Laser Scanning Confocal Microscope (Olympus America Inc., Melville, NY)

by Blue Argon 488 nm excitation. Images were analyzed using FV10-ASW version 1.6 software.

6

Figure S1. Purification of GTG proteins.

GTG1 and GTG2 proteins were purified as Histidine-tagged fusion proteins and run on a 10%

SDS-PAGE. Mr indicates marker lane. Numbers at the top represent protein amount (μg) loaded

to each lane.

26 33

50

79

118

213

Mr BSA GTG1 GTG2

0.5 1.0 2.5 0.2 0.4 0.2 0.4

7

A B Figure S2. GTG proteins specifically bind GDP but not ATP.

GDP binding was measured using GDP-BODIPY FL and ATP binding was measured using

ATP-BODIPY FL in real time fluorescence assays. Relative Fluorescence Units (RFU) was

8

recorded as a function of time. Three replicates of each assay were performed in each of two

separate experiments. The graphs show data from one representative experiment, mean ± S.D.

Arabidopsis GTG1 (A) and GTG2 (B) have specific GDP-binding activity that is efficiently

competed with non-labeled GTP but not by non-labeled ATP. GTG1 and GTG2 do not bind

BODIPY-FL ATP.

9

A B

10

Figure S3. ATP does not affect GTP binding of GTG proteins.

GTP binding was measured using GTP-BODIPY FL in real time fluorescence assays. Relative

Fluorescence Units (RFU) was recorded as a function of time. Three replicates of each assay

were performed in each of two separate experiments. The graphs show data from one

representative experiment, mean ± S.D. Arabidopsis GTG1 (A) and GTG2 (B) have specific

GTP-binding activity that is efficiently competed with non-labeled GDP but not by non-labeled

ATP.

11

Figure S4. GTPase activity assay of GTG1 and GTG2.

Purified GTG1, GTG2, GPA1 as well as the enzyme standard PNP (purine nucleoside

phosphorylase) hydrolyze GTP as measured by enzymatic conversion of MESG (2-amino-6-

mercapto-7-methylpurine riboside) to ribose-1-phosphate and 2-amino-6-mercapto-7-

methylpurine upon production of free Pi. No activity was observed for human GPR89 (not

shown).

12

Figure S5. GTP-binding and GTPase activities of GTG1 and GTG2 are Mg2+-dependent.

Both GTG1 and GTG2 specifically bind and hydrolyze GTP only in the presence of Mg2+. No

activity was detected in the absence of Mg2+ as also reported for other G proteins (Coleman and

Sprang, 1998).

13

EtOH (con) cpm

ABA (10 μM) cpm

GTG1 9641.5±232.5 9958±1070

GTG2 13644±524 16003.5±1073.5

GPA1 30173.5±1294 31170.5±189.5

CaGPA1 48069.5±748.5 45773.5±336

BSA 218±79 204.5±23.5

A

C

B

14

Figure S6. ABA has no effect on GTP-binding or hydrolytic activity of GTG proteins under

in vitro conditions.

(A) GTP binding and hydrolysis of GTG1 was measured using GTP-BODIPY FL in real time

fluorescence assays in the absence or presence of ABA (0.5-10 μM, data shown for 1 μM), either

alone or in combination with GDP (5 μM). Three different pH values were tested for these

experiments to take into account that the protonated form of ABA may have a differential effect

(Goh et al., 1996; Wang et al., 2001). The GTG1 protein’s activity showed a broad pH optimum

and no significant effect of ABA was observed at any pH value. Identical results were obtained

with GTG2.

(B) Hydrolysis of radiolabeled [α32P]GTP was measured in the presence or absence of 10 μM

ABA by TLC assays. The experiment was repeated 3 times at 4 different time points. Data from

one experiment at 45 minutes’ time point are presented. The left panel shows scanned TLC plate

image. The histogram in the right panel shows the densitometric scanning values of the spots on

the same TLC plate. Similar results were obtained when the assay was performed in the absence

of UPC (data not shown).

(C) Radiolabeled [35S]GTPγS binding assay was performed to test the effect of ABA (10 μM) on

GTP binding. The experiment was repeated 4 times with samples in duplicate. Average data of

two duplicates from one experiment at 45 min. time point are presented ± S.D.

15

Figure S7. Expression of GTG1 and GTG2 genes in the single gtg1-1, gtg2-1 and double gtg1

gtg2 mutant backgrounds.

Relative expression of GTG1 and GTG2 genes in wild type and single mutants as determined by

real time quantitative PCR. Expression of each gene was set to 1 in wild type plants and

expression in the mutant background was plotted relative to expression in wild type. Actin2/8

gene expression was used for normalization. Data represent mean ± S.E., n = 3 independent

experiments. Primer pairs gtg1-P1 and -P2 are located upstream of T DNA insertion site, primer

pairs gtg1-P1 and P4 flank the T-DNA insertion site and primer pairs gtg1-P3+P4 are located

downstream of T-DNA insertion site in gtg1-1 mutant. Primer pairs gtg2-P1 and -P2 are located

upstream of T DNA insertion site, primer pairs gtg2-P4 and P5 flank the T-DNA insertion site

and primer pairs gtg2-P3 and P4 are located downstream of T-DNA insertion site in gtg2-1

Actin GTG1 GTG1 GTG1 GTG2 GTG2 GTG2 P1+P2 P1+P4 P3+P4 P1+P2 P4+P5 P3+P4

16

mutant. Positions of primers are also depicted in Figure 5. PCR with primer combinations P1+P2

and P3+P4 revealed that reduced levels of a truncated transcript could be detected for both GTG1

and GTG2 upstream of the insertion site at ~40% of the wild type level in gtg1-1 and ~50% of

the wild type in gtg2-1.

17

Figure S8. Inhibition of seed germination by ABA.

The graph shows germination of wild type, single (gtg1-1 and gtg2-1) and double (gtg1 gtg2)

mutants and gtg1 gtg2 complemented with GTG1, GTG2 or empty vector controls. Lines 1 (data

presented in the main text) and 2 have C terminal and line 3 and 4 have N terminal FLAG-

epitope fusions. Germination was recorded in the presence of different concentrations of ABA at

48h after transfer of plates to light at 22oC. The experiment was repeated three times and data

were averaged; values are means ± S.E; n = 100 for each experiment per genotype.

18

Figure S9. Inhibition of primary root length by ABA.

The graph shows root length inhibition of wild type, single (gtg1-1 and gtg2-1) and double (gtg1

gtg2) mutants and gtg1 gtg2 complemented with GTG1, GTG2 or empty vector controls in the

presence of different concentrations of ABA. Lines 1 (data presented in the main text) and 2

have C terminal and line 3 and 4 have N terminal FLAG-epitope fusions. Seedlings were

germinated and grown on MS media for 3 days followed by transfer to media containing

indicated amounts of ABA. The seedlings were grown for 10 more days and root lengths were

recorded. The experiment was repeated thrice and data were averaged. For all experiments,

values are means ± S.E; n = 72 per genotype.

19

Figure S10. Expression of ABA-responsive genes determined by real time quantitative PCR in

Ws, single gtg1, gtg2 mutants, gtg1 gtg2 double mutants and gtg1 gtg2 mutants complemented

with GTG1, GTG2 or empty vector controls. Line 1 (main text) has C terminal and line 2 (this

figure) has N terminal FLAG-epitope fusion. Act 2/8 expression was used for normalization.

Values are means ± S.E., n = 3 independent experiments.

20

Figure S11. ABA-promoted stomatal closure.

ABA-induced stomatal closure was assayed in Ws, single gtg1, gtg2 mutants, gtg1 gtg2 double

mutants and gtg1 gtg2 mutants complemented with GTG1 or GTG2. gtg1 gtg2 mutants show

ABA-hyposensitivity to ABA-induced promotion of stomatal closure, which is complemented by

introduction of either GTG1 or GTG2 genes but not by the empty vector. Both C terminal (main

text) and N terminal (this figure) FLAG-epitope tagged lines showed similar results. The

experiment was repeated thrice and data were averaged, ± S.E. For each experiment n=300 per

genotype per treatment.

21

Figure S12. ABA-induced inhibition of stomatal opening.

ABA-induced inhibition of stomatal opening was assayed in Ws, single gtg1, gtg2 mutants, gtg1

gtg2 double mutants and gtg1 gtg2 mutants complemented with GTG1, GTG2 or empty vector.

Both C terminal (main text) and N terminal (this figure) FLAG-epitope tagged lines showed

similar results. The experiment was repeated thrice and data were averaged, ± S.E. For each

experiment n=300 per genotype per treatment.

22

Figure S13. Endogenous ABA levels in Ws and gtg1gtg2 double mutants. Endogenous ABA

levels were measured using the PhytoDetek ABA kit. This immunoassay quantifies ABA by

measuring competitive binding to anti-ABA antibodies of an ABA-tracer (supplied in the kit) vs.

ABA supplied as a standard (black circles) or in tissue samples (colored circles). Addition of

external ABA (standards or samples) competes for binding with the ABA tracer solution,

resulting in release of tracer followed by its loss during washing steps, which is recorded as a

change in absorbance. The readout from ABA tracer solution with only buffer (no external ABA

added, hence no competition) is set at 100% (B100) and the readout from 100 pmoles/mL of

added ABA (fully competing with tracer) is set at 0% (B0). Binding percentage was determined

according to [(OD sample-OD B0)/(OD B100- ODB0)] X 100. The standard curve generated by

using known ABA amounts is plotted in black. Four different serial dilutions of Ws (green

circles) and gtg1 gtg2 mutant (blue circles) tissue extracts were analyzed. The experiment was

repeated thrice and data were averaged, ± S.D.

ABA (pmoles/mL)

0 20 100

Perc

ent b

indi

ng o

f lab

eled

AB

A tr

acer

0

20

40

60

80

100

23

Figure S14. Expression of other reported ABA-receptor transcripts in Ws and gtg1 gtg2

mutant background.

Gene expression was analyzed by real time quantitative PCR using gene specific primers for

FCA, CHLH and GCR2. Expression of Actin2/8 gene was used as normalization control.

24

Table S1. Summary of split ubiquitin assay for GTG1, GTG2 and GPA1.

Test Construct (Gene-Cub)

Test Construct (Gene-Nub or

NUb-Gene)

Growth Assay/ β-galactosidase

filter assay

Notes

GPA1-CUb GTG1-NUbwt Positive Positive Control GPA1-CUb NUbwt-GTG1 Positive Positive Control GPA1-CUb GTG1-NUbG Positive Test Interaction GPA1-CUb NUbG-GTG1 Positive Test Interaction GPA1-CUb GTG2-NUbwt Positive Positive Control GPA1-CUb NUbwt-GTG2 Positive Positive Control GPA1-CUb GTG2-NUbG Positive Test Interaction GPA1-CUb NUbG-GTG2 Positive Test Interaction GPA1-CUb Vector-NUbwt Positive Positive Control GPA1-CUb NUbwt-Vector Positive Positive Control GPA1-CUb Vector-NUbG Negative Test Interaction GPA1-CUb NUbG-Vector Negative Test Interaction GTG2-CUb GPA1-NUbwt Positive Positive Control GTG2-CUb NUbwt-GPA1 Positive Positive Control GTG2-CUb GPA1-NUbG Positive Test Interaction GTG2-CUb NUbG-GPA1 Positive Test Interaction GTG2-CUb GTG1-NUbwt Positive Positive Control GTG2-CUb NUbwt-GTG1 Positive Positive Control GTG2-CUb GTG1-NUbG Positive Test Interaction GTG2-CUb NUbG-GTG1 Positive Test Interaction GTG2-CUb Vector-NUbwt Positive Positive Control GTG2-CUb NUbwt-Vector Positive Positive Control GTG2-CUb Vector-NUbG Negative Test Interaction GTG2-CUb NUbG-Vector Negative Test Interaction

GTG1-Cub does not show any interaction with any proteins, including positive controls.

25

Table S2. Sequence of primers used for identification and relative expression level

determination of GTG1 and GTG2 and primers used in real time PCR assays.

Primer name Primer sequence

JL202 CATTTTATAATAACGCTGCGGACATCTAC

1P1 GCGATATACGAAGGCACGGT

1P2 ACCAGAAGAAGTATCAAACA

1P3 AAGCAGATATAATATCTTTG

1P4 TTTGTACCGGCCTCTTTGAAG

2P1 TCTCAACCGGAGGCTTTACA

2P2 AAGATTTACCCTTTTGATG

2P3 TTTCAAGGAGGCGGGCACGAA

2P4 AAAGCGCTAGCCACGAATAT

2P5 GAGCATCAAAAGGGTAAATC

Act2/8 For GGTAACATTGTGCTCAGTGGTGG

Act2/8 Rev AACGACCTTAATCTTCATGCTGC

Act2 For AACCACTATGTTCTCAGGCATCG

Act2 Rev CCTGGACCTGCCTCATCATACT

FCA For CACCTCCTGTTGGACTTGGT

FCA Rev AGGGGAGGAACACCATAACC

CHLH For AGGGACTGCAGCTTACCTCA

CHLH Rev CTCACGGACTCCCATTTTGT

GCR2 For TGCATACGGAACTTGAACCA

GCR2 Rev TGTGAGAGCAACACCAGGAG

Rab18 For TCCACAAGGAAAGTGGTGGT

Rab18 Rev TGTCCATCATCCCCTTCTTC

Rd29B For CTGATCCCACGCATAAAGGT

Rd29B Rev TCCATCCCAGCTTTTGATTC

ERD10 For CTCCACCGATCCAACAGCTC

ERD10 Rev GACGACTGGTACATCATCAC

DREB2A For GACCTAAATGGCGACGATGT

DREB2A Rev GCGGATCAAAACCACTTTGT

DREB2B For GGGTAAATGGGTTGCAGAGA

DREB2B Rev CCGCCTTATTTTCAACCGTA

ABI5 For ACCTAATCCAAACCCGAACC

ABI5 Rev AGCAAACACCTGCCTGAACT

26

Table S3. Summary of number of transmembrane domains in GTG1, GTG2, GCR1 and GCR2

using different TM prediction softwares.

TM

prediction

program

Reference GTG1 GTG2 GCR1 GCR2

TMHMM www.cbs.dtu.dk/services/TMHMM 9 9 7 none

HMMTOP www.enzim.hu/hmmtop 9 9 7 none

Phobius http://phobius.sbc.su.se 9 9 7 1

DAS www.sbc.su.se/~miklos/DAS/maindas.html 9 9 5 1

SPLIT www.split.pmfst.hr 9 9 6 1

SOSUI www.bp.nuap.nagoya-u.ac.jp/sosui/ 10 10 3 none

TM Pred www.ch.embnet.org/software/TMPRED_form.html 8 8 7 3

27

Table S4. Comparison of stomatal aperture values of Ws, gtg1, gtg2, gtg1 gtg2, and

complemented lines using two different parameters of for statistical analysis, n=300 (total

number of stomata counted) and n=3 (number of independent replicate experiments). Data

presented are for the ABA induced promotion of closure response. P values are for WT (Ws)

versus mutant apertures in the presence of ABA using two-tailed Student’s t test.

Average Apertures (μm) Change in

Aperture

P value

Genotypes

Control ABA (%) n=300 n=3

Ws 5.66±0.45 3.15±0.22 44.32 - -

gtg1 5.43±0.34 3.09±0.31 43.19 0.613 0.692

gtg2 5.43±0.39 3.14±0.61 42.18 0.939 0.971

gtg1 gtg2 4.95±0.65 4.09±0.29 17.47 0.00057 0.037

gtg1 gtg2:GTG1 #1 5.42±0.39 3.29±0.71 39.34 0.825 0.923

gtg1 gtg2:GTG1 #2 5.40±0.28 3.18±0.44 41.17 0.733 0.892

gtg1 gtg2:GTG2 #1 5.36±0.76 3.23±0.35 39.77 0.584 0.768

gtg1 gtg2:GTG2 #2 5.45±0.41 3.22±0.37 40.95 0.811 0.886

gtg1 gtg2:EV #1 4.85±0.53 3.90±0.36 19.50 0.0014 0.042

gtg1 gtg2:EV#2 5.02±0.77 3.99±0.26 20.48 0.00082 0.039

28

Supplemental Acknowledgments

All confocal microscopy was done at the Cytometry Facility at the Huck Institutes of the Life

Sciences, Penn State University. This project is funded, in part, under a grant with the

Pennsylvania Department of Health using Tobacco Settlement Funds. The Department

specifically disclaims responsibility for any analyses, interpretations or conclusions.

Supplemental References

Andre, B., Hamacher, T., Boles, E., Von Wiren, N., and Frommer, W.B. (2003) Homo- and

hetero-oligomerization of AMT1 NH4+-uniporters. J. Biol. Chem. 278, 45603-45610.

Coleman, D. E., and Sprang, S. R. (1998). Crystal structures of the G protein Giα 1 complexed

with GDP and Mg2+: a crystallographic titration experiment. Biochemistry 37, 14376-14385.

Earley, K.W., Haag, J.R., Pontes, O., Opper, K., Juehne, T., Song, K., Pikaard, C.S. (2006)

Gateway-compatible vectors for plant functional genomics and proteomics. Plant J. 45,616-629.

Goh, C.H., Kinoshita, T., Oku, T., and Shimazaki, K. (1996) Inhibition of blue light-dependent

H+ pumping by abscisic acid in Vicia guard-cell protoplasts. Plant Physiol. 111,433-440.

Kim, J., Moriyama, E.N., Warr, C.G., Clyne, P.J., and Carlson, .JR. (2000) Identification of

novel multi-transmembrane proteins from genomic databases using quasi-periodic structural

properties. Bioinformatics 16, 767-775.

Ludewig, U., Wilken, S., Wu, B., Jost, W., Obrdlik, P., El Bakkoury, M., Marini, A.M.,

Obrdlik, P., El-Bakkoury, M., Hamacher, T., Cappellaro, C., Vilarino, C., Fleischer, C.,

Ellerbrok, H., Kamuzinzi, R., Ledent, V., Blaudez, D., Sanders, D., Revuelta, J.L., Boles, E.,

André, B., and Frommer, W.B. (2004) K+ channel interactions detected by a genetic system

optimized for systematic studies of membrane protein interactions. Proc. Natl. Acad. Sci. USA.

101, 12242-12247.

29

Pandey, S., and Assmann, S.M. (2004) The Arabidopsis putative G protein-coupled receptor

GCR1 interacts with the G protein α subunit GPA1 and regulates abscisic acid signaling. Plant

Cell, 16, 1616-1632.

Sheen, J. (2001) Signal transduction in maize and Arabidopsis mesophyll protoplasts. Plant

Physiol. 127,1466-1475.

Tiwari, S., Wang, S., Hagen, G., and Guilfoyle, T.J. (2006) Transfection assays with protoplasts

containing integrated reporter genes. Methods Mol Biol. 323,237-244.

Wang, X.Q., Ullah, H., Jones, A.M., and Assmann, S.M. (2001) G protein regulation of ion

channels and abscisic acid signaling in Arabidopsis guard cells. Science. 292,2070-2072.