Spécificité de Zymoseptoria tritici en Tunisie

INSTITUT NATIONAL AGRONOMIQUE DE TUNISIE

THESE DE DOCTORAT EN SCIENCES AGRONOMIQUES

Spécialité : Science de la Production Végétale

Thème :

Préparée et présentée publiquement le 10 Mars 2020 par :

Rim Bel Hadj Chedli Ep Tayari

Devant le Jury :

Pr. Faycal Ben Jeddi (INAT) : Président de Jury

Dr. Hanène Chaabane (INAT) : Directrice de thèse

Pr. Walid Hamada (INAT) : Rappoteur

Dr. Naceur Djbali (CBBC) : Rapporteur

Pr. Sonia Hamza (INAT) : Examinatrice

Dr. Sarrah Ben M’barek (CRRGC) : Invitée

Ministère de l’Enseignement

Supérieur et de la Recherche

Scientifique

*****

Université de Carthage

Spécificité de Zymoseptoria tritici en

Tunisie

Ministère de l’Agriculture, des Ressources

Hydrauliques et de la Pêche

*****

Institution de la Recherche et de

l’Enseignement Supérieur Agricoles

REPUBLIQUE TUNISIENNE

DEDICACES

Je tiens tout d’abord à remercier Dieu, qui m’a donné la force

et la patience d’accomplir ce modeste travail

Je dédie cette thèse

A mes chers parents, Jamel et Rekaya

A mon frère Mohamed et à ma sœur Raja

A mon cher mari Wassim

A mon cher fils Iskander

A toute ma famille

Merci pour votre amour, patience, encouragements et soutien

qui ont toujours illuminé mon chemin …

J’ai de la chance de vous avoir dans ma vie….

Que Dieu vous protège

RIM

Remerciements

Ce travail de thèse a été réalisé au sein du Laboratoire de génétique et d’amélioration des

plantes de l’Institut National Agronomique de Tunisie (INAT) en collaboration avec la plateforme

septoriose « Tunisia STB-Precision Phenotyping Platform (TunSPP) » dirigée par le Centre

International du Maïs et du Blé ‘CIMMYT’.

Au terme de ce travail, je tiens à remercier ma directrice de thèse Dr. Hanène Chaabane ;

Maître de conférences à l’INAT de m'avoir accueillie dans son équipe malgré ses occupations

professionnelles. Je tiens à rendre hommage à la pertinence de ses conseils et ses remarques

constructives au cours de la rédaction de ce mémoire.

Je remercie très sincèrement Pr. Salah Rezgui, mon ancien directeur de thèse retraité pour

m’avoir encadrée durant toutes ces années de thèse et pour ses conseils prodigués au cours de la

réalisation de ce travail.

Mes profonds remerciements et ma vive gratitude s’adressent aussi au Pr. Amor Yahyaoui,

Consultant et Coordinateur de Septoria Phenotyping Platform, pour son implication personnelle, son

soutien matériel et moral, ses orientations qui ont ponctué ces années de thèse et tout le temps qu'il

m'a consacré malgré ses nombreuses occupations. Je souhaiterais ici le témoigner ma sincère

reconnaissance pour tous les conseils et les remarques objectives qu’il m’a apporté.

Je remercie chaleureusement Dr. Sarrah Ben M’barek Maitre-assistant à CRRGC (Béjà), pour

sa patience, son aide, ses encouragements et ses conseils précieux. Qu’elle trouve ici l’expression de

toute ma reconnaissance, de ma profonde admiration et de ma respectueuse considération.

Ma grande reconnaissance s’adresse aussi au Pr. Gerrit Kema du ‘Wageningen University and

Research Center’, et à Dr. Lamia Aouini de ‘Purdue University’ pour leur contribution dans les

analyses moléculaires. Qu’ils trouvent ici mes chaleureux remerciements.

J’adresse mes plus sincères remerciements également à Dr. Bochra Amina Bahri de l’université

de Georgia-INAT, Dr. Zakaria Kehel de l’ICARDA-Maroc et Amir Souissi doctorant à l’INAT pour

leur aide dans les analyses statistiques et bio-informatiques. Je souhaiterais leur témoigner ma grande

gratitude.

Une pensée bien particulière à Dr. Sameh Boukef, Maitre-assistant à L’Institut Supérieur

Agronomique de Chott Meriem, qui m’a beaucoup encadrée, m’a appris les techniques d’isolements

du pathogène et m’a aimablement guidée vers les premiers pas de la recherche. Qu’elle trouve ici ma

grande reconnaissance.

Je tiens également à adresser mes vifs remerciements aussi à Dr Abdennour Sbei du CRRGC

(Béjà), Dr Fatiha Ben Tata de INRA Maroc et Dr. Abdelkader Benbelkacem de INRA Algérie d’avoir

assuré les semences de blé utilisées dans cette étude.

Je remercie tout particulièrement Pr. Faycel Ben Jeddi d’avoir accepté de juger et présider cette

thèse.

Je tiens à remercier également mes deux rapporteurs, Pr. Walid Hamada et Dr. Naceur Djbali

pour le temps qu’ils ont consacré à ce travail, et pour l’intérêt qu’ils ont bien voulu porter au

manuscrit.

Je remercie très sincèrement Pr. Sonia Hamza pour l’effort qu’elle a fourni pour examiner ce

travail.

Je n’oublierai pas d’adresser mes remerciements à tous les membres de la plateforme

septoriose en Tunisie, Maroua Laribi, Lamia Ben Naceur, Hajer Kouki, et Radhouan… pour leur

aide et leur soutien.

Mes remerciements seraient bien incomplets si ma grande famille n’y était pas associée. Merci

donc à mes chers parents Jamel et Rekaya, ma sœur Raja et mon frère Mohamed, mon petit garçon

Iskander, aux Familles Bel Hadj Chedli, Tayari et Ben Taher pour m’avoir soutenue et avoir partagé

ce parcours avec moi. Cette thèse leur est dédiée en reconnaissance des efforts et des sacrifices

consentis durant toutes ces années.

Mes remerciements les plus particulières s’adressent à mon cher mari Wassim pour ses

consolations pendant mes moments de détresse, son soutien sans faille, sa grande indulgence, sa

compréhension et surtout sa contribution dans la réussite de ce travail. Qu’il trouve ici ma plus grande

reconnaissance.

Je ne saurais terminer cette liste de remerciements sans évoquer les efforts de mon cher oncle

Mouhamed Taher pour son dévouement et sa disponibilité dans la réalisation de l’enquête et les essais

de plein champ à El Haouaria.

Enfin, à tous ceux qui ont contribué de près ou de loin à la réalisation de ce modeste travail de

recherche et dont le nom m’échappe à cet instant et que je regretterais de n’avoir pas cités, tous mes

remerciements.

RIM

Résumé

La septoriose du blé (Septoria tritici blotch (STB)) causée par Zymoseptoria tritici (Z. tritici)

reste la maladie la plus dommageable des cultures du blé dur en Tunisie. Etant donné que cette maladie

fut observée annuellement sur blé dur, peu de travaux sont disponibles sur la distribution et

l’occurrence de ce pathogène chez le blé tendre en Tunisie.

Ainsi, l’enquête menée au Nord et au Nord-Ouest de la Tunisie a révelé des moyennes

d’incidence et de sévérité les plus élevées sur blé dur, à Jendouba, Bizerte, Béjà et au Kef. D’autre part,

sur blé tendre, les moyennes d’incidences et de sévérités les plus importantes ont été signalées à El

Haouaria particulièrement sur une ancienne variété de blé tendre désignée localement par ‘Farina Arbi’.

Des incidences importantes ont été également notées sur triticale dans certaines régions.

Ensuite, l’évaluation de la résistance relative à STB de 89 variétés de blé dur et tendre a indiqué

que la majorité des variétés de blé dur Tunisien, Marocain et Algérien sont classées comme sensibles

et hautement sensibles dans les deux sites (Béjà et Cap Bon) avec des moyennes du rAUDPC allant de

0,5 à 0,8 et des valeurs de N et PC variant entre 30 et 65%, et 40 et 75% respectivement. Toutefois, le

blé tendre Marocain était sensible dans les régions du Cap Bon alors que le blé tendre Tunisien a été

classé comme résistant à totalement résistant à l’exception de la ‘Farina Arbi’, sensible au Cap Bon et

résistante à Béjà.

Le génotypage moyennant 12 marqueurs microsatellites (SSR) a englobé une collection de 184

isolats mono-pycnidiaux de Z. tritici issues du blé tendre (El Haouaria, Béjà et Jendouba) et 65 isolats

échantillonnés de blé tendre, blé dur et triticale cultivés dans le même champ à El Haouaria. Au niveau

régional, la région d’El Haouaria présente les indices de Nei’s (0,42), de Shannon (0,84) et le nombre

d’allèles privés (36) les plus importants. En outre, une différenciation modérée entre les populations

(Fst=0,16) et un important flux de gène (Nm = 1,85) ont été ainsi signalés. De point de vue espèces, la

diversité génétique de Nei’s (0,52), la diversité génétique non biaisée (0,58) et richesse allélique (4,43)

sont égales.

Par conséquent, cette étude a démontré d’une part que la diversité et la structure des populations

de Z. tritici semblent ne pas être affectées par l’espèce hôte à l’échelle de la parcelle, et elle a dévoilé

d’autre part une absence de structure des populations de Z. tritici en Tunisie.

Mots-clés: Blé tendre, blé dur, triticale, El Haouaria, diversité génétique, structure des populationst, Z.

tritici.

Abstract

Septoria tritici blotch (STB) caused by Zymoseptoria tritici (Z. tritici) has become an inherent

disease of durum wheat in Tunisia. Although Septoria was observed on durum wheat annually, up to

now not much is known on the occurence of STB on bread wheat. In this study, the STB survey

conducted in North and Northwestern Tunisia revealed that important incidence and severity were

recorded on durum wheat at Jendouba, Bizerte, Béjà, and Kef while STB was nearly absent in these

regions on bread wheat. However, the highest mean incidence and severity were recorded at El

Haouaria region mainly on bread wheat landrace of unknown origin called ‘Farina Arbi’. STB was

noted also on Triticale during the survey.

In addition, the performance of 89 wheat varieties from Morocco, Algeria and Tunisia were

screened in Tunisia for their relative resistance to STB at Cap Bon and Béjà regions. Results indicated

that the majority of Tunisian, Algerian and Moroccan durum wheat varieties were susceptible to STB

at both locations ranging from susceptible to highly susceptible where the average of the relative Area

inder disease progresse curve (rAUDPC) was ranged from 0.5 to 0.8 and the Necrosis (N) and the

Pycnidial coverage (CP) values were ranged from, 30 to 65 % and 40 to 75% respectively. The

Moroccan bread wheat varieties were susceptible in Cap Bon area, while the commercial Tunisian

bread wheat were resistant at both locations with the exception of “Farina Arbi” which was susceptible

at El Haouaria and resistant at Béjà.

Genotyping using 12 polymorphic microsatellite (SSR) was carried out using a set of 184 single-

pycnidial isolates sampled from infected bread wheat fields at EL Haouaria, Béjà and Bizerte, and 65

isolates from infected wheat species: durum wheat, bread wheat and triticale from the same field at

Cap Bon Area. At regional level, the highest Nei’s index value (0.42), Shannon Index (0.84), and the

private alleles number (36) were observed at El Haouaria region. Moderate population differentiation

(Fst=0.16) and a high gene flow (Nm =1.85) were then observed between the sampled fields. However,

at species level, an equal Nei’s gene diversity (0.52), unbiased gene diversity (0.58) and allele richness

(4.43) within Z. tritici-durum and bread wheat populations were observed. Therefore, weak population

differentiation (0.13) between species population explained by high levels of gene flow (3.26) were

then observed. The high degree of diversity could be due to and active sexual reproduction. Overall,

results of this study revealed an absence of relationship between genetic diversity and structure and

wheat-host species at regional and field level in Tunisia.

Key-words: Bread wheat, durum wheat, triticale, El Haouaria, genetic diversity, genetic structure, Z.

tritici

ملخص

لدى القمح السبتوري من أهم األمراض شيوعا ع المتسبب في مرض التبق ' Zymoseptoria tritici (Z. tritici)يعتبر الفطر'

الرغم من تسجيل أعراض هذا المرض على القمح الصلب سنويا في تونس إال وعلى. والتريتيكالأقل لدى القمح اللين الصلب وبصفة

.............................. . أن انتشاره على أصناف القمح اللين يضل مجهوال.

2017-2016و 2016-2015الدراسة االستقصائية لمائة وستة وعشرون حقل خالل الفصول الفالحية أولى كشفتة في مرحل

مرتفعة في كل من: باجة، جندوبة، بنزرت والكاف وخطورةعن حساسية كامل أصناف القمح الصلب للتبقع السبتوري مع معدالت حد ة

ناطق باستثناء صنف واحد 'فارينة عربي' الذي أثبت حساسية عالية في منطقة الهوارية مقابل مقاومة أنواع القمح اللين للمرض بهذه الم

............................................... .أين يتم إنتاجه. كما أثبتت هذه الدراسة أيضا مدى حساسية الترتيكال لهذا المرض في عدة مناطق

أنه يمكن والمغرب والجزائرمن تونس واللينلى عدة أصناف من القمح الصلب في مرحلة ثانية أثبتت هذه الدراسة المنجزة ع

(rAUDPC) لتطورالمرضالرسم البياني تحت المساحة بمعدالت والهواريةتصنيفها من حساس إلى حساس جدا في منطقتي باجة

و بين %75و %40متراوحة على التوالي بين (N) النخرية والمنطقة(PC) بالبيكنديا المساحة المغطات ومعدالت 0,8إلى 0,5من

الصنف المغربي حساس مقارنة بالصنف التونسي الذي أبرز مقاومته التجارب أن أما بخصوص القمح اللين أظهرت .%65و 30%

على صنف 'فرينة عربي'. وخاصةالسبتوري في جل المناطق ما عدى منطقة الهوارية للتبق عبالنسبة

عزلة لدى 65عزلة من هذا فطر لدى القمح اللين من عدة مناطق و 184ٲثبت هذا البحث من ناحية أخرى مدى التنوع الجيني ل

Nei (0,42 ،)لتريتيكال من نفس الحقل. على مستوى الجهات، سجلت ٲعلى معدالت مؤشر عدة أنواع من القمح الصلب واللين واا

( ومؤشر 1,85( في الهوارية باإلضافة إلى معدل جيني كبير )36) Allèles privés(، ٲعلى ٲعداد 0,84) Shannonٲعلى مؤشر

سجلت معدالت متساوية من مؤشر ني ،مستوى األصناف(. أما على 0,16اختالف متوسط للتركيز السكاني بين مختلف الحقول )

....... (. 3,26( و ٲيضا معدل جيني كبير )4,43) Allèle(، ثراء 0,58) Shannon(، مؤشر 0,52)

وجود أخرى عدمجهة ومنبصفة عامة، أثبتت الدراسة من جهة عدم وجود عالقة بين التنوع الجيني وأصناف القمح المعتمدة

في تونس. سكانية للفطرتركيبة

Zymoseptoria tritici جينية، ةالجيني، تركيبالصلب، القمح اللين، الهوارية، التنوع ح: القمالمفاتيحالكلمات

Table des matières

RÉSUMÉ

ABSTRACT

ملخص

INTRODUCTION GÉNÉRALE 1

1. Importance du secteur céréalier dans le monde .................................................................................. 4

3. La septoriose du blé : Importance dans le Monde, au nord de l’Afrique et en Tunisie ...................... 7

4. Généralités sur la septoriose ............................................................................................................... 9

4.1. Classification et plantes hôtes .................................................................................................. 9

4.2. Symptômatologie ................................................................................................................... 10

4.3. Cycle biologique de Zymoseptoria tritici .............................................................................. 10

4.4. Hétérothallisme et reproduction sexuée................................................................................. 13

4.5. Intéraction entre Zymoseptoria tritici-blé et spécificité ......................................................... 13

4.6. Structure des populations de Zymoseptoria tritici ................................................................. 15

4.7. Diversité génétique des populations ...................................................................................... 16

4.8. Les forces évolutives affectant la diversité génétique des populations ................................. 16

5. Influence des facteurs climatiques sur le développement de la maladie .......................................... 17

CHAPITRE 2. OCCURRENCE OF SEPTORIA TRITICI BLOTCH (ZYMOSEPTORIA

TRITICI) DISEASE ON DURUM WHEAT, TRITICALE, AND BREAD WHEAT IN

NORTHERN TUNISIA 20

1. Introduction ...................................................................................................................................... 21

2. Materials and Methods ..................................................................................................................... 22

2.1. Study area description .......................................................................................................................... 22 2.2. Climatic conditions of the surveyed regions ........................................................................................ 23 2.3. Cereal crops .......................................................................................................................................... 24 2.4. Septoria leaf blotch disease assessment ............................................................................................... 25 2.5. Data analysis ........................................................................................................................................ 26

3. Results .............................................................................................................................................. 26

3.1. Incidence of wheat Septoria tritici blotch ............................................................................................. 26 3.2. Incidence of Septoria tritici blotch on commercial wheat varieties...................................................... 31

4. Discussion ........................................................................................................................................ 33

5. Conclusion ........................................................................................................................................ 34

CHAPITRE 3. GENETIC DIFFERENTIATION BETWEEN ‘ZYMOSEPTORIA TRITICI’

POPULATIONS SAMPLED FROM BREAD WHEAT IN TUNISIA REVEALED BY SSR

MARKERS……………………………………………………………………………………………36

1. Introduction ...................................................................................................................................... 36


2.1. Fungal sampling and isolation .............................................................................................................. 38 2.2. DNA extraction and mating type’s determination ................................................................................ 39

2.3. Microsatellites analysis ........................................................................................................................ 41 2.4. Data analysis .......................................................................................................................... 42

3. Results .............................................................................................................................................. 42

3.1. Genetic diversity within and among sampled populations ................................................................... 42 3.2. Genetic differentiation between populations ........................................................................................ 44 3.3. Relationship between geographic populations and genetic structure ................................................... 45 3.4. Occurrence of sexual reproduction ....................................................................................................... 47

4. Discussion ........................................................................................................................................ 48

5. Conclusion ........................................................................................................................................ 51

CHAPITRE 4. SCREENING FOR RESISTANCE OF TUNISIAN, MOROCCAN AND

ALGERIAN WHEAT VARIETIES TO ZYMOSEPTORIA TRITICI IN NORTHERN

TUNISIA………………………………………………………………………………………………53

1. Introduction ...................................................................................................................................... 53


2.1. Description of the study areas and experimental design ...................................................................... 55 2.2. Plant materials ...................................................................................................................................... 56 2.3. Evaluation of disease severity and area under disease progress curve ................................................. 59 2.4. Statistical analysis ................................................................................................................................ 59

3. Results .............................................................................................................................................. 60

3.1. Meteorological conditions during the crop cycle ................................................................................. 60 3.2. Genotype by region interaction ............................................................................................................ 60 3.3. Varieties response to STB .................................................................................................................... 62 3.4. Varieties classification ......................................................................................................................... 63 3.5. Significant correlation between quantitative traits ............................................................................... 67

4. Discussion ........................................................................................................................................ 68

5. Conclusion ........................................................................................................................................ 70

CHAPITRE 5. EFFECT OF HOST-WHEAT SPECIES ON GENETIC DIFFERENTIATION

OF ‘ZYMOSEPTORIA TRITICI’ AT SINGLE FIELD IN NORTHERN

TUNISIA………………………………………………………………………………………………72

1. Introduction ...................................................................................................................................... 72

2. Materiel and Methods ....................................................................................................................... 74

2.1. Wheat varieties and Z. tritici sampling................................................................................................. 74 2.2. Mating types determination .................................................................................................................. 75 2.3. Microsatellite analysis .......................................................................................................................... 76 2.4. Data analysis ........................................................................................................................................ 76

3. Results .............................................................................................................................................. 77

3.1. Distribution of mating-type alleles at single field ................................................................................ 77 3.2. Genetic variability in core chromosome according to host species ...................................................... 77 1.1. Genetic diversity and differentiation between varieties populations .................................................... 78 1.2. Lack of genetic structure within total population ................................................................................. 80

2. Discussion ........................................................................................................................................ 82

3. Conclusion ........................................................................................................................................ 85

DISCUSSION GÉNÉRALE ET CONCLUSION…………………………………………………..86

RÉFÉRENCES BIBLIOGRAPHIQUES……………………………………………………………93

Liste des Figures

CHAPITRE 1

Figure1. Etages bioclimatiques en Tunisie (Anonyme 1) .............................................................................. 7

Figure 2. Symptômes typiques de la septoriose du blé. (A) Les pycnides de la phase asexuée de Z.tritici (B)

(photo adapté par suffert et al.2016), (B) Taches nécrotiques avec de petits points brun foncés à noirs. (Photo

adapté par Gigot, 2013) ................................................................................................................................. 10

Figure3. Cycle biologique de Zymoseptoria tritici…………………………………………………………………12

Figure4. Schéma représentatif de la dynamique des ascospores (d'inoculum primaire) et celui des

pycnidiospores (inoculum secondaire) et leurs rôles dans l’induction d’une épidémie (Suffert et al.2016). 12

CHAPITRE 2

Figure 1. Map of Tunisia showing the location of survey areas across different climatic regions during 2016

and 2017 cropping seasons. Sub-humid: Cap Bon North (A), Bizerte (B) and Béjà (C). Semi-arid region of

Northern Tunisia: Cap Bon South (D), Manouba (E), Zaghouan (F), Jendouba (G), and Le Kef (H). ......... 23

Figure 2. Incidence of Septoria tritici blotch during 2016 in surveyed areas on three cereal crops (bread

wheat, durum wheat and triticale). ................................................................................................................ 29

Figure 3. Severity of Septoria tritici blotch during 2016 in surveyed areas on three cereal crops (bread wheat,

durum wheat and triticale). ........................................................................................................................... 30

Figure 4. Incidence of Septoria tritici blotch during 2017 in surveyed areas on three cereal crops species

(bread wheat, durum wheat and triticale). ..................................................................................................... 30


durum wheat and triticale) ............................................................................................................................ 31

Figure 6. Incidence of STB on durum wheat, bread wheat and triticale varieties. ....................................... 32

Figure 7. Severity of STB on durum wheat, bread wheat, and triticale varieties. ........................................ 32

CHAPITRE 3

Figure 1. Schematic map of the sampling locations in Northern Tunisia. A: El Haouaria region, B:Bizete

(Ichkeul), C: Goubellat; D: Oued Zarga. ...................................................................................................... 40

Figure 2. Population structure of the 162 ‘Zymoseptoria tritici’ isolates sampled from four locations using

Structure software version 2.3.4 with K=4. .................................................................................................. 46

Figure. 3. Principal coordinates analysis (PCoA). Individuals from the same region are marked using the

same symbol. The first and second principal coordinates account for 15.07 % and 46.20 % of the variation,

respectively. .................................................................................................................................................. 46

Figure 4. Dendrogram showing the genetic clustering of the 162 Zymospetoria. Tritici isolates sampled from

bread wheat across three geographic locations in Northern Tunisia. The tree was constructed using the

weighted neighbor-joining method implemented in DARwin 6 software. Isolates from the same field were

indicated with the same color. Fields 1,2,3,4,5 and 6 are located at Ca Bon Area, fields 7 and 8 are located at

Béjà while field 9 belongs to Bizerte region. ................................................................................................ 47

file:///C:/Users/RIM/Desktop/Finale%20thèse%20RIM/Manusc%20Rim%20Tot.docx%23_Toc11670141



















CHAPITRE 4

Figure1. Map of Tunisia showing the location of study area (Béjà and Cap Bon area) during 2017-2018

cropping season. The STB experiments were set in an augmented design at both locations. ....................... 56

Figure 2. Variation of PC and N for all varieties in Cap Bon region during the two cropping seasons. TDM:

Tunisian durum wheat; TBW: Tunisian bread wheat; ADM: Algerian durum wheat; MBW: Moroccan durum

wheat; MDW: Moroccan durum wheat. ........................................................................................................ 62

Figure 3. Variation of PC and N across varieties in Béjà station. TDM: Tunisian durum wheat; TBW:

Tunisian bread wheat; ADM: Algerian durum wheat; MBW: Moroccan durum wheat; MDW: Moroccan

durum wheat.................................................................................................................................................. 63

Figure 4. PCA showing the major correlated variability of varieties as shown by axes 1 and 2. The first

Dimension1 accounted for 98% of the total variability expressed by quantitative traitswhile the second

component (Dimension2) accounts only 1.64% of the total variation. ACP revealed 6 clusters at Béjà region:

Cluster 1: Very resistant; Cluster 2: resistant; Cluster3: moderately resistant; Cluster4: moderately

susceptible; Cluster5: susceptible; Cluster 6: very susceptible. Details about genotypes of each group are

shown in table 3. ........................................................................................................................................... 65

Figure 5. PCA showing the major correlated variability of varieties as shown by axes 1 and 2 accounting

98% and 1.64% respectively of the total variability expressed by quantitative traits. ACP revealed 6 clusters

at Cap Bon region: Cluster 1: Very resistant; Cluster 2: resistant; Cluster3: moderately resistant; Cluster4:

moderately susceptible; Cluster5: susceptible; Cluster 6: very susceptible. Details about genotypes of each

group are shown in table 4. ........................................................................................................................... 67

Figure 6. Dimensional relationships among the measured parameters of STB infection showing a significant

correlation between AUDPC, rAUDPC, N and PC as revealed by principal component analyses over two

years. ............................................................................................................................................................ 68

CHAPITRE 5

Figure 1. Summary of different measured index: Genetic diversity (h); Shannon's Information Index (I), and

Unbiased genetic diversity (uh) across three wheat species. DW: durum wheat, BW: bread wheat and TRIT:

triticale. ......................................................................................................................................................... 81

Figure 2. PCoA analysis of 65 Z. tritici isolates sampled from three wheat species cropped in single field at

Cap Bon region during 2016-2017 cropping season. .................................................................................... 82

Figure 3. Lack of population structure as revealed by Structure software with K=2, K=3 and K=4 within a

total of 65 Zymoseptoria tritici population sampled from single field in Tunisia. ........................................ 83

Figure 4. Genetic clustering and relationships between 65 Z. tritici isolates sampled from bread wheat, durum

wheat and triticale from 22 wheat genotypes cultivated in Northern Tunisia. The tree was constructed using

the weighted neighbor-joining method implemented in DARwin 6 software. Isolates from bread wheat,

durum wheat and triticale were colored, black, red and blue respectively. Bootstrap values are indicated in

blue and references-isolates we designed with the green color. .................................................................... 84
































Liste des Tableaux

CHAPTER 2

Table 1. Climatic conditions of inspected regions during the survey period. .................................................. 23

Table 2. Geographical coordinates of inspected regions during the survey period ......................................... 24

Table 3. Survey designated Classes for Septoria tritici blotch (STB) prevalence, severity and incidence. ..... 25

Table 4. Triticum species and wheat varieties identified during the survey during the two cropping seasons.27

Table 5. Prevalence of Septoria tritici blotch in inspected areas during 2015-2016. ....................................... 28

Table 6. Prevalence of Septoria tritici blotch in inspected areas during 2016-2017 …………………………28

CHAPITRE 3

Table 1. Origin, number and geographical coordinates of Zymoseptoria tritici isolates used in this study .... 40

Table 2. Mating type’s specific primers and microsatellites markers used in this study ................................. 41

Table 3.Genetic diversity based on twelve microsatellite markers related to Zymoseptoria tritici

populations/sub-populations collected from three regions: Cap Bon Area, Bizerte and Béjà (Goubellat and

Oued Zarga) in Northern Tunisia during 2015-2016. ...................................................................................... 44

Table 4. Analysis of molecular variance (AMOVA) of the bread-wheat Zymoseptoria tritici population ..... 45

Table 5. Distribution of Z.tritici mating types across different regions. .......................................................... 48

CHAPTER 4

Table1. Wheat varieties screened for resistance to Septoria tritici blotch disease during 2016-2017 and 2017-

2018 cropping seasons. .................................................................................................................................... 57

Table 2. ANOVA analysis for Pycnidial coverage (PC), Necrotic area (N) and the relative area under disease

progress curve rAUDPC for 89 wheat varieties at Béjà and Cap Bon regions ................................................ 61

Table 3. Means and ranges of AUDPC and rAUDPC for all identified clusters at Béjà region ...................... 64

Table 4. Means and ranges of AUDPC and rAUDPC for all identified clusters at Cap Bon region ............... 65

CHAPTER 5

Table 1. Summary of information about ‘Zymoseptoria tritici’ isolates investigated in this study. ................ 75

Table 2. Distribution of Z. tritici mating types within wheat species from single field at Cap Bon region. ... 77

Table 4. Genetic diversity of ‘Zymoseptoria tritici’ population, genetic differentiation between population and

gene flow. ........................................................................................................................................................ 79

Table 5. Analysis of Molecular Variance (AMOVA) for 65 Zymoseptoria tritici isolates ............................. 79

Liste des Abréviations

ADN :Acide désoxyribonucléique

AMOVA : Analysis of Molecular Variance

AFLP : amplified fragment length polymorphisms

BW: bread wheat

CIMMYT : Centre d’amélioration du blé et du maïs

DW: Durum wheat

°C : Degré Celsius

ddl : Degré de liberté

dNTP : Désoxyribonuléotide triphosphate

FST : differentiation entre les populations

H: diversité génétique

I : l’index de Shannon

ISEPTON : International Septoria Observation Nursery

Max : Maximum

Mat1-1: Mating type 1-1

Mat1-2: Mating type 1-2

Min : Minimum

Mm : Millimètre

Mn : flux de gène

PCR: Polymerase Chain Reaction

PDA Potato Dextrose Agar

P : polymorphisme

RFLP : amplified fragment length polymorphisms

STB : septoria tritici blotch

SNP Single Nucleotide Polymorphism

SSR : simple sequence repeats

Trit: triticale

UV: ultrat violet

X2 : Chi-carré

Introduction générale

1

Introduction Générale

Les céréales occupent aujourd’hui une place prépondérante aussi bien dans la production

agricole qu’agroalimentaire, à l’échelle nationale et internationale (Rastoin et Benabderrazek,

2014). Néanmoins, la production céréalière en Tunisie est marquée par une forte irrégularité

conditionnée par les aléas climatiques. La stabilité des productions céréalières constitue

actuellement une priorité de la stratégie tunisienne d’amélioration des céréales (El Felah et

Gharbi, 2014). Ainsi, l’optimisation des rendements nécessite la maîtrise d’un maximum de

facteurs de nature abiotiques (tels que la sécheresse et la salinité) et biotiques (comme les

insectes, les nématodes et les maladies foliaires causées par les virus et les champignons

phytopathogènes). La septoriose du blé est considérée parmis les maladies les plus importantes

en Tunisie qui semble entraver les productions céréalières depuis des années (Gharbi et al.,

2002).

L’émergence de la maladie des taches septorienne (STB), causée par Zymoseptoria tritici

(Z. tritici), a commencé avec la domestication du blé dans le croissant fertile à partir des

ancêtres, Z. ardabiliae et Z. pseudotritici qui ont été isolés des volontaires Elymus repens,

Dactylis glomerata et Lolium perenne en Iran (Ponomarenko et al., 2011 ; Stukenbrock et al.,

2011). Par la suite, ce pathogène a été largement distribué en causant une grande menace des

cultures du blé tendre et du blé dur dans le monde surtout dans les zones humides (Nord de la

France, Allemagne, Royaume-Uni…) (Linde et al., 2002 ; Zhan et al., 2003 ; Kabbage et al.,

2008 ; Singh et al., 2016). Toutefois, en Europe, STB est considérée comme la maladie la plus

importante économiquement causant des pertes annuelles allant jusqu’à 1 milliard d’euro

(Torriani et al., 2015). Les pertes de rendement sont estimées à 50% dans les champs non traités,

et de 5 à 10% dans les champs traités ou avec des variétés résistantes (Fones and Gurr, 2015).

Cette maladie a suscité beaucoup d’attention après la grande épidémie enregistrée durant

les années 1968-1969 en Afrique du Nord, particulièrement après l’introduction du blé semi-

nain ou Mexicain (Ammar et al., 2011) qui a conduit considérablement à d’énormes attaques

de Z. tritici au Maroc, en Algérie et en Tunisie (Yahyaoui et al., 2002).

En Tunisie des pertes de rendements allant de 30 à 50% ont été enregistrées sur blé dur

durant les années pluvieuses (Ben Mohamed et al., 2000), en particulier lorsque les pluies de

printemps persistent après l’émergence de la feuille drapeau (Suffert et al., 2013). En

particulier, le nord du pays, qui compte les emblavures les plus importantes de blé dur et fournit

à peu près 85% de la production nationale, connaît les attaques les plus sévères surtout dans les


2

régions de Mateur, Bizerte, Béjà qui ont été signalées comme un « Hot Spot » pour la septoriose

(Gharbi et al., 2002 ; Fakhfekh et al., 2011 ; El Felah et Gharbi, 2014).

Ce pathogène était omniprésent dans les climats tempérés favorables pour les cultures de

blé tendre, dans les climats arides et semi-arides notamment dans le bassin méditerranéen et en

Afrique du Nord, mais également dans les climats chauds du Nord de l’Amérique (Linde et al.,

2002 ; Zhan et al., 2003 ; Singh et al., 2016). Par ailleurs, une grande spécificité de Z. tritici

aux divers écosystèmes agricoles a été notée (Eyal et al., 1985). D’une part, certains chercheurs

ont suggéré que cette spécificité est due à la grande plasticité de son génome illustré par le

grand nombre de chromosomes accessoires qui peuvent être perdus ou gagnés durant le cycle

d’infection (Stukenbrock et al., 2011 ; Gautier et al., 2014). D’autres part, une certaine

spécificité de Z. tritici envers le genre Triticum a été signalée grâce à la relation gène pour gène

et trois catégories d’isolats ont été ainsi rapportées : des isolats collectés de blé tendre qui ne

peuvent infecter que le blé tendre, des isolats isolés de blé dur qui ne s’attaquent qu’au blé dur

et ceux qui peuvent infester les deux espèces (Kema et al., 1996 a et b).

L’étude de l’effet de la spécificité du pathogène envers l’hôte sur la variation génétique

des populations paraît d’une grande importance. Dans le cas de Z. tritici, la structure génétique

des populations peut être altérée par des cycles réguliers de la reproduction sexuée (McDonald,

2016). Plusieurs marqueurs moléculaires à savoir : fragment length polymorphisms (RFLP) ;

amplified fragment length polymorphisms (AFLP) ; et simple sequence repeats (SSR), ont été

utilisés pour étudier et caractériser la génétique des populations de Z. tritici dans plusieurs pays

(Chen and McDonald, 1996 ; Linde et al., 2002 ; Zhan et al., 2003). Une grande diversité

génétique chez Z. tritici ainsi qu’un taux de migration très important chez des isolats de blé dur

ont été révélés en Tunisie (Boukef, 2012 ; Berrais et al., 2013 ; Nouari et al., 2016). Jusqu’à

présent, nous n’avons pas relevé de travaux qui ont étudié la diversité génétique de Z. tritici

isolée à partir du blé tendre en Tunisie.

C’est dans ce cadre que s’intègre ce travail de recherche qui constitue une première étude

de la distribution de la septoriose chez le blé tendre et le blé dur en Tunisie, de la spécificité de

ce pathogène en Tunisie, et de l’investigation de la diversité génétique d’une population de Z.

tritici isolée à partir des variétés Tunisiennes et étrangères de blé tendre, blé dur et triticale

cultivées en plein champ.


3

Ce manuscrit est organisé en cinq chapitres :

Le premier chapitre consiste en une synthèse bibliographique qui relate l’importance de

la culture du blé, des connaissances générales sur la septoriose et l’importance de l’étude des

populations du pathogène pour développer une stratégie de lutte intégrée contre cette maladie.

Le deuxième chapitre se base sur une enquête effectuée dans les principales régions

céréalières du Nord du pays pour étudier la prévalence et la distribution géographique de la

septoriose chez le blé tendre et le blé dur en Tunisie ainsi que la spécificité de Z. tritici envers

la plante l’hôte.

Le troisième chapitre comporte une étude de la diversité génétique d’une population

Tunisienne de Z. tritici isolée à partir du blé tendre dans différents étages bioclimatiques en

Tunisie en adoptant une approche basée sur l’analyse du polymorphisme de séquences

microsatellites SSR.

Le quatrième chapitre s’intéresse à une étude épidémiologique de la septoriose dans des

régions céréalières considérées comme un hot-spot sur blé dur. Etant donné que ce pathogène

s’attaque plus au blé dur qu’au blé tendre en Tunisie et inversement au Maroc, deux hypothèses

seront vérifiées : S’agit-il de la susceptibilité des variétés marocaines de blé tendre et de la

tolérance des variétés Tunisiennes à ce pathogène ou bien plutôt de la spécificité du pathogène

envers l’espèce ‘Tritcum durum’ et ‘Triticum aestivum’ ?

Le cinquième chapitre présente une investigation de la diversité génétique d’une

collection de 65 isolats de Z. tritici isolée à partir des variétés Marocaines, Algériennes, et

Tunisiennes de blé tendre, blé dur et triticale cultivées en Tunisie suite à une infection naturelle.

Les questions suivantes ont été abordées : La structure des populations de Z. tritici change-t-

elle en fonction de l’espèce hôte et de la variété de la même espèce ? Quels sont les facteurs qui

peuvent expliquer des différenciations entre ces populations ?

Chapitre 1. Synthèse bibliographique

Chapitre 1. Synthèse Bibliographique

4

1. Importance du secteur céréalier dans le monde

Les céréales sont les principales sources de la nutrition humaine et animale dans le monde.

Le maïs, le blé et le riz sont les trois principales céréales cultivées et ils constituent 89% de la

production mondiale (Rastoin et Benabderrazek, 2014). En 2015, la Chine était le premier

producteur mondial de céréales (21% du total), devant les États-Unis (16%), l’Union

Européenne (11%) et l’Inde (10%). La Chine, le Japon, le Mexique et l’Egypte sont les

principaux pays importateurs de céréales tandis que les Etats Unis, l’Union Européenne,

l’Argentine et l’Australie sont considérés les premiers exportateurs mondiaux (Graphagri,

2016).

Le blé occupe la première place au niveau mondial en termes de production et la

deuxième, après le riz, comme source de nourriture pour les populations humaines. La

production mondiale de blé a atteint un record en 2015 et elle est estimée à 735 000 Tonnes,

dont l’UE produit 21% et la France 6%. L’Amérique du Nord est aussi un producteur et un

exportateur majeur, les États-Unis et le Canada récoltant à eux deux 11% de la production

mondiale du blé (Graphagri, 2016).

2. Importance économique et répartition géographique des céréales en Tunisie

Le blé dur (Triticum turgidum L. ssp. durum) constitue avec l’olivier l’une des cultures

les plus anciennes de la Tunisie. Les agriculteurs tunisiens cultivent traditionnellement le blé

dur pour leurs besoins en semoule et ils le consomment sous plusieurs formes dont

essentiellement le couscous, les pâtes alimentaires, le pain et le borghol (Ben Salem et al.,

1995). La mise en place d’un programme d’amélioration variétale des céréales en Tunisie a

commencé il y a plus d’un siècle et les archives du programme des céréales de l’INRAT

attestent du nombre impressionnant de lignées introduites, collectées localement et créées à

travers les programmes de croisements annuels des blés et de l’orge (Gharbi et al., 2013).

Ainsi, le démarrage des croisements a eu lieu dès 1923 (Bœuf, 1936) et les sélectionneurs

ont commencé par des collectes du germoplasme local, suivies de sélections des meilleures

lignées tout en gardant leurs noms d’origine tels que Biskri, Mahmoudi, Sebeï, Hamira, et

Roussia, etc… (El Felah et Gharbi, 2014).

L’introduction du ‘blé semi-dwarf’ ou ‘blé Mexican’ a commencé vers la fin de l’année

1970 (Ammar et al., 2011). Amal 72 et Magherbi 72 étaient les premières variétés introduites,


5

suivies par Ben Bechir et INRAT 69. Les rendements des nouvelles variétés de céréales étaient

trois à quatre fois plus élevés que ceux des anciennes variétés (Gharbi et al., 2011).

L’introduction de la variété Karim en 1980 a créé une véritable percée avec les plus hauts

rendements et depuis elle est restée la plus populaire chez les agriculteurs tunisiens. De plus,

les variétés Razzak (1987), Khiar (1992), Nasr (2004) et Maali (2007) ont-elles aussi réalisé de

véritables succès (Ammar et al., 2011)

Pour le blé tendre (Triticum aestivum L.), exogène à la Tunisie, il n’a pris de l’importance

qu’avec la colonisation française. Cependant, des efforts de recherche sur le blé tendre ont

entraîné l'extension des superficies cultivées par l’introduction du « Florence Aurore » par les

colons depuis 1930 (Lasram, 2013). Ce dernier a eu beaucoup de succès grâce à sa rentabilité

et sa résistance aux maladies. Toutefois, au début des années 1950, le blé tendre était produit

en Tunisie, à 80% à partir de Florence-Aurore et à 20% de blés boulangers (EAP ou Guelma et

Etoile de Choisy) (Saade 1996 ; Ammar et al., 2011).

Avec l’avènement des blés semi-nains, ‘Sonora 63, Inia 66 et Tobari 66’ étaient les

premières variétés Mexicaines qui ont été introduites, et elles ont été abandonnées après des

années d’expérimentations. Au début des années 1980, le deuxième groupe de blé semi-nain a

été introduit (Soltane 72, Dougga 74, Carthage 74, Tanit 80) grâce à leurs bonnes performances.

Cettes dernières n’étaient pas appréciées par les agriculteurs à cause de leur sensibilité envers

la rouille et la septoriose (Ammar et al., 2011). Entre temps, la variété ‘Salammbô 80’ est

devenue la plus populaire en occupant 70% des superficies réservées au blé tendre, cette

dernière a réalisé le plus haut rendement. Un peu plus tard, la variété ‘Byrsa 87’ est apparue

avec de bonnes performances mais n’a pas pris une grande importance à cause de sa sensibilité

envers la rouille jaune et au mildiou. En 1996, avec de bons rendements, la variété ‘Utique 96’

vient de s’installer et devient en compétition avec ‘Salammbô 80’ (Ammar et al., 2011). Durant

la même période, plusieurs variétés à savoir ‘Tebica 96, Vaga 92’, ont été introduites mais elles

n’ont pas trouvé autant d’intérêt. Jusqu'à présent, ‘Haïdra et Tahent’ constituent les variétés de

blé tendre les plus récentes, elles ont été sélectionnées pour leurs caractéristiques

agronomiques : haut rendement, résistance à la sécheresse, tolérance à la rouille et à la

septoriose (Saade et al., 1996).

En Tunisie, le secteur demeure l’un des plus importants de la production agricole. Les

emblavures réservées aux céréales (blé dur, blé tendre, orge et triticale) sont en moyenne de 1,5

million d’hectares répartis en 700 000 hectares de blé dur, 500 000 hectares d’orge, 300 000

hectares de blé tendre et 20 000 hectares de triticale (Anonyme 1, 2015). Ainsi, 58% des

emblavures sont localisées au Nord et au Nord-Ouest du pays, avec 54% des emblavures qui


6

sont réservées au blé dur contre 36% pour le blé tendre alors que l’orge ne représente quant à

elle, que 10% des superficies emblavées (Anonyme 2, 2016).

Des rendements de 60 q/ha sont obtenus par les agriculteurs performants dans les zones

favorables du Nord de la Tunisie telles que BéjàBéjà, Jendouba et leLe Kef (El Faleh et al.,

2014). Les variétés Karim, Utique et Rihane dominent respectivement les emblavures de blé

dur, de blé tendre et d’orge, (El Faleh et al., 2014). Néanmoins, les productions nationales n’ont

pas permis la satisfaction des besoins domestiques et la Tunisie n’arrive pas à atteindre son

autosuffisance en céréales et a annuellement recours à l’importation de cette denrée.

Toutefois, le blé dur, qui représente 70% de la production des céréales, satisfait en

moyenne, 72% de la demande nationale alors que le blé tendre ne couvre que 20% des besoins

nationaux et les importations de blé tendre et de blé dur tournent autour de 79 et 27%

respectivement (Bachta, 2011). Les emblavures et les rendements sont largement dépendants

des conditions climatiques, notamment la pluviométrie. La culture du blé est principalement

conduite en pluvial au Nord du pays (Ammar et al., 2011). Par conséquent, on peut distinguer

4 étages bioclimatiques là où le blé est cultivé (figure 1) :

- Etage bioclimatique Humide : avec une pluviométrie dépassant 500 mm, c’est l’étage

bioclimatique le plus favorable pour la culture de blé, répartis sur quelques régions du

gouvernorat de Bizerte et de Jendouba.

- Etage bioclimatique Sub-humide : étage avec une pluviométrie allant de 400 à 500 mm

sur toute l’année, répartis entre les gouvernorats de Bizerte, La Manouba, Nabeul (El Haouaria)

et Béjà.

- Etage bioclimatique Semi-aride : dans cette zone la pluviométrie annuelle varie entre

250 et 400 mm. Cet étage s’étend sur quelques régions du gouvernorat de Jendouba, Le Kef,

La Manouba, Ariana, Ben Arous, Nabeul (Menzel Temim), Zaghouan et Siliana.

- Etage bioclimatique Aride : Centre et sud, zones avec des précipitations très limitées (<

200mm) influençant négativement la production céréalière dans les régions appartenant à cet

étage.


7

Figure 1. Etages bioclimatiques adaptés à la culture de blé en Tunisie (Anonyme 3, 2004)

La production céréalière en Tunisie est fortement liée aux stress abiotiques (salinité,

sécheresse) et aux stress biotiques (adventices, ravageurs et surtout les maladies). En effet,

Slama et al. (2005) ont signalé que la culture de blé est soumise souvent à des sécheresses très

fréquentes, entraînant des pertes considérables de rendement qui varient de 10 à 80% selon les

années. Des pertes de rendements importantes ont été également attribuées à l’effet néfaste

causé par les maladies foliaires notamment la septoriose qui entrave les cultures céréalières en

Tunisie (Ben Mohamed et al., 2000 ; Gharbi et al., 2000)

3. La septoriose du blé : Importance dans le Monde, au nord de l’Afrique et en

Tunisie

Ce pathogène est présent partout dans le monde, là où le blé est cultivé (Eyal, 1987). Il

est considéré comme le pathogène le plus destructif dans les pays du bassin méditerranéen,

l’Afrique et l’Amérique du sud. L’importance économique de la septoriose foliaire découle des

pertes de rendement importantes qu’elle occasionne sur le blé, surtout quand les trois dernières


8

feuilles sont sévèrement touchées. Des attaques sévères ont été enregistrées en Argentine

(Pampas) (Cordo et al., 2017), l’état de l’Oregon et l’ensemble des USA (Estep et al., 2015),

Canterbury (Drummond et al., 2016) et la Nouvelle Zélande (Stewart et al., 2014). En Australie,

des épidémies importantes ont été enregistrées chez des variétés précoces et les dégâts ont

atteint 50% dans les régions à pluviométrie élevée (Bathgate et Loughman, 1994). En Urugay

et au Brésil, les pertes de rendement étaient de l’ordre de 60 et 50% respectivement (Van

Beuningen et Kohli, 1990). Dans les pays européens, les pertes de rendements peuvent atteindre

30 à 40% (Morais et al., 2015) et plus qu’un milliard d’euro par an sont consacrés aux

fongicides pour lutter contre cette maladie (Kettles et kanyuka, 2016).

En Afrique du Nord, la première épidémie de septoriose s’est produite avec l’introduction

des variétés naines à maturité précoce et à haut rendement durant la campagnecampagne

agricole 1968/1969, qui a particulièremet connu des températures douces et une humidité très

élevée, des conditions très favorables à l’installation de la septoriose. Ainsi, tous les pays du

Maghreb ont connu durant cette période une épidémie spectaculaire et toutes les variétés

commerciales ont été détruites par ce pathogène (Mamluk et al., 1995 ; Mazouz et al., 1995).

En Algérie, Lounis-lalou (2005) a déclaré que toutes les variétés de blé tendre et de blé

dur ont montré des niveaux de sensibilité vis-à-vis de la septoriose. Dans ce sujet, Ayad et al.

(2014) ajoutent qu’en Algérie ce pathogène s’est montré très préjudiciable au cours des

dernières décennies, pouvant réduire les rendements de plus de 60%.

D’autre part, au Maroc Zahri (2008) a rapporté que ce pathogène s’attaque beaucoup plus

au blé tendre qu’au blé dur et que les pertes de rendement sont estimées entre 28 et 30% pour

la variété de blé tendre ‘Nesma’ et peuvent atteindre 35% (Mazouz et al., 1995). Dans le même

sujet, Jilbene (1996) a signalé des pertes dues à Z. tritici de l’ordre de 80% pour certaines

variétés de blé tendre sensibles, notamment pendant les années pluvieuses.

En Tunisie, en conditions favorables et pendant les années pluvieuses, ce pathogène se

place en tête du complexe parasitaire inféodées à la culture de blé dur (Harrabi et Cherif, 1990).

Les pertes de rendements chez le blé dur occasionnées par ce pathogène varient entre 10 et

15%, pouvant atteindre 60% quand les conditions environnementales sont favorables au

développement de la maladie. L’incidence de la maladie croît avec l’augmentation des

superficies irriguées, l’utilisation intensive de la fertilisation azotée et surtout avec les

conditions climatiques favorables caractérisant les régions céréalières du Nord et du Nord-

Ouest qui sont considérées comme étant un Hot-spot pour la septoriose (Rezgui et al., 2008 ;

Fakhfakh et al., 2011 ; Berrais et al., 2013).


9

De point de vue sensibilité variétale, Gharbi et al. (2011) ont rapporté que les variétés de

blé dur inscrites avant 2003 à savoir Karim (1980) Razzak (1987) et Khiar (19992), ont monté

une sensibilité très élevée à la septoriose. Par contre, les variétés Nasr (2004), Maali (2007) et

Salim (2010) ont montré des niveaux de résistance partielle à cette maladie. De plus, Gharbi et

Deghaies (1997) et Gharbi et al. (2000) suggèrent que l’incidence de cette maladie était

beaucoup plus importante sur le blé dur que sur le blé tendre.

Contrairement à la situation en Tunisie, Zahri et al. (2008), ont rapporté qu’au Maroc, les

attaques étaient plus fréquentes et plus sévères chez le blé tendre que chez le blé dur. Dans ce

contexte, Eyal et al. (1985), Kema et al. (1995) et Sayoud (1995) ont suggéré une certaine

spécialisation du pathogène sur le blé dur. En Tunisie, et jusqu’à présent pratiquement peu ou

pas de travaux ont été menés sur la septoriose chez le blé tendre en Tunisie et pas de données

exactes de rendements sont ainsi disponibles pour cette culture.

4. Généralités sur la septoriose

La spetoriose causée par ‘Zymosepotia tritici’ est présente chez le blé dur pendant tout

le cycle de la plante, dès l’apparition des premières feuilles jusqu’à la formation de la feuille

drapeau. Ce champignon est apparu comme étant un agent pathogène du blé coïncidant avec la

domestication de cette plante cultivée et sa spéciation a eu lieu avec une adaptation forte à

l'agro-écosystème, car le blé a été soumis à une forte pression de sélection pour augmenter le

rendement (Stukenbrock et al., 2010). Cette pression de sélection a été accompagnée par des

changements dans la diversité génétique des espèces végétales. La co-évolution à long terme

avec le blé a donné lieu à cet agent pathogène très spécialisé du blé et qui est difficile à contrôler

(McDonald, 2014).

4.1.Classification et plantes hôtes

La septoriose du blé, ‘Septoria tritici leaf blotch (STB)’ causée par Zymoseptoria tritici

(Roberge ex Desm.) Quaedvl. & Crous anamorph, et Mycosphaerella graminicola (Fuckel)

J.SchorÖt 1894 teleomorphe, est un champignon ascomycete de la classe des Dothideomycètes

qui s’attaque principalement au blé dur (Triticum turgidum L. subsp. durum (Desf.)), blé tendre

(Triticum aestivum L. subsp. aestivum) et triticale (×Triticosecale spp.).

Observée non seulement sur blé mais aussi sur plusieurs poacées (avoine, triticale, seigle),

cette maladie attaque principalement la partie foliaire (Nasraoui, 2008). De nombreux

adventices courants des cultures de blé, de seigle ou de triticale, tels que Brachypodium spp.,

Bromus spp., Dactylis spp., Festuca spp., peuvent jouer le rôle de réservoirs pour le champignon


10

pathogène en maintenant un inoculum à proximité immédiate des céréales cultivées (Gigot,

2013).

4.2.Symptômatologie

Les symptômes engendrés par ce pathogène se manifestent sur blé par des taches brunes,

irrégulières plus ou moins allongées souvent entourées par une bordure chlorotique mince.

Cette dernière se dessèche et devient de plus en plus clair blanchâtre, portant des fructifications

asexuées (pycnides) sous forme de petits points brun foncé à noir qui se forment alors au niveau

des nécroses foliaires, comme le montre la figure 2 (Nasraoui, 2008). Chaque pycnide est

capable de produire des milliers de pycnidiospores qui possèdent une forme allongée

légèrement arquée, d'une longueur comprise entre 20 et 98 μm (Suffert et al., 2013).

Figure 2. Symptômes typiques de la septoriose du blé. (A) Les pycnides de la phase asexuée de Z. tritici (B)

(suffert et al., 2016), (B) Taches nécrotiques avec de petits points brun foncé à noir (Gigot, 2013)

4.3.Cycle biologique de Zymoseptoria tritici

Zymoseptoria tritici est caractérisé par un cycle de vie hémibiotrophe qui commence par

une phase biotrophe par la colonisation du tissu vivant avant de devenir nécrotrophe et tuer les

cellules vivantes. Le stade biotrophe commence dès la pénétration du champignon à travers les

stomates des tissus foliaires vivants (feuilles vertes). L’infection se déclenche dans la cavité

stomatale et le cycle d’infection se déroule en trois phases : 1- l’entrée du champignon, 2- la

A B


11

colonisation des tissus de la plante et 3- la formation des pycnides ou ‘fruiting bodies’

(Steinberg, 2015) (figure 3).

Le premier jour de l’infection est connu par l’absence totale de symptômes (O’Driscoll

et al., 2014 ; Sánchez-Vallet et al., 2015). Dix jours après, le champignon entre en phase de

nécrotrophie et commence à causer des chloroses, des nécroses et des pycnides. En effet, cette

phase est étroitement couplée avec la croissance rapide et le début de la reproduction asexuée.

Cependant, le déclencheur moléculaire et environnemental de ce changement entre les deux

phases reste inconnu. Cepandant, Sanchez Vallet et al. (2015) ont rapporté que le stress

environnemental tel que la lumière, la disponibilité de l'eau et les fluctuations de la température

peuvent également jouer un rôle. A ce sujet, Brunner et al. (2013) et Gohari et al. (2015) ont

suggéré aussi que Z. tritici utilise probablement plusieurs mécanismes pour induire une nécrose,

y compris la production de protéines effectrices et que plusieurs gènes codant pour des protéines

riches en cystéine sont fortement exprimés au cours de la phase nécrotrophe. Cela peut indiquer

le rôle majeur des autres acteurs moléculaires tels que les métabolites secondaires, et les

enzymes dégradant les parois dans l’induction de la nécrose. Toutefois, trente jours après

l’infection, le pathogène entre en stade saprophyte (Sanchez Vallet et al., 2015).

Pendant la saison culturale, la maladie se propage d’une plante à une autre (progression

horizontale) et entre les feuilles (progression verticale) sur de courtes distances par dispersion

pluviale des pycnidiospores (figure 4). Il est désormais acquis que ces dernières, transportées

par la pluie sur de courtes distances provoquent l’infection secondaire alors que l’infection

primaire est assurée par les ascospores, potentiellement transportées sur de longues distances

par le vent. Les ascospores se forment sur les débris d’une culture de blé et contaminent le blé

de la saison suivante, en cas de monoculture (Suffert et Sache, 2011).


12

Figure 3. Cycle biologique de Zymoseptoria tritici (adapté par O’Driscoll et al., 2014)

Figure 4. Schéma représentatif de la dynamique des ascospores (d'inoculum primaire) et des pycnidiospores

(inoculum secondaire) ainis que leurs rôles dans l’induction d’une épidémie (Suffert et al., 2016).


13

4.4. Hétérothallisme et reproduction sexuée

La phase sexuée de Z. tritici a été observée pour la première fois par Sanderson (1972)

en Nouvelle-Zélande. Ce pathogène a été décrit par la suite par plusieurs chercheurs dans

plusieurs pays à travers le monde, au Chili, aux Etats-Unis, aux Pays-Bas, en France, en Algérie

et en Tunisie (Madariaga, 1986 ; Garcia et Marshall, 1992 ; Kema et al., 1996 ; Halama 1996 ;

Ayad et al., 2014 ; Ben Hassine et Hamada, 2014). Pour les espèces hétérothalliques, cette

phase sexuée commence par une étape de reconnaissance entre les types sexuels et entraine la

fusion temporaire de deux souches fongiques portant les mating types compatibles, suivie par

une méiose et un échange d’information génétique entre les individus (Zhan et al., 2004).

Dans le cas de Z. tritici, la reproduction sexuée est possible uniquement lorsque les deux

idiomorphes sont disponibles au même temps, au niveau de la même feuille et à la même

localité géographique (Waalwijk et al., 2002). L’identification, le clonage et le séquençage des

idiomorphes de Z. tritici ont été réalisés à partir de deux isolats de référence IPO323 et

IPO94269 (Waalwijk et al., 2002). Ces idiomorphes, lors du stade sexué de Z. tritici, donnent

naissance aux pseudothèces qui sont produits sous certaines conditions durant l’année (Hunter

et al., 1999). En effet, la distribution géographique des types sexuels parait fortement liée à

l’évolution et la biologie des populations des champignons hétérothalliques. Toutefois, la

reproduction sexuée possède un grand effet sur la diversité génétique des populations par

l’introduction de nouveaux allèles venant d’autres populations (Zhan et al., 1998 ; Kebbage et

al., 2008). Dans des études précédentes, il a été rapporté que la forme sexuée Mycrosphaerella

graminicola joue un rôle très important dans la diversité génétique des populations tout en

influençant le développement épidémiologique de la maladie à travers les saisons de croissance

du blé (Zhan et al., 1998 ; Zhan et al., 2004).

4.5.Intéraction entre Zymoseptoria tritici-blé et spécificité

L'histoire de Z. tritici peut être reliée au Croissant Fertile ~ il y a 11.000 ans (McDonald

et Mundt, 2016). Ainsi un hot-spot et une diversité génétique ont été découverts dans le Moyen

Orient à travers une population de 1673 isolats collectés à partir de plusieurs pays à travers le

monde (Zhan et al., 2003). L'existence d'une spécificité de l’hôte chez Z. tritici a été décrite

depuis plus de 25 ans (Eyal et al., 1973 ; Ware, 2006). La spécificité de l'hôte décrit le degré

d'adaptation d'un parasite à une espèce hôte spécifique. Pour les champignons phytopathogènes,

cette spécificité diffère beaucoup. Par exemple, les champignons nécrotrophes comme Botrytis


14

cinerea, l'agent causal de la pourriture grise ont une large gamme d'hôtes. Contrairement, Z.

tritici a une gamme d'hôtes très étroite qui est limitée au blé tendre (Triticum aestivum) et au

blé dur (T. durum), mais il infecte parfois d'autres espèces de graminées, comme l'orge et le

triticale ainsi que certains adventices (Stukenbrock et al., 2011 ; Ponomarenko et al., 2011). En

effet, il a été rapporté par Eyal et al. (1999), que ce champignon peut hiverner sur plusieurs

hôtes alternatifs comme « Agropyron spp., Agrostis spp., Brachypodium spp., Bromus spp.,

Dactylis spp., Festuca spp., Hordeum spp. ».

Seifbarghi et al. (2009) ont démontré que des souches de Z. tritici qui ont été isolées à

partir de T. aestivum étaient capables de causer des symptômes chez les espèces « T. aestivum,

T. durum, T. dicoccum et T. compactum ». Par contre, Kema et al. (2002) ont montré qu’en

général les isolats de blé tendre sont avirulents sur les cultivars de blé dur et les isolats de blé

dur sont avirulents sur des cultivars de blé tendre et il a attribué ceci à l’existence d’une relation

gène pour gène entre le pathogène et la plante. Dans ce contexte, Eyal et al. (1999) et Kema et

al. (1996) ont mentionné trois classes d’isolats : des souches isolées de blé tendre qui n’infectent

que T. aestivum, des souches isolées de blé dur qui infectent exclusivement T. durum et des

souches de blé dur et de blé tendre qui sont capables d’infecter les deux espèces.

Des études récentes ont prouvé une interaction complexe entre le blé et Z. tritici pendant

le processus d'infection (Kellner et al., 2014 ; Rudd et al., 2015). Ces mêmes chercheurs ont

montré que le champignon bénéficie probablement des carbohydrates produits au début de la

phase nécrotrophe. Cette étape est caractérisée également par une forte surexpression des gènes

de défense des plantes, qui coïncide avec l'activation des gènes codant pour les métabolismes

secondaires et les petites protéines sécrétées. Ainsi, il a été démontré que ces petites protéines

effectrices sécrétées jouent un rôle majeur dans la surexpression des réactions de défense dans

l’interaction plante-pathogène (Mirzadi et al., 2015 ; Poppe et al., 2015 ; Rudd et al., 2015).

En 2007, des travaux ont été menés par Goodwin sur l’interaction plante-pathogène et ont

abouti à la découverte des sources de résistance des cultures à Zymoseptoria tritici. Le blé

possède essentiellement deux types de résistance à la septoriose. Cette résistance peut être de

nature qualitative ou spécifique, et quantitative. La résistance qualitative, spécifique ou

verticale est pratiquement totale, monogénique et gouvernée par une relation gène-pour-gène

(Brown et al., 2015 ; Chartrain et al., 2005). Cette dernière est indépendante du stade de

croissance de la plante. Par contre la résistance quantitative ou horizontale peut être dépendante

du stade phénologique, elle n’est pas totale et elle est polygénique (contrôlée par plusieurs

gènes) et dans plusieurs cas elle est efficace contre Z. tritici (Brown et al., 2015).


15

Goodwin a montré l’existance de 12 gènes de résistance, dits Stb, en 2007. En tenant

compte de la mise à jour de l’inventaire par Cuthbert (2011) auquel se rajoutent les travaux de

Ghaffary et al. (2011 et 2012), 21 gènes Stb et 167 QTLs ont été identifiés (Hartmann, 2017).

Certains gènes Stb ont été tout à fait durables, tandis que d'autres ont échoué en raison du

changement génétique rapide de la population d'agents pathogènes. Par exemple, Stb1 est resté

efficace dans l'Indiana depuis plus de 25 ans, tandis que Stb 4 était efficace en Californie

pendant 14 ans puis il a échoué, et il a duré seulement un ou deux ans dans l'Oregon. Souvent,

les cultivars de blé rapportés comme résistants dans une région se sont revelés sensibles dans

une autre (Ponomarenko et al., 2011 ; Brown et al., 2015). Cela parait être dû en premier lieu à

la grande diversité génétique du pathogène, qui peut être affectée par les cultivars, la pertinence

de l'environnement et l'importance relative du stade sexuel du pathogène. En Tunisie, Ferjaoui

et ses collaborateurs (2015) ont identifiées la première source de résistance à la septoriose

identifié chez le blé dur a travers la résistance de l’accession ‘Agili39’ à l’isolat TunBz1 aux

stades plantule et adulte.

4.6. Structure des populations de Zymoseptoria tritici

L’identification de la structure génétique de la population de l'agent pathogène est utile

pour le développement des stratégies de gestion de la maladie. En outre, elle reflète l’histoire

évolutive du pathogène ainsi que son potentiel d’adaptation (McDonald, 1997). La structure

génétique se réfère à la quantité et la distribution de la variation génétique au sein et entre les

populations de pathogènes (McDonald et Mundt, 2016). La génétique des populations permet

de comprendre les processus évolutifs impliqués dans la création et le maintien de la variation

génétique au sein et entre des populations, en analysant les fréquences alléliques. En outre deux

types de diversité génétique contribuent à la structure génétique : la diversité génique et la

diversité génotypique.

La diversité génique est estimée grace au nombre et des fréquences d’allèles au niveau des loci

individuels dans une population. Elle augmente au fur et à mesure que le nombre d’allèles

augmente et les fréquences relatives de ces allèles deviennent égales. Cette diversité génique

peut être affectée par la taille et l’âge de la population ainsi par le flux de gène. La diversité

génotypique se réfère au nombre et à la fréquence des génotypes multi-locus ou d’individus

génétiquement distincts (génotypes) au sein d’une population donnée (McDonald et Linde,

2002).


16

4.7.Diversité génétique des populations

Plusieurs études antérieures ont été conduites sur l’analyse de la diversité génétique des

populations de Z. tritici, à tous les niveaux : pays, région, champ, plante et feuille (McDonald

et Martinez, 1990 ; Linde et al., 2002 ; Abrinbana et al., 2010 ; Gurung et al., 2011 ; El

Chartouni et al., 2012 ; Boukef et al., 2013 ; Nouari et al., 2016 ; Siah et al., 2018).

La caractérisation des populations à l’aide des premières générations de marqueurs

moléculaires a permis de mieux comprendre la structure génétique des populations de ce

pathogène. Ainsi, une faible différenciation génétique a été observée chez les populations de Z.

tritici sur les plans régional et mondial. En plus, une diversité génétique très élevée et un flux

de gène très important ont été ainsi signalés entre plusieurs populations à travers le monde

(Schnieder et al., 2001 ; Linde et al., 2002 ; Zhan et al., 2003 ; Drabesova et al., 2013). Le cas

contraire a été signalé en Iran où Abrinbana et al. (2011) ont démontré une faible diversité

génétique, et un flux de gène très bas dans cinq populations de Z. tritici. Des études précédentes

ont indiqué que la reproduction asexuée n’avait aucun effet sur la variabilité génétique des

populations du Z. tritici alors que la reproduction sexuée y joue un rôle important en favorisant

les flux de gènes et l'apparition rapide de résistance aux fongicides (Zhan et al., 1998;

Abrinbana et al., 2010 ; Boukef et al., 2012). De plus, les populations fongiques ayant une

variation génétique élevée sont plus capables de développer une résistance aux fongicides que

les populations ayant une faible variation génétique (Drabešová et al., 2013).

En Tunisie, une grande diversité génétique des populations de Z. tritici isolées à partir du

blé dur a été révelée à travers plusieurs études (Berraies et al., 2013; Boukef, 2012, Nouari et

al., 2016). Toutefois, étant donné que ce pathogène s’attaque plus au blé dur en Tunisie, la

diversité génétique des populations de Z. tritici isolées à partir du blé tendre reste inonnue.

4.8. Les forces évolutives affectant la diversité génétique des populations

Il a été rapporté que la diversité génétique des populations peut être affectée

principalement par cinq forces évolutives à savoir : la mutation, la taille de la population, le

flux de gène, la reproduction sexuée et la sélection (McDonald, 2014).

La mutation constitue la source la plus importante dans les variations génétiques en

conduisant directement à des changements dans la séquence d'ADN et créant ainsi de nouveaux

allèles dans les populations. Cette dernière pourrait également créer des souches avec une

pathogénicité accrue (McDonald et al., 2016). Une importance particulière a été attribuée aux

flux de gène dans la dispersion du pathogène. En effet, c’est au cours de ce processus que


17

s’effectue l’échange de gènes entre des populations séparées géographiquement. Toutefois, le

flux de gènes élevé limite la différenciation entre les populations, par l’homogénéisation des

fréquences des allèles, et augmente la diversité génétique dans la population (McDonald et al.,

1997). Cette dernière peut être aussi affectée par la reproduction sexuée tout en favorisant

l’apparition rapide de nouvelles recombinaisons d’allèles virulents qui contribuent eux-mêmes

par la suite à l’apparition de nouveaux gènes de résistances aux fongicides (Zhan et al., 1998).

La sélection est en outre une force évolutive non négligeable car c’est elle qui contribue aux

changements des fréquences alléliques qui se traduit par la perte des allèles au fil du temps

(McDonald et Linde, 2002).

5. Influence des facteurs climatiques sur le développement de la maladie

Les maladies des plantes cultivées peuvent occasionner des pertes considérables lorsque

les conditions climatiques sont favorables à leur développement. L'identification des facteurs

climatiques qui favorisent ou défavorisent le développement des agents pathogènes est

nécessaire à la compréhension de l'épidémiologie et l’évolution des maladies des plantes. De

plus, il est reconnu que c’est le climat qui gouverne en grande partie les changements au niveau

du pathogène, de l’épidémie et aussi de la plante hôte (Rapilly, 1991). Le développement d'une

maladie foliaire résulte de l'interaction dynamique entre la plante hôte, l'agent pathogène et

l'environnement (Suffert et al. 2015).

Dans le cas de la septoriose, la maladie se développe à une température modérée et à une

humidité relative élevée (Gouache et al., 2013). Dans ce contexte, Cordo et al. (2017)

rapportent que, la radiation, la température, l’intensité des pluies et l’humidité relative affectent

significativement la dispersion des ascospores et des pycnidiospores du pathogène. Cependant,

le processus de l’infection peut avoir lieu idéalement au cours des journées nuageuses et

pluvieuses et le progrès et l’intensité de l’épidémie sont déterminés par le nombre de cycles

asexués accomplis par le pathogène (généralement 4 à 6) qui sont fortement gouvernés par les

scénarios de la pluviométrie et de la température (Suffert et al., 2015).

Toutefois, l’humidité est déterminante pour toutes les étapes de l’infection : la

germination, la pénétration et le développement du mycelium dans le tissu de la plante hôte. En

effet, pour germer, les spores ont besoin d’eau sur les feuilles, ainsi qu’une période humide

assez longue pour pouvoir pénétrer dans l’hôte (Rapilly, 1991).

D’autre part, la température peut avoir plusieurs effets sur le changement du

comportement parasitaire du champignon. En effet, les températures basses affectent la


18

germination des pycnidiospores et la croissance mycelienne (Eyal et al., 1987). La germination

des spores exige une température optimale entre 5 et 35°C et une humidité relative saturée

constante de 3 à 100% sur le feuillage (Kema et al., 1996a). L’infection peut être retardée dans

le champ si la température est au dessous de 7°C durant 2 nuits consécutives. Cordo et al. (2017)

et Eyal et al. (1987) rapportent que la libération des pycnidiospores est fortement corrélée avec

la radiation et qu’un optimum de 8.000 à 12.000 lux est nécessaire pour la croissance du

mycelium.

Selon Suffert et al. (2015), le vent intervient directement sur la dissémination, la

dispersion et le transport à longue distance des ascospores pour initier une nouvelle épidémie.

Il agit aussi sur les flux de chaleur et de vapeur d’eau qui s’établissent au sein d’un couvert

végétal. En effet, par ses vitesses et ses changements brutaux de direction que le vent joue un

rôle dans la libération des spores (Rapilly, 1991).

Certains groupes de parasites nécrotrophes sont dépendants de l’eau libre pour la

libération de l’inoculum primaire et même l’inoculum secondaire (grâce à la libération de la

gelée). Toutefois, l’humidité saturante et l’eau libre sont indispensables pour la contamination,

par contre une humidité relative élevée est suffisante pour l’incubation, la latence et l’extension

des surfaces sporulantes. En effet, selon Rapilly (1991), à peu près 25% de l’intensité de la

septoriose causée par Septoria nodurum sur les deux derniers limbes du blé est expliquée par la

persistance de la rosée. Toutefois, la vapeur d’eau peut accroitre l’adhésion des spores sur les

feuilles tout en augmentant la pression de l’inoculum. En outre, Cordo et al. (2017), ont signalé

que plus les pluies sont intenses plus la dispersion des spores par splash est rapide vers les

surfaces foliaires saines.

D’autre part, la pluie et la rosée interviennent aussi par la dilution de la concentration de

l’inoculum primaire, parfois par la dissolution des substances sporales du pathogène et même

l’élimination de ces derniers. Selon Morais (2015), la vitesse de développement d'une épidémie

est déterminée par le nombre de cycles de multiplication asexuée qui dépend des conditions de

température et du nombre d'épisodes pluvieux.

6. La résistance variétale comme alternative de lutte contre la septoriose

Face aux limites de la lutte chimique via des molécules unisites, la méthode de contrôle

la plus importante, économique et respectueuse de l'environnement est d’utiliser des cultivars

résistants. L’utilisation de variétés résistantes constitue une composante essentielle pour la

majorité des programmes de sélection et un moyen de contrôle efficace (Fones et Gurr, 2015).


19

De leur part, Ben Mbarek et al. (2019) ont souligné l’importance du recours au mélange variétal

à raison de 25% (pour les variétés résistantes) qui a améliore significativement la réduction de

la septoriose dans des essais de plein champ à Béjà.

C’est dans ce cadre que s’intègre ce travail de thèse qui s’est basé sur une étude de la

distribution géographique de Z. tritici en Tunisie chez le genre Triticum particulièrement

l’espèce T. aestivum dans les différentes régions céréalières en une première étape. Ensuite, il

s’est orienté vers l’investigation de la sensibilité/résistance d’un ensemble de 89 génotypes de

blé de différentes origines Tunisienne, Marocaine et Algérienne, cultivés en Tunisie.

Finalement, ce travail s’est interessé à l’étude de la diversité et la structure génétique d’une

collection de Z. tritici et de la différentiation génétique entre les populations à plusieurs

niveaux : région, parcelle, espèce et cultivar.

Chapitre2. Occurrence of Septoria tritici blotch (Zymoseptoria

tritici) disease on durum wheat, triticale, and bread wheat in

Northern Tunisia

Rim Bel Hadj Chedli1, Sarrah Ben M’Barek2, Amor Yahyaoui3, Zakaria Kehel4, and Salah

Rezgui1

1 National Agronomic Institute of Tunisia (INAT), 43 Avenue Charles Nicolle, 1002 Tunis, Tunisia. 2 Regional Field Crop Research Center of Beja (CRRGC) BP 350, 9000 Beja, Tunisia. 3 Centro Internacional de Mejoramiento de Maíz y Trigo (CIMMYT), km 45 Carretera México-Veracruz El Batán,

Texcoco, Estado de México, México. 4 International Center for Agricultural Research in the Dry Areas (ICARDA), Rue Hafiane Cherkaoui, Agdal Rabat

Po Box 6299 PC: 10112, Morocco

Bel Hadj Chedli et al. Occurrence of Septoria tritici blotch (Zymoseptoria tritici ) disease on durum

wheat, triticale, and bread wheat in Northern Tunisia. Chil. j. agric. res. [online]. 2018, vol.78, n.4,

pp.559-568. ISSN 0718-5839. http://dx.doi.org/10.4067/S0718-58392018000400559.

http://dx.doi.org/10.4067/S0718-58392018000400559

Chapitre 2. Occurrence of Septoria tritici blotch (Zymoseptoria tritici) disease on durum wheat, triticale, and

bread wheat in Northern Tunisia

20

Objectifs et démarche

La sévérité de l’attaque par Z. tritici dans les champs de blé dur (Triticum turgidum L.

subsp. durum (Desf.)) est influencée par la sensibilité élevée des variétés améliorées ‘Karim’,

‘Khiar’ et ‘Razzak’. Les infections de ce champignon phytopathogène se sont intensifiées dans

les zones humides notamment à Bizerte et à Béjà et les pertes de rendements ont dépassé 60%

chez les variétés sensibles comme ‘Karim’ (Ben Mouhamed et al., 2000 ; El Faleh et al., 2014)

Bien que la septoriose fût observée annuellement sur blé dur, le blé tendre ‘Triticum

aestivum’ semble être beaucoup plus résistant à cette maladie en Tunisie. Cette hypothèse a été

supportée par plusieurs chercheurs à savoir Dhgaies et al. (1996) et Gharbi et al. (2000), qui

ont signalé que le blé tendre en Tunisie a montré depuis toujours un haut niveau de résistance

à ce pathogène. Cependant, jusqu’à présent, aucune information n’a été publiée concernant

l’importance de cette maladie et sa répartition géographique en Tunisie chez le blé tendre.

Ainsi, les principaux objectifs de ce chapitre sont :

✓ L’étude de la prévalence et la distribution géographique de Z. tritici chez le genre

« Triticum » dans différentes régions céréalières au Nord de la Tunisie,

✓ La réévaluation de l'importance relative de cette maladie qui s’attaque

principalement au blé dur en Tunisie

✓ L’identification des microclimats favorables à ce champignon pathogène pour

développer des stratégies de lutte spécifiques pour chaque situation.

Pour cela, une enquête a été menée dans les principales régions céréalières du nord de la

Tunisie (Béjà, Bizerte, Manouba, Jendouba, Cap Bon, Zaghouan et Le Kef) où 57 champs ont

été prospectés durant la saison agricole 2015-16, et 69 champs ont été inspectés en 2016-17. La

prévalence de la maladie a été mesurée au sein de chaque région alors que l’incidence et la

sévérité ont été déterminées au niveau de chaque champ en se basant sur l’échelle de notation

« Saari-Prescott ». En plus, un protocole de classification adapté par ‘CIMMYT-septoria

phenotyping platform’ a été aussi appliqué pour identifier les différentes régions à risque.



21

Abstract

Wheat (Triticum turgidum L. subsp. durum (Desf.) is the most important cereal crop in

Tunisia, nonetheless production is highly affected by drought and diseases mainly Septoria

tritici blotch (STB) caused by ‘Zymoseptoria tritici’.The main objective of this work was to

study prevalence and geographical distribution of this pathogen on triticale, durum wheat and

particularly on bread wheat in different cereal growing regions of North and Northwestern

Tunisia to confirm its presence/absence on bread wheat. For this study, 126 wheat fields were

surveyed in North and Northwestern Tunisia during 2015-2016 and 2016-2017 cropping

seasons. STB on durum wheat was present in the majority of inspected durum wheat fields,

where high mean incidence (60%) and severity (40%) were recorded at Jendouba, Bizerte, Béjà,

and Kef. The survey data revealed low risk on bread wheat with an incidence of 23% and 29%

at Bizerte and Béjà, respectively. However high incidence of 84% and 52% was recorded at

Cap Bon in 2016 and 2017, respectively and mainly at El Haouaria where STB severity was

relatively high on bread wheat landrace of unknown origin but called by local farmers as ‘Farina

Arbi’. High (100%) and moderate (33%) incidence was recorded on Triticale at Bizerte and

Jendouba respectively during the two-cropping season. The survey data revealed low risk on

bread wheat except at El Haouaria where STB severity was relatively high on a bread wheat

landrace; while it was considered as high risk at all durum wheat fields in Béjà, Bizerte,

Jendouba, Zaghouan and Kef regions, such distinct occurrence could lead to clarify host

specificity in Z. tritici.

Key words: Farina Arbi, survey, Triticum, Tunisia, wheat, Zymoseptoria.

1. Introduction

The cereal sector is of major economic importance in Tunisia. It provides major staple

food commodities for most Tunisian households. Cereals are cultivated on almost one third of

agricultural land (1.5 million hectares) (Tunisian Ministry of Agriculture, 2015), 58% are

located in the Northern and Western regions where durum wheat (Triticum turgidum L. subsp.

durum (Desf.) van Slageren) represents 54%, against 36% for bread wheat (Triticum aestivum

L. subsp. aestivum) and 10% for barley (FAO, 2017). Average production is around 1.05

million tons, which represent approximately 80% of the country needs (Gharbi et al., 2000).

However, cereal production in Tunisia faces many challenges of which drought is the most

limiting abiotic stress in semi arid zones (Slama et al., 2005), while biotic stress, mainly leaf



22

rust and Septoria tritici blotch (STB), cause important yield losses particularly on durum wheat

in sub-humid regions (Ben Mohamed et al., 2000; Gharbi et al., 2000) of North and

Northwestern Tunisia.

STB caused by the ascomycete fungus Zymoseptoria tritici (Roberge ex Desm.) Quaedvl.

& Crous became more important in Tunisia since the introduction of early maturing, semi

dwarf, high yielding varieties. It has become an inherent disease of durum wheat, and thus a

significant challenge for breeders to release varieties which combine good resistance and higher

yields (Ammar et al., 2011). In contrast to durum wheat, bread wheat varieties grown in Tunisia

are almost indemn of Septoria. High incidence of STB on durum compared to bread wheat in

Tunisia suggests either an adaptation of Z. tritici isolates to durum rather than bread wheat

(Yahyaoui et al., 2000) or high levels of resistance in bread wheat. The observed levels of

resistance amongst cultivated bread wheat varies from year to year, most likeley based on the

environmental conditions and the dynamics of STB populations.

Although Septoria was observed on durum wheat annually, up to now not much is known

on the occurence of STB on bread wheat. Hence, the main objective of this paper was to study

the prevalence and geographical distribution of Z. tritici on Triticum species and particularly

on T. aestivum in different cereal growing regions of North and Northwestern Tunisia to

eventually confirm its presence/absence on bread wheat.

2. Materials and Methods

2.1.Study area description

Surveys were conducted during two cropping seasons (2015-2016; 2016-2017) at seven

major wheat-growing areas in North and Northwestern Tunisia (Figure 1). Fifty-seven fields

were surveyed in Cap Bon North (El Haouaria), Cap Bon South, Bizerte, Manouba, Béjà, and

Jendouba during 2016 and sixty-nine fields were surveyed in Cap Bon regions, Bizerte,

Manouba, Béjà, Jendouba, Zaghouan, and Kef during 2017 (Figure1). Certain varieties were

more predominant than others rendering therefore inter region comparison rather difficult to

make.



23

Figure 1. Map of Tunisia showing the location of survey areas across different climatic regions during 2016 and

2017 cropping seasons. Sub-humid: Cap Bon North (A), Bizerte (B) and Béjà (C). Semi-arid region of Northern

Tunisia: Cap Bon South (D), Manouba (E), Zaghouan (F), Jendouba (G), and Le Kef (H).

2.2. Climatic conditions of the surveyed regions

Meteorological data (temperature and rainfall, Table 1) and geographical coordinates

(Altitude, longitude and latitude, Table 2) over different climatic regions for each survey areas

were recorded. The average rainfall varied from 500 to 800 mm and the temperature ranged

between 6 and 33 °C in the sub-humid region (Cap Bon North, Bizerte and Béjà). Precipitation

and temperature rates varied from 400 to 600 mm and from 5 to 37 °C respectively in the semi-

arid regions (Cap Bon south, Manouba, Zaghouan, Jendouba, and Le Kef).

Table 1. Climatic conditions of inspected regions during the survey period.

Regions

Weather conditions (range)

Rainfall Temperature (min-max)

Mm °C

Cap Bon North* 500-800 9-31

Cap Bon South** 400-500 7-34

Bizerte 600-800 7-33

Béjà 500-600 6-32

Manouba 400-600 8-34

Zaghouan 400-600 4-34

Jendouba 400-500 5-37

Le Kef 300-400 2-38

*Cap Bon North: El Haouaria.

**Cap Bon South: Soliman, Beni Khalled and Grombalia.

A B

D G E

H

C

F



24

Table 2. Geographical coordinates of inspected regions during the survey period

Region Altitude

(range)

Longitude (N)

(range)

Latitude (E)

(range)

Bizerte 16-354 09°03’1 09°69’83 32°50’56 37°14’12

Cap bon North* 11-876 10°02’73 10°10’95 36°52’41 36°67’82

Cap bon South** 24- 446 10°45’27 10°49’10 36°47’47 36°92’68

Manouba 58-244 09°59’1 09°91’41 36°30’70 36°85’04

Zaghouan 81-320 09°45’43 10°4’42 36°21’18 36°30’53

Béjà 18-290 09°09’01 10°78’62 36°22’26 36°68’31

Jendouba 21-341 08°32’35 08°42’45 36°28’4 36°32’48

Kef 100-327 08’39°12 08°48’50 36°22’26 36°11’44

*Cap Bon North : El Haouaria.

**Cap Bon South : Soliman, Beni Khalled and Grombalia.

2.3. Cereal crops

The survey covered the major cereal growing areas in North and Northwestern Tunisia

where commercial durum wheat varieties (‘Karim’, ‘Razzak’, ‘Maali’) occupy over 60% of the

area compared to the introduced varieties (‘Saragola’, ‘Carioca’, ‘Sculpture’, ‘Soudaine’) that

cover so far less than 10%. Commercial bread wheat varieties (‘Salambo’, ‘Utique’, ‘Haidra’)

and introduced varieties (‘Zanzibar’) occupy no more than 20% of the area; while triticale

(‘Bienvenue’ and others) covers about 1-3%; the rest of the area is covered by barley and oats.

A unique situation in Cap Bon region where a landrace bread wheat (‘Farina Arbi’) occupies

over 60% of the area, the rest is covered by commercial barley, durum and bread wheat

varieties. ‘Farina arbi’, a tall low yielding bread wheat (landrace) of unknown origin is

cultivated annually for over a century, according to local farmers, in the same region and

exclusively used for pastry known as “Kaak”. The seed is maintained by local farmers and not

commercialized. Bread wheat landrace (‘Farina arbi’) and Septoria tritici blotch (STB)

differentials, (comprised within CIMMYT’s ISEPTON) were phenotyped at experimental

station of Bou Salem (Tunisia) under artificial inoculation with Zymoseptoria tritici populations

sampled from durum wheat. Inoculation was performed at tillering stage using bulk isolates at

a rate of 106 spores/ml, according to Ferjaoui et al. (2015) with slight modifications.



25

2.4. Septoria leaf blotch disease assessment

Field surveys were conducted during flowering stage of bread and durum wheat where

each field was visited once. STB prevalence was assessed within and between regions based on

number of fields surveyed and the presence/absence of Septoria at each location. The incidence

was reported on this study based on Saari-Prescott modified “0-9” Cobb-scale (Saari and

Prescott, 1975). In this survey, we designed five field classes (Table 3) to assess STB within

each region where prevalence, severity and incidence were the main criteria. The relative

importance of STB was based on its prevalence at each location where incidence and severity

were assessed and averaged at each surveyed field. In this study, prevalence indicates how wide

spread is STB, whereas incidence conveys information on the risk of the disease within a

severity range. In the survey protocol of the CIMMYT septoria phenotyping platform five

classes (Class I-V) were adopted. Class I: Low prevalence (%), severity (0-9), and low

incidence indicating insignificant risk; Class II: low prevalence and incidence indicating low

risk. Class III: moderate prevalence and incidence indicating moderate risk to be monitored.

Class IV: fields where STB was wide spread and apparent high severity observed at flag leaf,

indicating high risk of the disease. Class V: includes fields heavily infested by STB; situation

where the disease is obvious at each field surveyed and where the severity is at its most, i.e.

severe symptom on flag leaf and spikes, this is a situation where STB is a high risk. Relevant

agronomic data such as, variety name, sowing date, fertilization, crop density and spatial pattern

and previous crops were recorded. Altitude, longitude and latitude were also recorded using

Global Positioning System (GPS).

Table 3. Survey designated Classes for Septoria tritici blotch (STB) prevalence, severity and incidence.

Class Prevalence1 (%) Severity2

(Cobb-Scale: 0-9)

Incidence3

H Severity

I 0-10 0-3 0-2 Insignificant

II 10-20 3-5 2-3 Low

III 20-40 5-6 3-5 Moderate

IV 40-60 6-8 5-7 High

V 60-100 8-9 7-9 Severe

1(Number of infected fields (STB present)/total number of fields surveyed) × 100. 2H: Level of infection plant level. 3Percentage of STB within each class level at surveyed field.

mailto:[email protected]



26

2.5. Data analysis

Linear mixed model was used to analyze the disease data (incidence and severity)

collected during the survey using ASReml-R software (Gilmour et al., 2002). The years,

regions, species, varieties together with their interactions were assumed to be fixed.

3. Results

3.1. Incidence of wheat Septoria tritici blotch

Survey results showed that STB incidence on bread wheat was very limited across

surveyed areas in Northern Tunisia Triticum species and wheat varieties identified during the

survey during the two cropping seasons are presented in Table 4. STB prevalence during the

two cropping seasons (2015-2016 and 2016-2017) was insignificant to low on commercial

bread wheat varieties in the majority of the surveyed regions (Tables 5 and 6). It was ranked as

class I or II except at El Haouaria (region A, Figure 1) where prevalence and incidence were

relatively high (Tables 5 and 6; Figures 2 and 4) putting it as class IV-V level (Table 3).

Insignificant prevalence levels were recorded at Zaghouan, Bizerte, and Béjà (Tables 5 and 6).

Even though relatively high incidence was recorded at Bizerte, the severity was still low;

hence it is of low to moderate risk (class II-III). The high incidence observed at Béjà was only

at 1 out of 2 fields surveyed, hence it is not quite representative and we considered it low. The

mean disease incidence and severity on bread wheat landrace reached the maximum levels in

2016 with 84% and 52% respectively at El Haouaria (Figures 2 and 3). Same trend was

observed in 2017, where over 77% and 32% disease incidence and severity respectively were

recorded in the same region (Figures 4 and 5).

Low STB incidence on bread wheat were recorded in 2016 on bread wheat fields at

Bizerte 23% and Béjà 29%, and in 2017 at Bizerte 17% and Zaghouan 5% (Figures 2 and 4).

The severity percentages in these regions did not exceed 5% during the two cropping seasons

(Figures 3 and 5). These data showed that STB level was at class I and II ratings except at El

Haouaria, where it was rated class IV and V.

Chapitre 2. Occurrence of Septoria tritici blotch (Zymoseptoria tritici) disease on durum wheat, triticale, and bread wheat in Northern Tunisia

27

Table 4. Triticum species and wheat varieties identified during the survey during the two cropping seasons.

Species Varieties Surveyed regions

Bread wheat Zanzibar Bizerte

Utique Bizerte, Béjà, Zaghouan

Haïdra Bizerte, Béjà, Zaghouan

Vaga Bizerte, Jendouba

Salammbô Cap Bon North (El Haouaria), Jendouba

Bread wheat landrace Cap Bon North (El Haouaria)

Durum wheat Karim Bizerte, Béjà, Jendouba, Manouba, Cap Bon North, Cap Bon South, Kef

Maali Bizerte, Béjà, Cap Bon North, Cap Bon South, Jendouba, Manouba, Kef

Razzak Bizerte, Béjà, Cap Bon North, Cap Bon South, Jendouba, Zaghouan, Kef

Monastir Cap Bon North

Carioca Bizerte, Jendouba, Zaghouan

Saragolla Bizerte

Soudaine Bizerte

Sculpture Bizerte, Béjà, Jendouba

Triticale TL4 Bizerte, Cap Bon North,

Bienvenue Bizerte, Manouba

Chapitre 2. Occurrence of Septoria tritici blotch (Zymoseptoria tritici) disease on durum wheat, triticale, and bread wheat in Northern Tunisia

28

Table 5. Prevalence of Septoria tritici blotch in inspected areas during 2015-2016.

*Cap Bon South: Soliman, Beni Khalled and Grombalia; **Prevalence: Number of infected field/ fields assessed number; DW: Durum wheat; BW: bread wheat, Trit: triticale.


Region/District Number of surveyed fields Number of infected fields Prevalence (%)**

DW BW Trit DW BW Trit DW BW Trit

Bizerte 15 4 3 14 3 1 93.33 75.00 33.33

Cap Bon South * 5 0 0 2 0 0 40.00 0.00 0.00

Cap Bon North (El Haouaria) 2 7 1 0 7 0 0.00 100.00 0.00

Manouba 2 0 0 1 0 0 50.00 0.00 0.00

Béjà 5 1 0 5 0 0 100.00 0.00 0.00

Jendouba 3 1 0 3 0 0 100.00 0.00 0.00

Zaghouan 7 4 1 6 1 0 85.71 25.00 0.00

Le Kef 8 0 0 8 0 0 100.00 0.00 0.00

Total/mean 47 17 5 39 11 1 85.10 66.66 20.00

*Cap bon South: Soliman, Beni Khalled and Grombalia; **Prevalence: Number of infected field/total number of surveyed fields; DW: Durum wheat; BW: bread wheat, Trit:

triticale.

Region/District Number of surveyed fields Number of infected fields Prevalence (%)**

DW BW Trit DW BW Trit DW BW Trit

Bizerte 6 7 3 6 2 1 100.00 33.33 33.33

Cap Bon South* 8 1 0 8 0 0 100.00 0.00 0.00

Cap bon North (El Haouaria) 3 9 2 2 9 2 66.66 100.00 100.00

Manouba 5 0 1 4 0 1 80.00 0.00 100.00

Béjà 4 2 0 4 1 0 100.00 50.00 0.00

Jendouba 3 2 1 3 0 1 100.00 0.00 100.00

Total/mean 29 21 7 27 12 5 93.10 57.14 71.42



29

Unlike the situation on bread wheat, STB was widely distributed on durum wheat and

was highly prevalent at Bizerte, Béjà, Jendouba, and Le Kef where it ranked from class III to

V (Table 3). The overall prevalence of the disease was about 50%, 85.71%, 93.3% at Manouba,

Zaghouan, and Bizerte, respectively, in 2017 (Table 6). More than 65% and 47% of the disease

incidence and severity respectively were recorded in the majority of prospected areas (Béjà,

Bizerte, Jendouba and Le Kef) compared to 35.77% and 10% in Cap Bon regions during the

surveyed period in 2016 (Figures 2 and 3). STB was also found on durum wheat varieties in

Southern of Cap Bon area such as Grombalia, Soliman and Beni Khalled (region B, Figure 1)

with a prevalence of 100% and 40% during 2016 and 2017 respectively (Tables 5 and 6). In

2017, STB was not observed on durum wheat at El Haouaria.

STB on triticale was observed at only four regions to include Jendouba, Bizerte, Cap bon

and Manouba. It was more prevalent (100%) in Jendouba, Cap Bon North and Manouba in 2016

followed by Bizerte 33% during the two survey years (Tables 5 and 6). Greater mean incidence

of STB was recorded on triticale at Jendouba (43%, Figure 2) and more than 20% was noted at

Bizerte and Cap Bon North (Figure 2). The overall mean severity varied from 13% to 42 % in

2016 cropping season (Figure 3). However, STB was very low on triticale at Bizerte region

with 3% and 5% disease incidence and severity respectively during 2017 (Figures 4 and 5).

Figure 2. Incidence of Septoria tritici blotch during 2016 in surveyed areas on three cereal crops (bread wheat,

durum wheat and triticale).

0

10

20

30

40

50

60

70

80

90

Beja Bizerte Cap Bon N Cap Bon S Jendouba Manouba

Inci

de

nce

%

Regions

BW

DW

TRIT



30


durum wheat and triticale).

Figure 4. Incidence of Septoria tritici blotch during 2017 in surveyed areas on three cereal crops species (bread

wheat, durum wheat and triticale).

0

10

20

30

40

50

60

70

Beja Bizerte Cap Bon N Cap Bon S Jendouba Manouba

Seve

rity

%

Regions

BW

DW

TRIT

0

10

20

30

40

50

60

70

80

90

Bizerte Cap Bon N Cap Bon S Jendouba Manouba Kef Zaghouan

Inci

de

nce

%

Regions

BW

DW

TRIT



31


durum wheat and triticale)

3.2.Incidence of Septoria tritici blotch on commercial wheat varieties

Even though the variety distribution between years and surveyed areas varied, the

general trends show that most durum wheat varieties were highly susceptible to STB at different

levels (Figures 6 and 7). The disease incidence reached 100% on the commercial durum wheat

varieties ‘Saragolla’, followed by ‘Soudaine’ (90%), ‘Carioca’ (80%) and ‘Sculpture’ (60%).

High incidence was also recorded on the lead commercial durum wheat ‘Razzak’ (75%),

‘Maali’ (60%), and ‘Karim’ (45%) (Figure 6). The lower incidence of the local cultivars was

showed by the low STB levels at Cap Bon region, particularly that of ‘Karim’ that could have

been affected by late planting. Despite the high STB disease pressure on durum wheat across

the surveyed areas, it was nearly absent at El Haouaria (Cap Bon North) where mainly bread

wheat was cultivated. In 2016 high STB incidence (90%) and severity (70%) were observed

mainly on the bread wheat landrace ‘Farina arbi’ at El Haouaria (Figure 6). Mean incidence and

severity of 30 and 25%, respectively, were recorded on the bread wheat ‘Salammbô’. Lower

rates (<10%) were recorded on other commercial bread wheat varieties such as ‘Zanzibar’,

‘Utique’ and ‘Haïdra’, which were below 10%.When tested at experimental station in Northern

Tunisia, ‘Farina arbi’ and the other bread wheat varieties showed no infection of STB despite

high levels of infection on most if not all commercial durum wheat varieties. In addition, low

levels of susceptibility to STB were recorded on triticale varieties where incidence and severity

ranged from 0% to 30%. Out of three triticale varieties, the disease was totally absent on

‘Bienvenue’ (Figures 6 and 7).

0

10

20

30

40

50

60

70

80

Beja Bizerte Cap Bon N Cap Bon S Jendouba Manouba Kef Zaghouan

Seve

rity

%

Regions

BW

DW

TRIT



32

Figure 6. Incidence of STB on durum wheat, bread wheat and triticale varieties.

Figure 7. Severity of STB on durum wheat, bread wheat and triticale varieties.



34

Gerbreslassie, 2015; Tekele et al., 2015; ÜNAL et al., 2017) showed that the impact and

distribution of diseases varied due to the continuous release and extensive cultivation of

susceptible varieties. Thus, the magnitude of virulence and disease incidence are variable and

closely related to the frequency of the variety used in a particular area as well as the proportion

of durum wheat area as compared to that of bread wheat (Yahyaoui et al., 2000).

Testing ‘Farina arbi’ land race for its resistance/susceptibility to Z. tritici at other

Northern regions where durum wheat is mostly cultivated showed no STB infection. This

unique bread wheat landrace, completely susceptible at El Haouaria (North Eastern Tunisia)

and completely resistant at Béjà Northwestern Tunisia, could be that we are definitely dealing

with two distinct Z. tritici populations and could give more highlight on STB specificity. Further

studies will be conducted to characterize the STB populations from El Haouaria that are mostly

specific to the bread wheat landrace ‘Farina arbi’ and have no effect on other bread and durum

wheat varieties. Such phenomenon has not been observed before and could lead to further

understanding of STB host specificity.

5. Conclusion

The survey data revealed low risk of Z. tritici on bread wheat except at Cap Bon region

especially at El Haouaria where Septoria tritici blotch severity was relatively high on the old

bread wheat landrace, while rare occurrence at other sites was observed on some commercial

bread wheat varieties. High incidence and severity were observed on triticale across the

surveyed fields. Although Tunisia is primarily a durum-wheat producing country with Z. tritici

being mostly prevalent on durum wheat; bread wheat is of great economic importance, even

though it occupies small areas. The occurrence of STB on the landrace could lead to

development of Septoria population that could become of major importance on bread wheat as

is the case in Morocco and other regions. The presence of an STB population at one site and

infecting a single cultivar will be further investigated and will possibly lead to better

understanding of Z. tritici population dynamics that could become an important tool in

screening for disease resistance.

Chapitre 3. Genetic differentiation between ‘Zymoseptoria tritici’

populations sampled from bread wheat in Tunisia revealed by

SSR markers

Bel Hadj Chedli Rim1,2, Aouini Lamia3, Ben M’Barek Sarrah4,2, Bochra Amina Bahri5,6,

Verstappen Els7, Kema Gerrit H.J.7, Rezgui Salah1, Yahyaoui Amor8,2, Chaabane Hanène6

1Laboratory of genetics and plant breeding, National Agronomic Institute of Tunisia (INAT), 43 Avenue Charles

Nicolle, 1002 Tunis, Tunisia. 2 CRP Wheat Septoria Precision Phenotyping Platform, Tunisia. 3 Department of Agronomy, Purdue University, 915 West State Street, West Lafayette, IN 47907 USA. 4 Regional Field Crops Research Center of Beja (CRRGC) BP 350, 9000 Beja, Tunisia. 5 Department of Plant Pathology, College of Agricultural and Environmental Sciences, University of Georgia, 228

Turfgrass Research and EducationCenter, 1109 Experiment Street, Griffin, GA 30223 USA. 6Laboratory of Bioagressors and Integrated protection in agriculture, National Agronomic Institute of Tunisia

(INAT), 43 Avenue Charles Nicolle, 1002 Tunis, Tunisia. 7 WageningenUniversity and Research Center, Wageningen, The Netherlands. 8 Centro Internacional de Mejoramiento de Maíz y Trigo (CIMMYT), km 45 Carretera México-Veracruz El Batán,

Texcoco.

https://maps.google.com/?q=+226%20Turfgrass%20Research%20and%20Educaton%20Building+1109%20Experiment%20Street+Griffin+GA+30223

Chapitre 3. Genetic differentiation between ‘Zymoseptoria tritici’ populations sampled from bread wheat in

Tunisia revealed by SSR markers

35


Plusieurs marqueurs moléculaires ont été utilisés pour analyser la diversité génétique des

populations de Z. tritici issues de nombreux pays à travers le monde. Toutefois, l’observation

récente d’une grande incidence de Z. tritici sur blé tendre dans la région du Cap Bon comme

nous l’avons souligné dans le chapitre 2, montre l’importance et l’urgence d’entamer une

caractérisation moléculaire de la diversité génétique des populations de ce pathogène dans cette

région.

C’est dans ce cadre que s’insère l’objectif principal de ce chapitre qui permet d’étudier la

diversité et la structure génétique d’une population de 184 isolats de Z. tritici isolés à partir des

feuilles de blé tendre infestées naturellement dans trois régions céréalières du Nord de la Tunisie

(Cap Bon, Béjà et Bizerte) moyennant 12 marqueurs microsatellites.

De plus, une approche bio-informatique a été appliquée pour déterminer la diversité

génétique (H) (Nei, 1973), l’indice de Shannon (I), le polymorphisme (P), le flux de gène (Nm),

la différentiation génétique entre les populations (Fst) et la structure génétique des populations

de Z. tritici à deux échelles : champ et région. Les proportions de la distribution de deux types

sexules Mat1-1 et Mat1-2 dans tous les champs ont été aussi calculées dans cette étude.



36

Abstract

Septoria tritici blotch (STB) is the primary biotic stress for durum wheat production in

Tunisia and has not been common on bread wheat. During the 2015-2016 growing season,

strong STB disease severity was observed in the littoral Tunisian area on an old bread wheat

landrace known as “Farina Arbi” particularly at ‘El Haouaria’ region. A total of 184 single-

pycnidial fungal isolates were sampled from nine naturally infected bread wheat fields in three

main wheat growing area in Tunisia (Cap Bon area, Bizerte and Béjà). The collected isolates

were fingerprinted using 12 polymorphic microsatellite (SSR) markers in order to assess the

genetic diversity and population structure of Zymoseptoria tritici (Z. tritici) at regional and field

scale levels. A high genetic diversity was observed within the collected Z. tritici population,

with the highest Nei’s index value (0.42), Shannon Index (0.84), and important private alleles

number (36) at El Haouaria region. However, moderate population differentiation (Fst=0.16)

and a high gene flow (Nm =1.85) were observed between the nine sampled fields across the

surveyed regions. A lack of genetic structure was observed at both regional and field levels.

The high degree of diversity was likely due to an active sexual recombination in the investigated

areas, as revealed by equal proportions of the two mating types that was also assessed during

this study.

Key words: Bread wheat, genetic diversity, population structure, Zymoseptoria tritici.

1. Introduction

The cereal sector is one of the pillars of the Tunisian agriculture in terms of its output and

cultivated area with nearly a total of 1.5 million of hectares (Ben Hamouda et al., 2016). It is

characterized by a predominance of durum wheat (Triticum turgidum L. subsp. durum (Desf.)

van Slageren) that has been cultivated in Tunisia since the Roman era while the bread wheat

(Triticum aestivum L. subsp. aestivum) was introduced relatively recently after the French

colonization (El Felah et al., 2015). Since then, bread wheat was commonly cultivated in

mixture with durum wheat landraces (Ben Hammouda et al., 2016). Tunisian farmers and rural

communities used the Arabic word “Gameh” to designate durum wheat against the non-Arabic

word “Farina” to indicate bread wheat (Ammar et al.,2011). The gain in wheat production has

often been hampered by low yields caused by drastic losses due to abiotic and biotic constraints.

Septoria tritici blotch (STB) caused by the hemibiotrophic fungus Zymoseptoria tritici (Z.

tritici) (Desm.) Quaedvlieg and Crous (formerly Mycosphaerella graminicola [Fuckel] J.

Schröt. in Cohn), is an important disease in North Africa and particularly in Tunisia where an



37

early widespread epidemic occurred between 1968-1969 (Saari and Wilcoxcon, 1974; Brown

et al., 2015). Epidemics have become recurrent since the 1990’s. In Tunisia, STB mainly

infects durum wheat (Triticum turgidum L. ssp. durum (Desf.), genome BBAA), particularly in

the North Western region to include the main durum wheat producing districts of Bizerte, Béjà

and Jendouba (Fakhfakh et al., 2011). Nevertheless, Z. tritici also infects the hexaploid wheat

(Triticum aestivum, L., genome, AABBDD) exclusively in the North Eastern region (Bel Hadj

Chedli et al. 2018).

Z. tritici has a heterothallic bipolar mating system with two mating type alleles, mat1-1

and mat1-2 (Waalwijk et al. 2002) and undergoes sexual and asexual sporulation. Sexual

reproduction requires contact between the two separate mating types (Kema et al., 1996),

resulting in fruiting bodies (pseudothecia) that contain ascospores (Eyal et al., 1987). These

latter are released from wheat debris, dispersed by wind and hence constitute the primary

inoculum (Ponomarkenko et al., 2011; Suffert et al., 2011). An evident and frequent sexual

reproduction has been observed in most Z. tritici populations worldwide as even frequencies of

both mating types idiomorphs were observed (Waalwijk et al. 2002; Siah et al. 2010). On the

other hand, through asexual reproduction, pycnidiospores that are formed in the pycnidia, are

locally dispersed by rain splash and are considered as secondary source of inoculum,

contributing thus to the disease progression during the cropping season (Steinberg, 2015).

Since sexual reproduction of this fungus may occur year-round, it plays a crucial role in

its epidemiology and has a major impact on its population structure (Zhan et al., 2003;

McDonald, 2015). It maintains the diversity of the pathogen populations that are more likely to

adapt to selection pressures such as those exerted by resistant hosts or fungicides treatments

compared to populations with less genetic variability (McDonald et al., 1997; Zhan and

McDonald; 2004).

Genetic structure is the study of genetic variation within and among populations and

reflects thus its evolutionary history and its potential to evolve (Banke and McDonald, 2005).

Many factors contribute to genetic change (i.e., evolution) within populations. These factors

include mutation, mating systems/recombination, gene flow or migration, population size, and

selection (McDonald et al., 1997). In nature, all of these forces interact to determine the course

of evolution of a pathogen and to generate the genetic structure of its populations. According

to McDonald and Linde (2002), pathogens that generate the greatest risk of breaking down

resistance genes have a mixed reproduction system, a high potential for gene flow, large

effective population sizes, and high mutation rates compared to pathogens with strict asexual

reproduction that have low potential for gene flow, small effective population sizes, and low



38

mutation rates. Therefore, information on the distribution of genetic variation is important and

could be used to deploy more efficient control strategies against Z. tritici (McDonald and Mundt

2016).

In many countries, population genetic studies using RFLP, AFLP and SSR markers,

showed that Z. tritici-populations are characterized by high genetic diversities and low genetic

differentiation between populations (Schnieder et al., 2001; Linde et al., 2002; Zhan et al.,

2003; Banke and McDonald, 2005). Significant rates of population structure were also reported

in many studies, and important genetic differentiation was noted within and among different Z.

tritici populations sampled at different levels and from many geographical locations: Czech

republic, Iran, California, Indiana, Kansas, North Dakota, France (Linde et al. 2002; Abrinbana

et al. 2010; El Chartouni et al., 2011; Gurung et al., 2011; Drabesova et al., 2013).

In Tunisia, the genetic structure of Z. tritici has been extensively studied mainly using

SSR markers which revealed a strong genetic diversity (Berraies et al., 2013; Boukef, 2012,

Nouari et al., 2016). Although, these studies were concentrated only on populations sampled

from durum wheat. Studying the genetic diversity of the Tunisian bread wheat Z. tritici

population may lead to a better understanding of the epidemiological and evolutionary driving

forces in Z. tritici in Tunisia, particularly at El Haouaria region where STB was recently

intensified on bread wheat ‘Farina Arbi’. In this study, we present the first description of a

Tunisian population of Z. tritici collected from bread wheat which was sampled from three

provinces throughout Northern Tunisia (Béjà, Bizerte and Cap Bon Area).

This study aims to evaluate the molecular polymorphism and the genetic diversity of Z.

tritici at regional and field scales with a focus on the Cap-Bon area region where previously,

high STB severity was reported on an old bread wheat landrace and to estimate the gene flow

among the studied locations and finally to investigate the population structure.


2.1. Fungal sampling and isolation

Leaf samples were collected from nine bread wheat fields located at three regions in

Northern Tunisia: Cap Bon area (El Haouaria), Bizerte (Ichkeul) and Béjà (Goubellat and Oued

Zarga) where STB infections were reported during 2015-2016 cropping season (Bel Hadj

Chedli et al., 2018) (Figure1). Out of the nine assessed fields, four fields were located at El

Haouaria region where the bread wheat landrace ‘Farina Arbi’ was grown as a monoculture

over several years and two fields where cropped with the variety ‘Salammbô’. Three sampled



33

4. Discussion

The response of durum wheat, bread wheat, and triticale to Z. tritici varied according to

the crop species. During the surveyed period, Z. tritici was more prevalent on durum wheat at

the majority of surveyed areas except Cap Bon North (El Haouaria) and confirms the high to

moderate risk of STB at Northern and Cap Bon regions of Tunisia, respectively.

This result supports conclusions of previous reports and confirms that Septoria diseases

hot spots are prevalent in the sub humid and semi-arid areas at the beginning of winter season

(Fakhfakh et al., 2011). The new commercial durum wheat ‘Sculpture’, ‘Saragolla’, ‘Carioca’

and ‘Soudaine’ were susceptible to Septoria as they were mainly grown at Septoria hot spots

where monoculture of durum wheat particularly the susceptible ‘Karim’ and relatively high

rainfall contributed to the development of high infection levels. In particular, high incidence

and severity were recorded on ‘Karim’ and ‘Razzak’, which confirmed previous findings

conducted by Ltifi and Sakkouhi (2008), and Ben Mohamed et al. (2000). In contrast, ‘Maali’,

which was previously characterized by a good level of resistance in Béjà (Gharbi et al., 2011),

was susceptible to STB in the majority of surveyed areas in this study, which could be explained

by a slow decline of host resistance (Kema et al., 2018). The survey data also revealed that

triticale was also susceptible to STB across the majority of surveyed areas posing therefore a

serious threat to this crop.

On the other hand, the data revealed that STB was very low in the majority of inspected

regions on the commercial bread wheat cultivars such as ‘Haïdra’, ‘Vaga’, ‘Utique’, and

‘Zanzibar’, which could explained by the relative resistance of these varieties to Septoria (Ben

Hamouda et al., 2016) while it was higher in ‘Salammbô’ (Saade, 1996). ‘Salammbô’ was

released in 1980, period that has known a substantial expansion in bread wheat acreage

particularly for varieties with high yield and good level of diseases resistance. It seems that this

variety has undergone a slow decline of host resistance over time that is commonly observed in

this pathosystem, particularly for bread wheat in Europe (Kema et al., 2018).

Surprisingly from this study, STB on bread wheat poses a great risk only at one region,

El Haouaria, where it was rated class IV and V and mainly only on the old bread wheat landrace

‘Farina arbi’. The important incidence of Septoria observed on this variety reveals a specific

presence of Z. tritici population that only develops on this old bread wheat landrace with little

or no apparent effect on other bread wheat varieties. This could be mainly associated with the

wheat-based mono-cropping system and monoculture of this landrace over several decades

facilitating thereby the adaptation of the pathogen to this specific variety (Holloway, 2014;

McDonald and Mundt, 2016). Similar research reviews on wheat diseases surveys (Teferi and



39

fields located at Béjà and Bizerte were cropped with the cultivars ‘Utique’ and ‘Zanzibar’,

respectively. Sampling details and GPS coordinates were shown in Table 1.

Hierarchical sampling was carried out according to McDonald et al. (1999) where

infected leaves were obtained from six to nine locations approximately 10 m apart within

individual fields. From each location, five leaves were randomly collected from different plants

and only one isolate was selected from each leaf for genotyping. Isolates from each region are

considered as separate populations and isolates sampled from each field are referred as sub-

populations. Mono-pycnidial isolates were obtained as described by Siah et al. (2010) resulting

in a total of 184 Z. tritici isolates (Table 1) that were subsequently grown on PDA medium

(potato dextrose agar, 39 g L−1) and stored at (-80°C) for further analyses.

2.2. DNA extraction and mating type’s determination

Fungal DNA was extracted using the Sbeadex® mini plant kit (LGC genomics) extraction

performed on a King Fisher KF96 system according to the manufacturer's instructions. Mating

type of each isolate was identified using a multiplex Polymerase Chain Reaction (PCR)

amplification of partial two mating type loci as described by Waalwijk et al. (2002) (Table 2).

PCR for mating type amplifications were performed using a mixture of 2.5µL (6µM) of each

primer, 5µL (600 µM) of dNTPs, 5 µLof 10X reaction buffer, 0.25µL(5U/ul) of Taq polymerase

(Ampli Taq Gold, Roche, Someville MA) and 1 µL (10 ng to 20 ng/µL) of genomic DNA. The

total PCR reaction volume was adjusted with nuclease free water to 50 µL per PCR reaction.

DNA samples were amplified using an MJ Research PT-100 Thermocycle (Biorad, Hercules,

CA) adjusted at thermal cycling conditions that started with an initial denaturation at 94°C for

2 min, followed by 39 cycles at 94°C for 1 min for denaturation, and at 68°C for 30 min for

annealing, and a final extension at 72°C for 1 min. DNA samples were subsequently incubated

at 72°C for 10 min for a final elongation and stored at 4°C for further processing. Amplification

products were stained with GelRed, separated in 1% agarose gel and electrophoresis at 100 V

for 45 min and visualized under UV light.

Chapitre 3. Genetic differentiation between ‘Zymoseptoria tritici’ populations sampled from bread wheat in Tunisia revealed by SSR markers

40

Table 1. Origin, number and geographical coordinates of Zymoseptoria tritici isolates used in this study

Regions Year Location Host Cultivar Field

number

Isolates

number

Altitude

range

Longitude (N) (range) Latitude (E)

(range)

Bizerte 2015 Ichkeul Bread wheat Zanzibar 1 8 16-354 09°03’1 09°69’83 32°50’56 37°14’12

Béjà 2015 Goubellat Bread wheat Utique 1 3 11-876 09°09’01 10°78’62 36°47’47 36°92’68

Oued Zarga Bread wheat Unknown 1 13

Cap Bon 2015 El Haouaria Bread wheat Salammbô 2 18 18-290 10°02’73 10°49’10 36°22’26 36°68’31

El Haouaria Bread wheat Farina Arbi 4 120

Total 9 162

Figure 1. Schematic map of the sampling locations in Northern Tunisia. A: El Haouaria region, B: Bizerte

(Ichkeul), C: Goubellat; D: Oued Zarga.



41

Table 2. Mating type’s specific primers and microsatellites markers used in this study.

Primer sequence (3’-5’) Primer sequence (5’-3’) Length Fluorescent dye

Mat1-1 TGGACACCATGGTGAGAGAACC

T

CCGCTTTCTGGCTTCTTCGCACTG 660 -

Mat1-2 GATGCGGTTCTGGACTGGAG GGCGCCTCCGAAGCAACT 340 -

ST4 TGAACATCAACCTCACACGC AGAAGAGGACGACCCACGAG 182-206 Vic

ST3A ACTTGGGGAGGTGTTGTGAG ACGAATTGTTCATTCCAGCG 226-258 Pet

ST9 CACCTCACTCCTCAATTCCG GAAAGGTTGGTGTCGTGTCC 336-348 Fam

ST6 TCAATTGCCAATAATTCGGG AGACGAGGCAGTTGGTTGAG 161-179 Pet

ST7 CACCACACCGTCGTTCAAG CGTAAGTTGGTGGAGATGGG 171-227 Ned

ST3C TCCTATCAACTCCCGAGACG CCGCACGTAGGAATTTTCAG 229-253 Fam

ST2 ACACCAAAGAAGGATCCACG GCCGGAGGTCTATCAGTTTG 338-365 Ned

ST1 AATCGACCCCTTCCTTCAAC GGGGGAGAGGCATAGTCTTG 192-222 Fam

ST5 GATACCAAGGTGGCCAAGG CACGTTGGGAGTGTCGAAG 232-256 Ned

ST10 TCCGTCATCAACAACACCAG TGGCCGTAGAACTGCTGAG 139-160 Fam

ST12 GAATCCACCTCTTCCTTGCC AGGAGGATATCAAGGCCCAG 226-232 Vic

ST3B AAGAATCCCACCACCCAAAC CACACGGCTCCTTTGACAC 263-299 Vic

2.3. Microsatellites analysis

Twelve pairs of primers corresponding to simple sequence repeat (SSR) loci described

by Gautier et al. (2014), representative of the core genome of Z. tritici were used to genotype

the 162 Z. tritici isolates. In addition, three isolates were used as reference in this study: the

Dutch isolates IPO323 and IPO94269 and the Algerian durum wheat isolate IPO95052. SSR

primers were selected based on length polymorphism criteria (Gautier et al., 2014; Siah et al.,

2018), and were amplified using the Type-it Microsatellite kit (Qiagen) in accordance with the

manufacturer recommendations (table 2).

Each 25μLPCR reaction contained 12.5μL of the Type-it mix, 2.5μLofprimer mix

(containing 2μM of each primer), 2.5 μL deionized water,2.5μL Q-solution and 5μL template

DNA (10ng/μL). PCR reactions were performed with preheating at 95°C for 5 min, followed

by 35 cycles of 95°C for 30 s, 55°C for 90 s and 72°C for 30 s, with a final extension step of

60°C for 30 min, using a PT100 Biorad thermocyler. The PCR products were subsequently ran

on 3130xl instrument (Life Technologies) using the “Liz500 size standard.



42

2.4. Data analysis

Molecular data analyses were carried out using the GenALEx software version 6.5

(Peakall and Smouse, 2012). The Genetic diversity was assessed by investigating the number

of private alleles (alleles found only in a single location), the Nei’s genetic diversity (H) (Nei

1973) and the Shannon’s information Index (I). The relationship between the Nei’s genetic

diversity (GD) and the geographic distance (GGD) was investigated using Mantel test

implemented in GenALEx 6.5 in order to examine the level of genetic isolation by geographical

distances. Gene flow (Nm) within and among population and the percentage of polymorphic

loci present at frequencies>1% were also determined.

The magnitude of the genetic differentiation according to each locus was assessed using

the Nei’s Fst fixation index (Nei, 1973) implemented in GenALEX 6.5 in order to assess the

degree of genetic differentiation between populations and to identify the correlation between

alleles within populations relative to the entire population. Genetic variation within and among

populations was further partitioned by analysis of molecular variance (AMOVA). The

relationship between individuals was calculated using principal coordinate analysis (PCoA) to

detect genetic divergence among subpopulations (Sun et al. 2013).

Population structure was inferred using the Structure 2.3.4 program (Pritchard et al. 2000)

which uses Bayesian algorithm to estimate the number of populations. The burn-in period was

followed by a run phase of 100000 iterations, with the number of clusters K ranging from 1 to

10, and 10 replicates for each value of K. A dendrogram estimating genetic clustering of the

studied Z. tritici population was subsequently produced using the weighted neighbor-joining

method based on the dissimilarity matrix (500 bootstraps), as implemented in the DARwin6

software (Perrier and Jacquemoud-Collet, 2006).

For mating type’s determination, among 162 Z. tritici isolates, only 141 were further

assessed for mating type analysis. the null hypothesis of a 1:1 ratio of two mating types within

each collection at different scales among and within regions, was evaluated using a χ2-test at

the significance level of P=0.05 (Waalwijk et al. 2002).

3. Results

3.1. Genetic diversity within and among sampled populations

In this study, 162 Z. tritici isolates collected from nine bread-wheat fields were analyzed

using 12 microsatellites markers in order to assess the genetic diversity and structure of a Z.



43

tritici population collected from different region and field scales in Northern Tunisia. Isolates

that did not amplify for more than 6 loci (50%) were removed from the data set and only a total

of 162 isolates were then conserved. A multilocus analysis identified 128 distinct genotypes

(MLG) among 162 Z. tritici isolates (Table 3). The most important MLG number (116) were

identified at El Haouaria region and a total of 4 multilocus were shared between El Haouaria

fields while only one multilocus was shared between Goubellat, Oued Zarga and Bizerte

populations (Table 3).

Results revealed that El Haouaria population possessed the highest number of private

alleles (36), whereas Bizerte isolates presented only one private allele with a frequency of

0.33% (Annexe 1, Table 2,). No private alleles were observed within Oued Zarga population

(Table 3).

Of the 12 loci scored, 100% were polymorphic at El Haouaria population and 75% were

polymorphic at Bizerte and Goubellat populations while 0% polymorphism was observed on

Oued Zarga population (Béjà region) (Table 3). Allele diversity analyses revealed high levels

of genetic diversity among the studied populations. Within the region scale, the most important

Nei's gene diversity (0.4) and Shannon's index (0.8) were recorded at El Haouaria region

whereas there were similar at Goubellat and Bizerte regions with (0.5) and (0.3) respectively

(Table 3).

At the field scale, the Nei’s gene diversity and Shannon's indexes were approximately

similar at El Haouaria region and averaged of 0.7 and 0.4 values respectively with very slight

variations among the sub-collections (field populations).



44

Table 3. Genetic diversity based on twelve microsatellite markers related to Zymoseptoria tritici populations/sub-

populations collected from three regions: Cap Bon Area (El Haouaria), Bizerte (Ichkeul) and Béjà (Goubellat and

Oued Zarga) in Northern Tunisia during 2015-2016.

A: Field population; B: Region population

N: Isolate Number; I: Shannon's Information Index; Ne: No. of Effective Alleles; H: genetic diversity; P%: polymorphism; Fst: Wright’s

F index indicating genetic differentiation between populations; Nm: gene flow; Pa: private allele

3.2. Genetic differentiation between populations

In this study, the differentiation within and between subpopulations derived from the 162

Z. tritici isolates was investigated by calculating the Fst pairwise that showed a moderate

differentiation (0.16 and 0.23) between field and regional populations respectively (Table 3).

These results are consistent with AMOVA analysis which revealed a small but significant level

of genetic differentiation within region and field populations (9 and 27 % at P< 0.002 and P <

0.0023 respectively, Table 4) and a high significant level among all studied populations (91 %,

73%, Table 4).

Populations N Ne

(SE)

I

(SE)

H

(SE)

%P Pa MLG Fst

(SE)

Nm

(SE)

A

El

Haouraria

Field 1 29 2(0,308) 0,75(0,12) 0,40(0,06) 91.67 2 26

Field 2 33 2,12(0,39) 0,79(0,14) 0,40(0,68) 100 4 30

Field 3 31 2,13(0,34) 0,79(0,13) 0,42(0,06) 100 5 29

Field 4 27 1,97(0,272) 0,71(0,14) 0,38(0,07) 91.67 2 20

Field 5 8 2,04(0,23) 0,77(0,10) 0,44(0,05) 100 1 6

Field 6 1 1,72(0,21) 0,59(0,09) 0,35(0,05) 100 - 5

Oued

Zargua

Field 7 13 1(0) 0(0,00) 0(0,00) 0 - 3

Bizerte Field 8 8 1,73(0,16) 0,56(0,10) 0,35(0,06) 75 1 6

Goubellat Field 9 3 1,8(0,19) 0,55(0.10) 0,37(0,06) 75 - 3

Total 162 1,83

(0,089)

0,616

(0,04)

0,35

(0,02)

81 15 128 0.16

(0.03)

1.85

(0.36)

B

Bizerte 8 1,73(0,16) 0,56(0,10) 0,35(0,06) 75 1 6

Goubellat 3 1,8(0,19) 0,55(0,10) 0,37(0,06) 75 - 3

El Haouaria 138 2,16(0,35) 0,84(0,13) 0,42(0,06) 100 36 116

Oued Zarga 13 1(0) 0(0) 0(0) 0 - 3

Total 162 1,67

(0,12)

0,49

(0,06)

0,28

(0,03)

62.50 37 128 0.23

(0.03)

1.50

(0.56)



45

Table 4. Analysis of molecular variance (AMOVA) of the bread wheat- Zymoseptoria tritici population

Significant level: 0.001 ‘***’ 0.01‘**’ 0.05‘*’ A: Field population; B : Region population df: degree of freedom; SS: sum of square; MS: mean of square; P: probability

3.3. Relationship between geographic populations and genetic structure

Overall, a significant relationship (P = 0.01) was observed between the geographic

distance (GDD) and the Nei’s genetic distance (GD) (data not shown). This observation was

confirmed by the high levels of the gene flow (Nm) which reached 1.85 and 1.50 within field

and regional populations respectively.

Data analyses using Stucture software, showed a lack of a genetic structure based on the

magnitude of ΔK for the Tunisian Z. tritici populations within and among the studied locations

(Figure 2). Results from the principal coordinates analysis (PCoA) detected a lack of genetic

divergence among the studied populations. Isolates from each population were grouped

together and some isolates of various populations had most divergent positions and did not

constitute distinct groups (Figure 3).

Furthermore, the hierarchical classification based on UPGMA method (Unweighted pair

group method with arithmetic mean) clearly classify Z. tritici population in two groups and

isolates from different regions and fields were grouped together. However, the reference

isolates used in this study: Dutch isolates IPO323 and IPO94269 and the Algerian durum wheat

isolate IPO95052 were associated with the Tunisian isolates with a close genetic similarity

(Figure 4).

Source df SS MS Est. Var. % variation P

A Among population 8 375359.715 46919.964 1745.200 9% 0.002**

Within population 153 2601168.427 17001.101 17001.101 91%

Total 161 2976528.142 18746.301 100%

B Among population 3 323465.256 107821.752 6358.247 27% 0.002**

Within population 158 2653062.89 16791.537 16791.537 73%

Total 161.000 2976528.142 23149.785 100%



46

Figure2. Population structure of the 162 ‘Zymoseptoria tritici’ isolates sampled from four locations using

Structure software version 2.3.4 with K=4.

Figure. 3. Principal coordinates analysis (PCoA). Individuals from the same region are marked using the

same symbol. The first and second principal coordinates account for 15.22 % and 43.95 % of the variation,

respectively.



47

3.4. Occurrence of sexual reproduction

The results of this study indicate that the two mating types coexisted in fungal populations

sampled from all geographical scales including Cap Bon and Bizerte but also in different fields

within the same region (Table 5).

While the absolute ratio of the two mating types varied among sampling units (fields, and

locations), none of the differences differed significantly from the null hypothesis that the same

frequency of mating types existed among all sampling units (Table 5) except at Béjà region,

where MAT1-2 was exclusively predominant across 13 Z. tritici isolates and a significant

deviation (P<0.05) from the expected 1:1 ratio was noted.

Fig 4. Dendrogram showing the genetic clustering of the 162 Zymospetoria. Tritici isolates sampled from bread

wheat across three geographic locations in Northern Tunisia. The tree was constructed using the weighted neighbor-

joining method implemented in DARwin 6 software. Isolates from the same field were indicated with the same

color. Fields 1,2,3,4,5 and 6 are located at Ca Bon Area, fields 7 and 8 are located at Beja while field 9 belongs to

Bizerte region.



48

Table 5. Distribution of Z. tritici mating types across different regions.

Region Field/Location Variety Isolates

number

MAT 1-1

(%)

MAT1- 2

(%)

χ2

Cap Bon

El Haouaria Farina Arbi 29 48.27 51.72 0.03



El Haouaria Farina Arbi 20 40 60 0.80

El Haouaria Salammbô 10 20 80 3.60

El Haouaria Salammbô 10 20 80 3.60

Total 123 40.65 59.34 4.30

Béjà Oued Zarga Utique 10 0 100 10

Goubellat Unknown 3 0 100 3

Total 13 0 100 13

Bizerte Ichkeul Zanzibar 5 40 60 0.2

Total 141 93.12 70.5 9.7

4. Discussion

Here, we present the first investigation on the patterns of genetic variation in population

of Z. tritici sampled from bread wheat across three wheat-growing provinces of Tunisia. The

sampling was carried out at Béjà and Bizerte regions that are considered as hot spot for STB on

durum wheat and at Cap Bon area where septoria was observed annually on the local bread

wheat designated by farmers as “Farina Arbi” (Bel Haj Chedli et al., 2018). Our results revealed

high levels of genetic diversity of the Tunisian bread wheat-Z. tritici population at regional

scales. This finding is in agreement with previous studies which reported high level of genetic

diversity of Z. tritici population sampled from natural field across major wheat producing areas

in Tunisia (Nouari et al., 2016; Boukef et al., 2012) and worldwide (Kabbage et al., 2008; El

Chartouni et al., 2011; Gurung et al., 2011; Drabešová et al., 2013; Welch et al., 2017; Siah et

al., 2018).

Interestingly, in the regional collection, the most important Shannon’s Index, genetic

diversity and private alleles number were observed at El Haouaria fields. The level of the

genetic variation in the natural bread wheat populations revealed in this study was supported

by the high rate of sexual recombination. In fact, frequencies of the two mating types occurred

equally at the Cap Bon region which confirms the active undergoing sexual reproduction

leading to create new genotypes and increase their gene diversity through migration, with high

potential of gene flow (Linde et al., 2002; Siah et al., 2010; McDonald et al., 2016). Sexual

reproduction in Z. tritici has been an effective pathway to increase its fitness to cope with the



49

constant changing environment and to overcome host resistance (Kema et al., 2018; McDonald

and Linde, 2002) and this may have resulted in the pathogen diversification in this region (Zhan

et al., 2003; Siah et al., 2013; Siah et al., 2018).

On the other hand, the predominance of Mat1-2 at Oued Zarga could not be attributed to

the lack or to the low rate of sexual recombination which was considered as the only

evolutionary process that affect gametic equilibrium (Zhan et McDonald, 2004; Abrinbana et

al., 2010) but probably to the biased and an insufficient sampling.

A high polymorphism (91 % and 100%) was recorded at six sampled fields at El Haouaria

region where annual incidence of the disease occurred on the old landrace ‘Farina Arbi’

exclusively cultivated in this area. In this context, McDonald and Mundt (2016) and Dalvant et

al. (2018) reported that fungal populations having higher degrees of polymorphism naturally

possess a greater number of genes to exchange which could consequently influence diversity in

pathogenicity.

In contrast, the fungal populations sampled from Bizerte and Goubellat appeared to

possess lower genetic diversity compared to El Haouaria collection. Oued Zarga Z. tritici

population seems to be not polymorphic and lower levels of genetic diversity was recorded at

this region. Moreover, monitoring of STB during recent years in Tunisia demonstrated that this

pathogen is more adapted to durum wheat in these regions where it was mostly cultivated

(Fakhfakh et al., 2011). In Tunisia, STB was found at a very lower severity in few bread wheat

fields in regions such as Bizerte, Goubellat and Oued Zarga (Bel Hadj Chedli et al., 2018).

Consequently, our sampled populations for these regions (Bizerte, Goubellat and Oued Zarga)

may be considered as small which led to biased results because of the limited sample sizes (El

Chatrouni et al., 2012). Hence, the lower genetic diversity of Z. tritici in these regions suggests

that sexual reproduction might be less active than in other regions.

AMOVA analysis revealed that 73% of genetic variation could be attributed to

differences within regional populations and 27% to differences among individuals within

population. Similar results were observed with Razavi and Hughes (2004) findings which

indicated that 88% and 12% of the genetic diversity in 90 isolates were related to intra-

population and inter-population diversity respectively. In contrast, Abrinbana et al. (2010)

reported that the most important genetic variation was attributed among Z. tritici populations

sampled from different wheat provinces in Iran.

Nonetheless, moderate differentiation between regional subpopulations was noted by Fst

index which could be reflected by the high values of gene flow (Nm).The important (Nm) index

as revealed in the present study which suggests the occurrence of a strong gene flow between



50

the studied locations would further explain the higher intrapopulation diversity compared to

interpopulation diversity (Dalvant et al., 2018). Even so, Siah et al. (2018) reported a none

significant genetic differentiation at the field, plant and leaf layer scales in the French Z. tritici

population whereas a significant genetic differentiation was observed among Z. tritici

populations and higher degree of homogenization over many countries: Syria, Iran, Algeria,

United Kingdom, Switzerland, Germany, France, Argentina, Australia, Iran, and Czech

Republic (Zhan et al., 2003; Jurgens et al., 2006; El Chartouni et al., 2011; Gurung et al., 2011;

Drabešová et al., 2013). Therefore, many researchers reported that genetic differentiation

depends on the geographical locations studied and the markers used (Linde et al., 2002;

Abrinbana et al., 2010).

However, in this finding, the sampling sites were located in regions where different wheat

genotypes were cultivated. The geographic barriers and the differences in the used bread wheat

varieties may lead to conductive conditions for an important gene flow between Z. tritici

populations across the studied regions (Abrinbana et al., 2010; Zhan and McDonald, 2004).

Data analyses using Mantel test confirms this conclusion and revealed a significant correlation

between the genetic and the geographic distance indicating a great relationship isolation-

distance within the global population.

In this study, no population structure was observed at regional and field scales. This

finding is in agreement with the previous study of Boukef et al. (2012), revealing a lack of a

genetic structure of the Tunisian durum wheat derived Z. tritici populations according to nuclear

microsatellite markers genotyping. The lack of structure has also been reported in the

mitochondrial DNA, with high levels of gene flow and an active sexual reproduction among

durum wheat Tunisian Z. tritici population (Naouari et al., 2016). Even so, several earlier

studies that reported a lack of population structure for Z. tritici at regional and global scales,

attributed the lack of a geographic structure to the spore dispersal that probably occurs over a

wide geographic area and thus to long distance gene flow (McDonald et al. 1999; Linde et

al.2002; Zhan et al.2003). Another possible explanation could be related to the sampled area,

the population size or to the type of marker used (SSR) that cannot accurately capture the small

genomic variation that would occur at a single nucleotide level (Vali et al., 2008; Siah et al.,

2018). However, using the high Single nucleotide polymorphisms (SNP), Gibriel (2019)

investigated a large-scale structural variation in accessory and core chromosomes in the Middle

East-bread and durum wheat Z. tritici population. In this context, Drabešová et al. (2012)

reported that different genetic markers are known to produce different levels of genetic structure

for the same samples.



51

The Principal coordinates analysis (PCoA) confirmed the lack of genetic variation among

the studied populations where the majority of Z. tritici isolates of each population were grouped

together. However, few exceptions were observed with some isolates of various populations

which were divergent and constituted distinct groups. Bayesian and unweighted neighbor-

joining results are consistent with the lack of the genetic structure where no differentiated

clusters in the bread-wheat Z. tritici populations sampled from different geographical locations

were observed. Furthermore, the dendrogram showed that isolates from different regions and

fields tended to cluster together with the Dutch bread wheat isolates (IPO323, IPO94269) and

with the Algerian durum wheat isolate IPO95052 and were associated with a close genetic

similarity. This observation suggests that sources of inoculum originating from genetically

diverse Z. tritici local population spores conserved a limited familial structure (Berraies et al.,

2013).

In this study, the same genotypes were shared among different regional populations

studied which could be explained by a great migration between different populations or perhaps

by the presence of some individuals that had the same multilocus genotype by chance (Gurung

et al., 2011). However, additional sampling from many bread and durum wheat growing area

in Tunisia is needed to confirm this result and to determine the causes. To our knowledge, this

work is the first study assessing fungal genetic diversity on Z. tritici population sampled from

bread wheat in Tunisia at regional and field scales. This research could provide new information

to further explore the epidemiology and management strategies of Septoria tritici blotch disease

in Northern Tunisia.

5. Conclusion

This study revealed high genetic variation and a clear evidence for recombination within

and among geographic populations of Z. tritici on bread-wheat fields in Tunisia consistent with

sexual reproduction of this organism in nature. Moderate differentiation between populations

leading to an important gene flow and a lack of structuration were further demonstrated. To

further examine the genetic diversity of Z. tritici in Tunisia, larger population size with large

number of isolates and greater number of microsatellite markers should be considered to study

the genetic structure of Z. tritici on both bread and durum wheat. These investigations could be

carried out not only at the field level but also on populations coming from different years and

at different time periods during the cropping season.

Chapter 4. Screening for resistance of Tunisian, Moroccan and

Algerian wheat varieties to Zymoseptoria tritici in Northern

Tunisia

Rim Bel Hadj Chedli1,4, Sarrah Ben M’Barek2,4, Amir Suissi1, Amor Yahyaoui3,4, Salah Rezgui1 and

Hanène Chaabane5

1Laboratory of genetics and plant breeding, National Agronomic Institute of Tunisia (INAT), 43 Avenue Charles Nicolle, 1002

Tunis, University of Carthage, Tunisia. 2Regional Field Crops Research Center of Beja (CRRGC) BP 350, 9000 Beja, Tunisia. 3 Centro Internacional de Mejoramiento de Maíz y Trigo (CIMMYT), km 45 Carretera México-Veracruz El Batán, Texcoco. 4 CRP Wheat Septoria Precision Phenotyping Platform, Tunisia 5Laboratory of Bioagressors and Integrated protection in agriculture, National Agronomic Institute of Tunisia (INAT), 43

Avenue Charles Nicolle, 1002 Tunis, University of Carthage,Tunisia.

Hanène Chaabane : ORCID : 0000-0002-0958-3818

Chapitre 4. Screening for resistance of Tunisian, Moroccaon and Algerian wheat varieties to Zymoseptoria

tritici in Northern Tunisia

52


Le choix d’une variété résistante permet d’abaisser la pression parasitaire et donc la

nuisibilité. Les variétés commerciales Tunisiennes de blé tendre ont montré une certaine

résistance à la septoriose. Au contraire, au Maroc une situation inverse existait et une résistance

des variétés de blé dur contre une sensibilité du blé tendre a été observée. En Algérie, toutes

les variétés de blé tendre et de blé dur ont montré une sensibilité à cette maladie. Face à cette

situation, il est raisonnable d'examiner les conditions associées à l'expansion rapide de Z. tritici

et aux variations de la sévérité d'attaque d’un génotype a un autre en Afrique du Nord.

Cependant, la recherche des sources de résistance a été faite sur 89 variétés de blé tendre

et de blé dur d’origine Algérienne, Marocaine et Tunisienne et une série différentielle constituée

de 49 ISEPTONS durant les deux campagnes agricoles 2016-2017 et 2017-2018 dans le cadre

d’essais multi-locaux. Les essais ont été menés sous l’infection naturelle dans la région du Cap

bon (El Haouaria et Menzel Temim) là où une grande incidence de septoriose a été observée

sur le blé tendre et dans la station expérimentale Oued Béjà qui est connue comme un hot spot

pour le blé dur.

D’une part, l’évolution de la maladie a été effectuée en évaluant la sévérité (pourcentage

de surface foliaire attaquée) et la hauteur de l’attaque selon l’échelle de Saari et Prescott (00-

99) décrite par Eyal et al. (1987), et aussi en mesurant la couverture pycnidiale (PC) et la surface

nécrosée (N). D’autre part, la progression de la maladie au cours du cycle a été estimée par la

mesure de l’AUDPC (area under disease progress curve) et le rAUDPC (relative area under

disease progress curve). En plus, l’identification de differentes classes de variétés (allant de la

classe immune jusqu’à hautement sensible) a eu lieu en utilisant la méthode statistique “K-

means” classification.



53

Abstract

In this study, we investigated the performance of 89 wheat varieties from Morocco, Algeria and

Tunisia, screened in Tunisia for their relative resistance to STB. Field experiments were carried

out in an Augmented design, during 2016-17 and 2017-18 cropping seasons at two locations in

Northern Tunisia: Béjà (Oued Béjà station) and Cap Bon regions (Menzel Temim and El

Haouaria). All trials were conducted under natural infection. Visual disease assessments were

quantified using the percentage of leaf area covered by pycnidia (PC), necrotic area (N), area

under disease progress curve of each variety (AUDPC) and the relative area under disease

progress curve (rAUDPC). Results indicated that the majority of Tunisian, Algerian and

Moroccan durum wheat populations were susceptible to STB at both locations ranging from

susceptible to highly susceptible, with the rAUDPC, N and PC ranging from 0.5 to 0.8, 30 to

65 % and 40 to 75% respectively. On the other hand, the Moroccan bread wheat varieties were

susceptible in Cap Bon area, while the Tunisian bread wheat varieties were resistant; with levels

varying from immune to resistant classes, where rAUDPC value was 0.2, and PC and N not

exceeding 0.2 and 10% respectively, with the exception of local bread wheat known as “Farina

Arbi”.

Key words: wheat varieties, Zymoseptoria tritici, resistance, susceptibility

1. Introduction

North Africa has been the cradle of wheat production for centuries and was the bread

basket for the Romain Empire (Bachta, 2011). Nowadays, the Maghreb zone of North Africa is

still the major durum wheat producer which is the basis for their traditionnal dishes such as

couscous and pasta (Rastoin and Benabdrazik, 2014). Tunisia is among the countries with high

cereal consumption and the average per capita consumption reached 259 kg (Rastoin and Ben

Abderrazik, 2014; Hanson et al., 2016). Durum wheat (Triticum turgidum L. subsp. durum

(Desf.)) is commonly cultivated in Tunisia probably since the Roman era, while cultivation of

bread wheat (Triticum aestivum L. subsp. aestivum) was introduced by French colonists in the

early 1900s (El Falleh et al., 2015). Hence, the cultivation of bread wheat in Tunisia started

with the selection of the cultivar Florence-Aurore that covered up to 80% of the Tunisian bread

wheat acreage until 1952 then dropped to about 50% by 1959 (Ammar et al., 2011; Ben

Hamouda, 2016).



54

After the introduction of the semi-dwarf high yielding bread wheats varities selected from

CIMMYT nurseries known as « Mexican wheat », the bread wheat varieties such as Baroota

52, Sonora 63, Inia 66, Tobari 66, Ariana 66 and Mahon 73, selected from introduced

populations were released and covered large areas due to their high-yield performances (Saade,

1996). These varieties were soon replaced by many wheats varieties such as ‘Soltane 72’, but

also rapidly abandoned due to their succeptibility to many diseases namely yellow rust and

septoria. During the late 1980’s and early 1990’s, ‘Salammbô 80’ was the most grown bread

wheat variety and covered 70% of the bread wheat acreage followed by ‘Byrsa 87’. These two

varieties became the most popular because of their high-yield potentiel and resistance to rust

and septoria (Saade 1996). More recent release such as Utique (1996), Haidra (2004), and

Tahent (2009) had good performances and acceptable diseases resistance mainly to powdery

mildew, yellow rust, leaf rust, and septoria (Ammar et al.,2011).

Across the Magreb countries, the most prevalent foliar disease is Septoria tritici blotch

(STB) caused by the ascomycete fungus Zymoseptoria tritici (Roberge ex Desm.): Quaedvl.

and Crous anamorph and Mycosphaerella graminicola (Fuckel) J. Schröt. 1894 teleomorph.

This disease can reach epidemic levels on early planted cereals particularly when rainfall occurs

in late winter and/or spring which is common in the Mediterranean-type environments

(Chartrain et al., 2005).

In Tunisia, STB causes major yield losses on durum wheat (Ben Mohamed et al. 2000)

where most commercial durum wheat varities are highly susceptible to this pathogen while

bread wheat has been resistant to STB (Gharbi and Deghaies 1997; Gharbi et al., 2000). Under

favorable growing conditions STB disease could reduce yield by 40% (Gharbi et al., 2011;

Berraies et al., 2014). The prevailing strains seem to have developed a unique virulence towards

durum wheat (Yahyaoui et al., 2000). The opposite situation exists in Morocco, where bread

wheat is the major crop affected by STB (Mazzouz et al., 1995; Zahri et al., 2014). It has been

previously reported that isolates of Z. tritici exhibit both cultivar specificity (ability to infect

only some cultivars of either durum or bread-wheat) and host species specificity (ability to only

infect one or the other wheat (Kema et al.,1996; Kema and Van Silfhout, 1997). This contrast

between Morocco and Tunisia may explain further that specificity of Z. tritici isolates exists in

wheat (Yahyaoui et al., 2000). However, in Algeria, the STB becomes the major threat to both

durum and bread wheat on coastal and sub-littoral regions of the country (Benbelkacem et al.,

2011; Ayad et al., 2014).

https://en.wikipedia.org/wiki/Joseph_Schr%C3%B6ter

https://onlinelibrary.wiley.com/doi/full/10.1111/mpp.12251#mpp12251-bib-0037



55

Recent research provided better insight on the epidemiology of Z. tritici in the Maghreb

countries. Siah et al. (2015) reported a high level of genetic diversity within the Moroccan Z.

tritici population. The occurrence of the teleomorph stage of Z. tritici has been confirmed in

Algeria and Tunisia (Meamiche-Neddaf et al., 2017; Ben Hassine and Hamada, 2014) where

the two mating types were found at equal frequencies (Boukef et al., 2012; Ayad et al., 2014).

Thus, knowledge of the host-pathogen relationship and understanding the basis of host-

specificity and resistance in the Mediterranean area are essential for successful genetic control

of STB both on durum and bread wheat in the Maghreb region.

The objectives of this study were: (i) to evaluate bread and durum wheat varieties from

Tunisia, Algeria and Morocco for STB resistance under natural infection in Tunisia, (ii) to

evaluate the phenotypic differences in resistance of wheat varieties to STB using the area under

disease progress curve (AUDPC), the relative AUDPC (rAUDPC), pycnidial coverage (PC),

necrosis (N) in order to compare STB development between wheat species and finally (iii) to

investigate the relationships between quantitative traits.


2.1. Description of the study areas and experimental design

Field experiments were conducted during 2016-2017 and 2017-2018 wheat-growing

seasons, in two regions under different sub-humid zones where STB epidemics regularly occur

(Figure 1). The first experiment was carried out at the CRP Wheat Septoria Precision

Phenotyping Platform-experimental station of the CRRGC at Oued-Béjà (36°44’05’’N,

9°13’’35’’E, governorate of Béjà, northwest of Tunisia) located in the sub-humid bioclimatic

zone where the average annual rainfall ranges from 500 to 850 mm and a daily mean

temperature varies between 10 and 28°C. This area is particularly known to be a hot spot for

STB especially on durum wheat. The second experimental was carried out at a farmer field

located at Cap Bon Area (36°47’47’’N, 11°0’8’’E, governorate of Nabeul, northwest of

Tunisia) with precipitation and temperature rates varying from 400 to 600 mm and from 6 to

33 °C, respectively. This region has been recently identified as a hot spot for STB especially on

bread wheat (Bel Hadj Chedli et al., 2018).



56

The experiments were set up in an augmented design. During 2016-17, the trials were

sown on November 17 and 18 at Béjà and Cap Bon respectively while during the 2017-18, these

fields were sown on November 6 and 11 at Cap Bon and Béjà respectively. Each variety was

sown in paired rows of 2m with 4g of seeds per row. Standard experimental station plot was

applied (herbicide, hand weeding and fertilizer application) to ensure adequate crop

development.

2.2. Plant materials

A set of 89 wheat varieties including bread wheat from CIMMYT’s International Septoria

Observation Nursery (ISEPTON) (Annexes 2); bread and durum wheat varieties from Tunisia,

Morocco and Algeria (Table 1), were screened for their relative resistance to STB. Two

susceptible checks were used in this study: the bread wheat landrace identified as susceptible

in Cap Bon region during a survey conducted in 2015-16 cropping season (Bel Hadj Chedli et

al., 2018) and the most susceptible durum wheat ‘Karim’.

Beja governorate

36°44’05’’N, 9°13’35’’E

Nabeul governorate (Cap Bon)

36°47’47’’N, 11°0’8’’E

Figure1. Map of Tunisia showing the location of study area (Beja and Cap Bon area) during 2017-2018

cropping season. The STB experiments were set in an augmented design at both locations.

Chapitre 4. Screening for resistance of Tunisian, Moroccaon and Algerian wheat varieties to Zymoseptoria tritici in Northern Tunisia

57

Table1. Wheat varieties screened for resistance to Septoria tritici blotch disease during 2016-2017 and 2017-2018 cropping seasons.

BW/DW Variety name Number Country Provenance Origin/Year

BW Néapolis 1 Tunisia CRRGCB CRRGC & INRAT

BW Mahon 73 1 Tunisia CRRGCB Algeria, 1910

BW Inia 66 1 Tunisia CRRGCB INRAT/CIMMYT, 1970.

BW Castan 1 Tunisia CRRGCB France, 1976

BW Dougga 74 1 Tunisia CRRGCB CIMMYT, 1974.

BW Florence Aurore 1 Tunisia CRRGCB France, 1974.

BW Carthage 74 1 Tunisia CRRGCB Mexico, 1974.

BW Ariana66 1 Tunisia CRRGCB France, 1970

BW Tahent 1 Tunisia CRRGCB INRAT/CIMMYT, 2010

BW Haïdra 1 Tunisia CRRGCB INRAT, enregistrée en 2004.

BW Utique 96 1 Tunisia CRRGCB INRAT/CIMMYT, 1996.

BW Salammbô 80 1 Tunisia CRRGCB INRAT/CIMMYT, 1980

BW Vaga 92 1 Tunisia CRRGCB INRAT/CIMMYT, 1992

BW Byrsa 87 1 Tunisia CRRGCB INRAT/ CIMMYT,1987

DW Maali 1 Tunisia INGC Tunisia, 2007

DW Nasr 1 Tunisia INGC INRAT/ICARDA, 2004

DW Inrat 100 1 Tunisia INGC INRAT,2017

DW Dhahbi 1 Tunisia INGC INRAT,2017

DW Razzak 1 Tunisia INGC INRAT, 1987

DW Salim 1 Tunisia INGC INRAT,2009

DW Karim 1 Morocco Morocco INRA Morocco, 1985

DW Marzak 1 Morocco Morocco INRA Morocco, 1984

DW Sebou 1 Morocco Morocco INRA Morocco, 1987


58

DW: durum wheat, BW: bread wheat, DZ : Durum wheat Algerian; CCB:crossing block ; INGC : Field Crops Research Institute; CRRGCB : Regional Field Crops

Research Center of Béjà.

DW Omrabia 1 Morocco Morocco INRA Morocco, 1988

BW Amal 1 Morocco Morocco INRA Morocco, 1993

BW Arrehane 1 Morocco Morocco INRA Morocco, 1996

BW Aguilal 1 Morocco Morocco INRA Morocco, 1996

BW Marchouch 1 Morocco Morocco INRA Morocco 1984

DW Tomouch 1 Morocco Morocco INRA Morocco, 1997

DW Algeria1 1 Algeria Algeria DZ/CCB

DW Algeria 2 1 Algeria Algeria DZ/CCB








BW ISEPTONS 49 CIMMYT CIMMYT CIMMYT

Checks

Karim 1 Tunisia INGC INRAT/CIMMYT, 1980

Farina Arbi 1 Tunisia Farmers Landrace/El Haouaria farmers

Total : 89



59

2.3. Evaluation of disease severity and area under disease progress curve

Visual disease assessment based on the leaf area covered with pycnidia (PC) and the

necrotic area (N) were estimated as a percentage of the uppermost-infected leaves either on

Flag leaf or Flag leaf-1 at the end of the growth stage, i.e GS70. In addition, the symptoms and

lesion development over the assessment period were summarized by the area under disease

progress curve (AUDPC) that allows the identification of different classes of resistance. Disease

severity was scored for each plot using the double-digit scale (Saari and Prescott, 1975). The

first digit (D1) indicates disease progress on the infected plants, and the second digit (D2) refers

to severity of infection. Three consecutive evaluations were made at 10 days interval, at GS51,

GS59 and GS65 respectively according to Zadok’s scales (Zadoks et al., 1974). The AUDPC

and the relative area under disease progress curve (rAUDPC) were subsequently calculated

according to Simko and Piepho (2012) formula:

𝐴𝑈𝐷𝑃𝐶 = ∑𝑦𝑖 + 𝑦𝑖+1

2

𝑛−1

𝑖=1

× (𝑡𝑖+1 − 𝑡𝑖)

Where:

Yi: STB severity at time ti,

t(i+1)-ti = time interval (days) between two disease scores,

n = number of times when STB was recorded.

𝑟𝐴𝑈𝐷𝑃𝐶 =𝐴𝑈𝐷𝑃𝐶 (𝑔é𝑛𝑜𝑡𝑦𝑝𝑒)

𝐴𝑈𝐷𝑃𝐶 (𝐾𝑎𝑟𝑖𝑚)

Where: Karim is the most susceptible variety used as a check.

2.4. Statistical analysis

All the observations in the experimental field and dependent variables were subjected to

analysis of variance (ANOVA) using ‘aov’ function from R package ‘daewr’ (Lawson 2016)

implemented in R software v3.4.2 (R Core Team 2017) and least-Squares Means using R

package ‘lsmeans’ (V. Lenth 2016). Distances between wheat varieties using hierarchical

clustering method and correlations coefficients between characters were calculated for all traits

analyzed in the study. A weighted clustering algorithm K-mean (K =6) (Duda and Hart, 1973)

was performed using JMP®11.0 in order to group the different varieties in classes.

Subsequently, Principal component analysis (PCA) was performed using the JMP®11.0



60

statistical software (SAS Institute Inc., Cary, NC, USA) with component analysis procedure

(SAS Institute, 2014).

3. Results

3.1. Meteorological conditions during the crop cycle

Meteorological data (temperature and rainfall) over different climatic regions and during

the two cropping seasons were recorded. The annual average rainfall varied from 500 to 800

mm and the temperature ranged between 6 and 33°C in Cap Bon and Béjà regions. The variation

of temperature and rainfall from November to May during the two cropping seasons of 2017

and 2018 is shown in (Annexe 3).

Although epidemics of STB are associated with favorable weather conditions (frequent

rains and moderate temperature) that are encountered in these two regions, the different

responses of wheat varieties across regions were rather associated to the specialization of the

pathogen to the one or the other wheat species.

3.2. Genotype by region interaction

Results of this study revealed a good STB development at the two locations. Therefore, a

significant effect (P<0.0001 and P<0.01, Table 2) of variety and region for pycnidial coverage

(PC), necrotic area (N) and area under the disease progress curves (AUDPC) was observed.

The variety-by-region interaction term in the ANOVA analysis was significant at P0.05, for N,

PC and the rAUDPC indicating different responses of wheat varieties to Z. tritici across regions.

Therefore, any significant effect was observed with year as source of variation and also with

the interaction variety-region-year.


61

Table 2. ANOVA analysis for Pycnidial coverage (PC), Necrotic area (N) and the relative area under disease progress curve (rAUDPC) for 89 wheat varieties at Béjà and

Cap Bon regions.

Significant codes : 0 ‘***’ 0.001 ‘**’ 0.01 ‘*’ 0.05 1Pr(>F): the significant probability associated with the F statistic.

PC N rAUDPC

Source of variation Sum sq Mean

sq

F value Pr(>F)1 Sum sq Mean

sq

F value Pr(>F) Sum sq Mean

sq

F value Pr(>F)

Variety 179556 2040.4 7.337 1.06e-07*** 8323 94.58 6.963 1.91 e-07 *** 18.454 0.209 6.425 2.82 e-07***

Region 2923 2922.8 10.510 0.013** 165 165.37 12.176 0.0016 ** 0.256 0.255 8.203 0.008***

Year 56 55.9 0.201 0.29909 5 4.59 0.338 0.565 0.064 0.06 2.065 0.162

Variety: Region 50571 574.7 2.066 0.0173* 2651 30.13 2.218 0.010* 5.776 0.065 2.105 0.0153*

Variety: Year 2923 112.7 0.405 0.99917 654 7.43 0.547 0.981 1.053 0.011 0.384 0.999

Region : Year 312 311.7 1.121 0.29909 14 14.26 1.050 0.314 0.045 0.044 1.440 0.240

Variety:region:year 7515 91.6 0.330 0.999 524 5.95 0.438 0.997 0.857 0.031 0.335 0.999



62

3.3. Varieties response to STB

The data of this study revealed that the highest mean PC and N were observed on the

Tunisian durum wheat (68 and 74% respectively, Figure 2) at the experimental station of Béjà

where STB occurs annually. At Cap Bon area, the Tunisian durum wheat varieties were

moderately infected with STB where PC and N ranged from 19to 22% respectively (Figure 3).

A great level of susceptibility was observed also on the Algerian durum wheat varieties at both

Cap Bon and Béjà station where PC ranged from 30 to 74% (Figures 2 and 3).

Surprisingly, under natural condition of Cap Bon area, the Moroccan durum wheat

varieties known as resistant in Morocco showed a moderate level of susceptibility to STB where

PC and N reached 22 and 34% respectively (Figure 2). The same trend was observed for

Moroccan durum wheat at Béjà where PC and N ranged between 35 and 45%. High STB

infection level (63% for PC), was also observed on Moroccan bread wheat in this region

whereas STB was nearly absent on Moroccan bread wheat at Béjà (Figure 3). The same

situation was observed on Tunisian bread wheat varieties and ISEPTON with insignificant PC

and N levels where they did not exceed 10% (Figure 2) at Cap Bon. In this region the susceptible

check bread wheat landrace “Farina Arbi” showed high level of susceptibility (70 and 65% for

PC and N respectively, Figure 2). Despite the high STB disease pressure on bread wheat

landrace “Farina Arbi” observed in previous survey at Cap Bon region, this landrace seems to

be immune at Béjà station (Figure 3).

Figure 2. Variation of PC and N across varieties in Beja station during the two cropping seasons. TDM: Tunisian

durum wheat; TBW: Tunisian bread wheat; ADM: Algerian durum wheat; MBW: Moroccan durum wheat; MDW:

Moroccan durum wheat.



63

3.4.Varieties classification

K-means classification proved the presence of significant differences between all tested

varieties related to the percentage of diseases infection observed in wheat areas included in the

study. Six different classes were then identified.

At Béjà site, an immune reaction (class I: rAUDPC = 0) was recorded for all ISEPTONS

and all Tunisian and Moroccan bread wheat varieties (Table 3). Two Moroccan wheat varieties

(Sebou and Marchouch) were ranked as resistant (class II; Table 3, Figure 4) where rAUDPC

did not exceed 0.1. Two Moroccan durum wheat (Marzak, Toumouh) and four Algerian durum

wheat (Algeria2, Algeria 3, Algeria 4, Algeria 7) were ranked as class III and IV (moderately

resistant to moderately susceptible). At Béjà site, varieties with rAUDPC higher than 0.6 such

as Algerian durum: Algeria 5, Algeria 6, Algeria 8, and Algeria 9, Tunisian durum wheat:

Salim, Maali, Karim, Dhahbi, INRAT100, and Nasr ranked as class VI and VII, susceptible and

highly susceptible (Table 3, Figure 4).

Figure 3. Variation of PC and N for all varieties in Cap Bon region during the two cropping seasons. TDM: Tunisian

durum wheat; TBW: Tunisian bread wheat; ADM: Algerian durum wheat; MBW: Moroccan durum wheat; MDW:

Moroccan durum wheat.


64

Table 3. Means and ranges of AUDPC and rAUDPC for all identified clusters at Béjà region

Max: Maximum; Min: Minimum

Clusters AUDPC rAUDPC Durum wheat varieties Bread wheat varieties

I

Highly

Resistant

Max 0.0 0.1 Algeria 1 From ISEPTON 1 to ISEPTON 49, Mahon73, Amal, Arrehane, Aguilal, , Néapolis, Farin

Arbi, Salammbô, Tahent, Utique, Vaga, , Ariana66, Byrsa, Carthage, Castan, Dougga,

Florence Aurore, Haidra. Inia66.

Min 0.0 0.0

Mean 0.0 0.0

II

Resistant

Max 367.5 0.2 Sebou Marchouch

Min 220.0 0.1

Mean 293.8 0.15

III

Moderately

resistant)

Max 937.5 0.4 Marzak, Algeria 7, Algeria2, Algeria

3

-

Min 772.5 0.4

Mean 857.5 0.4

IV

Moderately

susceptible

Max 1121.3 0.5 Toumouch,

Algeria 4

-

Min 1086.3 0.5

Mean 1014.6 0.5

V

Susceptible

Max 1528.8 0.7 Algeria 5, Algeria 6, Algeria8, Nasr,

Salim,Maali, Moroccan varieties

(Karim and Om rabia)

-

Mini 1356.3 0.6

Mean 1440.8 0.65

VI

Highly

susceptible

Max 1775.9 0.8 Algeria 9, Dhahbi, INRAT100, karim -

Min 1576.3 0.7

Mean 1636.2 0.75

Chapitre 4. Screening for resistance of Tunisian, Moroccaon and Algerian wheat cultivars to Zymoseptoria


65

On the other hand, at Cap Bon area, the highly resistant and resistant class (I and II)

where rAUDPC did not exceed 0.2 included the Tunisian durum (Karim and Salim), the

Algerian durum wheat ‘Algeria 1’, a set of Tunisian bread wheat and ISEPTONS (Table 4;

Figure 5). The moderately resistant group (III) where rAUDPC varied from 0.2 to 0.3 included

the following varieties: Algeria 2, Algeria 3, Algeria 4, Moroccan durum (Sebou and Tomouch)

and the Tunisian cv. ‘Nasr’ (Table 4; Figure 5).

The rest of Algerian durum wheat: Algeria 5, Algeria 6, Algeria 7, Algeria 8, Algeria 9,

the Tunisian cvs.: Dhahbi, Maali, INRAT100, the Moroccan varieties (Marzak, Amal, Karim

and Om rabia) and three ISEPTONS were ranked as moderately susceptible and susceptible

class IV and V (Table 4; Figure 5) where rAUDPC did not exceed 0.7. The varieties with

rAUDPC over than 0.8 included the Moroccan bread wheat: Aguilal, Marchouch and Arrehane

and the Tunisian old variety (Farina Arbi) were ranked as highly susceptible class VI (Table 4;

Figure 5).

Figure 4. PCA showing the major correlated variability of varieties as shown by axes 1 and 2. The first Dimension1

accounted for 99.6% of the total variability expressed by quantitative traits while the second component (Dimension2)

accounts only 0.3% of the total variation. ACP revealed 6 clusters at Beja region: Cluster 1: Very resistant; Cluster

2: resistant; Cluster3: moderately resistant; Cluster4: moderately susceptible; Cluster5: susceptible; Cluster 6: very

susceptible. Details about varieties of each group are shown in table 3.

Chapitre 4. Screening for resistance of Tunisian, Moroccaon and Algerian wheat cultivars to Zymoseptoria tritici in Northern Tunisia

66

Table 4. Means and ranges of AUDPC and rAUDPC for all identified clusters at El Cap Bon region

Max: Maximum; Min: Minimum

Clusters AUDPC rAUDPC Durum wheat varietiess Bread wheat varieties

I

Highly

resistant

Max 500.0 0.2 Algeria 1 Ariana66, Byrsa, Carthage, Castan, Dougga, Inia66, Utique, Vaga,

From ISEPTON 10, to ISEPTON 31

ISEPTON 34, 35, 36, 39, 40, 42, 43, 44, 48, 8, 9, 3, 4.

Min 0.0 0.0

Mean 5.2 0.0

II

Resistant

Max 425.8 0.2 Salim, Karim, Florence Aurore, Haidra, Néapolis, Tahent, Mahon 73, ISEPTONS 2, 24, 32, 33, 37,38, 41, 45,

46, 47, 5, 7. Min 22.5 0.0

Mean 232.9 0.1

III

Moderately

resistant

Max 686.3 0.3 Algeria 2, Algeria 3, Algeria 4,

Sebou, Tomouch, Nasr.

Min 449.0 0.2

Mean 591.3 0.3

IV

Moderately

susceptible

Max 1281.3 0.6 Algeria 5, Dhahbi, Maali,

INRAT100

ISEPTON 1, 49, 6,

Min 753.8 0.4

Mean 1138.6 0.5

V

Susceptible

Max 1491.3 0.7 Marzak, Algeria 7, Algeria 6,

Algeria 8, Algeria9, Moroccan

varieties (Karim and Om rabia)

Salambo, Amal

Min 1110.0 0.5

Mean 1325.7 0.6

VI

Highly

susceptible

Max 1907.5 0.9 - Arrehane, Aguilal, Marchouch, Old variety

Min 1671.3 0.8

Mean 1785.7 0.8



67

3.5. Significant correlation between quantitative traits

Principal component analysis (PCA) allowed detecting similarities in the varieties with

regards to STB responses across two experimental sites during two years (Figure 6). The major

correlated variability of varieties showed by axes 1 and 2, revealed 6 groups within each region

(Figures 4 and 5). The first PC1 axe accounted for 98% of the total variability expressed by

quantitative traits (AUDPC, rAUDPC, PC, and N) while the second component (PC2) accounts

only 1.64% of the total variation. On the other hand, strong positive correlation between the

four infection measures (AUDPC, rAUDPC, PC, and N) of the 89 varieties was observed in

this study (Figure 6).

Figure 5. PCA showing the major correlated variability of varieties as shown by axes 1 and 2 accounting 98%

and 1.64% respectively of the total variability expressed by quantitative traits. ACP revealed 6 clusters at Cap

Bon region: Cluster 1: Very resistant; Cluster 2: resistant; Cluster 3: moderately resistant; Cluster 4:

moderately susceptible; Cluster 5: susceptible; Cluster 6: very susceptible. Details about varieties of each group

are shown in table 4.



68

4. Discussion

Disease severity in plant-pathosystems can be assessed either once or several times at

some intervals during the plant growth cycle. The former method of assessment measures can

be used to estimate different parameters like the area under the disease progress curves

(AUDPC) and the relative area under the disease progress curve (rAUDPC) which are being

used by several pathologists in the analysis of data on resistance to Septoria (Kema et al., 1996;

Chartrain et al., 2004; Mojerlou et al., 2009; Ferjaoui et al., 2015). Here, we assessed AUDPC

and rAUDPC, pycnidial coverage (PC) and the necrotic area (N) under field conditions to

investigate the behavior of the Tunisian, Moroccon and Algerian bread and durum wheat

varieties for their resistance to Septoria tritici blotch (STB) at two different locations where the

pathogen seems to have achieved a specialization to one or other wheat species.

The choice of using Moroccon, Tunisian and Algerian durum and bread wheat varieties

relies on the fact that even though STB is considered as a serious threat in the Maghreb

countries, different responses towards STB exist in terms of host range. The disease is mostly

prevalent on durum wheat in Tunisia (Gharbi et al., 2000) and on bread wheat in Morocco

Figure 6. Dimensional relationships among the measured parameters of STB infection showing a significant

correlation between AUDPC, rAUDPC, N and PC as revealed by principal component analyses over two years.



69

(Mazzouz et al., 1995) while it is a major threat for both durum and bread wheat in Algeria

(Ayad et al., 2014).

Results of this study showed a good STB development at the two locations and analysis

of variance revealed the presence of important and significant variability of the experimental

materials used to evaluate the susceptibility and resistance of wheat varieties against STB. On

the other hand, PCA results showed that the four quantitative variables (N, PC, rAUDPC and

AUDPC) contributed in the total with 99 % of variance, and high positive correlation was

recorded between these measured parameters. These results are in agreement with Odilbekov

et al. (2018) finding which reported that, STB measured parameters affected by the disease

increased upon disease progression. Similar studies conducted by Karisto et al. (2017) showed

a positive correlation between quantitative variables (AUDPC and PC) and STB infection.

More important, a significant interaction between Variety: Region was observed in this

study suggesting a possible physiological specialization of the pathogen across studied regions

(Boughalleb et Harrabi, 1997). STB was nearly absent on ISEPTONS and the Tunisian

commercial bread wheat at Béjà where they were ranked as immune, resistant and very resistant

groups (Class I, II and III; respectively) which confirms previous conclusions about the great

level of resistance of bread wheat in Tunisia and the adaptation of Z. tritici isolates to durum

wheat in Tunisia (Gharbi et al., 2000; Fakhfakh et al., 2011). Interestingly, STB was also absent

on Moroccan bread wheat varieties at Béjà showing again that Béjà is a clear hot spot region

for STB on durum wheat.

In Cap Bon region, STB was present on Tunisian bread wheat but still insignificant

compared to the bread wheat landrace known as “Farina Arbi” which was considered as a

susceptible check in our study. In this context, Holloway (2014) and McDonald and Mundt

(2016) reported that when a very susceptible variety becomes widely grown, STB will be more

severe in the next season on the susceptible wheat. However, insignificant infection was

reported on Tunisian durum wheat Karim, Salim and Nasr which were ranked as resistant class

in this region. This could be mainly associated with the limited cultivated areas of durum wheat

which represent only 20 % of the total cereal growing areas at El Haouaria region (Cap Bon

area) compared to the old variety ‘Farina Arbi’ that cover more than 60%.

Surprisingly, STB was strongly present at Cap Bon region on Moroccan bread and durum

wheat varieties and at Béjà only on Moroccan durum wheat with the highest mean of PC, N and

rAUDPC and they were ranked as very susceptible class VII. This data contrasted with the

finding of Zahri and collaborators (2014) that highlighted the resistance of Moroccan durum



70

wheat and the susceptibility of bread wheat to STB (Mazouz et al., 1995; Jilbene, 1996) when

cultivated in Morocco. This could be related to the great adaptation of Z. tritici population to

wheat species in each geographic area (Aouini, 2018).

5. Conclusion

As previously reported, STB populations from Cap Bon region seem to be mostly specific

to bread wheat genotypes (Bel Hadj Chedli et al., 2018) whereas STB population from Béjà

seems to be more adapted to durum wheat varieties where it occurs annually (Gharbi et al.,

2000). At the country level, this opposite situation between Morocco and Tunisia could be

explained by the existence of host-species specificity in Septoria (Kema et al. 1996; Kema et

al., 2018). The resistance bread wheat varieties identified in this study may possess different

resistance genes that can be used in developing cultivars with and durable resistance to Septoria

diseases (Aouini, 2018; Medini et al., 2014) and may prove useful in breeding efforts to

improve STB resistance in wheat (Zhang et al., 2001).

Future research on the genetic diversity and population structure of durum and bread

wheat adapted to Z. tritici in Tunisia is underway. Finally, the analysis of population dynamics

of Z. tritici with respect to diversity and frequency distribution of the resistance sources is

essential to guide decisions on developing strategies for durable resistance.

Chapter 5. Effect of Host-wheat species on Genetic differentiation

of ‘Zymoseptoria tritici’ at single field in Northern Tunisia

Chapitre 5. Effect of Host-wheat species on genetic differentiation of ‘Zymoseptoria tritici’ at single field in

Northern Tunisia

71


La diversité génétique des populations de Z. tritici a été bien documentée. Toutefois,

aucune information n’a été publiée en ce qui concerne la variation de la diversité génétique et

de la structure des populations en fonction de l’espèce et de la variété choisie.

Dans ce chapitre, une première approche moléculaire complémentaire à l’approche

phénotypique adoptée précédemment (chapitre 4) a été appliquée. En partant de l’hypothèse

que les populations de Z. tritici collectées de différentes espèces de blé soient génétiquement

distinctes, une caractérisation moléculaire de 65 isolats mono-pycnidiaux issus de 22 variétés

de blé tendre, blé dur et triticale a été suivie.

L’expérience a été conduite durant la saison agricole 2016-2017 en « Augmented

design » en plein champ et sous l’infection naturelle dans la région du Cap Bon. Un

échantillonnage aléatoire a eu lieu et uniquement trois isolats ont été retenus de chaque

génotype. L’extraction d’ADN a été réalisée moyennant le Kit ‘Sbeadex® mini plant kit’ alors

que le génotypage a été assuré par le Kit ‘Type-it microsatellite kit (Qiagen)’ moyennant 12

marqueurs microsatellites. La présence des deux mating types et l’occurrence d’un cycle sexuel

régulier de Z. tritici ont été aussi vérifiées.

Dans une deuxième étape, une approche bio-informatique a été adoptée pour déterminer

la diversité génétique et la stucture des populations de Z. tritici au sein de l’espèce Triticum et

aussi pour la construction de l’arbre phylogénétique par le biais de plusieurs logiciels, à savoir

Genalex, Structure, DARwin 6…


Northern Tunisia

72

Abstract

Zymoseptoria tritici is currently one of the most devastating fungal diseases of durum

wheat in Tunisia. Up to date, few studies have compared the genetic diversity of Z. tritici

populations sampled from different wheat-host species. In this context, 65 isolates were

collected during 2016-2017 cropping season, from naturally infected wheat species: bread

wheat, durum wheat and triticale grown under rainfed conditions and naturally infected at at

the Cap Bon Area located North western Tunisia. The genotyping of the 65 Z. tritici isolates

using 12 microsatellite markers revealed significant levels of genetic diversity in the total

population and within species and cultivars populations. Results indicate an equal Nei’s gene

diversity (0.52), unbiased gene diversity (0.58) and allele richness (4.43) within Z. tritici-durum

and bread wheat populations. Therefore, weak population differentiation (0.13) between species

population explained by high levels of gene flow (3.26) and a lack of a genetic structuration

were then concluded. Furthermore, all studied populations displayed an unequal mating type

distribution with a predominance of Mat 1-2. Our data did not show a significant interaction

between the mating type distribution, the genetic diversity, the population structure of the Z.

tritici – host species specialization. Thus, a proper and an accurate Z. tritici population sampling

is required to better capture empirical genetic diversity between the well adapted Z. tritici

isolates to their corresponding hosts.

Key words: wheat species, Zymoseptoria tritici, genetic diversity and structure, Tunisia

1. Introduction

Zymoseptoria tritici (Z. tritici) the causal agent of Septoria tritici blotch (STB) has

become an imminent threat in several wheat-growing areas causing significant economic

impact worldwide (McDonald, 2016, Fones and Gurr, 2015) and has been reported as a severe

disease in many countries such as in : North and South America, Europe, the Central and West

Asia and North Africa (Linde et al., 2002; Zhan et al., 2003; Kabbage et al., 2008; Singh et al.,

2016). STB could reduce wheat yields by 30 to 50% under inducive conditions, increasing thus

fungicides use that costs global expenditure of hundreds of millions of dollars each year

(Torriani et al., 2015). This fungus has a heterothallic bipolar mating system with two mating

type alleles, mat1-1 and mat1-2 (Waalwijk et al. 2002), and actively sporulates through asexual

and sexual fructifications that release splash-borne pycnidisopores and air-borne ascospores,

respectively (Ponomarenko et al., 2011), both contributing to epidemics. The ascospores

constitute the primary inoculum released from wheat debris and can be formed year-round


Northern Tunisia

73

while asexual pycnidiospores are splash-dispersed over short distances and act as the main

secondary inoculum and hence ensure the disease progress during the growing season (Eyal et

al., 1987; Kema et al., 1996; Eyal 1999; Hunter et al., 1999; McDonald and Linde, 2002;

Ponomarenko et al., 2011). This pathogen can accomplish up to six cycles on the wheat crop

(Fones and Gurr, 2015). Due to the Z. tritici's mixed reproductive system, Z. tritici populations

are extremely diverse (Linde et al., 2002; Hartmann et al., 2018) where the sexual reproduction

plays a key role in shaping the genetic structure (Chen and McDonald 1996; Linde et al., 2002;

Zhan et al., 2003). Hence, knowledge of the genetic diversity and the structure of Z. tritici

populations is essential to predict the evolutionary potential of the pathogen which could better

direct the host resistance deployment and the fungicide management strategies (McDonald and

Linde, 2002).

Previous studies reported that the Middle East was probably the origin of Z. tritici, and

the domestication of wheat-Z. tritici happened ~11.000 years ago (Stukenbrock et al., 2007).

This pathogen can infect durum wheat (Triticum turgidum L. subsp. durum (Desf.), bread wheat

(Triticum aestivum L. subsp. aestivum) and triticale (Triticosecale spp) and can also infect other

grass species (Ponomarenko et al., 2011; Stukenbrock et al., 2011). The long co-evolution with

wheat has resulted into a highly specialized pathogen of wheat that is difficult to control (Poppe

et al., 2014). The physiological specialization of Z. tritici on bread wheat and durum wheat was

for a long time open to various speculations especially in some regions such as the Maghreb

region where STB is a major threat (Medini and Hamza, 2008).

In Algeria, STB was reported on the entire country cereal zones on both cultivated wheat

species durum wheat and bread wheat (Harrat and Bouznad, 2018). In Morocco, bread wheat

is the major crop affected by Septoria while durum wheat seems to be more resistant to this

disease (Jilbène et al., 1995; Mazzouz et al., 1995) which might suggest a great specialization

of the pathogen (Kema et al., 1996). The inverse situation exists in Tunisia where severe

incidence occurs annually and mainly on durum wheat (Fakhfakh et al., 2011) which could be

related to the proportion of cultivated durum wheat area as compared to that of bread wheat in

each country (Medini and Hamza, 2008). Recently, STB has intensified in some bread wheat-

growing area of Northern Tunisia especially at “El Haouaria” region, where severe epidemic

occurs annually mainly because of the extensive monoculture of the susceptible wheat “Farina

Arbi” in that area (Bel Hadj Chedli et al., 2018).

Genetic variation and structure of Z. tritici populations have been intensively investigated

in recent years at a large geographic scales using several type of markers (Razavi and Hughes


Northern Tunisia

74

2004; Abrinbana et al., 2010; El Chartouni et al., 2011; Gurung et al., 2011; Boukef et al.,

2012; Drabešová et al., 2013; Dalvant et al., 2018) and also at small spatial scale (Linde et al.,

2002; Kabbage et al., 2008; El Chartouni et al., 2012; Welch et al., 2017; Siah et al., 2018;

Morais et al., 2019). Recently, Gibriel (2019) highlighted the important genetic variation and

population structure among bread and durum wheat isolates from many countries. In Tunisia,

very little is known about the epidemiology, the genetic diversity and structure of Z. tritici

populations harvested from different wheat species and cultivars in the field mostly conducted

on durum wheat (Boukef et al., 2012; Berraies et al., 2013; Naouari et al., 2016).

Hence, this study is the primary investigation of genetic diversity and stucture of Z. tritici

sampled from different species (durum wheat, bread wheat and triticale) in Tunisia. First, our

primary goal was to test the hypothesis that Z. tritici collected from different wheat species

would be genetically differentiated. Second, this study aims to characterize the genetic diversity

between the different Z. tritici- populations collected from bread wheat (Triticum aestivum L.

subsp. aestivum), durum wheat (Triticum turgidum L. subsp. durum (Desf.) and triticale

(Triticosecale spp.) cultivated in a single field at Cap Bon region and to assess the effect of the

host on the pathogen genetic diversity.

2. Materiel and Methods

2.1. Wheat varieties and Z. tritici sampling

In this study, a total of 22 wheat varieties including commercial durum and bread wheat

and triticale cultivars from Algeria, Morocco and Tunisia, previously classified from resistant,

moderately resistant, moderately susceptible, susceptible to highly susceptible (chapitre 3) were

used to study the genetic diversity of Z. tritici under natural conditions (Table 1). The

experiment was carried out during the 2016-17 cropping season at the farmer field located at

Cap Bon Area (36°47’47’’N, 11°0’8’’E, governorate of Nabeul, northwest of Tunisia) which

was reported recently as a primary hot-spot for STB on bread wheat (Bel Hadj Chedli et al.,

2018).

The trial was conducted in an augmented design and each cultivar was grown in

individual sub-plot. All plots were naturally infected by Z. tritici and where not treated with

fungicides. Within each sub-plot, five infected flag leaves from different plants were randomly

collected at growth stage 31 (Zadok Scale) and subsequently one mono-pycnidial isolate was

obtained per leaf following the protocol published by Siah et al. (2010). Only three isolates per

cultivar were analyzed in this study (Table 1). Isolates from each specie and cultivar are


Northern Tunisia

75

considered as separate populations. At last, a total of 65 mono-pycnidial isolates were obtained

and DNA extraction was carried out using the Sbeadex® mini plant kit (LGC genomics)

extraction on a King Fisher KF96 system according to the manufacturer's instructions.

Table 1. Summary of information about ‘Zymoseptoria tritici’ isolates investigated in this study.

Host Varieties Varieties Origin Isolates number Situation in Cap Bon Area

Bread wheat Marchouch Morocco 3 Highly Susceptible

Bread wheat Amal Morocco 3 Susceptible

Bread wheat Arrehane Morocco 3 Highly Susceptible

Bread wheat Aguilal Morocco 3 Highly Susceptible

Durum wheat Om rabia Morocco 3 Susceptible

Durum wheat Karim Morocco 2 Susceptible

Durum wheat Sebou Morocco 3 Moderately resistant

Durum wheat Toumoch Morocco 3 Moderately resistant

Durum wheat Marzak Morocco 3 Susceptible

Durum wheat Algeria 5 Algeria 3 Moderately susceptible

Durum wheat Algeria3 Algeria 2 Moderately resistant

Durum wheat Algeria6 Algeria 4 Susceptible




Bread wheat Dougga Tunisia 3 Resistant

Bread wheat Utique Tunisia 3 Resistant

Bread wheat Mahon Tunisia 3 Resistant

Bread wheat Farina Ari Tunisia 3 Highly Susceptible

Durum Wheat Maali Tunisia 3 Moderately susceptible

Durum Wheat Karim Tunisia 3 Resistant

Triticale TL4 Tunisia 3 Susceptible

Total 65

2.2. Mating types determination

Mating-type idiomorphs distributions of 65 Z. tritici isolates from single field at Cap Bon

area were determined by multiplex PCR as described previously by Waalwijk et al. (2002). The

primer sequences 5′-CCGCTT TCTGGCTTCTTCGCACTG-3′ (F) and 5′-TGGACACC

ATGGTGAGAGAACCT-3′ (R) were used to amplify a 340-bp fragment from MAT1-1

isolates, and the primer sequences 5′-GGC GCCTCCGAAGCAACT-3′ (F) and 5′-

GATGCGGTTCTGGACTGGAG-3′ (R) amplified a 660-bp fragment from MAT1-2 isolates.


Northern Tunisia

76

PCR reactions were performed in 2.5 µl volumes containing (6µM) of each primer, 5µl (600

µM) of dNTPs, 5 µl of 10 X reaction buffer, 0.25 unit of Taq polymerase (Promega) and 10 ng

of genomic DNA. The total PCR reaction volume was adjusted with sterile distilled water to 50

µl per PCR reaction. PCR amplifications were performed using a ‘Biorad’ thermocycler with

the following thermal cycling conditions: 1 min at 94°C for initial denaturation, 30 s at 68°C

for annealing, 1 min at 72°C for extension, followed by a final 10-min extension at 72°C. PCR-

amplified products were separated in 1% (wt/vol) agarose gels electrophoresis in 0.5× Tris-

Borate-EDTA (TBE) buffer at 100 V for 45 min.

2.3. Microsatellite analysis

Twelve pairs of single locus microsatellite primers (SSR) markers (St1, St2, St3A, St3B,

St3C St4, St5, St6, St7, St9, St10, and St12) described by Gautier et al. (2014) were used to

study the genetic variability of 65 Z. tritici isolates (details are shown in chapter 3). Two bread

wheat isolates from Netherlands (IPO323 and IPO94269) and one durum wheat isolate from

Algeria (IPO95052) were used as refences in this study. However, 20μL PCR reactions were

performed using the Type-it microsatellite kit (Qiagen) in accordance with manufacture

recommendations. PCR reactions were performed in 25µL volumes with the following

components: 2.5μL deionized water, 2.5μL Q-solution, 2.5μL of the primer mix (containing

2μM of each primer), 12.5μL of the Type-it mix and 5μL of DNA (10ng.µL). Reactions were

run at 95°C for 5 min, followed by 35 cycles of 95°C for 30s, 55°C for 90s and 72°C for 30s,

with a final extension step of 60°C for 30 min, using a PT100 thermocyler (Biorad). The PCR

products were run on 3130xl instrument (Life Technologies) using the Liz500 size standard.

2.4. Data analysis

Mating types distribution was determined by calculating the ratio of mating-type alleles

(Mat 1–1/Mat1–2) and χ2 tests were performed to determine whether the frequencies of the two

mating types within different species-populations departed from the null hypothesis of a 1:1

ratio (Waalwijk et al. 2002).

Genetic diversity in the total population, the total number of alleles and allele frequencies

at each SSR locus, the polymorphism (P%), Shannon information index (I), genetic diversity

(H) and unbiased diversity (uh) were investigated within each population using GENALEX 6.5

software (Peakall and Smouse, 2012). The magnitude of genetic differentiation among

populations was assessed using Wright’s FST statistic (Nei, 1973). Analysis of Molecular


Northern Tunisia

77

Variance (AMOVA) and gene flow index (Nm) were further investigated using GENALEX 6.5

within and among each population.

Structure analyses were carried out to investigate the genetic structure of Z. tritici

populations using Structure software version 2.3.4 (Pritchard et al., 2000). Population structure

analyses were based on Twenty-seven multilocus genotypes which were identified out of the

initial 65 populations. The relationship between individuals was calculated using principal

coordinate analysis (PCoA) to detect genetic divergence among subpopulations (Sun et al.,

2013). A neighbor-joining phylogenetic tree based on distance between subpopulations was

established with DARwin6 software with 1000 bootstraps (Perrier and Jacquemoud-Collet,

2006).

3. Results

3.1. Distribution of mating-type alleles at single field

Among 65 Z. tritici isolates sampled from the three wheat species, three isolates that did

not amplify were not included in mating type frequencies. The two mating types, Mat1-1 and

Mat1-2, were found within the three studied species. However, the χ2 test detected a significant

deviation from the 1:1 ratio at the significance level of P = 0.05 with a great predominance of

Mat1-2 compared to Mat1-1(Table 2).

Table 2. Distribution of Z. tritici mating types within wheat species from single field at Cap Bon region.

Wheat Species Isolates Number MAT 1-1 (%) MAT1- 2 (%) χ2

Durum Wheat 39 30.76 69.23 2.88

Bread wheat 20 35 65 0.9

Triticale 3 0 100 1.5

Total population 62* 30.64 70.49 4.64

* Three isolates that did not amplify were not included in mating type determination

3.2. Genetic variability in core chromosome according to host species

Twenty-seven multilocus genotypes (MLG) were identified from the initial population.

However, high and equal genetic diversity (0.7), Shannon’s index (0.4) and unbiased diversity

(0.4) were recorded for durum and bread wheat Z. tritici populations (Figure 1). Similarly, great

genetic diversity (0.5) was observed for the Z. tritici in triticale population (Figure 1). The most

important level of polymorphism (91%), private alleles number (14) and multilocus genotypes

number (17) were observed for the durum wheat derived Z. tritici isolates (Table 3) followed

by the bread wheat derived isolates population and subsequently by the triticale derived isolate

population with 83% and 75%, of polymorphism level respectively (Table 3).


Northern Tunisia

78

Genetic differentiation within and between different populations was also investigated by

calculating the pairwise Fst. Overall, moderate Fst value (0.13, Table 3) was observed among

durum wheat, bread wheat and triticale populations. We further examined the partitioning of

genetic variation between the three various collections through hierarchical AMOVA, where a

lack of significant variance within and between species populations was observed (P=0.22;

Table 4). Hence, 97% of the molecular variance was attributed to the variation within each

wheat species populations whereas only 3% was observed among all wheat species populations.

3.3. Genetic diversity and differentiation between varieties populations

In this study, SSR analyses revealed that high levels of polymorphism were observed

among isolates from bread wheat, durum wheat and triticale varieties suggesting high genetic

diversity among different varieties populations (Table 3). Thus, the most important genotypes

multilocus number (MLG=3) was noted with Triticale and the bread wheat “Amal” while the

rest were ranged between 1 and 2 (Table 3). Furthermore, higher levels of polymorphism were

observed for many durum and bread wheat varieties (66% for Karim, Dougga and Mahon) and

75% for Triticale, while the lowers ones (0%) were observed with Algerian durum wheat

varieties and the Tunisian one ‘Maali’. These results revealed that genetic diversity and

polymorphism seems to be independent of wheat species and varieties. The most important

level of Fst index (0.6) was recorded between varieties populations and low gene flow (0.16)

was then observed (Table 3). In addition, significant variation (P=0.001, Table 4) between

varieties population as reveled by ANOVA analysis confirms these results where 53 and 47%

of the variation was explained within and among varieties populations, respectively.

Figure 1. Summary of different measured index: Genetic diversity (h); Shannon's Information Index (I),

and Unbiased genetic diversity (uh) across three wheat species. DW: durum wheat, BW: bread wheat

and TRIT: triticale.


Northern Tunisia

79

Table 3. Genetic diversity of Zymoseptoria tritici populations, genetic differentiation between populations and

gene flow.

N: Isolate Number; Ne = No. of Effective Alleles; P%: polymorphic loci; Fst: Wright’s F index indicating genetic differentiation between

populations; Nm: gene flow; Pa: private allele; SE: Standard Error.

Table 4. Analysis of Molecular Variance (AMOVA) for 65 Zymoseptoria tritici isolates.

Source df SS MS Est. Var. % variation P

Species

populations

Among subpopulations 2 32399.633 16199.817 297.185 3% 0.229

Within subpopulations 62 707596.643 11412.849 11412.849 97%

Total 64 739996.277

11710.034 100%

Cultivars

populations

Among subpopulations 21 474712.444 22605.354 5567.020 47% 0.001

Within subpopulations 43 265283.833 6169.391 6169.391 53%

Total 64 739996.277

11736.411 100%

df: degree of freedom; SS: sum of square; MS: mean of square; P: probability

Population Sub-popluations N Ne (SE) %P MLG Fst (SE) Nm (SE)

Species

populations

Durum wheat 41 2.02(0.29) 91.67 17

Bread wheat 21 2.09(0.22) 83.33 10

Triticale 3 1.7(0.15) 75.00 3

Total 65 1.94(0.13) 83.33 27 0.13(0.03) 3.26 (1.12)

Varieties

populations

Toumouch 3 1.33(0.11) 41.67 2

Marzak 3 1.06(0.06) 8.33 1

Om rabia 3 1.26(0.11) 33.33 2

Sebou 3 1(0) 0.00 1

Karim 2 1.53(0.11) 66.67 2

Marchouch 3 1(0) 0.00 1

Amal 3 1.56(0.17) 58.33 3

Arrehane 3 1.6(0.10) 75.00 2

Aguilal 3 1.75(0.31) 75.00 2

Algeria5 3 1(0) 0.00 1

Algeria3 2 1.08(0.83) 8.33% 2

Algeria6 4 1.1(0.06) 16.67 1

Algeria7 3 1(0) 0.00 1

Algeria8 3 1(0) 0.00 1

Algeria9 3 1.33(0.11) 41.67 2

Dougga 3 1.53(0.11) 66.67 2

Mahon 3 1.53(0.11) 66.67 2

Farina Arbi 3 1.4(0.12) 50.00 2

Utique 3 1.96(0.2) 83.33 2

Karim 3 1.53(0.11) 66.67 2

Maali 3 1(0) 0.00 1

TL4 3 1.7(0.15) 75.00 3

Total 65 1.33(0.02) 37.88 27 0.63 (0.04) 0.16 (0.02)


Northern Tunisia

80

3.4. Lack of genetic structure within total population

The PCoA analysis showed a lack of a genetic divergence among different wheat-species

populations (Figure 2). Some durum wheat isolates which were more aggregated and also some

bread wheat isolates have a divergent position without the formation of a distinct group.

Besides, genetic similarity was observed between two Tunisian bread wheat isolates and both

bread wheat isolates from the Netherlands (IPO323 and IPO94269). Therefore, the Algerian

durum wheat isolate (IPO95052), the four-bread wheat and one triticale isolates were grouped

together (Figure 3). Few exceptions were observed with a set of 12 durum wheat isolates that

were located in separate clade from all other Z. tritici investigated populations (Figure 3).

Overall, most of the bread wheat, the durum wheat and the triticale Z. tritici derived

populations were grouped together as revealed by the dendrogram (Figure 3). Structure analysis

confirmed these results where a lack of a genetic structure neither within wheat species

populations nor within cultivars populations was revealed (Figure 4).

Figure 2. PCoA analysis of 65 Z. tritici isolates sampled from three wheat species cropped in single

field at Cap Bon region during 2016-2017 cropping season.

Chapitre 5. Effect of Host-wheat species on Genetic differentiation of ‘Zymoseptoria tritici’ at single field in Northern Tunisia

81

Figure 3. Genetic clustering and relationships between 65 Z. tritici isolates sampled from bread wheat, durum wheat and triticale from 22 wheat varieties cultivated

in Northern Tunisia. The tree was constructed using the weighted neighbor-joining method implemented in DARwin 6 software. Isolates from bread wheat, durum

wheat and triticale were colored, black, blue and green respectively. References-isolates (IPO323 and IPO94269 and IPO95052), we designed with the red color.

Chapitre 5. Effect of Host-wheat species on Genetic differentiation of ‘Zymoseptoria tritici’ at single field in

Northern Tunisia

82

4. Discussion

Knowledge of the evolutionary potential of plant pathogens in agricultural systems could

be a useful tool to develop durable disease management strategies (McDonald et al., 2016).

However, the pathogen dynamics and genetic diversity and structure, could enhance knowledge

about host-pathogen adaptation (Plissonneau et al., 2017; Gibriel 2019).

In this study, the use of SSR markers revealed a high genetic variability among species

and varieties populations which suggest an important diversification of Z. tritici at field level at

Cap Bon area which was previously reported as a hot spot for Septoria tritici blotch especially

on bread wheat (Bel Had Chedli et al., 2018). These results are in agreement with Kabbage et

al. (2008) findings showing a diversity of 98% within Kansas Z. tritici population at a single

field, and even at smaller micro and macro-plots. More important, McDonald et al. (1995),

Zhan et al. (2002), Abrinbana et al., (2010) reported that sexual reproduction, allowing

generation of new genotypes, is likely frequent in small geographic areas leading to the

diversification of the pathogen in the field. Similar study was performed in Tunisia by Berraies

et al. (2013) which attributed the high level of genetic diversity of durum wheat at a single field

in Northern Tunisia to a spontaneous mutation and frequent sexual recombination. However, in

Tunsisia, this study is the first investigation of Z. tritici of bread wheat, durum wheat and

triticale population.

Figure 4. Lack of population structure as revealed by Structure software with K=2, K=3 and K=4 within a

total of 65 Zymoseptoria tritici population sampled from single field in Tunisia.


Northern Tunisia

83

The occurrence of a sexual cycle was further revealed by the presence of two mating types

Mat1-1 and Mat1-2 on bread wheat, durum wheat and triticale species which indicate that Z.

tritici isolates undertake sexual reproduction irrespectively to the host species (Waalwijk et al.,

2002; Elbekali et al., 2012; Ayad et al., 2014). The even mating type distribution seems to be

not affected by wheat varieties from which the isolates were harvested. This finding could be

related to the lack of specificity between mating types and wheat varieties during host pathogen

interactions wheat-Z. tritici pathosystem (Kema et al., 1996; Brading et al., 2002; Siah et al.,

2010). The predominance of Mat1-2, as revealed in this study could be due to the small

population size. Hence, a proper sampling is definitely required to avoid a mating type ratio

distortion (Leslie and Klein, 1996; Abrinbana et al., 2010).

In this study, twenty-seven unique genotypes were detected among the total sixty-five

investigated Z. tritici isolates, presenting thus 41% of the total number of isolates. Detecting

unique genotypes is common in Z. tritici population genetic studies with different proportions.

In 2010, Castillo and collaborators, identified 35 and 39 multilocus haplotypes among the 58

isolates of “Los Hornos” and 62 of “Balcarce” locality respectively. The greater number of

identified clones or may be due to the shorter distance between sampling points and the higher

conidial splash-dispersal in the field (Cordo et al., 2006).

On the other hand, an equal genetic diversity, Shannon’s index and Unbiased diversity

were observed within bread and durum wheat derived Z. tritici populations which could prove

that diversity in the field seems to be not affected by wheat species. Therefore, the private allele

number, the proportion of multilocus genotypes (MLG) and the polymorphism level were

relatively high for the durum wheat derived Z. tritici population, but slightly smaller for the

bread wheat and the triticale Z. tritici populations. These findings could be explained by the

unbiased sampling of the diverse Z. tritici populations where we have a higher number of the

durum wheat derived Z. tritici isolates (41) compared to the numbers of isolates collected from

bread wheat (21) and triticale (3).

Interestingly, minor differentiation and important gene flow were detected among wheat

species populations. Similar studies were conducted by Siah et al. (2013) highlighting a low

population differentiation (GST = 0.08) and a high degree of gene flow (Nm = 5.64) of local

French Z. tritici population. In this context, Oğuz et al. (2019) reported that when the pathogen

undergoes asexual reproduction, the risk of epidemic induction through gene flow is high.

Furthermore, Zhan and McDonald (2004) reported that during the long period of co-evolution

of Z. tritici and wheat, gene flow could decrease population differentiation. At Cap Bon Area,


Northern Tunisia

84

the old bread wheat, a tall low yielding bread wheat landrace ‘Farina Arbi’, is cultivated

annually for over a century, and the seeds are maintained by local farmers and not

commercialized. Consequently, the monoculture of wheat ‘Farina Arbi’ landrace at Cap Bon

area could explain the lack of differentiation between populations as the pathogen is hardly

defeated by the local host on which it is well-adapted and established. More importantly

Dalvant et al. (2018) assumed that movement of infected grains might have contributed to such

gene flow. Wind-born ascospores released during sexual reproduction more likely participate

to this homogenization and significantly increases gene flow within the field as well as among

different fields and regions (Zhan et al., 2003; El-Chartouni et al., 2011).

Furthermore, AMOVA analysis highlighted the lack of a significant differentiation

observed among and within durum wheat, bread wheat and triticale derived Z. tritici

populations while 47 and 53% of the genetic variation was explained by differences among and

within cultivars populations, respectively. These results are in agreement with Linde et al.,

(2002) study which reported that the most important level of genetic diversity (94%) occurs

within individual fields. In Tunisia, the existence of a strong gene flow and a lack of

differentiation between populations were previously reported at both regional (Boukef et al.,

2012; Nouari et al., 2016) and field levels (Berraies et al., 2013). However, the genetic variation

between and among different wheat species and cultivars at filed level still not well

documented. Recently, Gibriel (2019) investigated the genetic and genomic diversity of a

worldwide Z. tritici collection sampled from bread and durum wheat in the major global wheat

producing regions. He demonstrated an important genetic variation as revealed by the high

Single Nucleotide Polymorphisms (SNP) rate especially in the Middle East population. Thus,

important structural variation on accessory chromosomes and genome-wide differences

between durum and bread wheat isolates were further reported contributing to the dynamic

nature of Z. tritici populations (McDonald et al., 2016; Hartmann et al., 2017; Gibriel, 2019).

Bayesian statistical and PCoA analyses confirms a lack of a genetic structuration for Z.

tritici population within wheat species in local field in Tunisia. Recently, Welch et al. (2017)

reported an absence of clear structuration of Irish Z. tritici population sampled from different

wheat cultivars and grown at two experimental fields under different levels of diseases pressure.

Nevertheless, significant rates of population structure were reported in many previous studies

at region and country levels (Abrinbana et al., 2010; Drabešová et al., 2012; Siah et al., 2018)

whereas the level of the genetic differentiation seems to vary depending on the markers used

and the geographical locations studied (Nouari et al., 2016).


Northern Tunisia

85

The dendrogram constructed using the unweighted neighbor-joining method revealed that

the majority of isolates from different wheat species were grouped together. The two references

bread wheat isolates from the Netherlands (IPO323 and IPO94269) were grouped together with

a set of bread wheat isolates in the same group. Therefore, the Algerian durum wheat isolate

(IPO95052), four bread wheat and one triticale isolates were grouped together which revealed

a genetic similarity between theses isolates. On the other hand, a set of 12 durum wheat isolates

were aggregated and constitutes mostly a separate clade. This study revealed that no genetic

variation and structure was observed within durum and bread wheat species and cultivars. These

results contrasted Gibriel (2019) finding which aimed to assess genetic variation between

durum and bread wheat isolates in order to detect polymorphisms. He reported a large-scale

structural variation in accessory chromosomes and conserved core chromosomes in bread and

durm wheat Z. tritici population worldwide.

Nevertheless, the unbiased sampling due to a small population size investigated during

this study hampered an accurate comparison between the durum and bread wheat derived Z.

tritici isolates. Moreover, a genetic structure was expected and that could provide an insight

regarding the Z. tritici- host specificity (ŠÍP et al., 2015).

5. Conclusion

This study constitutes a preliminary characterization of the Z. tritici population sampled

from different wheat species at a single field in Northern Tunisia. Additional large collections

of isolates need to be analyzed in order to further investigate the population differentiation

observed in three wheat species and also to identify the different causes that could influence the

lack of the genetic structure of Z. tritici in Tunisia such as: varieties adaptation; disease

pressure, geographic spreads and meteorological conditions. The use of other marquers such as

SNPs could be helpful to detect a genetic stucutre between durum and bread wheat isolates.

Examination of cultivar resistance under conditions of natural infection and further field

sampling and pathogen population analyses are needed to assess the population biology and the

genetic structure of STB, to develop new wheat varieties in national breeding programs and

improve disease management strategies.

Discussion générale et conclusions

Discussion Générale et Conclusion

86


Les premiers blés tétraploïdes ont été cultivés en Syrie plus particulièrement à Damas. Le

Blé dur (Triticiumtu rgidium spp durum) est apparu pour la première fois à Can Hasan III en

Turquie il y a 7500 ans (Ren et al., 2013). La migration de l’Homme a conduit très vite à

l’expansion géographique du blé (Baloch et al., 2017) disséminé initialement vers l’Europe et

le Nord de l’Afrique durant la période Néolithique (Zapata et al., 2004). Aujourd’hui, le blé

s’étend sur environ 17 millions d’ha dans le Grand Maghreb représentant ainsi la première

source alimentaire. En Tunisie, la production du blé reste tributaire des conditions climatiques

et des pratiques culturales (Rastoin et Benabderrazek, 2014). Toutefois, l’utilisation excessive

des fertilisants, les semis précoces, l’augmentation de la densité du semis et le recours aux

variétés semi-naines ont augmenté considérablement les attaques des bio-agresseurs notamment

les maladies foliaires (Ben Mouhamed et al., 2000).

Causée par Zymoseptoria tritici, Septoria tritici blotch (STB) est considérée parmi les

principales maladies fongiques qui entrave annuellement les champs de blé et particulièrement

le blé dur (Ben Mohamed et al., 2000 ; Ammar et al., 2011). Les premiers résultats obtenus

après deux saisons agricoles successives 2015-16 et 2016-17, ont montré la gravité de la

septoriose qui a été enregistrée dans pratiquement toutes les régions céréalières prospectées

(Bizerte, Béjà, Le Kef, Jendouba, Zaghouan et la région du Cap Bon-Sud comme ‘Soliman,

Grombalia et Beni khalled’) chez toutes les variétés de blé dur et principalement ‘Maali, Karim

et Razzak’. Ces dernières sont les plus utilisées par les agriculteurs du Nord-Ouest qui ont

recours au minimum à deux traitements fongicides pour lutter contre la septoriose (Allagui et

al., 2014).

Ainsi, pour faire face à cette situation, un programme national d’amélioration pour le

développement des variétés à la fois dotée d’un haut rendement et résistantes à la septoriose,

parait essentiel (Sbei et al., 2009 ; El Falleh et Gharbi, 2014). D’où l’intérêt d’installer des

essais variétaux à travers des plateformes afin d’identifier de nouvelles sources de résistance.

Par ailleurs, certains chercheurs ont proposé le recours aux mélanges variétaux comme

une alternative pour réduire les attaques de STB (Gigot, 2013). Dans le cadre des essais

variétaux installés à la « Plateforme Septoriose » au sein de la station « Kodia », Ben M’Barek

et ses collaborateurs (2019) ont pu déduire que l’ajout des variétés résistantes ‘Salim’ et


87

‘Monastir’ à raison de 25% avec la variété sensible ‘Karim’ a diminué de manière significative

les attaques de Z. tritici d’une part et amélioré le rendement d’autre part.

Dans un autre contexte de réduction des attaques de STB, les études de Ferjaoui (2015)

ont conduit à l’identification du premier QTL majeur chez l’accession ‘Agili 39’ qui a été

cultivée durant plusieurs années successives dans la station expérimentale du CRRGC à Oued

Béjà connu comme un hot-spot de STB chez le blé dur. Cette accession a prouvé sa résistance

vis-à-vis de plusieurs isolats aux stades plantule et adulte. Un peu plus tard, Aouini (2018) a

montré que les analyses de résistance dans la population recombinante générée ont révélé que

la résistance à large spectre de ‘Agili 39’ résulte du pyramidage naturel de plusieurs QTLs à

effets mineurs. Elle a ajouté que les QTLs identifiés sur les régions chromosomiques 2BL et

2BS ont un effet majeur sur la résistance de ‘Agili 39’ à Z. tritici.

Tandis que la résistance du blé tétraploïde à Z. tritici n’a pas suscité beaucoup d’attention

et peu de travaux ont traité l’interaction Z. tritici-blé dur (Aouini, 2018), la résistance chez le

blé hexaploïde a été bien documentée et jusqu’à présent 21 gènes majeurs ou stb et 167 loci

quantitatifs (QTLs) ont été identifiés et déployés dans les travaux de sélection dans le monde

(Ghaffary et al., 2011 ; Brown et al., 2015 ; Mirzadi et al., 2015). En Tunisie, les variétés

commerciales de blé tendre sont dotées d’un excellent niveau de résistance sous l’infection

naturelle dans la région d’El Haouria comme il a été démontré dans le chapitre 2. Cultivées à

Béjà, connue par des attaques sévères de septoriose presque chaque année, ces variétés ont

connu une absence totale de la maladie. Cependant, il serait très important de chercher des

sources de résistances dans les variétés Tunisiennes de blé tendre, qui seront utiles pour les

programmes de sélection et d’amélioration. L’introgression des gènes de résistances du blé

tendre au blé dur serait d’un intérêt majeur.

Toutefois, malgré la bonne résistance des variétés de blé tendre à STB en Tunisie, cette

étude vient de prouver pour la première fois, une grande sensibilité d’une variété de blé tendre

cultivée exclusivement dans un petit village appartenant à la région d’El Haouaria avec des

incidences et des sévérités les plus importantes durant les deux saisons agricoles (2016 et 2017).

Depuis des décennies, pour la désigner, les agriculteurs de ce village utilisent la dénomination

générale ‘Farina arbi’ et ils procèdent à leur propre multiplication tout en refusant d’introduire

ou de cultiver d’autres variétés commerciales. En occupant des superficies très importantes dans

la région d’El Haouaria, cette variété ancienne sert particulièrement à la fabrication du « kaak »

qui fait partie des traditions de cette région.

De ce fait, et suite à la monoculture de la variété ‘Farina Arbi’, les agriculteurs se trouvent

face à une situation alarmante et un nouveau « hot-spot de STB » chez le blé tendre qui vient


88

de se créer dans la région d’El Haouaria. Devant cette situation, il est fortement recommandé

aux agriculteurs d’El Haouaria de pratiquer la rotation des cultures pour briser le cycle de

reproduction sexuée de Z. tritici qui persiste d’une année à une autre à cause de l’intensification

et la monoculture de la variété ‘Farina Arbi’ pour éliminer toutes structures vivantes (débris et

chaumes) pouvant héberger les ascospores.

De plus, ce qui a été surprenant dans cette recherche, c’est que la variété ‘Farina Arbi’

classée comme sensible dans la région d’El Haouaria a montré une résistance exceptionnelle à

ce pathogène lorsqu’elle a été cultivée à Béjà et classée comme immune. En plus, une infection

non significative a été observée chez les variétés commerciales de blé dur (Karim, Salim et

Nasr) cultivées à El Haouaria. Ceci peut être attribué à la dominance de la culture de blé dur

par rapport à celle de blé tendre dans la région de Béjà et de la culture de blé tendre à El

Haouaria tout en sachant que ‘Farina Arbi’ domine à peu près 60% des cultures céréalières dans

cette région (Bel Hadj Chedli et al., 2018). Ces résultats laissent à suggérer une spécialisation

physiologique de Z. tritici envers l’espèce T. aestivum dans cette région.

Toutefois, bien que la spécificité du pathosystème Z. tritici-blé envers l’espèce a attiré

l’attention de plusieurs chercheurs et a créé des débats depuis une cinquantaine d’années (Eyal

et al., 1973), cette interaction reste toujours non claire. De plus, la spécificité de ce pathogène

a été rapportée aussi bien chez les hexaploïdes (T. aestivm, AABBDD, 2n=42) (Kema et al.,

1996a ; Kema et al., 1996b; Kema et Van Silfout, 1997) que chez les tétraploïdes (T. turgidum

L. subp durum, AABB, 2n=28) (Ghaneie et al., 2012; Medini et Hamza, 2008) suggérant ainsi

une interaction gène pour gène (GFG) entre le blé et Z. tritici (Kema et al., 2018). Cette

constatation a été précédemment signalée par Eyal et al. (1973), Van Ginkel et Scharen (1988),

Johnson (1992), qui ont référé la spécificité de Z. tritici à la virulence/avirulence envers des

cultivars particuliers de blé dur ou de blé tendre. D’autre part, une évidence de l’existence d’une

division dans la population de Z. tritici qui sépare les isolats de blé tendre, virulents uniquement

sur blé tendre, et les isolats de blé dur adaptés uniquement au blé dur, a été rapportée (Kema et

al., 1996). Ainsi, certains auteurs ont attribué ceci à la dominance d’une espèce par rapport à

une autre dans certains pays comme dans le cas du blé dur en Tunisie, en Algérie et au Maroc

(Sayoud, 1995 ; Yahyaoui et al., 2000 ; Hamza et al., 2008).

Cette hypothèse vient d’être confirmée dans cette étude qui a dévoilé une grande

sensibilité des variétés Marocaines de blé tendre, résistantes au Maroc, dans la région d’El

Haouaria. Cultivées à Béjà, toutes les variétés Tunisiennes et Marocaines de blé tendre étaient

résistantes et toutes les variétés de blé dur quelle que soit l’origine étaient sensibles. Ces

constatations supposeraient que les populations de Z. tritici ont développé un pouvoir pathogène


89

plus élevé envers le T. durum à Béjà et envers le blé tendre T. aestivum à El Haouria comme

une réaction d’adaptation (Kema et al., 1996 a et b; Medini et Hamza, 2008). Ces résultats ne

pourront que confirmer d’une part le phénomène de la spécificité de Z. tritici envers l’espèce

hôte en Tunisie et d’autre part dévoiler la haute sensibilité des variétés de blé tendre et de blé

dur d’origines Marocaine et Algérienne lorsqu’elles sont cultivées en Tunisie. Il parait donc

essentiel de déterminer le niveau de spécificité de l’espèce hôte des isolats de blé tendre et blé

dur, en effectuant des inoculations croisées sur un panel de variétés de blé dur et blé tendre

Tunisiens et d’installer des essais variétaux à travers les plateformes dans les pays de l’Afrique

du Nord d’une façon particulière.

Par ailleurs, le génotypage d’une collection de 65 isolats de blé tendre, blé dur et triticale

d’origines Marocaine, Algérienne et Tunisienne cultivées à proximité dans la région du Cap

Bon durant la saison agricole 2016-17 en utilisant 12 marqueurs SSR, a révélé que la diversité

génétique, la richesse allélique, la diversité non biaisée et l’indice de Shannon chez les deux

populations de blé tendre et de blé dur sont similaires et des valeurs relativement basses pour

la population de Triticale. Ceci prouve en partie que la diversité au sein du champ semble ne

pas être affectée par l’espèce cultivée dans cette étude et dévoile le faible potentiel de l’espèce

et de la variété dans la variation génétique de Z. tritici (Welch et al., 2017).

En tenant compte de l’espèce mise en jeu, l’étude de la composante principale (ACP) et

l’analyse Bayésienne ont montré que les isolats de blé tendre, blé dur et triticale sont groupés

ensemble à l’exception d’un nombre limité d’isolats qui ont montré une certaine parenté. Une

divergence bien claire a été observée chez quelques isolats de blé tendre qui ont été groupés

ensemble et autres de blé dur qui ont montré une similarité génétique entre eux. A l’échelle

régionale la majorité des isolats de blé tendre ont été groupés ensemble avec les trois isolats de

référence (IPO323, IPO94269, IPO95052). Des constations similaires ont été obtenues par

Berraies et al. (2013) qui ont pensé que lorsque les sources d’inoculum sont originaires d’une

population locale de Z. tritici, les spores conservent ainsi une structure familiale limitée.

L’étude de la variabilité génétique et phénotypique des populations de l’agent pathogène

constitue un défi majeur pour le développement d’une gestion durable avec des cultivars

résistants et facilite la mise en place des programmes de sélection et des stratégies de lutte

(McDonald, 1997 ; McDonald et Linde, 2002 ; McDonald et al., 2016). Toutefois, la diversité

génétique de Z. tritici a été bien documentée et plusieurs travaux ont été élaborés dans ce sujet.

En 2003, une étude a porté sur une collection de 1673 isolats à l’échelle continentale, (Algérie,

Californie, Canada, Danemark, Australie, Allemagne, Israel, Mexico, Oregon, Syrie, Texas,

Uruguay, Royaume-Uni) montrant ainsi que la plus grande diversité génétique a été observée


90

en Israel ce qui a conduit à constater que le croissant fertile est le centre d’origine de Z. tritici

(Linde et al., 2000 ; Zhan et al., 2003). Toutefois, une importante diversité génétique du

génome nucléaire a été notée au niveau du champ (~12%) comparée à celle entre les régions

(~5%) et entre les continents (~3%). En plus, une faible différentiation entre les différentes

populations due à un important flux de gène a été ainsi rapportée. Des marqueurs AFLP ont été

utilisés pour étudier la diversité génétique de ce pathogène à plusieurs niveaux : micro et macro-

plots (Kabbage et al., 2008). Ces mêmes marqueurs ont été investigués pour montrer une

importante diversité génétique chez des isolats de blé dur de l’Algérie, de la Tunisie, et du

Canada (Medini and Hamza, 2008). Des comparaisons de la diversité génétique d’une

population Irlandaise de Z. tritici collectée à partir de différentes variétés (Welch et al., 2017)

et sur plusieurs années en France (El Chartrouni et al., 2011 et 2012 ; Morais et al., 2019) ont

été aussi abordées moyennant différents marqueurs moléculaires (SSR et SSCP).

En Tunisie, très peu de travaux ont traité la diversité génétique de ce pathogène et

uniquement trois travaux ont été élaborés dans ce sujet. La première étude de la génétique des

populations de Z. tritici en Afrique du Nord et en Tunisie particulièrement a été menée par

Boukef (2012) qui, en se basant sur 11 marqueurs microsatellites, a signalé une grande diversité

génétique de Z. tritici à partir d’une large collection de plusieurs pays (218 isolats). Récemment,

Nouari et al. (2016) ont étudié le génome nucléaire et mitochondrial de ce pathogène chez 108

isolats de blé dur collectés de Bizerte, Béjà, kef et Jendouba. Ainsi, une grande diversité

génétique, un important flux de gène et une faible différentiation entre les populations et une

absence de structuration ont été notés. A l’échelle parcellaire, des résultats similaires ont été

signalés par Berraies et al. (2013) moyennant une population de 45 isolats de blé dur (Karim)

collectée d’un seul champ à Béjà en utilisant 7 marqueurs SSR.

Dans cette étude, l’approche moléculaire basée sur 12 marqueurs microsatellites, a révélé

une importante diversité dans une population Tunisienne de Z. tritici collectée à partir du blé

tendre à travers trois regions (Cap Bon, Bizerte et Béjà). Ainsi, le grand nombre d’allèles privés,

de génotypes multilocus (MLG) et l’indice de Shannon les plus importants ont été enregistrés

dans tous les champs prospectés à El Haouaria. Une telle diversité génétique élevée qui a été

trouvée au sein de toutes les populations pourrait, d’une part être à l’origine d’une capacité

d’adaptation du pathogène aux différentes conditions climatiques des régions humide et semi-

aride de la Tunisie (Boukef, 2012). D’autre part, ceci peut être lié à l’occurrence régulière d’un

cycle sexué de Z. tritici dans cette région ce qui a été prouvé par la présence des proportions

presque égales de MAT1-1 et MAT1-2 (Bel Hadj Chedli et al., 2019). Les ascospores

transportés par le vent sur de longues distances génèrent ainsi de nouveaux allèles et la


91

recombinaison génétique entre ces types sexuels compatibles lors du cycle sexué aboutit à

l’apparition de nouveaux génotypes conduisant par conséquent à une grande diversification

(Zhan et al., 2003; Siah et al., 2013; Siah et al., 2018). Par contre, la dominance du MAT1-2

observée dans la région de Goubellat et les faibles pourcentages ainsi notés à Béjà et Bizerte ne

peuvent en aucun cas négliger la présence d’un cycle sexué dans ces régions. Par ailleurs, ceci

peut être attribué au nombre réduit des isolats collectés à partir de ces endroits et l’inadéquation

de l’échantillonnage (El Chatrouni et al., 2012) du fait que Z. tritici était rarement présent dans

les champs de blé tendre en Tunisie.

Le polymorphisme ainsi observé à El Haouaria laisse suggérer que probablement cette

population de Z. tritici possède naturellement de nouveaux gènes à échanger ce qui a augmenté

considérablement la diversité génétique et a influencé la pathogénicité de la population

(McDonald et Mundt, 2016 ; Dalvant et al., 2018). Malgré qu’un important flux de gène a été

signalé dans les différentes populations étudiées quelle que soit l’échelle considérée : région,

parcelle, espèce et variété, une faible différentiation génétique ainsi qu’une absence de

structuration ont été notées. Ces résultats peuvent être liés à la dispersion des spores qui se

produiraient probablement sur une large zone géographique et par conséquent un flux de gène

sur une longue distance (McDonald et al., 1999 ; Linde et al., 2002 ; Zhan et al., 2003). Les

mêmes constatations ont révélé une absence de structuration chez d’autres agents pathogènes

en Tunisie à savoir Fusarium culmorum agent causal de la Fusariose du Blé (Oufensou et al.,

2019). Par contre une structuration bien claire a été observée dans une population clonale de

Puccinia striiformis, agent causal de la rouille jaune, dans les régions méditerranéennes

(Tunisie, Maroc, Algérie…), en Europe (France, Allemagne, Belgique…) et aussi à travers une

population recombinante en Chine et au Sud de l’Asie (Népal et Pakistan) (Thach et al., 2016).

En Tunisie, la taille réduite de la population étudiée de Z. tritici, la limitation des zones

d’échantillonnage et le type de marqueur utilisé pourraient aussi expliquer l’absence d’une

structure claire des populations (Siah et al., 2018). Toutefois, il est connu que les différents

marqueurs moléculaires peuvent causer des différences même en utilisant les mêmes

échantillons (Drabešová et al., 2012). De leur part, Väli et ses collaborateurs (2008) pensaient

que les marqueurs SSR ne sont pas capables de capturer les petites variations génomiques qui

peuvent se reproduire au niveau de chaque nucléotide. Cette constatation a été confirmée

recemment par Gibriel (2019) qui, en utilisant des ‘Single nucleotide polymorphisms (SNPs)’,

a pu détecter une grande diversité génétique et une importante structuration d’une collection de

Z. tritici collectée à partir du blé tendre et du blé dur tout en soulignant ainsi une specialisation

de Z. tritici -blé.


92

Le génotypage moyennant des (SNPs) pourrait probablement détecter une stucturation

pareille en Tunisie. L’utilisation d’un plus grand nombre de marqueurs pourrait être ainsi

recommandée. D’autres travaux sont nécessaires pour consolider les résultats trouvés dans cette

investigation, et plusieurs études doivent être aussi effectuées non seulement au niveau régional

et parcellaire mais aussi au niveau de la même feuille et la même lésion sur plusieurs années.

La recherche des sources de variations de ces isolats génétiquement distincts reste à déterminer.

Le croisement des différentes souches de Z. tritici collectées à partir du blé tendre ‘Farina Arbi’

de la region du Cap Bon, et l’installation des series d’inoculations artificielles dans des

chambres de culture avec une caractérisation phénotypique et génotypique et le séquençage du

génome de plusieurs souches de blé tendre issues de cette région sont ainsi recommandés pour

trouver des explications génétiques de cette specialisation signalée dans la region d’El Haouria.

Références

93

Références Bibliographiques

Abrinbana M., Mozafari J., Shams-Bakhsh M., Mehrabi R. 2010. Genetic structure of

Mycosphaerella graminicola populations in Iran. Plant Pathology, 59: 829-838.

Allagui M. B., Sebei A., et Sakkouhi L. 2014. Importance de l’association de variétés de blé

dur dans la réduction des maladies fongiques foliaires et l’amélioration de la productivité.

Journée Nationale sur la valorisation des résultats de la Recherche dans le domaine des

Grandes Cultures, 8-10.

Ammar K., Gharbi M.S., and Deghais M. 2011. Wheat in Tunisia. In Bonjean, A.P.Angus, and

W.J. van Ginkel, M. (eds.) The world wheat book: A history of wheat breeding. Lavoisier,

Paris, France, (2):443-463.

Anonyme 1. Ministère de l’agriculture, des ressources hydrauliques et de la pêche, 2015.

Anonyme 2. FAO, Food and Agriculutre Policy decision Analysis. Country fact sheet on food

and agriculture policy trends 2017,1-6.

Anonyme 3. Valorisation des produits forestiers au Nord-Ouest. Ministère de développement

et de coopération internationale. Office de développement du Nord-Ouest, 2004.

Aouini L. 2018. Durum wheat and septoria tritici blotch : gene and prospects for breeding. PhD

thesis, Wageningen University, Wageningen, Netherlands: 225p.

Ayad D., Sayoud R., Benbelkacem K., et Bouznad Z. 2014. La tâche septorienne du blé:

Première signalisation de la présence en Algérie des deux Mating types du téleomorphe

Mycosphaerella graminicola (Fuckel) Schröter, (anamorphe: Septoria tritici Rob. Ex

Desm.) et diversité phénotypique de l’agent pathogène. “Nature & Technologie ". B-

Sciences Agronomiques et Biologiques: 34 -45.

Bachta M.S. 2011. La céréaliculture en Tunisie Une politique de régulation à repenser, note

d’analyse du CIHEAM, 64: 3.

Balotch F.S., Alsaleh A., Shahid M.Q., Ciftci V., et al. 2017. A hole genome DArTseq and SNP

analysis for genetic diversity assessment in durum wheat from central fertile crescent.

PloS one, 12: e 0167821.

Banke S., Peschon A., et McDonald B A.2004. Phylogenetic analysis of globally distributed

Mycrosphaerella graminicola populations based on three DNA sequence loci. Fungal

Genet. Biol,41:226-23.

Banke S., et McDonald B.A, 2005. Migration patterns among global populations of the

pathogenic fungus Mycosphaerella graminicola. Molecular Ecology, 14: 1881-1896.

Références

94

Bannon F., and Cook B.M. 1998. Studies on dispersal of Septoria tritici pycnidiospores in

wheat-clover intercrops. Plant Pathol, 47:49-56

Bathgate J.A., et Loughman R. 1994. Are ascospores a significant source of primary inoculum

of leptoshaeria nodorum, L. avenariaf. sp avenaria and Mycosphaerella graminicola in

the Northern wheat belt of Western Australia. In proceeding of the 4th international

workshop on septoria of cereals. pp :271-275.

Bel Hadj Chedli R., Ben M’Barek S., Yahyaoui A., Kehel Z., Rezgui S.2018. Occurrence of

Septoria tritici blotch (Zymoseptoria tritici) disease on durum wheat, triticale, and bread

wheat in Northern Tunisia. Chliean Journal of Agricultural Research, 78(4):559-568.

Bel Hadj Chedli R., Aouini, L., Ben M’Barek S., Yahyaoui, A., Rezgui, S., et Chaabène, H.

2019. Distribution of mating types in Zymoseptoria tritici populations collected from

bread wheat at El Haouaria region. Journal of New sciences, 61(5): 3892-3898.

Benbelkacem K., Bouznad Z., Benslimane H., Salhi N.L. 2011. Occurrence of septoria leaf

blotch in Algéria and assessment of wheat resistance. 8ème International Symposium on

Mycrosphaerella and Stagnospora Diseases of Cereals, Mexico City September: 10-14.

Ben Hamouda H., Ben Youssef S., Sonia Bedhiaf S., Mohamed Annabi M., Zied Draief Z., and

Gharbi M.S. 2016. Status of agricultural innovations, innovation platforms, and

innovations investment. Tunisia. 2015 PARI project country report: Republic of Tunisia.

Forum for Agricultural Research in Africa (FARA), Accra, Ghana.

Ben Hassine A., & Hamada W. 2014. First isolation of the Mycosphaerella graminicola

teleomorph stage causing Septoria leaf blotch on wheat in Tunisia. New Disease Reports

29, 18.

Ben Jabeur M., Somai-Jemmali L., et Hamada W. 2017. Thyme essential oil as an alternative

mechanism: biofungicide-causing sensitivity of Mycosphaerella graminicola. Journal of

Applied Microbiology, 122:932-939.

Ben M’Barek S., Karisto P., Fakhfakh M., Mikaberidze A., Yahyaoui A. 2019. Improved

control of Septoria trtici blotch in durum wheat using cultivar mixtures. bioRxiv: 1-23.

Ben Mohamed L., Rouaissi M., Sebei A., Hamza S., and Harrabi M. 2000. Effet du génotype,

de la date de semis, de la fertilisation azotée et potassique et des fongicides sur le

développement de Septoria tritici. p. 350-356. In Royo, C., Nachit, M., Di Fronzo, N.,

and Araus, J.L. (eds.) Durum wheat improvement in the Mediterranean region: New

challenges. CHIEHAM- options méditerranéennes : Série A. Séminaires Méditerranéens,

40: 350-356.

Références

95

Ben Salem M., Daaloul A., et Ayadi A. 1995. Le blé dur en Tunisie. In : Di Fonzo N. (ed.),

Kaan F. (ed.), Nachit M. (ed.). Durum wheat quality in the Mediterranean region

Zaragoza. CIHEAM Options Méditerranéennes : Série A. Séminaires Méditerranéens,

22 :81-91.

Berraies S., Gharbi M.S., Belzile F., Yahyaoui A., Hajlaoui M.R., Trifi M., Jean, M., et Rezgui

S. 2013. High genetic diversity of Mycospaherella graminicola (Zymoseptoria tritici)

from a single wheat field in Tunisia as revealed by SSR markers. African Journal of

Biotechnology, 12: 1344-1349.

Berraies S., Ammar K., Gharbi M.S., Amor Y, Rezgui, S. 2014. Quantitative inheritance of

resistance to Septoria tritici blotch in durum wheat in Tunisia. Chilean Journal of

Agricultural Research, 74: 35-40.

Bœuf F. 1936. Rôle du Service Botanique et Agronomique dans l’Economie Agricole de la

Tunisie. Résultats acquis, Programme en cours de réalisation. La Tunisie Agricole N°3 :

203-221

Boughalleb N., and Harrabi M. 1997. Physiologic specialization of Septoria tritici in North-

Africa. Tropicultura 15(1) :33-36.

Boukef, S. 2012. Structure des populations, spécificité parasitaire et évaluation de la résistance

aux fongicides chez Zymoseptoria tritici, agent de la septoriose du blé en Tunisie. Thèse

de doctorat de L’Institut National Agronomique de Tunisie, 1-102.

Brading P.A., Vertrappen E.C.P., Kema G.H.J., Brown J.K.M. 2002. A gene for gene

relationship between wheat and Mycosphaerella graminicola, the Septoria tritici blotch

pathogen. Phytophathology 92:439-445.

Brown J.K.M., Chartrain L., Lasserre-Zuber P., Saintenac C. 2015.Genetics of resistance to

Zymoseptoria tritici and applications to wheatbreeding. Fungal Genetics and Biology,

79 :33-41.

Brunner P.C., Stefano F.F., Croll T.D., Stukenbrock E., McDonald B.A. 2013. Coevolution and

Life Cycle Specialization of Plant Cell Wall Degrading Enzymes in a Hemibiotrophic

Pathogen. Mol. Biol. Evol. doi:10.1093/molbev/mst04.

Castillo N., Cordo C., Simón M. R. 2010. Molecular variability among isolates of

Mycosphaerella graminicola, the causal agent of septoria tritici blotch, in Argentina.

Chartrain L., Brading P.A., Makepeace J.C., Brown J.K.M. 2004. Sources of resistance to

Septoria tritici blotch and implications for wheat breeding. Plant Pathology, 53: 454-460.

Références

96

Chartrain L., Berry S.T., & Brown J.K.M., 2005. Resistance of wheat line Kavkaz-K4500

L.6.A.4 to septoria tritici blotch controlled by isolate-specific resistance genes.

Phytopathology, 95: 664-71.

Chebil A., & Frija A. 2016. Impact of improving water-use efficiency on its valuation: The case

of irrigated wheat production in Tunisia. African Journal of Agricultural and Resource

Economics, 11 (2) : 131-140.

Chen R.S, &McDonald B.A.1996. Sexual reproduction plays a major role in the genetic

structure of populations of the fungus Mycosphaerella graminicola. Genetics 142:1119-

1127.

Cordo C.A., Linde C.C., Zhan J., & McDonald B. 2006. Genotypic diversity of the wheat leaf

blotch pathogen (Septoria tritici) in Buenos Aires province. Sociedad Argentina Botánica,

41: 293–305.

Cordo C.A., Monaco C.I., Altamirano R., Perello A.E., Larran S., Kripelz N.I., and Simon M.R.

2017. Wheat Conditions Associated with the Release and Dispersal of Zymoseptoria

tritici Spores in the Argentine Pampas Region. International journal of Agronomy: 1-13.

Coppin E., Debuchy R., Arnaise S., et Picard M. 1997. Mating type and sexual developpement

in filamentous Ascomycetes. Microbiology and Molecular Biology Reviews, 61 :441-

428.

Cuthbert R.D. 2011. Molecular mapping of septoria tritici blotch resistance in hexaploid wheat

(Triticum aestivum L.). PhD thesis, University of Manitoba, Canada.

Dalvand M., Zafar D., Soleimani Pari M.J., Roohparvar R., and Tabib Ghafari S.M. 2018.

Studying Genetic Diversity in Zymoseptoria tritici, Causal Agent of Septoria Tritici

Blotch, by Using ISSR and SSR Markers.J. Agr. Sci. Tech, 20: 1307-1316.

Duncan K.E., Howard R.J. 2000. Cytological analysis of wheat infection by the leaf blotch

pathogen Mycosphaerella graminicola - Mycological research, 104( 9) : 1074-1082.

De Wolf E.2008. Septoria Tritici Blotch. Plant pathology. EP-133.

Djerbi M., et Ghodhbane A. 1975. Contribution à l’étude du Septoria tritici Rob. ex Desm.,

conservation et résistance variétale. Annales de l’INRAT, 48, Fasc. 1.

Drabešová J., Ryšánek P., Brunner P., McDonald B.A., and Croll D. 2013. Population genetic

structure of Mycosphaerella graminicola and quinone outside inhibitor (QoI) resistance

in the Czech Republic. European Journal of Plant Pathology: 135, 211.

Drummond J.B., Craigie R.A., Braithwaite M., Gillum A.T. McCloy B.L. 2015.The effect of

fungicide dose rate and mixtures on Zymoseptoria tritici in two cultivars of autumn sown

wheat. New Zealand Plant Protection 68: 420-427.

Références

97

Duda R. O., and Hart P. E. 1973. Pattern Classification and Scene Analysis. Wiley, New York.

Elbekali A.Y., Siah A., Ramdani A., El Chartouni L., Tisserant B., Deweer C., Hafidi M.,

Reignault, P., Halama P. 2012. First report of the mating types MAT1-1 and MAT1-2 of

Mycosphaerella graminicola in Morocco. J. Plant Pathol. 94:243–247.

El Chartouni L., Tisserant B., Siah A., Duyme F., Leducq J.-B., Deweer C., et al. 2011. Genetic

diversity and population structure in French populations of Mycosphaerella graminicola.

Mycologia, 103, 764.

El Chartouni L., Tisserant B., Siah A., Duyme F., Durand R., Halama P., & Reignault P. 2012.

Evolution of Mycosphaerella graminicola at the wheat leaf and field levels.

Phytopathologia Mediterranea, 51(3):32.

El Felah M., Gharbi M.S. 2014. Les céréales en Tunisie : Historique, contraintes de

développement et perspectives. Journée Nationale sur la valorisation des résultats de la

Recherche dans le domaine des Grandes Cultures : 1-7.

EL Felah M., Gharbi M.S., Ben Ghanem H., et Elloumi M. 2015. Les céréales en Tunisie entre

mythe et réalité. Annales de l’INRAT, 2ème Numéro Spécial Centenaire, 88 :1-17.

Estep L.K., Torriani S.F.F., Zala M., Anderson N.P., Flower M.D., McDonald B.A., Mundt

C.C. et Brunner P.C. 2015. Emergence and early evolution of fungicide resistance in

North American populations of Zymoseptoria tritici, 64: 961-971.

Eyal Z., Amiri Z., Wahl I. 1973. Physiologic specialization of Septoria tritici. Phytopathology

63:1087-1091.

Eyal Z., Scharen A.L., Huffman M.D., et Prescott J.M. 1985. Global insights into virulence

frequencies of Mycosphaerella graminicola. Phytopathology, 75: 1456-1462.

Eyal Z., Scharen A.L., Prescott J.M., et Vanginkel M. 1987. The Septoria Diseases of Wheat

Concepts and Methods of Disease Management. CIMMYT, Mexico, D.F, 10-35.

Eyal Z. 1999. The Septoria/ Stagonospora blotch diseases of wheat: past, peresent, and future.

p. 177–182. In: “Septoria and Stagonospora Disease of Cereal: A Compilation of Global

Research”. Mexico, D.F.: CIMMYT: 177–182.

Fakhfakh M.M., Rezgui S., Jarrahi T., Zouani R., Bousalmi A., Sgatni K., et Yahyaoui A. 2011.

Mapping distribution of Septoria allowed targeting management options of the disease.

8th International symposium on Mycosphaerella and Stagonospora diseases of cereals.

CIMMYT, Mexico.

Feldman M., et Sears R.E. 1981. The wild gene sources of wheat. Scientific American, 244:

102-112.

Références

98

Ferjaoui S., M’Barek S.B., Bahri B., Slimane R.B., and Hamza S. 2015. Identification of

resistance sources to Septoria tritici blotch in old durum wheat germplasm applied for the

analysis of the Zymoseptoria tritici-durum wheat interaction. Journal of Plant Pathology

97 (3): 471- 481.

Fones H., & Gurr S. 2015. The impact of Septoria tritici blotch disease on wheat: An EU

perspective. Fungal Genetics and Biology, 79:3.

Fones H.N., Eylesa C.J., Kaya W., Cowpera J, Gurr S.J. 2017. A role for random, humidity-

dependent epiphytic growth prior to invasionof wheat by Zymoseptoria tritici. Fungal

Genetics and Biology, 106:51-60

Garcia C., et Marshall D.1992. Observations on the ascogenous stage of Septoria tritici in

Texas. Mycological Research, 96: 65-70.

Garrett K.A., Nita M., De Wolf E.D., Gomez L., and Sparks A.H. 2009. Plant Pathogens as

Indicators of Climate Change. Elsevier B.V:425-436.

Gautier A., Marcel T., Confais J., Crane C., Kema G., Suffert F., et Walker A.S. 2014.

Development of a rapid multiplex SSR genotyping method to study populations of the

fungal plant pathogen Zymoseptoria tritici. BMC Research Notes, 7(373): 1-10.

Ghaffary S.M.T, Robert O., Laurent V., Lonnet P., et al.2011. Genetic analysis of resistance to

septoria tritici blotch in the French winter wheat cultivars Balance and Apache. Theor

Appl Genet., 123:741–754.

Ghaffary S.M.T., Faris J.D., Friesen T.L., Visser R.J.F., et al. 2012. New broad-spectrum

resistance to septoria tritici blotch derived from synthetic hexaploid wheat. Theor Appl

Genet., 124:125–142.

Gharbi M.S., et Deghaies M. 1997. Principaux enseignements à tirer de la campagne céréalière

1995/1996. Actes des 3èmes journées nationales sur les acquis de la recherche agronomique

halieutique et vétérinaire, 29/11-01/12/1996, Nabeul, Tunisie.

Gharbi M.S., Deghais M., Ben Amar F. 2000. Breeding for resistance to Septoria tritici in

durum wheat. In: Royo C. (ed.), Nachit M. (ed.), Di Fonzo N. (ed.), Araus J.L. (ed.).

Durum wheat improvement in the Mediterranean region : New challenges. Options

Méditerranéennes : Série A. Séminaires Méditerranéens,40 : 397- 401.

Gharbi M.S., Berraiess Fakhar S., Ammar K., Hajlaoui M.R., Yahyaoui A., et Trifi M. 2008.

Breeding durum wheat with resistance to Septoria leaf blotch for sustainable production

under Mediterranean conditions. International durum wheat symposium: from seed to

pasta, 30/06-03/07/2008, Bologne, Italie.

Références

99

Gharbi M.S., Berraies S., Ammar K., Yahyaoui A. 2011. Delivering disease resistant cultivars

to enhance sustainability of durum wheat production in Tunisia. p. 60. In Duveiller E, Singh

PK, et al. (eds.) 8th International Symposium on Mycosphaerella and Stagonospora

Diseases of Cereals, Mexico City. 10-14 September 2011. Book of Abstracts. CIMMYT,

Mexico.

Gharbi M.S., et El Faleh M. 2013. Les céréales en Tunisie : Plus d’un siècle de recherche

variétale. Annales de l'INRAT, Numéro Spécial Centenaire, 86 :45-68.

Ghaneie A., Mehrabi R., Safaie N., Abrinbana M., Saidi A., Aghaee M. 2012. Genetic variation

for resistance to Septoria tritici blotch in Iranian tetraploid wheat landraces. European

Journal of Plant Pathology, 132:191-202.

Gibriel H. 2019.Comparative pathogenomics in the ascomycete plant pathogens Zymoseptoria

tritici and Verticillium dahlia. Wageningen, Netherland.

Gigot C. 2013. Potentialités des associations de variétés pour limiter la progression épidémique

de la septoriose du blé: rôle des mécanismes de dispersion des spores par la pluie dans un

couvert végétal hétérogène. AgroParisTech – Institut National de la Recherche

Agronomique Unité Environnement et Grandes Cultures, 17-27.

Gilmour R., Gogel B.J., Cullis B.R., Welham S.J., and Thompson R. 2002. ASReml user guide

release 1.0. VSN International Ltd., Hemel Hempstead, UK.

Gladders P., Paveley N.D., Barrie I.A., Hardwick N.V., et al. 2001. Agronomic and

meteorological factors affecting the severity of leaf blotch caused by Mycosphaerella

graminicola in commercial wheat crops in England. Annals of Applied Biology, 138, 301–

311.

Gohari A. 2015. Identification and functional characterization of putative (a) virulence factors

in the fungal wheat pathogen Zymoseptoria tritici. PhD Thesis, Wageningen University, The

Netherlands

Goodwin S.B. 2007.Back to basics and beyond: increasing the level of resistance to Septoria

tritici blotch in wheat. Australasian Plant Pathology, 36: 532–538.

Gouache D., Bensadoum A., Brun F., Pagé C., et al. 2013. Modeling climate change impact on

Septoria tritici Blotch (STB) in France Accounting for climate model and disease model

uncertainty. Agricultural and Forest Meteorology, 170:242.252.

GrapheAgri 2016. Céréales - Agreste :120-127.

http://agreste.agriculture.gouv.fr/IMG/pdf/Gaf16p120-131.pdf

GrapheAgri 2016. Céréales - Agreste :117-128.




Références

100

Gurung S., Goodwin S.B., Kabbage M., Bockus W., et B. Adhikari T. 2011. Genetic

Differentiation at Microsatellite Loci Among Populations of Mycosphaerella graminicola

from California, Indiana, Kansas, and North Dakota. Phytopathology, 101: 1251-1257.

Hailu E., et Woldeab G. 2015. Survey of Rust and Septoria Leaf Blotch Diseases of Wheat in

Central Ethiopia and Virulence Diversity of Stem Rust Puccinia graminis f. sp. tritici.

Advances in Crop Sciences Technology, (3):2.

Halama P. 1996. The occurrence of Mycosphaerella graminicola, teleomorph of Septoria tritici

in France. Plant Pathology, 45: 135-138.

Hanson S. 2016. Tunisia Grain and Feed Annual. USDA Foreign Agricultural service, GAIN

Report Number: 1-8.

Harrabi M., et Cherif M. 1990. Diagnostic des maladies de grandes cultures. Document

technique de l’INAT, 50.

Harrat W., and Bouznad Z. 2018. Prevalence, cultural and pathogenic characterization of

Zymoseptoria tritici, agent of wheat septoria leaf blotch, in Algeria. African Journal of

Agricultural Research, 13(40): 2146-2153.

Hartman F.E. 2017. Population Genomics of adaptation in the fungal wheat pathogen

Zymoseptoria tritici. Thèse de Doctorat, ETH Zurich.

Henze M., Beyer M., Klink H., et Verreet J.A. 2007. Characterizing Meteorological Scenarios

Favorable for Septoria tritici Infections in Wheat and Estimation of Latent Periods. Plant

disease, 91(11):1445-1449.

Hunter T., Coker R.R., et Royle D.J. 1999. The teleomorph stage, Mycosphaerella graminicola,

in epidemics of Septoria tritici blotch on winter wheat in the UK. Plant Pathology, 48:

51–57.

Holloway G.2014. Septoria tritici blotch of wheat. DEPI Information Note Series May 2014. 2

p. Department of Environment and Primary Industries (DEPI), Melbourne, Australia.

Jilbene, 1996. Etat des recherches sur la septoriose au Maroc. Proceeding du Symposium

régional sur les Maladies des céréales et les Légumineuses Alimentaires Edit. INRA

Rabat, 11-14.

Johnson R.1992. Past, present and future opportunities in breeding for disease resistance, with

examples from wheat. Breeding for disease resistance. Springer: 3-22

Jürgens T., Linde C.C., and McDonald B.A. 2006. Genetic structure of Mycosphaerella

graminicola populations from Iran, Argentina and Australia. European Journal of Plant

Pathology 115: 223-233.

Références

101

Kabbage M., Leslie J.F., Zeller K.A., Hulbert H., et Bockus W.W. 2008. Genetic diversity of

Mycosphaerella graminicola, the causal agent of Septoria tritici blotch, in Kansas winter

wheat. Jounral of Agricultural, Food and Environmental Sciences, 2 (1):1934-7235.

Karisto P., Hund A., Yu K., Anderegg J., Walter A., Mascher F., McDonald B.A, et

Mikaberidze A. 2017. Ranking quantitative resistance to Septoria tritici blotch in elite

wheat cultivars using automated image analysis. bioRxiv: 3-44.

Kellner R., Bhattacharyya A., Poppe S., Hsu T.Y. et al. 2014. Expression Profiling of the Wheat

Pathogen Zymoseptoria tritici Reveals Genomic Patterns of Transcription and Host-

Specific Regulatory Programs. Genome Biology and Evaluation. 6(6):1353–1365.

Kema G.H.J., Annone J.G., Sayoud R., Van Silfhout C.H, Van Ginkel M., and De Bree J. 1996

a. Genetic variation for virulence and resistance in the wheat–Mycosphaerella graminicola

pathosystem I. Interactions between pathogen isolates and host cultivars. Phytopathology,

86: 200- 212.

Kema, G.H.J., Sayoud R., Annone, J.G., Silfhout C.H. van. 1996 b. Genetic variation for

virulence and resistance in the wheat-Mycosphaerella graminicola pathosystem II.

Analysis of interactions between pathogen isolates and host cultivars Phytopathology 86,

213-220. Kronstard, J.W., et Staben,C. 1997. Mating type in filamentous fungi. Annual

Review of Genetics. 31:245-276.

Kema, G.H.J., Verstappen, E.C.P., Todorova, M., and Waalwijk, C. 1996. Successful crosses

and molecular tetrad and progeny analyses demonstrate heterothallism in Mycosphaerella

graminicola. Curr. Genet. 30: 251-258.

Kema G.H.J., et Van Silfhout C.H. 1997. Genetic variation for virulence and resistance in the

wheat–Mycosphaerella graminicola pathosystem III. Comparative seedling and adult plant

experiments. Phytopathology, 87:266-272.

Kema G. H. J., Goodwin S. B., Hamza S., Verstappen E. C. P ET AL. 2002. A Combined AFLP

and RAPD Genetic Linkage Map of Mycosphaerella graminicola, the Septoria tritici Leaf

Blotch Pathogen of Wheat. Genet., 161: 1497–1505.

Kema G.H.J., Gohari A.M., Aouini L., Gibriel H.A.Y, Ware S.B., et al. 2018. Stress and sexual

reproduction affect the dynamics of the wheat pathogen effector AvrStb6 and strobilurin

resistance. Nature Genetics, 50:375-380.

Kettles G.J., et Kanyuka K. 2016. Dissecting the Molecular Interactions between Wheat and

the Fungal Pathogen Zymoseptoria tritici. Frontiers in plant sciences, 7(508): 1-7.

Références

102

Kidane Y.G., Hailemariam B.N., Mengistu D.K., Fadda C., Pè M.E., et Dell’Acqua M. 2017.

Genome-Wide Association Study of Septoria tritici Blotch Resistance in Ethiopian

Durum Wheat Landraces. Frontiers in plant sciences, 8:1-3.

Krupinsky J. M., and Tanaka D.L. 2001. Leaf Spot Diseases on Winter Wheat Influenced by

Nitrogen, Tillage, and Haying after a Grass–Alfalfa Mixture in the Conservation Reserve

Lasram M. 2013. INRAT History: a hundred years serving Tunisian Agriculture. Annales de

l’INRAT, Numéro Spécial Centenaire, 86 :6-42.

Leslie J.F., Klein K.K. 1996. Female fertility and mating type effects on effective population

size and effective population size and evolution in filamentous fungi. Genetics, 144:557-

567.

Linde C.C., Zhan J., McDonald B.A. 2002. Population structure of Mycosphaerella

graminicola: from lesions to continents. Phytopathology, 92: 946-955.

Ltifi A., et Sakkouhi L. 2008. La septoriose du blédur : Résistance Variétale et impact de la

maladie sur le rendement. Annales de l’INRAT :76-84.

Lounis-Lalou F. 2005. Bilan d’activité 2004/2005. Amélioration des céréales. Ferme

expérimentale de démonstration et production de semences d’Oued Smar, ITGC, 35.

Lawson J. 2016. daewr: Design and Analysis of Experiments with R. R package version 1:1-7.

https://CRAN.R-project.org/package=daewr

Macauley H. 2015. Document de référence : Les cultures céréalières : riz, maïs, millet, sorgho

et blé. Nourrir l’Afrique. Centre international de référence Abdou Diouf :1-13.

Madariaga B.R.1986. Occurrence in Chile of Mycosphaerella graminicola (Fuckel) Schroeter,

teleomorph of Septoria tritici Rob. Ex Desm. Agricultura Tecnica,46, 209-211.

Mamluk A.F., Gilchrist D.G., et Singh M. 1995. Variartion in virulence in isolates of

Mycrosphaerella graminicola from six geographical wheat growing regions.

Phytopathology. Medit, 34:45-51.

Marshall R., Kombrink A., Motteram J., Loza-Reyes E., et al. 2011. Analysis of two in planta

expressed LysM effector homologs from the fungus Mycosphaerella graminicola reveals

novel properties and varying contricbution to virulence on wheat. Plant physiology,

156(2): 756-769.

Mazzouz H., Saadaoui M., Jilbène M., Lyamani A. 1995. Importance des septorioses du blé au

Maroc en 1991. Al Awamia, 91 :63-69.

McDonald B.A., Martinez J.P., 1990. Restriction fragment length polymorphisms in Septoria

tritici occur at a high frequency. Current Genetics, 17:133–138.

https://cran.r-project.org/package=daewr

Références

103

McDonald B.A., Pettway R.E., Chen R.S., Boeger J.M., Martinez, J.P. 1995. The population

genetics of Septoria tritici (teleomorph Mycosphaerella graminicola). Canadien Journal

of Botany, 73:292-301.

McDonald B.A. 1997. The Population Genetics of Fungi: Tools and Techniques.

Phythopathology, 87(4):448-453.

McDonald B.A., Zhan J., et Burdon J.J. 1999. Genetic Structure of Rhynchosporium secalis in

Australia. Ecologie and Population Biology, 89(8): 639-644

McDonald B.A., Linde C.C. 2002. The population genetics of plant pathogens and breeding

strategies for durable resistance. Euphytica, 124: 163-180.

McDonald B.A. 2014. Using dynamic diversity to achieve durable disease resistance in

agricultural ecosystems. Tropical Plant Pathology, 39(3):191-196.

McDonald B.A. 2015. How can research on pathogen population biology suggest disease

management strategies? The example of barley scaled (Rhynchosporium commune). Plant

Pathology, 64: 1005-1013.

McDonald B.A., et Mundt C.C. 2016. How knowledge of Pathogen Population Biology Informs

Management of Septoria Tritici Blotch. Phytopathology, 106(09): 948-955.

Meamiche H.N., Aouini L., Bouznad Z., Gerrit H.J. 2018. Equal distribution of mating type

alleles and the presence of strobilurin resistance in Algerian Zymoseptoria tritici field

populations. Plant Disease :1-27.

Medini M., and Hamza S. 2008. Pathotype and molecular characterization of Mycosphaerella

graminicola isolates collected from Tunisia, Algeria, and Canada. Journal of Plant

Pathology, 90:65–73.

Medini M., Ferjaoui S., Bahri B., Mhri W., Hattab S., Hamza S. 2014. Bulk segregant Analysis

and marker-trait association reveal common AFLP markers for resistance to Septoria leaf

blotch in Tunisian old durum wheat. BASE Biotechnology, Agronomy, Society.

Environment,18(1):3-10.

Mizradi G.A.M., Ware S, Wittenberg H.J., Mehrabi R., et al. 2015. Effector discovery in the

fungal wheat pathogen Zymoseptoria tritici. Molecular Plant Pathology: 1-15.

Mojerlou S., Safaie N., Alizadeh A., Khelghatibana F. 2009. Measuring and modeling crop

loss of wheat caused by septoria leaf blotch in seven cultivars and lines in Iran. Journal

of Plant Protection Research 49: 257-262.

Morais D., Laval V., Sache I., et Suffert F. 2015. Comparative pathogenicity of sexual and

asexual spores of Zymoseptoria tritici (septoria tritici blotch) on wheat leaves. Plant

pathology:1-11.

Références

104

Morais D., Duplaix C., Sache I., Laval V., Suffert F., and Walker., A.S. 2019. Overall stability

in the genetic structure of a Zymoseptoria tritici population from epidemic to

interepidemic stages at a small spatial scale. European Journal of Plant Pathology.

doi.org/10.1007/s10658-018-01666-y.

Naouari M., Siah A., Elgazzah M., Reignault P., and Halama P. 2016. Mitochondrial DNA-

based genetic diversity and population structure of Zymoseptoria tritici in Tunisia.

European Journal of Plant Pathology,146:305-314.

Nasraoui B. 2008. Principales maladies fongiques des céréales et légumineuses en Tunisie,

Nei M.1973. Analysis of gene diversity in subdivided populations. Proceedings of the National

Academy of Sciences of the United States of America, 70: 3321-3323.

Nelson S.C., 1996. A Simple analysis of disease foci. Phytopathology, 86:332-339.

Odlibekov F., Armoniené R., Henriksson T., Chwade A. 2018. Proximal Phenotyping and

Machine Learning Methods to Identify Septoria Tritici Blotch Disease Symptoms in

wheat. Frontier in Plant Science, 9:1-11.

O’Driscoll A., Kildea S., Doohan F., Spink J., & Mullins E. 2014. The wheat–Septoria conflict:

A new front opening up? Trends in Plant Science, 19(9): 602-610.

Oğuz A.C., Ölmez F., and Karakaya A. Genetic Diversity of Net Blotch Pathogens of Barley

in Turkey. International Journal of Agriculture & Biology: 1814-9596.

Oufensou S., Balmas V., Scherm B., Rau D., Camiolo S. 2019. Genetic variability, chemotype

distribution, and aggressiveness of Fusarium culmorum on durum wheat in Tunisia.

Phytopathologia Mediterranea, 58:103-113.

Palma-Guerrero J., Torriani S.F.F., Zala M., Carter D., et al. 2016. Comparative transcriptomic

analyses of Zymoseptoria tritici strains show complex lifestyle transitions and

intraspecific variability in transcription profiles. Molecular Plant Pathology, 17(6), 845-

859.

Peakall R., and Smouse P.E. 2012. GenAlEx 6.5: genetic analysis in Excel. Population genetic

software for teaching and research-an update. Bioinformatics, 28:2537-2539.

Perrier X., and Jacquemoud-Collet J.P. 2006. DARwin6 software.

Pietravalle S., Shaw M.W., Parker S.R., et Van Den Bosch F. 2003. Modeling of relationships

between weather and Septoria tritici epidemics on winter wheat: a critical approach.

Phytopathology, 93, 1329–1339.

Plissonneau C., Benevenuto J., Mohd-Assaad N., Fouché S., Hartmann F. E., and Croll, D.

2017. Using population and comparative genomics to understand the genetic basis of

effector-driven fungal pathogen evolution. Frontiers in Plant Sciences, 8:119.

Références

105

Ponomarenko A., Goodwin S.B., and Kema G.H.J. 2011. Septoria tritici blotch (STB) of wheat

Septoria tritici blotch (STB) of wheat. Plant Heal. Instr. :1–7.

Poppe S. 2014. Host specialization in the fungal plant pathogen Zymoseptoria tritici.

Dissertation, Dem Fachbereich Biologie der Philipps-Universität Marburg vorgelegt von:

2-73.

Pritchard J.K., Stephens M., et Donnelly P. 2000. Inference of population structure using

multilocus genotype data. Genetics, 155: 945.

Quadvlieg W., Kema, G.H.J., Groenewald J.Z., Verkley, et al. 2011. Zymoseptoria gen. nov.:

a new genus to accommodate Septoria-like species occurring on graminicolous hosts.

Persoonia 26, 57–69.

Ramdani A., Halama P., Elbekali1 A.Y., Siah A., et al. 2011. Septoria tritici blotch of wheat in

Morocco: current status and perspective. 8th International Symposium on

Mycosphaerella and Stagonospora Diseases of Cereals Mexico City September.

Rapilly F. 1991. L’épidémiologie en pathologie végétale : mycoses aériennes. Institut National

de la recherche agronomique. Paris,11-36.

Rastoin J.L., et Ben Abderrazik H. 2014. Céréales et oléoprotéagineux au Maghreb : Pour un

co-développement de filières territorialisées. Tunisie : le poids des institutions. Editions

Institut de Prospective Economique du Monde Méditerranéen (IPEMED), Maroc, 37.

Razavi M., & Hughes G. 2004. Molecular variability of Mycosphaerella graminicola as

detected by RAPD markers. Journal of Phytopathology, 152(10), 543–548.

R Core Team. 2017. R: A language and environment for statistical computing. R Foundation

for Statistical Computing, Vienna, Austria. https://www.R-project.org/.

Ren J., Sun D., Chen L., You F.M., Peng Y., et al. 2013. Genetic Dversity revealed By Single

Nucleotide Polymorphism Markers in a Worldwide Germplasm Collection of Durum

Wheat. International Journal of Molecular Sciences, 14:7061-7088.

Rezgui S., Fakhfakh M.M., Boukef S., Rhaiem A., Chérif Mo., Chérif Ma et Yahyaoui A.H.

2008. Effect of common cultural practices on Septoria leaf blotch disease and grain yield

of irrigated durum wheat. Tunisian Journal of Plant Protection, 3: 59-67.

Ross McKenzie.1998. Wheat nutrition and fertiliser requirements-Nitrogen.

Roohparvar R. 2007. Drug transporters of the fungal wheat pathogen Mycosphaerella

graminicola. Thèse de doctorat, Université de Wageningen, Netherland, 182.

Rudd J.J, Kanyuka K., Hassani-Pak K., Derbyshire M., et al. 2015. Transcriptome and

Metabolite Profiling of the Infection Cycle of Zymoseptoria tritici on Wheat Reveals a

Biphasic Interaction with Plant Immunity Involving Differential Pathogen Chromosomal

https://www.r-project.org/

Références

106

Contributions and a Variation on the Hemibiotrophic Lifestyle Definition. Plant

Physiology, 167: 1158–1185

Russell V. Lenth. 2016. Least-Squares Means: The R Package lsmeans. Journal of Statistical

Software, 69(1): 1-33.

Saade M.E. 1996. Adoption and impact of high yielding wheat varieties in Northern Tunisia.

CIMMYT. Economics Working Paper 96-03. CIMMYT, Mexico D.F.

Saari E.E., Wilcoxcon R.D.1974. Plant situation of high-yielding dwarf wheats in Asia and

Africa. Annu.Rev. Phytopathology.12, 49-68.

Saari E.E, Prescott J.M.1975. A scale for appraising the foliar intensity of wheat diseases. Plant

Disease Reporter, 59:377-380.

Saidi A., Safaie N., and Palizi P. 2012. Study on mating types and sensitivity to strobilurin

fungicide in fungal wheat pathogen Mycosphaerella graminicola. Crop Protection, 1(4):

271-277.

Sánchez-Vallet A., McDonald M.C., Solomon P.S., McDonald B.A.2015. Is Zymoseptoria

tritici a hemibiotroph?. Fungal Genetics and Biology, 79:29-32.

Sanderson FR, 1972. A Mycosphaerella species as the ascogenous state of Septoria tritici

Rob.and Desm. New Zealand Journal of Botany,10 :707-709.

SAS Institute 2014. ‘JMP® 11 scripting guide.’ 2nd edn (SAS Institute Inc.: Cary, NC, USA)

Sayoud R., Ezzahiri B., et Bouznad Z. 1999. Les maladies de céréales et de légumineuses

alimentaires au Maghreb. I.T.G.C.

Sbei A., 2009. Contribution à l’étude de la variabilité de la résistance à la septoriose chez le blé

dur et la virulence chez Septoria tritici : Conséquences sur le rendement. Thèse de

Doctorat, Institut National Agronomique de Tunisie : 129.

Schneider F., Koch G., Jung C., and Verreet J. A. 2001. Genotypic diversity of the wheat leaf

blotch pathogen Mycosphaerella graminicola (anamorph) Septoria tritici in Germany.

European Journal. Plant Pathology, 107: 285-290.

Seifbarghi S., Razavi M., Aminian H., Zare R., and Etebarian H.E. 2009. Studies on the host

range of Septoria species on cereals and some wild grasses in Iran. Phytopathologia

Mediterranea, 48, 422–429

Siah A., Tisserant B., El Chartouni L., Duyme F., et al. 2010. Mating type idiomorph from

French population of the wheat pathogen Mycrosphaerella graminicola : widespread

equal distribution and low but distinct levels of molecular polymorphism. Fungal

Biology, 114: 980-990.

Références

107

Siah A., Reignault P., & Halama P.2013. Genetic diversity of Mycosphaerella graminicola

isolates from a single field. Communications in Agricultural and Applied Biological

Sciences, 78, 437.

Siah, A., cedex, L., Elbekali, A.Y., Ramdani, A., Reignault, P., Torriani, S.F.F., Brunner, P.C,

Halama P. 2015. QoI Resistance and Mitochondrial Genetic Structure of Zymoseptoria

tritici in Morocco. Plant Disease, 98 (8): 1138-1144.

Siah A., Bomble M., Tisserant B., Cadalen T., Holvoet M., Hilbert R., Reignault P., Halama P.

2018. Genetic structure of Zymoseptoria tritici in Northern France at region, field, plant

and leaf layer scales. Phytopathology :1-42.

Singh R.P., Singh P.K., Rutkoski J., Hodson D.P., He X., Jørgensen L.N., Hovmøller M.S. and

Huerta-Espino J. 2016. Disease Impact on Wheat Yield Potential and Prospects of

Genetic Control.

ŠÍP V., Chropava J., and Palicova J. 2015. Response of Selected Winter Wheat Cultivars to

Inoculation with different Mycosphaerella graminicola Isolates. Czech J. Genet. Plant

Breed., 51, 2015 (3): 86–95.

Simko I., Piepho H.P. 2012. The Area Under the Disease Progress Stairs: Calculation,

Advantage, and Application. Phythopathology, 102(4) : 381-389.

Slama A., Ben Salem M., Ben Naceur M., Zid E. 2005.Les céréales en Tunisie : production

effet de la sécheresse et mécanismes de résistance. Sécheresse, 16, (3) :225-229.

Somai-Jemmali L. 2015. Stimulateurs des défenses naturelles du blé dur en Tunisie et du blé

tendre en France contre la septoriose causée par Zymoseptoria tritici. Thèse de Doctorat

en cotutelle INAT-ULCO.

Somai-Jemmali L., Randoux B., Siah A., Magnin-Robert M., et al. 2016. Similar infection

process and induced defense patterns during compatible interactions between

Zymoseptoria tritici and both bread and durum wheat species. European Journal of plant

pathology,

Steinberg G. 2015. Cell Biology of Zymoseptoria tritici. Pathogen cell organization and wheat

infection. Fungal Genetic and Biology, 79 :17-23.

Stewart T.M., Perry A.J., and Evans, M.J. 2014. Resistance of Zymoseptoria tritici to

azoxystrobin and epoxiconazole in the lower North Island of New Zealand. New Zealand

Plant Protection, 67: 304-313.

Stukenbrock E.H., Banke S., Javan-Nikkhah M., and McDonald B. A. 2007. Origin and

domestication of the fungal wheat pathogen Mycosphaerella graminicola via sympatric

speciation. Mol Biol Evol. 24:398–411.

Références

108

Stukenbrock E. H., Frank G. J., Marcello Z., Hansen T.T., McDonald B.A., Schierup M.H.

2010. Whole-Genome and Chromosome Evolution Associated with Host Adaptation and

Speciation of the Wheat Pathogen Mycosphaerella graminicola. Recent Genome

Evolution of M. graminicola. PLoS Genetics, 6 (12) :1-10.

Stukenbrock E.H., Bataillon T., Dutheil J.Y., Hansen, T.T., et al. 2011. The making of a new

pathogen: insights from comparative population genomics of the domesticated wheat

pathogen Mycosphaerella graminicola and its wild sister species. Genome Res. 21:2157-

2166.

Suffert F., et Sache I. 2011. Relative importance of different types of inoculum to the

establishment of Mycosphaerella graminicola in wheat crops in north-west Europe. Plant

Pathology,60: 878-889.

Suffert F., Sache I., Lannou C. 2013. Assessment of quantitative traits of aggressiveness in

Mycosphaerella graminicola on adult wheat plants. Plant Pathology, 62:1330-1341.

Suffert F., Ravigné V., et Sache I. 2015. Can short-term selection for fitness traits in a fungal

plant pathogen be driven by seasonal changes? A case study in the wheat pathogen

Zymoseptoria tritici. Appl. Environ. Microbiol:1-27.

Suffert F., Morais D., Delestre G., Gélisse S., Laval V., et Sache I. 2016. Investigation of the

mechanisms of sexual reproduction in Zymoseptoria tritici and their consequences on

STB dynamics. INRA BIOGER, ISSDC9 Paris.

Suffert F., Delestre G., Gélisse S.2018. Sexual Reproduction in the Fungal Foliar Pathogen

Zymoseptoria tritici Is Driven by Antagonistic Density Dependence Mechanisms.

Microbial Ecology.

Sun X., Kang,S., Zhang Y., Tan X., Yu Y., et al. 2013. Genetic diversity and population

structure of rice pathogen Ustilaginoidea virens in China. PLoS ONE, 8(9), e76879.

Taher K., Graf S., Fakhfakh M.M., Salah H.B.H., et al. 2014. Sensitivity of Zymoseptoria tritici

Isolates from Tunisia to Pyraclostrobin, Fluxapyroxad, Epoxiconazole, Metconazole,

Prochloraz and Tébuconazoles. Journal of Phytopathology, 162:442-448.

Thach T., Ali S., Vallavieille-Pope C., Justesen A.F., et Hovmøller M.S. 2016. Worldwide

population structure of the wheat rust fungus Puccinia striiformis in the past. Fungal

Genetics and Biology, 87 :1-8.

Takele A., Lencho A., W/Ab G., Hailu E., Kassa B. 2015. Status of Wheat Septoria Leaf Blotch

(Septaria tritici Roberge in Desmaz) in South West and Western Shewa Zones of Oromiya

Regional State, Ethiopia. Research in Plant Sciences, 3(3): 43-48.

Références

109

Teferi T.A., Gebreslassie Z.S. 2015. Occurrence and intensity of wheat Septoria tritici blotch

and host response in Tigray, Ethiopia. Crop protection, 68:76-71.

Torriani S.F.F., Brunner P.C., McDonald B.A., & Sierotzki H. 2009. Qoi resistance emerged in

dependently at least 4times in European populations of Mycosphaerella graminicola. Pest

Management Science, 65(2), 155–162.

Torriani S.F.F., Melichar J.P.E., Mills C., Pain N., Sierotzki H., et Courbot M. 2015.

Zymoseptoria tritici: A major threat to wheat production, integrated approaches to

control. Fungal Genetics and Biology 79: 8–12.

Tunisian Ministry of Agriculture Water Resources and Fisheries. 2015. Statistics Service of the

General Direction of Agricultural Production, Ministry of Agriculture, Water Resources

and Fishing, Tunis, Tunisia.

Ünal G., Kayim M., Ay T., et Yones A. 2017. Biological Control Research Institute, Yüreğir,

Adana, Turkey. Turkish Journal of Agriculture and Forestry:1-9.

Waalwijk C., Mendes O., Verstappen E.C.P., de Waard M.A, et Kema G.H.J. 2002. Isolation

and characterization of the mating type idiomorphs from the wheat septoria leaf blotch

fungus Mycosphaerella graminicola. Fungal Genetics and Biology, 35 :277-286.

Valade R., Vitry C., Leilte S., Stragaliati J., Senellart P., et al. 2010. Constitution d’une

mycothèque des champignons pathogènes du blé tendre et mise au point d’outils

permettant la caractérisation et la quantification de ces espèces. FSOV :1-13.

Väli Ü., Einarsson A., Waits L., & Ellegren H. 2008. To what extent do microsatellite markers

reflect genome‐wide genetic diversity in natural populations? Molecular ecology, 17(17),

3808-3817.

Van Beuningen L.T., et Kohli M.M. 1990. Deviation from the regression of infection heading

and height as a measure of resistance to septoria tritici blotch in wheat. Plant dis.74

(7):488-493.

Ware B.S. 2006. Aspects of sexual reproduction in Mycosphaerella species on wheat and barley

genetic studies on specificity, mapping, and fungicide resistance. Thèse de Doctorat,

Wageningen niversity.

Welch T., Feechan, A., et Kildea, S. 2017. Effect of host resistance on genetic structure of core

and accessory chromosomes in Irish Zymoseptoria tritici. Eur. J. Plant Pathology. DOI

10.1007/s10658-017-1259-9.

Yahyaoui A., Hakim S., Al-Naimi M., Nachit M.M .2000. Multiple disease resistance in durum

wheat (Triticum turgidum L. var. durum). p. 387-392. In Royo C, Nachit M, Di Fronzo

N, Araus JL (eds.). Durum wheat improvement in the Mediterranean region: New

Références

110

challenges. CIHEAM, Zaragoza, Spain. Options Méditerranéennes. Série A : Séminaires

Méditerranéens ; n. 40.

Zadoks J.C., Chang T.T, Konzak C.F. 1974. “A decimal code for the growth stages of cereals,”

Weed Research, 14 (6): 415-421.

Zapata L., Pena Chocarro L., PerezJorda G., Stika H.P. 2004. Early Neolithic Agriclture in the

Iberian Peninsula. Journal of world Perihistory 18:283-325

Zahri S., Farih A, Douira A. 2014. Statut des principales maladies cryptogamiques foliaires du

blé au Maroc en 2013. J. Appl. Biosci: 6543-6549.

Zahri S., Farih A., Badoc A., Douira A. 2008. Importance des septorioses dans les champs de

blés Marocains. Bull. Soc. Pharm. Bordeaux, 147: 29-38

Zhan J., Mundt C.C., Mc Donald B.A. 1998. Measuring immigration and sexual reproduction

in field of Mycosphaerella graminicola. Phytopathology. 88:1330-1337.

Zhan J., Mundt C., Hoffer M., & McDonald B.A. 2002. Local adaptation and effect of host

genotype on the rate of pathogen evolution: An experimental test in a plant pathosystem.

Journal of Evolutionary Biology, 15(4): 634-647.

Zhan J., Pettway R.E., McDonald BA. 2003. The global genetic structure of the wheat pathogen

Mycosphaerella graminicola is characterized by high nuclear diversity, low

mitochondrial diversity, regular recombination, and gene flow. Fungal Gene. Biol.

38:286-297.

Zhan J., et McDonald B.A. 2004. Global genetic structure in natural population of

Mycosphaerella graminicola. Phytopathology, 91:12-14.

Zhang X., Haley S.D, Jin Y. 2001. Inheritance of Septoria Tritici Blotch Resistance in Winter

Wheat. Crop Sciences, 41:323–326.

Productions Scientifiques

111

Productions scientifiques

Articles scientifiques

Bel Hadj Chedli, R., Ben M’Barek, S., Yahyaoui, A., Kehel, Z., Rezgui, S.2018. Occurrence

of Septoria tritici blotch (Zymoseptoria tritici ) disease on durum wheat, triticale, and bread

wheat in Northern Tunisia. Chliean Journal of Agricultural Research, 78(4):559-568. (Publié)

Bel Hadj Chedli R., Aouini, L., Ben M’Barek S., Yahyaoui, A., Rezgui, S., et Chaabène, H.

2019. Distribution of mating types in Zymoseptoria tritici populations collected from bread

wheat at El Haouaria region. Journal of New sciences, 61(5) : 3892-3898. (Publié)

Bel Hadj Chedli R., Ben M’Barek S., Souissi, A., Yahyaoui, A., Rezgui, S., et Chaabène, H.

2019. Screening for resistance of Tunisian, Moroccan and Algerian wheat cultivars to

Zymoseptoria tritici in Northern Tunisia. (Soumis dans: Journal of Plant Pathology)

Bel Hadj Chedli R., Aouini L., Ben M’Barek S., Bochra Bahri A., Verstappen E, Gerrit K.H.J.,

Rezgui S, Yahyaoui A., Chaabane H. 2019. Genetic differentiation between ‘Zymoseptoria

tritici’ populations sampled from bread wheat in Tunisia revealed by SSR markers. (Soumis

dans: European Journal of Plant Pathology)

Conférences:

Bel Hadj Chedli R., Akrouti, W., Yahyaoui, A., Rezgui, S. Incidence evaluation of

Zymoseptoria tritici in treated and untreated durum wheat fields in Northern Tunisia.

13thEuropean conférence on fungal genetics ECFG13, Paris, April 3-6,2016.

Bel Hadj Chedli R., Yahyaoui, A., Rezgui, S. Distribution de la septoriose chez le blé tendre

selon les étages bioclimatiques en Tunisie. Conférence scientifique internationale sur

l’environnement et l’agriculture, Hammamet, 24 et 25 Avril 2017.

Bel Hadj Chedli R., Aouini, L., Ben M’Barek S., Bahri, B.A., Els, V., Gerrit, K.H.J.,Yahyaoui,

A., Rezgui, S., et Chaabène, H. 2019. High genetic diversity among Zymoseptoria tritici isolates

from bread wheat in Northern Tunisia. The International Symposium on Cereal Leaf Blights

2019 in University College Dublin 22 -24 May 2019.

Annexes

112

Annexes

Annexes

113

Annexe 1

Table 1. Haploid allele frequencies and sample size by population

Locus Allele Bizerte Goubellat El Haouaria Oued Zarga

ST4 N 8 3 137 13

185 0.000 0.000 0.015 0.000

187 1.000 0.667 0.672 1.000

189 0.000 0.333 0.270 0.000

191 0.000 0.000 0.044 0.000

ST3A N 8 3 135 13

229 0.000 0.333 0.007 0.000

231 0.750 0.333 0.319 0.000

233 0.000 0.000 0.022 0.000

235 0.000 0.000 0.044 0.000

243 0.000 0.000 0.022 0.000

245 0.125 0.000 0.081 0.000

247 0.125 0.333 0.215 1.000

249 0.000 0.000 0.148 0.000

251 0.000 0.000 0.111 0.000

253 0.000 0.000 0.030 0.000

ST9 N 7 3 137 12

332 0.000 0.000 0.015 0.000

340 1.000 0.667 0.810 1.000

342 0.000 0.000 0.015 0.000

344 0.000 0.333 0.153 0.000

346 0.000 0.000 0.007 0.000

ST6 N 8 3 136 13

164 0.000 0.000 0.029 0.000

167 0.375 1.000 0.831 1.000

170 0.625 0.000 0.110 0.000

173 0.000 0.000 0.022 0.000

185 0.000 0.000 0.007 0.000

ST7 N 5 3 136 13

Annexes

114

169 0.400 0.000 0.412 0.000

177 0.000 0.000 0.007 0.000

181 0.000 0.000 0.007 0.000

183 0.600 0.667 0.382 1.000

185 0.000 0.333 0.037 0.000

197 0.000 0.000 0.103 0.000

199 0.000 0.000 0.007 0.000

209 0.000 0.000 0.015 0.000

211 0.000 0.000 0.029 0.000

ST3C N 8 3 136 13

229 0.625 0.667 0.559 0.000

238 0.000 0.000 0.007 0.000

244 0.125 0.333 0.426 1.000

247 0.250 0.000 0.007 0.000

ST2 N 6 3 136 10

344 0.000 0.000 0.007 0.000

350 0.167 0.667 0.213 0.000

353 0.667 0.000 0.294 0.000

356 0.000 0.000 0.338 0.000

359 0.167 0.333 0.140 1.000

365 0.000 0.000 0.007 0.000

ST1 N 8 3 137 13

190 0.375 0.333 0.161 0.000

193 0.625 0.667 0.818 1.000

196 0.000 0.000 0.015 0.000

217 0.000 0.000 0.007 0.000

ST5 N 6 3 134 8

207 0.000 0.000 0.007 0.000

243 0.000 0.000 0.082 0.000

246 0.000 0.000 0.052 0.000

249 0.833 1.000 0.836 1.000

252 0.167 0.000 0.022 0.000

ST10 N 7 3 138 13

137 0.000 0.000 0.007 0.000

Annexes

115

146 0.000 0.333 0.036 0.000

149 0.429 0.333 0.167 0.000

152 0.571 0.333 0.681 1.000

155 0.000 0.000 0.094 0.000

158 0.000 0.000 0.014 0.000

ST12 N 8 3 135 12

221 0.000 0.000 0.007 0.000

224 1.000 1.000 0.941 1.000

227 0.000 0.000 0.015 0.000

230 0.000 0.000 0.037 0.000

ST3B N 6 3 137 11

260 0.333 0.333 0.934 1.000

263 0.333 0.000 0.000 0.000

269 0.333 0.667 0.007 0.000

272 0.000 0.000 0.058 0.000

N: Allele number

Table 2. Summary of private alleles by population

Population Locus Allele Frequency

Bizerte ST3B 263 0.333

El Haouaria ST4 185 0.015


El Haouaria ST3A 233 0.022


















El Haouaria ST3C 238 0.007

Annexes

116















El Haouaria ST3B 272 0.058

Annexes

117

Annexe 2

Iseptons Stb genes

1 Stb 1- Stb 4- Stb 10- Stb 17



4 Stb 7- Stb 10- Stb 17

5 Stb 9- Stb 10- Stb 17

6 Stb 4- Stb 10

7 Stb 10

8 Stb 7- Stb 9

9 Stb 7- Stb 8-Stb 9- Stb 17

10 Stb 4- Stb 8-Stb 9- Stb 11

11 Stb 7

12 Stb 1- Stb 4- Stb 7- Stb 8- Stb17


14 Stb 4- Stb 7- Stb 8

15 Stb 4- Stb 7

15 Stb 9

16 Stb 1- Stb 9

17 Stb 1- Stb 7- Stb 17

18 Stb 11- Stb 17

19 Stb 10- Stb 11- Stb 17

20 Stb 7- Stb 17

21 Stb 3- Stb 7- Stb 17

22 Stb 11- Stb 17

23 Stb 1- Stb 4- Stb 17


25 Stb 1- Stb 9

26 Stb 4

27 Stb 7

28 Stb 7- Stb 10- Stb 17


30 Stb 1- Stb 3- Stb 4- Stb 7- Stb 9- Stb

17

31 Stb 4- Stb 9- Stb 17

32 Stb 4- Stb 7- Stb 9- Stb 11-Stb17

33 Stb 1- Stb 4- Stb 7- Stb 10- Stb 17


Annexes

118




38 Stb 4- Stb 6- Stb 17


40 Stb 3- Stb 4- Stb 7 Stb 10- Stb 17

41 Stb 9- Stb 11


43 Stb 1- Stb 4- Stb 7- Stb 8-




47 Stb 9- Stb 10

48 Stb 1- Stb 7

Annexes

119

Annexe 3

Annexe 3. Meteorological data (temperature and rainfall) over different regions Cap Bon area, Beja during

2016-2017 (A, B, respectively) and during 2017-2018 cropping seasons (C, D, respectively).

A C

C D

Annexes

120

559CHILEAN JOURNAL OF AGRICULTURAL RESEARCH 78(4) OCTOBER-DECEMBER 2018

RESEARCH

Occurrence of Septoria tritici blotch (Zymoseptoria tritici) disease on durum wheat, triticale, and bread wheat in Northern TunisiaRim Bel Hadj Chedli1, Sarrah Ben M’Barek2, Amor Yahyaoui3*, Zakaria Kehel4, and Salah Rezgui1

1National Agronomic Institute of Tunisia (INAT), 43 Avenue Charles Nicolle, 1002 Tunis, Tunisia.2Regional Field Crop Research Center of Beja (CRRGC) BP 350, 9000 Beja, Tunisia.3Centro Internacional de Mejoramiento de Maíz y Trigo (CIMMYT), km 45 Carretera México-Veracruz El Batán, Texcoco, Estado de México, México. *Corresponding author ([email protected]).4International Center for Agricultural Research in the Dry Areas (ICARDA), Rue Hafiane Cherkaoui, Agdal Rabat Po Box 6299 PC: 10112, Morocco

Received: 13 August 2018; Accepted: 19 October 2018; doi:10.4067/S0718-58392018000400559

ABSTRACT

Wheat (Triticum aestivum L.) is the most important cereal crop in Tunisia, nonetheless production is highly affected by drought and diseases mainly Septoria tritici blotch (STB) caused by Zymoseptoria tritici (Roberge ex Desm.) Quaedvl. & Crous anamorph and Mycosphaerella graminicola (Fuckel) J. Schröt. 1894 teleomorph; that has become an inherent disease of durum wheat (Triticum turgidum L. subsp. durum (Desf.) van Slageren) but rarely observed on bread wheat (Triticum aestivum L. subsp. aestivum) and on triticale (×Triticosecale spp.) The main objective of this work was to study the prevalence and geographical distribution of Z. tritici on triticale, durum wheat and particularly on bread wheat in different cereal growing regions of North and Northwestern Tunisia to confirm its presence/absence on bread wheat. For this study, 126 wheat fields were surveyed in North and Northwestern Tunisia during 2015-2016 and 2016-2017 cropping seasons. STB on durum wheat was present in the majority of inspected durum wheat fields, where high mean incidence (60%) and severity (40%) were recorded at Jendouba, Bizerte, Beja, and Kef. The survey data revealed low risk on bread wheat with an incidence of 23% and 29% at Bizerte and Beja, respectively. However high incidence of 84% and 52% was recorded at Cap Bon in 2016 and 2017, respectively and mainly at El Haouaria where STB severity was relatively high on bread wheat landrace of unknown origin but called by local farmers as ‘Farina arbi’. Sporadic incidence was recorded on Triticale of 100% at Jendouba (in 2016), and 33% at Bizerte (in 2016 and 2017) and absence at all other surveyed sites; likewise for severity at same locations where 13% and 42% were recorded in 2016. The survey data revealed low risk on bread wheat except at El Haouaria where STB severity was relatively high on a bread wheat landrace; while it was considered as high risk at all durum wheat fields in Beja, Bizerte, Jendouba, Zaghouan and Kef regions, such distinct occurrence could lead to clarify host specificity in Z. tritici.

Key words: Farina Arbi, survey, Triticum, Tunisia, wheat, Zymoseptoria.

INTRODUCTION

The cereal sector is of major economic importance in Tunisia. It provides major staple food commodities for most Tunisian households. Cereals are cultivated on almost one third of agricultural land (1.5 million hectares) (Tunisian Ministry of Agriculture, Water Resources and Fishing, 2015), 58% are located in the Northern and Western regions where durum wheat (Triticum turgidum L. subsp. durum (Desf.) van Slageren) represents 54%, against 36% for bread wheat (Triticum aestivum L. subsp. aestivum) and 10% for barley (FAO, 2017). Average production is around 1.05 million tons, which


represent approximately 80% of the country needs (Gharbi et al., 2000). However, cereal production in Tunisia faces many challenges of which drought is the most limiting abiotic stress in semi arid zones (Slama et al., 2005), while biotic stress, mainly leaf rust and Septoria tritici blotch (STB), cause important yield losses particularly on durum wheat in sub-humid regions (Ben Mohamed et al., 2000; Gharbi et al., 2000) of North and Northwestern Tunisia. STB caused by the ascomycete fungus Zymoseptoria tritici (Roberge ex Desm.) Quaedvl. & Crous became more important in Tunisia since the introduction of early maturing, semi dwarf, high yielding varieties. It has become an inherent disease of durum wheat, and thus a significant challenge for breeders to release varieties which combine good resistance and higher yields (Ammar et al., 2011). In contrast to durum wheat, bread wheat varieties grown in Tunisia are almost indemn of Septoria. High incidence of STB on durum compared to bread wheat in Tunisia suggests either an adaptation of Z. tritici isolates to durum rather than bread wheat (Yahyaoui et al., 2000) or high levels of resistance in bread wheat. The observed levels of resistance amongst cultivated bread wheat varies from year to year, most likely based on the environmental conditions and the dynamics of STB populations. Although Septoria was observed on durum wheat annually, up to now not much is known on the occurence of STB on bread wheat. Hence, the main objective of this paper was to study the prevalence and geographical distribution of Z. tritici on Triticum species and particularly on T. aestivum in different cereal growing regions of North and Northwestern Tunisia to eventually confirm its presence/absence on bread wheat.

MATERIALS AND METHODS

Study area description and climatic conditions of the surveyed regionsSurveys were conducted during two cropping seasons (2015-2016; 2016-2017) at seven major wheat-growing areas in North and Northwestern Tunisia (Figure 1). Fifty-seven fields were surveyed in Cap Bon North (El Haouaria), Cap Bon South, Bizerte, Manouba, Beja, and Jendouba during 2016 and sixty-nine fields were surveyed in Cap Bon regions, Bizerte, Manouba, Beja, Jendouba, Zaghouan, and Kef during 2017 (Figure 1). Certain varieties were more predominant than others rendering therefore inter region comparison rather difficult to make. Meteorological data (temperature and rainfall, Table 1) and geographical coordinates (altitude, longitude and latitude, Table 2) over different climatic regions for each survey areas were recorded. The average rainfall varied from 500 to 800 mm and the temperature ranged between 6 and 33 °C in the sub-humid region (Cap Bon North, Bizerte and Beja). Precipitation and temperature rates varied from 400 to 600 mm and from 5 to 37 °C respectively in the semi-arid regions (Cap Bon south, Manouba, Zaghouan, Jendouba, and Kef).

Figure 1. Map of Tunisia showing the location of survey areas across different climatic regions during 2016 and 2017 cropping seasons. Sub-humid: Cap Bon North (A), Bizerte (B) and Beja (C). Semi-arid region of Northern Tunisia: Cap Bon South (D), Manouba (E), Zaghouan (F), Jendouba (G), and El Kef (H).


Cereal crops The survey covered the major cereal growing areas in North and Northwestern Tunisia where commercial durum wheat varieties (‘Karim’, ‘Razzak’, ‘Maali’) occupy over 60% of the area compared to the introduced varieties (‘Saragola’, ‘Carioca’, ‘Sculpture’, ‘Soudaine’) that cover so far less than 10%. Commercial bread wheat varieties (‘Salambo’, ‘Utique’, ‘Haidra’) and introduced varieties (‘Zanzibar’) occupy no more than 20% of the area; while triticale (‘Bienvenue’ and others) covers about 1%-3%; the rest of the area is covered by barley and oats. A unique situation in Cap Bon region where a landrace bread wheat (‘Farina arbi’) occupies over 60% of the area, the rest is covered by commercial barley, durum and bread wheat varieties. ‘Farina arbi’, a tall low yielding bread wheat (landrace) of unknown origin is cultivated annually for over a century, according to local farmers, in the same region and exclusively used for pastry known as “Kaak”. The seed is maintained by local farmers and not commercialized. Bread wheat landrace (‘Farina arbi’) and Septoria tritici blotch (STB) differentials (comprised within CIMMYT’s ISEPTON) were phenotyped at experimental station of Bou Salem (Tunisia) under artificial inoculation with Zymoseptoria tritici ([Roberge ex Desm.)] Quaedvl. & Crous) populations sampled from durum wheat. Inoculation was performed at tillering stage using bulk isolates at a rate of 106 spores mL-1 according to Ferjaoui et al. (2015) with slight modifications.

Septoria leaf blotch disease assessmentField surveys were conducted during flowering stage of bread and durum wheat, each field was visited once. STB prevalence was assessed within and between regions based on number of fields surveyed and the presence/absence of Septoria at each location. The incidence was reported on this study based on Saari-Prescott modified “0-9” Cobb-scale (Saari and Prescott, 1975). In this survey, we designed five field classes (Table 3) to assess STB within each region where prevalence, severity and incidence were the main criteria. The relative importance of STB was based on its prevalence at each location where incidence and severity were assessed and averaged at each surveyed field. In this study, prevalence

mm °CCap Bon North1 500-800 9-31Cap Bon South2 400-500 7-34Bizerte 600-800 7-33Beja 500-600 6-32Manouba 400-600 8-34Zaghouan 400-600 4-34Jendouba 400-500 5-37El Kef 300-400 2-38

Rainfall

1Cap Bon North: El Haouaria.2Cap Bon South: Soliman, Beni Khalled, and Grombalia.

Table 1. Climatic conditions of inspected regions during the survey period.

Regions

Weather conditions (range)

Temperature (min-max)

Table 2. Geographical coordinates of inspected regions during the survey period.

m a.s.l. Bizerte 16-354 09°03’1” 09°69’83” 32°50’56” 37°14’12”Cap bon North1 11-876 10°02’73” 10°10’95” 36°52’41” 36°67’82”Cap bon South2 24-446 10°45’27” 10°49’10” 36°47’47” 36°92’68”Manouba 58-244 09°59’1” 09°91’41” 36°30’70” 36°85’04”Zaghouan 81-320 09°45’43” 10°4’42” 36°21’18” 36°30’53”Beja 18-290 09°09’01” 10°78’62” 36°22’26” 36°68’31”Jendouba 21-341 08°32’35” 08°42’45” 36°28’4” 36°32’48”Kef 100-327 08’39°12” 08°48’50” 36°22’26” 36°11’44”

TreatmentsAltitude(range)

Longitude (N)(range)

Latitude (E)(range)

1Cap Bon North: El Haouaria.2Cap Bon South: Soliman, Beni Khalled, and Grombalia.m a.s.l.: Meters above sea level.


indicates how wide spread is STB, whereas incidence conveys information on the risk of the disease within a severity range. In the survey protocol of the CIMMYT septoria phenotyping platform four classes (Class I-V) were adopted. Class I: Low prevalence (%), severity (0-9), and low incidence indicating insignificant risk. Class II: low prevalence and incidence indicating low risk. Class III: moderate prevalence and incidence indicating moderate risk to be monitored. Class IV: fields where STB was wide spread and apparent high severity observed at flag leaf, indicating high risk of the disease. Class V: includes fields heavily infested by STB; situation where the disease is obvious at each field surveyed and where the severity is at its most, i.e. severe symptom on flag leaf and spikes, this is a situation where STB is a high risk. Relevant agronomic data such as variety name, sowing date, fertilization, crop density and spatial pattern and previous crops were recorded. Altitude, longitude and latitude were also recorded using Global Positioning System (GPS).

Data analysisLinear mixed model was used to analyze disease data (incidence and severity) collected during the survey using ASReml-R software (Gilmour et al., 2002). The years, regions, species, varieties together with their interactions were assumed to be fixed.

RESULTS

Incidence of wheat Septoria tritici blotchSurvey results showed that STB incidence on bread wheat was very limited across surveyed areas in Northern Tunisia Triticum species and wheat varieties identified during the survey during the two cropping seasons are presented in Table 4. STB prevalence during the two cropping seasons (2015-2016 and 2016-2017) was insignificant to low on commercial bread wheat varieties in the majority of the surveyed regions (Tables 5 and 6). It was ranked as class I or II except at

I 0-10 0-3 0-2 InsignificantII 10-20 3-5 2-3 LowIII 20-40 5-6 3-5 ModerateIV 40-60 6-8 5-7 HighV 60-100 8-9 7-9 Severe

Prevalence1

%

1(Number of infected fields (STB present)/total number of fields surveyed) × 100.2H: Level of plant infection.3Percentage of STB within each class level at surveyed field.

Table 3. Survey designated Classes for Septoria tritici blotch (STB) prevalence, severity and incidence.

Class

Severity2

(Cobb-Scale: 0-9)

SeverityH Incidence3

Table 4. Triticum species and wheat varieties identified during the survey during the two cropping seasons.

Bread wheat Zanzibar Bizerte Utique Bizerte, Beja, Zaghouan Haïdra Bizerte, Beja, Zaghouan Vaga Bizerte, Jendouba Salambo Cap Bon North (El Haouaria), Jendouba Bread wheat landrace Cap Bon North (El Haouaria)Durum wheat Karim Bizerte, Beja, Jendouba, Manouba, Cap Bon North, Cap Bon South, Kef Maali Bizerte, Beja, Cap Bon North, Cap Bon South, Jendouba, Manouba, Kef Razzak Bizerte, Beja, Cap Bon North, Cap Bon South, Jendouba, Zaghouan, Kef Monastir Cap Bon North Carioca Bizerte, Jendouba, Zaghouan Saragolla Bizerte Soudaine Bizerte Sculpture Bizerte, Beja, JendoubaTriticale TL4 Bizerte, Cap Bon North, Bienvenue Bizerte, Manouba

Species Varieties Surveyed regions


El Haouaria (region A, Figure 1) where prevalence and incidence were relatively high (Tables 5 and 6; Figures 2 and 4) putting it as class IV-V level (Table 3). Insignificant prevalence levels were recorded at Zaghouan, Bizerte, and Beja (Tables 5 and 6). Even though relatively high incidence was recorded at Bizerte, the severity was still low; hence it is of low to moderate risk (class II-III). The high incidence observed at Beja was only at 1 out of 2 fields surveyed, hence it is not quite representative and we considered it low. The mean disease incidence and severity on bread wheat landrace reached the maximum levels in 2016 with 84% and 52% respectively at El Haouaria (Figures 2 and 3). Same trend was observed in 2017, where over 77% and 32% disease incidence and severity respectively were recorded in the same region (Figures 4 and 5). Low STB incidence on bread wheat were recorded in 2016 on bread wheat fields at Bizerte 23% and

1Cap Bon South: Soliman, Beni Khalled, and Grombalia.2Prevalence: Number of infected field/number of surveyed field.DW: Durum wheat; BW: bread wheat, Trit: triticale.


Bizerte 6 7 3 6 2 1 100.00 33.33 33.33Cap Bon South1 8 1 0 8 0 0 100.00 0.00 0.00Cap bon North (El Haouaria) 3 9 2 2 9 2 66.66 100.00 100.00Manouba 5 0 1 4 0 1 80.00 0.00 100.00Beja 4 2 0 4 1 0 100.00 50.00 0.00Jendouba 3 2 1 3 0 1 100.00 0.00 100.00Total/mean 29 21 7 27 12 5 93.10 57.14 71.42

Region/District Trit

Prevalence (%)2

BWDWTrit

Number of infected fields

BWDWTrit

Number of surveyed fields

BWDW

1Cap Bon South: Soliman, Beni Khalled, and Grombalia.2Prevalence: Number of infected field/number of surveyed field.DW: Durum wheat; BW: bread wheat, Trit: triticale.


Bizerte 15 4 3 14 3 1 93.33 75.00 33.33Cap Bon South1 5 0 0 2 0 0 40.00 0.00 0.00Cap Bon North (El Haouaria) 2 7 1 0 7 0 0.00 100.00 0.00Manouba 2 0 0 1 0 0 50.00 0.00 0.00Beja 5 1 0 5 0 0 100.00 0.00 0.00Jendouba 3 1 0 3 0 0 100.00 0.00 0.00Zaghouan 7 4 1 6 1 0 85.71 25.00 0.00El Kef 8 0 0 8 0 0 100.00 0.00 0.00Total/mean 47 17 5 39 11 1 85.10 66.66 20.00

Region/District Trit

Prevalence (%)2

BWDWTrit

Number of infected fields

BWDWTrit

Number of surveyed fields

BWDW

Figure 2. Incidence of Septoria tritici blotch during 2016 in surveyed areas on three cereal crops: bread wheat (BW), durum wheat (DW), and triticale (TRIT).


Beja 29%, and in 2017 at Bizerte 17% and Zaghouan 5% (Figures 2 and 4). The severity percentages in these regions did not exceed 5% during the two cropping seasons (Figures 3 and 5). These data showed that STB level was at class I and II ratings except at El Haouaria, where it was rated class IV and V. Unlike the situation on bread wheat, STB was widely distributed on durum wheat and was highly prevalent at Bizerte, Beja, Jendouba, and El Kef where it ranked from class III to V (Table 3). The overall prevalence of the disease was about 50%, 85.71%, 93.3% at Manouba, Zaghouan, and Bizerte, respectively, in 2017 (Table 6). More than 65% and 47% of the disease incidence and severity respectively were recorded in the majority of prospected areas (Beja, Bizerte, Jendouba and

Figure 3. Severity of Septoria tritici blotch during 2016 in surveyed areas on three cereal crops: bread wheat (BW), durum wheat (DW), and triticale (TRIT).

Figure 4. Incidence of Septoria tritici blotch during 2017 in surveyed areas on three cereal crops species: bread wheat (BW), durum wheat (DW), and triticale (TRIT).

Figure 5. Severity of Septoria tritici blotch during 2017 in surveyed areas on three cereal crops: bread wheat (BW), durum wheat (DW), and triticale (TRIT).


Figure 6. Incidence of Septoria tritici blotch on durum wheat, bread wheat and triticale varieties.

El Kef) compared to 35.77% and 10% in Cap Bon regions during the surveyed period in 2016 (Figures 2 and 3). STB was also found on durum wheat varieties in Southern of Cap Bon area such as Grombalia, Soliman and Beni Khalled (region B, Figure 1) with a prevalence of 100% and 40% during 2016 and 2017 respectively (Tables 5 and 6). In 2017, STB was not observed on durum wheat at El Haouaria. STB on triticale was observed at only four regions to include Jendouba, Bizerte, Cap bon and Manouba. It was more prevalent (100%) in Jendouba, Cap Bon North and Manouba in 2016 followed by Bizerte 33% during the two survey years (Tables 5 and 6). Greater mean incidence of STB was recorded on triticale at Jendouba (43%, Figure 2) and more than 20% was noted at Bizerte and Cap Bon North (Figure 2). The overall mean severity varied from 13% to 42% in 2016 cropping season (Figure 3). However, STB was very low on triticale at Bizerte region with 3% and 5% disease incidence and severity respectively during 2017 (Figures 4 and 5).

Incidence of Septoria tritici blotch on commercial wheat varietiesEven though the variety distribution between years and surveyed areas varied, general trends show that most durum wheat varieties were highly susceptible to STB at different levels (Figures 6 and 7). The disease incidence reached 100% on the commercial durum wheat varieties ‘Saragolla’, followed by ‘Soudaine’ (90%), ‘Carioca’ (80%) and ‘Sculpture’ (60%). High incidence was also recorded on the lead commercial durum wheat ‘Razzak’ (75%), ‘Maali’ (60%), and ‘Karim’ (45%) (Figure 6). The lower incidence of the local cultivars was showed by the low STB levels at Cap Bon region, particularly that of ‘Karim’ that could have been affected by late planting. Despite the high STB disease pressure on durum wheat across the surveyed areas, it was nearly absent at El Haouaria (Cap Bon North) where mainly bread wheat was cultivated. In 2016 high STB incidence (90%) and severity (70%) were observed mainly on the bread wheat landrace (‘Farina arbi’) at El Haouaria (Figures 6). Mean incidence and severity of 30% and 25%, respectively, were recorded on the bread wheat ‘Salambo’. Lower rates (< 10%) were recorded on other commercial bread wheat varieties such as ‘Zanzibar’, ‘Utique’ and ‘Haïdra’, which were below 10%. When tested at experimental station in Northern Tunisia, ‘Farina arbi’ and the other bread wheat varieties showed no infection of STB despite high levels of infection on most if not all commercial durum wheat varieties. In addition, low levels of susceptibility to STB were recorded on triticale varieties where incidence and severity ranged from 0% to 30%. Out of three triticale varieties, the disease was totally absent on ‘Bienvenue’ (Figures 6 and 7).


DISCUSSION

The response of durum wheat, bread wheat, and triticale to Z. tritici varied according to the crop species. During the surveyed period, Z. tritici was more prevalent on durum wheat at the majority of surveyed areas except Cap Bon North (El Haouaria) and confirms the high to moderate risk of STB at Northern and Cap Bon regions of Tunisia, respectively. This result supports conclusions of previous reports and confirms that Septoria diseases hot spots are prevalent in the sub humid and semi-arid areas at the beginning of winter season (Fakhfakh et al., 2011). The new commercial durum wheat ‘Sculpture’, ‘Saragolla’, ‘Carioca’ and ‘Soudaine’ were susceptible to Septoria as they were mainly grown at Septoria hot spots where monoculture of durum wheat particularly the susceptible ‘Karim’ and relatively high rainfall contributed to the development of high infection levels. In particular, high incidence and severity were recorded on ‘Karim’ and ‘Razzak’, which confirmed previous findings conducted by Ltifi and Sakkouhi (2008), and Ben Mohamed et al. (2000). In contrast, ‘Maali’, which was previously characterized by a good level of resistance in Beja (Gharbi et al., 2011), was susceptible to STB in the majority of surveyed areas in this study, which could be explained by a slow decline of host resistance (Kema et al., 2018). The survey data also revealed that triticale was also susceptible to STB across the majority of surveyed areas posing therefore a serious threat to this crop. On the other hand, the data revealed that STB was very low in the majority of inspected regions on the commercial bread wheat cultivars such as ‘Haïdra’, ‘Vaga’, ‘Utique’, and ‘Zanzibar’, which could explained by the relative resistance of these varieties to Septoria (Ben Hamouda et al., 2016) while it was higher in ‘Salambo’ (Saade, 1996). ‘Salambo’ was released in 1980, period that has known a substantial expansion in bread wheat acreage particularly for varieties with high yield and good level of diseases resistance. It seems that this variety has undergone a slow decline of host resistance over time that is commonly observed in this pathosystem, particularly for bread wheat in Europe (Kema et al., 2018). Surprisingly from this study, STB on bread wheat poses a great risk only at one region, El Haouaria, where it was rated class IV and V and mainly only on the old bread wheat landrace ‘Farina arbi’. The important incidence of Septoria observed on this variety reveals a specific presence of Z. tritici population that only develops on this old bread wheat landrace with little or no apparent effect on other bread wheat varieties. This could be mainly associated with the wheat-based mono-cropping system and monoculture of a land race over several decades facilitating thereby the adaptation of the pathogen to this specific variety (Holloway, 2014; McDonald and Mundt, 2016). Similar research reviews on wheat diseases surveys (Teferi and Gerbreslassie, 2015; Takele et al., 2015; Unal et al., 2017) showed that the impact and distribution of diseases varied due to the continuous release and extensive cultivation of susceptible varieties.

Figure 7. Severity of Septoria tritici blotch on durum wheat, bread wheat, and triticale varieties.


Thus, the magnitude of virulence and disease incidence are variable and closely related to the frequency of the variety used in a particular area as well as the proportion of durum wheat area as compared to that of bread wheat (Yahyaoui et al., 2000). Testing ‘Farina arbi’ land race for its resistance/susceptibility to Z. tritici at other Northern regions where durum wheat is mostly cultivated showed no STB infection. This unique bread wheat landrace, completely susceptible at El Haouaria (North eastern Tunisia) and completely resistant at Beja Northwestern Tunisia, could be that we are definitely dealing with two distinct Z. tritici populations and could give more highlight on STB specificity. Further studies will be conducted to characterize the STB populations from El Haouaria that are mostly specific to the bread wheat land races (‘Farina arbi’) and have no effect on other bread and durum wheat varieties. Such phenomenon has not been observed before and could lead to further understanding of STB host specificity.

CONCLUSIONS

The survey data revealed low risk of Zymoseptoria tritici on bread wheat except at Cap Bon region especially at El Haouaria where Septoria tritici blotch (STB) severity was relatively high on the old bread wheat landrace, while rare occurrence at other sites was observed on some commercial bread wheat varieties. Sporadic incidence and high severity were observed on triticale across the surveyed fields. Although Tunisia is primarily a durum-wheat producing country with Z. tritici being mostly prevalent on durum wheat; bread wheat is of great economic importance, even though it occupies small areas. The occurrence of STB on the landrace could lead to development of Septoria population that could become of major importance on bread wheat as is the case in Morocco and other regions. The presence of an STB population at one site and infecting a single cultivar will be further investigated and will possibly lead to better understanding of Z. tritici population dynamics that could become an important tool in screening for disease resistance.

ACKNOWLEDGEMENTS

This research was supported by “CRP WHEAT Tunisia Septoria Precision Phenotyping Platform”.

REFERENCES

Ammar, K., Gharbi, M.S., and Deghais, M. 2011. Wheat in Tunisia. p. 443-463. In Bonjean, A.P., Angus, W.J, and van Ginkel, M. (eds.) The world wheat book: A history of wheat breeding. Vol. 2. Lavoisier, Paris, France.

Ben Hamouda, M., Ben Youssef, S., Bedhiaf, S., Annabi, M., Draief, Z., and Gharbi, M.S. 2016. Status of agricultural innovations, innovation platforms, and innovations investment. Tunisia. 2015 PARI project country report: Republic of Tunisia. Forum for Agricultural Research in Africa (FARA), Accra, Ghana.

Ben Mohamed, L., Rouaissi, M., Sebei, A., Hamza, S., et Harrabi, M. 2000. Effet du génotype, de la date de semis, de la fertilisation azotée et potassique et des fongicides sur le développement de Septoria tritici. p. 350-356. In Royo, C., Nachit, M., Di Fronzo, N., and Araus, J.L. (eds.) Durum wheat improvement in the Mediterranean region: New challenges. CIEHAM, Zaragoza, Spain. (Options Méditerranéenne: Série A. Séminaires Méditerranéens; n. 40).

Fakhfakh, M.M., Rezgui, S., Jarrahi, T., Zouani, R., Bousalmi, A., Sgatni K., and Yahyaoui, A. 2011. Mapping distribution of Septoria allowed targeting management options of the disease. 8th International Symposium on Mycosphaerella and Stagonospora Diseases of Cereals, Mexico City. 10-14 September 2011. Book of Abstracts. Centro Internacional de Mejoramiento de Maíz y Trigo (CIMMYT), Mexico.

FAO. 2017. Country fact sheet on food and agriculture policy trends. Socio-economic context and role of agriculture. p. 1-6. Food and Agriculture Policy Decision Analysis (FAPDA), FAO, Rome, Italy. Available at http://www.fao.org/3/a-i7738e.pdf.

Ferjaoui, S., M’Barek, S.B., Bahri, B., Slimane, R.B. and Hamza, S. 2015. Identification of resistance sources to septoria tritici blotch in old durum wheat germplasm applied for the analysis of the Zymoseptoria tritici-durum wheat interaction. Journal of Plant Pathology 97(3):471-481.

Gharbi, M.S., Berraies, S., Ammar, K., and Yahyaoui, A. 2011. Delivering disease resistant cultivars to enhance sustainability of durum wheat production in Tunisia. p. 60. In Duveiller E., Singh, P.K., et al. (eds.) 8th International Symposium on Mycosphaerella and Stagonospora Diseases of Cereals, Mexico City. 10-14 September. Book of Abstracts. Centro Internacional de Mejoramiento de Maíz y Trigo (CIMMYT), Mexico.


Gharbi, M.S., Deghais, M., and Ben Amar, F. 2000. Breeding for resistance to Septoria tritici in durum wheat. p. 397-401. In Royo, C., Nachit, M., Di Fronzo, N., and Araus, J.L. (eds.) Durum wheat improvement in the Mediterranean region: New challenges. CIHEAM, Zaragoza, Spain. (Options Méditerranéennes. Série A: Séminaires Méditerranéens; n. 40).

Gilmour, R., Gogel, B.J., Cullis, B.R., Welham, S.J., and Thompson, R. 2002. ASReml user guide release 1.0. VSN International Ltd., Hemel Hempstead, UK.

Holloway, G. 2014. Septoria tritici blotch of wheat. DEPI Information Note Series May 2014. 2 p. Department of Environment and Primary Industries (DEPI), Melbourne, Australia.

Kema, G.H.J., Gohari, A.M., Aouini, L., Gibriel, H.A.Y., Ware, S.B., et al. 2018. Stress and sexual reproduction affect the dynamics of the wheat pathogen effector AvrStb6 and strobilurin resistance. Nature Genetics 50:375-380.

Ltifi, A., et Sakkouhi, L. 2008. La septoriose du blédur: Résistance variétale et impact de la maladie sur le rendement. Annales de l’INRAT 81:76-84.

McDonald, B.A., and Mundt, C.C. 2016. How knowledge of pathogen population biology informs management of Septoria tritici blotch. Phytopathology 106(9):948-955.

Saade, M.E. 1996. Adoption and impact of high yielding wheat varieties in Northern Tunisia. CIMMYT Economics Working Paper 96-03. Centro Internacional de Mejoramiento de Maíz y Trigo (CIMMYT), Mexico D.F.

Saari, E.E., and Prescott, J.M. 1975. A scale for appraising the foliar intensity of wheat diseases. Plant Disease Reporter 59:377-380. Slama, A., Ben Naceur, M., Ben Salem, M., et Zied, E. 2005. Les céréales en Tunisie: production, effet de la sécheresse et

mécanismes de résistance. Sécheresse 16(3):225-229.Takele, A., Lencho, A., Getaneh, W.A., Hailu, E., and Kassa, B. 2015. Status of wheat Septoria leaf blotch (Septaria tritici

Roberge in Desmaz) in South West and Western Shewa Zones of Oromiya Regional State, Ethiopia. Research in Plant Sciences 3(3):43-48.

Teferi, T.A., and Gebreslassie, Z.S. 2015. Occurrence and intensity of wheat Septoria tritici blotch and host response in Tigray, Ethiopia. Crop Protection 68:76-71.

Tunisian Ministry of Agriculture, Water Resources and Fishing. 2015. Statistics Service of the General Direction of Agricultural Production. Ministry of Agriculture, Water Resources and Fishing, Tunis, Tunisia.

Unal, G., Kayim, M., Ay, T., and Yones, M.A. 2017. Evaluation of disease intensity and molecular identification of Zymoseptoria tritici causing Septoria leaf blotch on wheat in the Eastern Mediterranean Region of Turkey. Turkish Journal of Agriculture and Forestry 41(6):405-413.

Yahyaoui, A., Hakim, S., Al-Naimi, M., and Nachit, M.M. 2000. Multiple disease resistance in durum wheat (Triticum turgidum L. var. durum). p. 387-392. In Royo, C., Nachit, M., Di Fronzo, N., and Araus, J.L. (eds.) Durum wheat improvement in the Mediterranean region: New challenges. CIHEAM, Zaragoza, Spain (Options Méditerranéennes. Série A: Séminaires Méditerranéens; n. 40).

Volume 61 (5). Published January, 01, 2019 www.jnsciences.org E-ISSN 2286-5314

BELHADJ et al. (2019) / Journal of new sciences, Agriculture and Biotechnology, 61 (5), 3892-3898 3892

Distribution of mating types in Zymoseptoria tritici populations

collected from bread wheat at El Haouaria region

Distribution des types sexuels dans une population de Zymoseptoria

tritici collectée du blé tendre dans la région d’El Haouaria

R. BELHADJ CHEDLI1,4*

, L. AOUINI 2, S. BEN M’BAREK

3,4, A. YAHYAOUI

4,5, S. REZGUI

1,

H. CHAABENE1

1 National Agronomic Institute of Tunisia (INAT), 43 Avenue Charles Nicolle, 1002 Tunis, Tunisia. 2 Department of Agronomy, Purdue University, 915 West State Street, West Lafayette, IN 47907 3 Regional Field Crops Research Center of Beja (CRRGC) BP 350, 9000 Beja, Tunisia. 4 CRP Wheat Septoria Phenotyping Platform, Tunisia. 5 Centro Internacional de Mejoramiento de Maíz y Trigo (CIMMYT), km 45 Carretera México-Veracruz

El Batán, Texcoco.

*Corresponding author: [email protected]

Abstract – Bread wheat is one of the most important cereal crop in Tunisia, nonetheless production is

highly affected by drought and diseases mainly Septoria tritici blotch (STB) caused by the fungus Zymoseptoria tritici. The main objective of this study is to assess the mating types distribution of 103

bread-wheat-derived Z. tritici isolates collected during 2015-2016 cropping season from El Haouaria

region where STB occurs annually on a bread wheat landrace that is called by farmers ‘Farina Arbi’. For this study, a multiplex PCR was conducted using two pairs of mating type-specific primers for

MAT1-1 and MAT1-2. The results showed that on average both mating types occurred with an equal

frequency of MAT1-1 and MAT1-2 (44.7% and 55.3% respectively), except for one field where the

MAT1-2 was predominant with 74%, which could be certainly related to the reduced population size in this field. Overall, the equal mating type distribution observed at El Haouaria region suggests a frequent

sexual reproduction of bread-wheat derived Z. tritici isolates in Tunisia.

Keywords: Farina Arbi, Septoria, sexual reproduction

Résumé - Le blé tendre est l’une des céréales les plus importantes en Tunisie. Sa production reste

hautement affectée par la sècheresse et les maladies fongiques notamment la septoriose, causée par le

champignon Zymoseptoria tritici qui attaque principalement le blé dur. L’objectif majeur de cette étude est la détermination de la distribution des deux mating types (MAT1-1 and MAT1-2) d’une population

de 103 isolats de Z. tritici colléctés à partir du blé tendre ancien ‘Farina Arbi’ au niveau de quatre

champs, dans la région d’El Haouaria là où une grande incidence de septoriose a été notée durant la

saison agricole 2015-2016. Une PCR multiplexe utilisant deux paires d’amorces spécifiques MAT 1-1 et MAT1-2 a été effectuée. Les résultats de cette étude ont montré une distribution égale des deux types

sexuels (44.7% vs 55.3%). Cependant, une prédominance du MAT1-2 avec 74% a été notée au sein d’un

seul champ, ce qui pourrait s’expliquer par la taille réduite de la population de Z. tritici dans ce champ. D’une façon générale, la distribution équilibrée des deux types sexuels observée dans la région d’El

Haouaria suggère une reproduction sexuée fréquente des isolats de blé tendre en Tunisie.

Mots clés : Farina Arbi, Septoriose, reproduction sexuée

1. Introduction

Vers la fin du XIXeme siècle, la culture du blé tendre (Triticum aestivum L. subsp. aestivum) en Tunisie

existait sous forme de mélange dans les champs avec l'orge (Hordeum vulgare), le blé dur cultivé (Triticum turgidum L. subsp. durum (Desf.)), et d’autres espèces reconnaissables par la forme, la

couleur et la taille des épis, et aussi par les barbes et les grains (Gharbi et al., 2013). A cette époque, les

agriculteurs ne connaissaient même pas les noms vernaculaires aidant à la distinction de différents



cultivars de blé tendre et de blé dur, et n’utilisaient ainsi que la dénomination générale ‘Farina’ et ‘Gameh’ pour les deux espèces respectivement. Ce n'est que depuis la colonisation française que la

culture du blé tendre a commencé à prendre de la place dans l’agriculture Tunisienne (Ammar et al.,

2011 ; El Falleh et al., 2014). Au début des années 1930-1940, un développement rapide et relativement considérable des emblavures

de blé tendre a eu lieu grâce à l’introduction de la variété Florence Aurore. Dotée d’un bon rendement,

d’une excellente adaptabilité à la sécheresse dans les zones semi-arides et d’une bonne résistance aux différentes maladies (Septoria, Oïdium, Rouille…), cette dernière a pris, progressivement de

l’importance dans tous les pays du bassin méditerranéen jusqu’à l’introduction du blé semi-nain vers la

fin des années 1960 par CIMMYT (Saade, 1996). Malgré leur performance en termes de qualité, ces

variétés et beaucoup d’autres introduites après, ont été disparu très vite à cause de leurs susceptibilités à plusieurs maladies telles que la rouille et la septoriose. Jusqu’à ce jour, la sole nationale est prédominée

par les variétés de blé tendre, Salambo (1980), Utique (1996), Haidra (2004) et plus récemment Tahent

(2009). En effet, toutes ces variétés ont été sélectionnées pour leur bon rendement et leur résistance aux maladies à savoir la rouille jaune, rouille brune et la septoriose (Ammar et al., 2011 ; Gharbi et al., 2013 ;

Ben Hamouda et al., 2016).

Etant donné leur contribution dans la production en grain du blé, l’introduction des variétés semi-naines

a augmenté considérablement les attaques des pathogènes notamment la septoriose (Gharbi et al., 2013). En effet la progression verticale de la maladie à partir des feuilles basales là où l’infection commence

vers la feuille drapeau est devenue très rapide avec les nouveaux cultivars grâce à la hauteur réduite de

la plante (Ben Mohamed et al., 2000). Dans le cas de Zymoseptoria tritici, l’agent causal de la Septoriose du blé, la reproduction sexuée est possible uniquement lorsque les deux idiomorphes sont présents au

même niveau et à la même localité géographique et celle-ci ne sera initiée que par la rencontre et la

fusion de ces deux gamètes qui sont génétiquement compatibles (Zhan et al., 2002). L’identification, le clonage et le séquençage des idiomorphes de Z. tritici ont été réalisés à partir des deux isolats de

référence IPO323 et IPO94269 (Waalwijk et al., 2002). Ces idiomorphes, lors du stade sexué de Z.

tritici, donnent naissance aux pseudothèces qui sont produits sous certaines conditions durant l’année

(Hunter et al., 1999). Toutefois, la distribution géographique des types sexuels parait fortement liée à l’évolution et la biologie des populations des champignons hétérothalliques (McDonald et Mundt,

2016).

En Tunisie, cette maladie s’est intensifiée dans les zones humides de Bizerte et Béja engendrant des pertes des rendements dépassant 60% chez les variétés de blé dur sensibles comme ‘Karim’ (Gharbi et

al., 2008). La sévérité d’attaque par Z. tritici dans les champs de blé dur est influencée par la sensibilité

élevée des variétés améliorées ‘Maali’, ‘Khiar’ et ‘Razzek’. Cependant, la variété Salim reconnue comme résistante à la rouille brune est considérée également comme la plus résistante à Z. tritici en

Tunisie ((Ben Mohamed et al., 2000 ; Gharbi et al., 2013).

Toutefois, des études antérieures ont mentionné que la plus grande incidence de ce pathogène a été

observée sur le blé dur que sur le blé tendre (Djerbi et Ghodhbane, 1975). Cette hypothèse a été aussi supportée par Gharbi et al. (2000), qui ont signalé que le blé tendre en Tunisie a montré depuis toujours

un haut niveau de résistance à ce pathogène. C’est pour cette raison que seuls les travaux s’intéressant

à l’équilibre gamétique, la diversité génétique, les gènes de résistance et l’importance de Z. tritici en Tunisie n’ont été effectués que sur le blé dur (Boukef et al., 2012 ; Ferjaoui et al., 2015 ; Aouini, 2018).

Bien que la septoriose fût observée sur le blé dur annuellement, une incidence surprenante a été signalée

ces dernières années, particulièrement dans la région d’El Haouaria chez une ancienne variété appelée

par les agriculteurs de cette région : ‘Farina Arbi’ (Bel Hadj Chedli et al., 2018). Les objectifs majeurs de ce travail sont : (i) d’étudier la distribution des types sexuels (MAT1-1 et MAT 1-2) et d’évaluer le

potentiel de la reproduction sexuée de Z. tritici à partir d’une collection de 103 isolats obtenue à partir

de la variété de blé tendre ‘Farina Arbi’ durant la saison agricole 2015-2016, (ii) réévaluer l'importance relative de cette maladie en Tunisie.

2. Matériel et Méthodes

2.1. Echantillonnage

Des feuilles de blé tendre infectées par Zymoseptoria tritici ont été échantillonnées pendant la saison

agricole 2015/2016. Tous les échantillons ont été collectés à partir des champs de blé tendre ‘Farina

Arbi’ infectés naturellement dans la région de El Haouariavers la fin de la saison de croissance (GS 70 selon l’echelle Zadok (Zadoks et al., (1974)). L’échantillonnage a été réalisé selon la méthode



hiérarchique décrite par McDonald et al. (1999) (Figure 1). Après réception au laboratoire, des procédures du stockage des feuilles et d’isolement ont été adoptées.

Figure 1. Méthode d’échantillonnage adaptée : dans chaque point circulaire, 10 feuilles de blé tendre ont été échantillonnées

à des intervalles réguliers de 10 m entre les différents points selon des lignes parallèles distants de 10 m (Méthode adaptée

par McDonald et al.1999)

2.2. Préparation des isolats et multiplication sporale

Cette étape a consisté à préparer au total 103 souches mono-pycnidiales conformément à la méthode adaptée par Siah et al. (2010). En effet il s’agit d’incuber, des feuilles fraiches de blé tendre présentant

des pycnides, une nuit dans une boîte de Pétri préalablement stérilisée contenant du papier filtre imbibé

d’eau. L’environnement humide à l’intérieur de la boite a permis la libération des cirrhes contenant des

spores qui ont été récupéré sur milieu PDA. Ainsi, la masse fongique obtenue a été déposée sur milieu liquide pour la multiplication sporale puis récoltée dans des tubes Eppendorf et stockée au (-80) pour

servir par la suite à l’extraction d’ADN. Les détails du nombre d’isolats et leurs origines sont décrits

dans le tableau 1.

Tableau 1. Collection de Z. tritici utilisées dans cette étude : site, variété, hôte et nombre d’isolats.

Région Site Variété Hôte Lattitude

(intervalle)

Longitude

(intervalle)

Nombre de

champs

Nombre

d’isolats

Cap Bon Haouaria Farina Arbi Blé tendre 36.84-36.94 10.93-11.02 4 103

2.3. Extraction d’ADN

La première étape d’extraction a consisté à lyophiliser les échantillons qui ont été broyée par la suite

moyennant un Tissue Lyser II (Qiagen cat.no. 85300) jusqu'à l’obtention d’une poudre qui a servi à

l’extraction de l’ADN en utilisant le kit d’extraction ‘Sbeadex® mini plant kit (LGC genomics) sur un système KingFisher KF96 conformément aux instructions du fabricant. La qualité d’ADN a été par la

suite vérifiée sur gel d’agarose (1%).

2.4. Détermination des types sexuels

Les deux idiomorphes (MAT1-1 et MAT1-2) ont été déterminés avec une PCR multiplexe en combinant

les couples d’amorces spécifiques à chaque type sexuel (Waalwijk et al., 2002) (Tableau 2). Dans cette

étude, deux isolats de référence à savoir IPO95052 (660 bp, MAT1-2) et IPO323 (340 bp, MAT1-1), ont été utilisés comme témoin. Les produits PCR obtenus sont séparés par une électrophorèse sur gel

d’agarose (1% agarose, 0,5X TBE) à 100V pendant 45min. Le gel d’agarose est ensuite coloré avec du

bromure d’éthidium et visualisé sous lumière UV.



Tableau 2. Couple d’amorces spécifiques à chaque type sexuel

Mating Type Primer 5'to 3' longueur

Mat 1-1F CCGCTTTCTGGCTTCTTCGCACTG 660 bp

Mat 1-1R TGGACACCATGGTGAGAGAACCT

Mat 1-2F GGCGCCTCCGAAGCAACT 340 bp

Mat 1-2R GATGCGGTTCTGGACTGGAG

2.5. Analyse des données

Le potentiel de la reproduction sexuée a été évalué en utilisant le test Chi-deux (χ2). En considérant le

scenario des cycles réguliers d’une reproduction sexuée, une distribution égale (ratio 1:1) des idiomorphes à l’intérieur de chaque population est attendue.

Le Chi-deux a été calculé comme décrit ci-dessous et comparé avec la probabilité P dans le tableau de

χ2 à un degré de liberté. χ2 = Σ (O-E) 2/E Avec, O : la fréquence observée

E : la fréquence attendue

Σ : somme pour les deux types sexuels

3. Résultats et Discussion

Différentes régions céréalières dans le Nord du pays considéré comme des foyers chauds (hot-spot) de

septoriose ont été prospectées durant la saison agricole 2015-2016 afin d’étudier la distribution géographique de la septoriose chez le blé tendre (Triticum aestivum), le blé dur (Triticum durum) et le

triticale (Triticale secalis) (Bel Hadj chedli et al., 2018). En effet, une incidence surprenante de Z. tritici

a été observée exclusivement dans la région d’El Haouaria chez une variété ancienne de blé tendre.

Désignée par ‘Farina Arbi’, cette variété sert à la fabrication des biscuits traditionnels de cette région et plus particulièrement le ‘Kaak Arbi’.

Les résultats de cette étude ont montré que 46 isolats ont été amplifiés à 340 pb avec MAT1-1 et 57

isolats ont été amplifiés à 660 bp avec MAT1-2 avec des fréquences de 44,66 et 55,33 % respectivement (Figure 2). La détermination des types hétérothalliques (Mating type) a été bien documenté dans la

littérature et l’existence des deux types (MAT1-1 et MAT1-2) sur le blé a été prouvée dans plusieurs

études (Zhan et al., 2002 ; Siah et al., 2010 ; Ayad et al., 2013 ; Alioui et al., 2014 ; Harrat et Bouznad, 2018). Dans le cas de cette étude, les résultats du test Chi-deux (χ2) appliqué pour tester l’hypothèse

nulle (ratio 1 :1) pour une population se produisant au hasard a révélé une différence non significative

entre les fréquences des deux idiomorphes dans toute la population d’une façon générale dans les

champs 1, 2 et 4 particulièrement (Tableau 3).

Tableau 3. Fréquences des idiomorphes et test Chi-deux types sexuels MAT1-1 et MAT1-2 de Zymoseptoria tritici dans

la région d’El Haouaria

Région Parcelle Nombre d’isolats MAT1-1 MAT1-2 χ2

El Haouaria

1 29 14 (48,27%) 15 (51,72%) 0.03 2 31 18 (58,06%) 13 (41,93%) 0.80 3 23 6 (26,08%) 17 (73,91%) 5.26 4 20 8 (40%) 12 (60%) 0.8

Total 103 46 (44,66%) 57 (55,33%) 1.17

Ces résultats sont en accord avec ceux identifiés par Siah et al. (2010), El Chartouni et al. (2012) et

Morais et al. (2017), suggérant ainsi l’existence d’un cycle régulier de la forme sexuée de Z. trtici en conditions naturelles. Des fréquences approximativement égales des idiomorphes soulignent le rôle

important des ascospores impliqués dans l’initiation de la maladie et le maintien de l’épidémie dans

cette région (Abrindaba et al., 2010 ; Meamiche et al., 2017).

Contrairement, un déséquilibre gamétique a été observé dans le champ 3, avec un ratio déviant signification du 1 :1 à (P ≤ 0.05) entre les deux idiomorphes avec une prédominance du MAT 1-2. Des

études similaires ont signalé la présence des fréquences inégales des types sexuels à partir de plusieurs

populations de Z. tritici de différentes origines : Iran (Saidi et al., 2012) ; California et Kansas (Gurung et al., 2011) ; France (Morais et al., 2017). A partir d’une population syrienne de Z. tritici, Waalwijk et

al. (2002) ont signalé des fréquences inégales des deux types sexuels avec une dominance du MAT 1-

1, conséquente de la taille réduite de la population et de l’échantillonnage répété des clones. Certains



chercheurs ont attribué ce déséquilibre à l’effet de la sélection ou la dérive génétique qui favorise certains génotypes tout en augmentant la fréquence générant un déséquilibre jusqu’à ce que la

reproduction sexuée aura le temps d’atteindre un équilibre (McDonald et Linde, 2002 ; Boukef, 2012 ;

Abrindabaet al., 2010). Cette étude constitue une première approche dans la caractérisation moléculaire des isolats de Z. tritici collectés à partir du blé tendre en Tunisie. Ainsi, l’étude de l’équilibre gamétique

identifié dans les trois champs ne pourra que confirmer le déroulement de la phase sexuée dans la région

d’El Haouaria pour assurer un inoculum primaire dans le déclenchement des épidémies. La forme sexuée des isolats de blé tendre pourrait être ultérieurement confirmée par la présence des pseudothèces au

niveau des champs. Par ailleurs, une étude de la diversité génétique à l'aide de marqueurs microsatellites

permettra d’approfondir les connaissances sur la structure des populations de Z. tritici en Tunisie et

améliorera significativement nos connaissances sur l'impact de la reproduction sexuée sur l'évolution de ce pathogène en Tunisie.

Figure 2. PCR Multiplex pour Mat1-1 et Mat1-2 pour quelques isolats de Z. tritici chez le blé tendre de la région d’El

Haouaria (champs 1) avec les deux isolats de références : IPO95052 (660 bp, Mat1-2) et IPO323 (340 bp, Mat1-1).

3. Conclusion

L’identification des proportions égales des deux idiomorphes au sein des mêmes champs dans la région

du Cap Bon suggère que la forme téléomorphe se reproduit dans les champs de blé tendre et même dans

un espace réduit (même champs). D’autres travaux sont nécessaires pour consolider les résultats trouvés dans cette investigation. En effet, l’identification du cycle sexué, sa fréquence tout au long du cycle de

la plante et l’étude de la diversité génétique de Z. tritici chez le blé tendre en Tunisie restent à déterminer.

Remerciements

Les auteurs remercient vivement toute l’équipe de “CRP Wheat Septoria Precision Phenotyping

Platform, Tunisia” pour leur contribution dans ce travail. Egalement nos remerciements s’adressent à l’équipe du Pr. Kema du laboratoire de Phytopathologie à l’Université de Wageningen (Pays-Bas) pour

leur collaboration.

4. Références

Abrinbana M, Mozafari J, Shams-Bakhsh M, Mehrabi R (2010) Genetic structure of

Mycosphaerella graminicola populations in Iran. Plant Pathology 59:829-838.Doi: 10.1111/j.1365-

3059.2010.02309. Ammar K, Gharbi MS, Deghais M (2011) Wheat in Tunisia. In: The World Wheat Book: A History

of Wheat Breeding. Lavoisier, 2 pp: 443-463.

Allioui N, Siahb A, BrinisaL, Reignault P, et Halama P (2014) Mating type distribution provides evidence for sexual reproduction of Mycosphaerella graminicola in Algeria. Canadian Journal of

Plant Pathology36(4): 475-481.DOI: 10.1080/07060661.2014.964777

Aouini L (2018) Durum wheat and septoria tritici blotch : gene and prospects for breeding. PhD thesis,

Wageningen University, Wageningen, Netherlands: 1-225. Ayad D, Sayoud R, Benbelkacem K, Bouznad Z (2013) La tache septorienne du blé: Première

signalisation de la présence en Algérie des deux Mating types du téleomorphe Mycosphaerella

graminicola (Fuckel) Schröter, (anamorphe : Septoriatritici Rob. ex Desm.) et diversité phénotypique de l’agent pathogène. Nature and Technology :34-45.

Be lHadj Chedli R, Ben M’Barek S, Yahyaoui A, Kehel Z, Rezgui, S (2018) Occurrence of Septoria

tritici blotch (Zymoseptoria tritici) disease on durum wheat, triticale, and bread wheat in Northern



Tunisia. CHILEAN JOURNAL OF AGRICULTURAL RESEARCH, 78(4): 559-568.doi:10.4067/S0718-58392018000400559

Ben Hamouda M., Ben Youssef S, Bedhief S, Annabi M, Draief Z, Gharbi M S (2016) Status of

Agricultural Innovations, Innovation Platforms, and Innovations Investment in Tunisia. PARI project country report: Republic of Tunisia. Forum for Agricultural Research in Africa: 21-25.

Ben Mohamed L, Rouaissi M, Sebei A, Hamza S, Harrabi M (2000) Effet du génotype, de la date de

semis, de la fertilisation azotée et potassique et des fongicides sur le développement de Septoriatritici. In Royo C. (ed.), Nachit M. (ed.), Di Fonzo N. (ed.), Araus J.L. (ed.). Durum wheat

improvement in the Mediterranean region : New challenges. CHIEHAM- options

méditerranéenne : Série A. Séminaires Méditerranéens 40: 350-356.

Boukef S (2012) Structure des populations, spécificité parasitaire et évaluation de la résistance aux fongicides chez Zymoseptoriatritici, agent de la septoriose du blé en Tunisie. Institut National

Agronomique de Tunisie : 1-102.

Djerbi M, Ghodhbane A (1975) Contribution à l’étude du Septoriatritici Rob. ex Desm., conservation et résistance variétale. Ann INRAT 48:1.

EL Chartouni L, Tisseront B, Siah A, DuymeF, Durant R, Halama PP, Reignault P (2012)

Evolution of Mycosphaerella graminicola at the wheat leaf and field levels. Phytopathologia

Mediterranea 51 (52): 332−339. El Felah M, Gharbi MS, Ghanem HB, Elloumi M (2015) Les céréales en Tunisie entre mythe et

réalité. Annales de l’INRAT, 2ème Numéro Spécial Centenaire 88: 1-17.

Ferjaoui S, Ben M’Barek S, BahriAB, Slimane RB, Hamza S (2015) Identification of resistance sources to septoriatritici blotch in old durum wheat germplasm applied for the analysis of the

Zymoseptoria tritici-durum wheat interaction. Journal of Plant Pathology 97 (3): 471- 481.

Gharbi MS, et El Faleh M (2013) Les céréales en Tunisie : plus d’un siècle de recherche variétale. Ann INRAT, Numéro Spécial- Centenaire de l’INRAT86 :45-68.

Gharbi MS, Berraiess S, Fakhar S, Ammar K, Hajlaoui MR, Yahyaoui A, Trifi M (2008) Breeding

durum wheat with resistance to Septoria leaf blotch for sustainable production under Mediterranean

conditions. International durum wheat symposium: from seed to pasta, 30/06-03/07/2008, Bologne, Italie.

Gharbi MS, Deghais M, Ben Amar F (2000). Breeding for resistance to Septoria tritici in durum wheat.

In: Royo C. (ed.), Nachit M. (ed.), Di Fonzo N. (ed.) , Araus J.L. ( ed.). Durum wheat improvement in the Mediterranean region : New challenges. Options Méditerranéennes : Série A. Séminaires

Méditerranéens 40: 397- 401.

Gurung SB, Goodwin S, Kabbage MW, Bockus W, Adhikari T (2011). Genetic Differentiation at Microsatellite Loci Among Populations of Mycosphaerella graminicola from California, Indiana,

Kansas, and North Dakota. Phytopathology 101(10): 1251-1257.doi:10.1094/PHYTO-08-10-0212

Harrat W, Bouznad Z (2018) Prevalence, cultural and pathogenic characterization of

Zymoseptoriatritici, agent of wheat septoria leaf blotch, in Algeria. African Journal of Agricultural Research 13(40): 2146-2153.doi:10.1094/PHYTO-08-10-0212

Hunter T, Coker RR, et Royal DJ (1999) The teleomorph stage, Mycosphaerella graminicola, in

epidemic of Septoriatritici blotch on winter wheat in the UK. Plant Pathol 48:51-57. McDonald BA, Mundt CC (2016) How knowledge of Pathogen Population Biology Informs

Management of SeptoriaTritici Blotch. Phytopathology 106(09): 948-955.

McDonald BA, Linde, CC (2002) The population genetics of plant pathogens and breeding strategies

for durable resistance. Euphytica, 124: 163-180.Annu. Rev. Phytopathol. 2002. 40:349–79 doi: 10.1146/annurev.phyto.40.120501.101443

McDonald BA, Zhan J, et Burdon J J (1999) Genetic Structure of Rhynchosporium secalis in

Australia. Ecologie and Population Biologie89(8): 639-644.DOI:10.1094/PHYTO.1999.89.8.639 Meamiche HN, Aouini L, Bouznad Z, Gerrit HJ (2018) Equal distribution of mating type alleles and

the presence of strobilurin resistance in Algerian Zymoseptoria tritici field populations. Plant

Disease: 1-27. doi.org/10.1094/PDIS-03-16-0298-RE Morais D, Duplaix C, Sache I, Laval V, Suffert F, Walker AS (2017). Stability in the genetic structure

of a Zymoseptoria tritici population from epidemic to interepidemic stages at a small spatial scale.

bioRxiv: 1-37.

Saade, M.E. 1996. Adoption and impact of high yielding wheat varieties in Northern Tunisia. CIMMYT, Mexico D.F. Economics Working Paper: 03-96.

https://doi.org/10.1094/PHYTO.1999.89.8.639

https://doi.org/10.1094/PHYTO.1999.89.8.639



Saidi A, Safaie N, Palizi P (2012) Study on mating types and sensitivity to strobilurin fungicide in fungal wheat pathogen Mycosphaerella graminicola.J. Crop Prot. 1 (4): 271-277.

Siah A, Bomble M, TisserantB, Cadalen T, Holvoet M, Hilbert R, Reignault P, Halama P (2018)

Genetic structure of Zymoseptoria tritici in northern France at region, field, plant and leaf layer scales. Phytopathology: 1-42. doi.org/10.1094/PHYTO-09-17-0322-R

Siah A, Tisserant B, El Chartouni L, Duyme F, Deweer C, Fichter C, Sanssené J, Durand R,

Reignault P, Halama P (2010). Mating type idiomorphsfrom French population of the wheat pathogen Mycosphaerella graminicola: widespread equal distribution and low but distinctlevels of

molecular polymorphism. Fungal Biology114:980-990. doi :10.106/j.funbio.2010.09.008

Waalwijk C, Mendes O, Verstappen ECP, de Waard MA, Kema GHJ (2002.) Isolation and

characterization of the mating type idiomorphs from the wheat septoria leaf blotch fungus Mycosphaerella graminicola. Fungal Genetics and Biology 35:277-286.

doi:10.1006/fgbi.2001.1322

Zhan J, Kema GH J, Waalwijk C, McDonald BA (2002) Distribution of mating type alleles in the wheat pathogen Mycosphaerella graminicola over spatial scales from lesions to continents. Fungal

Genetics and Biology 36:128-136.

ORIGINAL ARTICLE

Screening for resistance of Tunisian, Moroccan and Algerian wheatcultivars to Zymoseptoria tritici in Northern Tunisia

Rim Bel Hadj Chedli1,2 & Sarrah Ben M’Barek3,2 & Amir Souissi1 & Amor Yahyaoui4,2 & Salah Rezgui1 &

Hanène Chaabane5

Received: 22 May 2019 /Accepted: 24 April 2020# Società Italiana di Patologia Vegetale (S.I.Pa.V.) 2020

AbstractSeptoria tritici blotch (STB) disease caused by Zymoseptoria tritici is the most predominant disease on durum wheat inTunisia, while its occurrence on bread wheat is rare. In this study, we investigated the performance of 89 wheat cultivarsfrom Morocco, Algeria and Tunisia, screened in Tunisia for their relative resistance to STB. Field experiments werecarried out in an augmented design, during 2016–17 and 2017–18 cropping seasons at two locations in NorthernTunisia: Beja (Oued Beja station) and Cap Bon regions (Menzel Temim and El Haouaria). All trials were conductedunder natural infection. Visual disease assessments were quantified using the percentage of leaf area covered by pycnidia(PC), necrotic area (N), area under disease progress curve of each genotype (AUDPC) and the relative area under diseaseprogress curve (rAUDPC). Results indicated that the majority of Tunisian, Algerian and Moroccan durum wheat popula-tions (TDM, ADW and MDW) were susceptible to STB at both locations in Tunisia ranging from susceptible to highlysusceptible, with the rAUDPC, N and PC ranging from 0.5 to 0.8, 30 to 65% and 40 to 75% respectively. On the otherhand, the Moroccan bread wheat genotypes (MBW) were susceptible in Cap Bon area and resistant at Beja. Tunisian breadwheat genotypes (TBW) were resistant at both locations; with levels varying from immune to resistant classes whererAUDPC, PC and N did not exceed 0.2 and 10% respectively, with the exception of the local bread wheat variety known as“Farina Arbi” which was susceptible at Cap Bon and resistant at Beja.

Keywords Wheat genotypes . Zymoseptoria tritici . Resistance . Susceptibility

Introduction

North Africa has been the cradle of wheat production for cen-turies and was the bread basket for the Romain Empire(Bachta 2011). Nowadays, the Maghreb zone of NorthAfrica is still the major durum wheat producer which is thebasis for their traditionnal dishes such as couscous and pasta(Rastoin and Benabdrazik 2014). Tunisia is among the coun-tries with high cereal consumption and the average per capitaconsumption reached 259 kg (Rastoin and Ben Abderrazik2014; Hanson 2016). Durum wheat Triticum turgidum L.subsp. durum (Desf.)) is commonly cultivated in Tunisia prob-ably since the Roman era, while cultivation of bread wheat(Triticum aestivum L. subsp. aestivum) was introduced byFrench colonists in the early 1900s (El Felah et al. 2015).Hence, the cultivation of bread wheat in Tunisia started withthe selection of the cultivar Florence-Aurore that covered upto 80% of the Tunisian bread wheat acreage until 1952 then

Electronic supplementary material The online version of this article(https://doi.org/10.1007/s42161-020-00563-w) contains supplementarymaterial, which is available to authorized users.

* Rim Bel Hadj [email protected]

1 Laboratory of genetics and plant breeding, National AgronomicInstitute of Tunisia (INAT), University of Carthage, 43 AvenueCharles Nicolle, 1002 Tunis, Tunisia

2 CRPWheat Septoria Precision Phenotyping Platform, Tunis, Tunisia3 Regional Field Crops Research Center of Beja (CRRGC) BP 350,

9000 Beja, Tunisia4 Centro Internacional de Mejoramiento de Maíz y Trigo (CIMMYT),

km 45 Carretera México-Veracruz El Batán, Texcoco, Mexico5 Laboratory of Bioagressors and Integrated protection in agriculture,

National Agronomic Institute of Tunisia (INAT), University ofCarthage, 43 Avenue Charles Nicolle, 1002 Tunis, Tunisia

Journal of Plant Pathologyhttps://doi.org/10.1007/s42161-020-00563-w

http://crossmark.crossref.org/dialog/?doi=10.1007/s42161-020-00563-w&domain=pdf

https://orcid.org/0000-0002-0958-3818

https://doi.org/10.1007/s42161-020-00563-w

mailto:[email protected]

dropped to about 50% by 1959 (Ammar et al. 2011; BenHamouda et al. 2016).

After the introduction of the semi-dwarf high yieldingbread wheats lines selected from CIMMYT nurseries knownas « Mexican wheat », the bread wheat lines such as Baroota52, Sonora 63, Inia 66, Tobari 66, Ariana 66 and Mahon 73,selected from introduced populations were releasedandcovered large areas due to their high-yield performances(Saade 1996). These varieties were soon replaced by manywheats line such as ‘Soltane 72’, but also rapidly abandoneddue to their succeptibility tomany diseases namely yellow rustand septoria. During the late 1980’s and early 1990’s,‘Salammbô 80’ was the most grown bread wheat variety thatcovered 70% of the bread wheat acreage and was subsequent-ly followed by ‘Byrsa 87’. These two varieties became themost popular because of their high-yield potentiel and resis-tance to rust and septoria (Saade 1996). More recent releasesuch as Utique (1996), Haidra (2004), and Tahent (2009) hadgood performances and acceptable diseases resistance mainlyto powdery mildew, yellow rust, leaf rust, and septoria(Ammar et al. 2011).

Across the Magreb countries, the most prevalent foliardisease is Septoria tritici blotch (STB) caused by theascomycete fungus Zymoseptoria tritici (Roberge ex Desm.)Quaedvl. & Crous anamorph and Mycosphaerellagraminicola (Fuckel) J. Schröt.1894 teleomorph. This diseasecan reach epidemic levels on early planted cereals particularlywhen rainfall occurs in late winter and/or spring which iscommon in the Mediterranean-type environments (Chartrainet al. 2005).

In Tunisia, STB causes major yield losses on durumwheat (Ben Mohamed et al. 2000) where most commer-cial durum wheat cultivars are highly susceptible to thispathogen while bread wheat has been tolerant to STB(Gharbi and Deghaies 1997; Gharbi et al. 2000). Underfavorable growing conditions STB disease could reduceyield by 40% (Gharbi et al. 2011; Berraies et al. 2014).The prevailing strains seem to have developed a uniqueaggressiveness towards durum wheat (Yahyaoui et al.2000). The opposite situation exists in Morocco, wherebread wheat is the major crop affected by STB(Mazzouz et al. 1995; Zahiri et al. 2014). It has beenpreviously reported that isolates of Z. tritici exhibit bothcultivar specificity (ability to infect only some cultivars ofeither durum or bread-wheat) and host species specificity[ability to only infect one or the other wheat (Kema et al.1996; Kema and Silfhout 1997)]. This contrast betweenMorocco and Tunisia may explain further that specificityof Z. tritici isolates exists in wheat (Yahyaoui et al. 2000).However, in Algeria, the STB represents the major threatto both durum and bread wheat on coastal and sub-littoralregions of the country (Benbelkacem et al. 2011; Ayadet al. 2014).

Recent research provided better insight on the epidemiolo-gy of Z. tritici in the Maghreb countries. Siah et al. (2015)reported a high level of genetic diversity within the MoroccanZ. tritici population. The occurrence of the teleomorph stageof Z. tritici has been confirmed in Algeria and Tunisia(Meamiche et al. 2018; Ben Hassine and Hamada 2014)where the two mating types were found at equal frequencies(Boukef 2012; Ayad et al. 2014). Thus, knowledge of thehost-pathogen relationship and understanding the basis ofhost-specificity and resistance in the Mediterranean area areessential for successful genetic control of STB both on durumand bread wheat in the Maghreb region.

The objectives of this study were: (i) to evaluate bread anddurum wheat varieties from Tunisia, Algeria and Morocco forSTB resistance under natural infection in Tunisia, (ii) to eval-uate the phenotypic differences in resistance of wheat geno-types to STB using the area under disease progress curve(AUDPC), the relative AUDPC (rAUDPC), pycnidial cover-age (PC) and necrosis (N) in order to compare STB develop-ment between wheat species and finally (iii) to investigate therelationships between quantitative traits.

Materials and methods

Description of the study areas and experimentaldesign

Field experiments were conducted during 2016–2017 and2017–2018 wheat-growing seasons, in two regions under dif-ferent sub-humid zones where STB epidemics regularly occur(Fig. 1). The first experiment was carried out at the CRPWheat Septoria Precision Phenotyping Platform- experimen-tal station of the CRRGC at Oued-Beja (36°44′05”N, 9°13″35”E, governorate of Beja, northwest of Tunisia) located inthe sub-humid bioclimatic zone where the average annualrainfall ranges from 500 to 850 mm and a daily mean temper-ature varies between 10 and 28 °C. This area is particularlyknown to be a hot spot for STB especially on durum wheat.The second experimental was carried out at a farmer fieldlocated at Cap Bon Area (36°47′47”N, 11°0′8″E, governorateof Nabeul, northwest of Tunisia) with precipitation and tem-perature rates varying from 400 to 600 mm and from 6 to33 °C, respectively. This region has been recently identifiedas a hot spot for STB especially on bread wheat (Bel HadjChedli et al. 2018).

The experiments were set in two trials and set up in anaugmented design. During 2016–2017, the trials were sownon November 17 and 18 at Beja and Cap Bon, respectivelywhile during the 2017–2018, these fields were sown onNovember 6 and 11 at Cap Bon and Beja respectively. Eachgenotype was sown in paired rows of 2 mwith 4 g of seeds perrow. Standard experimental station plot maintenance was

J Plant Pathol

applied (herbicide, hand weeding and fertilizer application) toensure adequate crop development.

Plant materials

A set of 89 wheat genotypes including bread wheat fromCIMMYT’s International Septoria Observation Nursery(ISEPTON); bread and durum wheat varieties from Tunisia,Morocco and Algeria (Table 1), were screened for their rela-tive resistance to STB. Details about ISEPTON’S stb genesare reported in supplementary data 2. Two susceptible checkswere used in this study: the bread wheat landrace “FarinaArbi” identified as susceptible in Cap Bon region during asurvey conducted in 2015–2016 cropping season (Bel HadjChedli et al. 2018) and the most susceptible durum wheatcultivar ‘Karim’ (Deghaïs et al. 2007; Ammar et al. 2011).

Evaluation of disease severity and area under diseaseprogress curve

Visual disease assessment based on the leaf area covered withpycnidia (PC) and the necrotic area (N) were estimated as apercentage of the uppermost-infected leaves either on Flagleaf or Flag leaf −1 at the end of the growth stage, i.e. GS70.In addition, the symptoms and lesion development over theassessment period were summarized by the area under diseaseprogress curve (AUDPC) that allows the identification of dif-ferent classes of resistance. Disease severity was scored foreach plot using the double-digit scale (Saari and Prescott1975). The first digit (D1) indicates disease progress on theinfected plants, and the second digit (D2) refers to severity ofinfection. Three consecutive evaluations weremade at 10 daysinterval, at GS51, GS59 and GS65 respectively according toZadok’s scales (Zadoks et al. 1974).

The AUDPC and the relative area under disease progresscurve (rAUDPC) were subsequently calculated according toSimko and Piepho (2012) formula:

AUDPC ¼ ∑n−1

i¼1

yi þ yiþ1

2� tiþ1−tið Þ

Where:Yi: STB severity at time ti,t(i + 1)-ti = time interval (days) between two disease scores,n = number of times when STB was recorded.

rAUDPC ¼ AUDPC g2notypeð ÞAUDPC Karimð Þ

Where: Karim is the most susceptible variety used as acheck.

Statistical analysis

All the observations in the experimental field and dependentvariables were subjected to analysis of variance (ANOVA)using ‘aov’ function from R package ‘daewr’ (Lawson 2016)implemented in R software v3.4.2 (R Core Team 2017) andleast-Squares Means using R package ‘lsmeans’ (V. Lenth2016). Distances between wheat genotypes using hierarchicalclustering method and correlations coefficients between char-acters were calculated for all traits analyzed in the study. Aweighted clustering algorithm K-mean (K = 6) (Duda andHart 1973) was performed using JMP®11.0 in order to groupthe different genotypes in classes. Subsequently, Principal com-ponent analysis (PCA) was performed using the JMP®11.0statistical software (SAS Institute Inc., Cary, NC, USA) withComponent analysis procedure (SAS Institute 2014).

Results

Meteorological conditions during the crop cycle

Meteorological data (temperature and rainfall) over differentclimatic regions and during the two cropping seasons was

Fig. 1 Map of Tunisia showing the location of study area (Beja and Cap Bon area) during 2017–2018 cropping season. The STB experiments were set inan augmented design at both locations

J Plant Pathol

Table 1 Wheat cultivars screened for resistance to Septoria tritici blotch disease during 2016–2017 and 2017–2018 cropping seasons

BW/DW

Cultivar name Number Country Provenance Origin/Year

BW Néapolis 1 Tunisia CRRGCB CRRGC & INRAT

BW Mahon 73 1 Tunisia CRRGCB Algeria, 1910

BW Inia 66 1 Tunisia CRRGCB INRAT/CIMMYT, 1970

BW Castan 1 Tunisia CRRGCB France, 1976

BW Dougga 74 1 Tunisia CRRGCB CIMMYT, 1974

BW Florence Aurore 1 Tunisia CRRGCB France, 1974

BW Carthage 74 1 Tunisia CRRGCB Mexico, 1974

BW Ariana66 1 Tunisia CRRGCB France, 1970

BW Tahent 1 Tunisia CRRGCB INRAT/CIMMYT, 2010

BW Haïdra 1 Tunisia CRRGCB INRAT, 2004

BW Utique 96 1 Tunisia CRRGCB INRAT/CIMMYT, 1996

BW Salammbô 80 1 Tunisia CRRGCB INRAT/CIMMYT, 1980

BW Vaga 92 1 Tunisia CRRGCB INRAT/CIMMYT, 1992

BW Byrsa 87 1 Tunisia CRRGCB INRAT/ CIMMYT, 1987

DW Maali 1 Tunisia INGC Tunisia, 2007

DW Nasr 1 Tunisia INGC INRAT/ICARDA, 2004

DW INRAT 100 1 Tunisia INGC INRAT, 2017

DW Dhahbi 1 Tunisia INGC INRAT, 2017

DW Razzak 1 Tunisia INGC INRAT, 1987

DW Salim 1 Tunisia INGC INRAT, 2009

DW Karim 1 Morocco Morocco INRA Morocco, 1985

DW Marzak 1 Morocco Morocco INRA Morocco, 1984

DW Sebou 1 Morocco Morocco INRA Morocco, 1987

DW Omrabia 1 Morocco Morocco INRA Morocco, 1988

BW Amal 1 Morocco Morocco INRA Morocco, 1993

BW Arrehane 1 Morocco Morocco INRA Morocco, 1996

BW Aguilal 1 Morocco Morocco INRA Morocco, 1996

BW Marchouch 1 Morocco Morocco INRA Morocco 1984

DW Tomouch 1 Morocco Morocco INRA Morocco, 1997

DW Algeria1 1 Algeria Algeria DZ/CCB









BW ISEPTONS 49 CIMMYT CIMMYT CIMMYT

Checks Karim 1 Tunisia INGC INRAT/CIMMYT, 1980

Farina Arbi 1 Tunisia Farmers Landrace/El Haouaria farmers

Total: 89

DW: durum wheat, BW: bread wheat

Durum accessions Algerian (DZ) crossing block (CCB)

INGC: Institut National des Grandes Cultures (National Institute of Field Crops)

CRRGCB: Centre Régional de Recherche des Grandes Cultures de Béja (Regional Field Crops Research Center of Béja)

J Plant Pathol

recorded. The variation of temperature and rainfall fromNovember to May during the two cropping seasons of 2017and 2018 is shown in supplementary data Fig. 1.

Although epidemics of STB are associated with favorableweather conditions (frequent rains and moderate temperature)that are encountered in these two regions, the different re-sponses of wheat genotypes across regions were rather asso-ciated to the specialization of the pathogen to the one or theother wheat species.

Genotype by region interaction

Results of this study revealed a good STB development at thetwo locations. Therefore, a significant effect (P < 0.0001 andP < 0.01, Table 2) of genotype and region for pycnidial cov-erage (PC), necrotic area (N) and area under the disease prog-ress curves (AUDPC) was observed. The genotype-by-regioninteraction term in the ANOVA analysis was significant atP0.05, for N, PC and the relative area under the disease prog-ress curve (rAUDPC) indicating different responses of wheatgenotypes to Z. tritici across regions. On the other hand, nosignificant year effect was observed for PC, N and therAUDPC and thus a lack of interaction genotypes-region-year was noted in this study.

Genotypes variation for STB

The data of this study revealed that the highest mean PCand N were observed on the Tunisian durum wheat (68and 74% respectively, Fig. 3) at the experimental stationof Beja where STB occurs annually. At Cap Bon area, theTunisian durum wheat varieties (TDW) were moderatelyinfected with STB where PC and N ranged from 19 to

22% respectively (Fig. 2). A great level of susceptibilitywas observed also on the Algerian durum wheat geno-types (ADW) at both Cap Bon and Beja station wherePC ranged from 30 to 74% (Figs. 2 and 3).

Surprisingly, under natural condition of Cap Bon area, theMoroccan durum wheat genotypes (MDW) known as resis-tant in Morocco showed a moderate level of susceptibility toSTB where PC and N reached 22 and 34%, respectively (Fig.2). The same trend was observed for Moroccan durum wheatat Beja where PC and N ranged between 35 and 45%. HighSTB infection level (63% for PC), was also observed onMoroccan bread wheat genotypes (MBW) at Cap Bon regionwhereas STB was nearly absent on Moroccan bread wheat atBeja. The same situation was observed on Tunisian bread

Table 2 ANOVA analysis for Pycnidial coverage (PC), Necrotic area (N) and the relative area under disease progress curve rAUDPC for 89 wheatgenotypes at Beja and Cap Bon regions

PC N rAUDPC

Source of variation Sum sq Meansq

Fvalue

Pr(>F)1 Sumsq

Meansq

Fvalue

Pr(>F) Sumsq

Meansq

Fvalue

Pr(>F)

Genotypes 179,556 2040.4 7.337 1.06e−07*** 8323 94.58 6.963 1.91 e−07

***18.454 0.209 6.425 2.82 e−07***

Region 2923 2922.8 10.510 0.013** 165 165.37 12.176 0.0016 ** 0.256 0.255 8.203 0.008***

Year 56 55.9 0.201 0.29909 5 4.59 0.338 0.565 0.064 0.06 2.065 0.162

Genotype: Region 50,571 574.7 2.066 0.0173* 2651 30.13 2.218 0.010* 5.776 0.065 2.105 0.0153*

Genotype: Year 2923 112.7 0.405 0.99917 654 7.43 0.547 0.981 1.053 0.011 0.384 0.999

Region: Year 312 311.7 1.121 0.29909 14 14.26 1.050 0.314 0.045 0.044 1.440 0.240

Genotype:region:year 7515 91.6 0.330 0.999 524 5.95 0.438 0.997 0.857 0.031 0.335 0.999

Significant codes: 0 ‘***’ 0.001 ‘**’ 0.01 ‘*’ 0.051 Pr(>F): the significant probability associated with the F statistic

Fig. 2 Variation of PC and N for all genotypes at Cap Bon region during2016–2017 and 2017–2018 cropping seasons. Tunisian durum wheatgenotypes have been grouped as (TDM), Tunisian breadwheat genotypeshave been grouped as (TBW); Algerian durum wheat genotypes havebeen grouped as (ADM); Moroccan durum wheat genotypes have beengrouped as (MBW); Moroccan durum wheat genotypes have beengrouped (MDW)

J Plant Pathol

wheat genotypes (TBW) and ISEPTON with insignificant PCand N levels where they did not exceed 10% (Fig. 2) at CapBon, whereas the susceptible check bread wheat landrace“Farina Arbi” showed high level of susceptibility (70 and65% for PC and N respectively, Fig. 2). Despite the highSTB disease pressure on bread wheat landrace “Farina Arbi”observed in previous survey at Cap Bon region, this landraceseems to be immune at Beja station (Fig. 3).

Genotypes classification

K-means classification proved the presence of significant dif-ferences between all tested genotypes related to the percentageof diseases infection observed in wheat areas included in thestudy. The analysis ranged wheat genotypes in six differentclasses.

At Beja site, an immune reaction (class I: rAUDPC = 0)was recorded for all ISEPTON accessions, and all Tunisianand Moroccan bread wheat genotypes (Table 3). TwoMoroccan wheat genotypes (Sebou and Marchouch) wereranked as resistant (class II; Table 3, Fig. 4) where rAUDPCdid not exceed 0.1. Two Moroccan durum wheat (Marzak,Toumouh) and four Algerian durum wheat genotypes(Algeria2, Algeria 3, Algeria 4, Algeria 7) were ranked asclass III and IV (moderately resistant to moderately suscepti-ble). At Beja site, the genotypes with rAUDPC higher than 0.6such as Algerian durum genotypes: Algeria 5, Algeria 6,Algeria 8, and Algeria 9, Tunisian durum wheat: Salim,Maali, Karim, Dhahbi, INRAT100, and Nasr ranked as classVI and VII, susceptible and highly susceptible cultivars(Table 3, Fig. 4).

On the other hand, at Cap Bon area, the highly resistant andresistant class (I and II) where rAUDPC did not exceed 0.2included the Tunisian durum genotypes (Karim and Salim),

the Algerian durum wheat ‘Algeria 1’, a set of Tunisian breadwheat and ISEPTONS (Table 4; Fig. 5). The moderately re-sistant group (III) where rAUDPC varied from 0.2 to 0.3 in-cluded the following genotypes: Algeria 2, Algeria 3, Algeria4, Moroccan durum genotypes (Sebou and Tomouch) and theTunisian cv. ‘Nasr’ (Table 4; Fig. 5).

The rest of Algerian durum genotypes: Algeria 5, Algeria6, Algeria 7, Algeria 8, Algeria 9, the Tunisian cvs.: Dhahbi,Maali, INRAT100, the Moroccan varieties (Marzak, Amal,Karim and Om rabia) and three ISEPTON accessions wereranked as moderately susceptible and susceptible class IVand V (Table 4; Fig. 5) where rAUDPC did not exceed 0.7.The genotypes with rAUDPC over than 0.8 included theMoroccan bread wheat genotypes: Aguilal, Marchouch andArrehane and the Tunisian landrace (Farina Arbi) were rankedas highly susceptible class VI (Table 4; Fig. 5).

Significant correlation between quantitative traits

Principal component analysis (PCA) allowed detecting simi-larities in the genotypes with regard to STB responses acrosstwo experimental sites during two years (Fig. 6). The majorcorrelated variability of genotypes showed by axes 1 and 2,revealed 6 groups within each region (Figs. 4 and 5). The firstPC1 axe accounted for 98% of the total variability expressedby quantitative traits (AUDPC, rAUDPC, PC, and N) whilethe second component (PC2) accounts for only 1.64% of thetotal variation. On the other hand, strong positive correlationbetween the four infection measures (AUDPC, rAUDPC, PC,and N) of the 89 genotypes was observed in this study (Fig. 6).

Discussion

Disease severity in plant-pathosystems can be assessed eitheronce or several times at some intervals starting from diseaseinitiation until the end of the epidemic. The former method ofassessment measures can be used to estimate different param-eters such as the area under the disease progress curves(AUDPC) and the relative area under the disease progresscurve (rAUDPC) which are used by several pathologists inthe analysis of data on resistance to Septoria (Kema et al.1996; Chartrain et al. 2004; Mojerlou et al. 2009; Ferjaouiet al. 2015). Here, we assessed AUDPC and rAUDPC, pyc-nidial coverage (PC) and the necrotic area (N) under fieldconditions to investigate the behavior of the Tunisian,Moroccon and Algerian bread and durum wheat varieties fortheir resistance to Septoria tritici blotch (STB) at two differentlocations where the pathogen seems to have achieved a spe-cialization to one or other wheat species.

The choice of using Moroccon, Tunisian and Algeriandurum and bread wheat genotypes relies on the fact that eventhough STB poses a serious threat in the Maghreb countries,

Fig. 3 Variation of PC and N across genotypes at Beja station regionduring 2016–2017 and 2017–2018 cropping seasons. Tunisian durumwheat genotypes have been grouped as (TDM), Tunisian bread wheatgenotypes have been grouped as (TBW); Algerian durum wheat geno-types have been grouped as (ADM); Moroccan durum wheat genotypeshave been grouped as (MBW); Moroccan durum wheat genotypes havebeen grouped (MDW)

J Plant Pathol

Table 3 Means and ranges of AUDPC and rAUDPC for all identified clusters at Beja region

Clusters AUDPC rAUDPC Durum wheat genotypes Bread wheat genotypes

IHighlyresistant

Maximum 0.0 0.0 Algeria 1 From ISEPTON 1 to ISEPTON 49, Mahon73,Amal, Arrehane, Aguilal,, Néapolis, Farina Arbi,Salammbô, Tahent, Utique, Vaga,, Ariana66, Byrsa,Carthage, Castan, Dougga, Florence Aurore, Haidra.Inia66.

Minimum 0.0 0.0

Mean 0.0 0.0

IIResistant

Maximum 367.5 0.2 Sebou MarchouchMinimum 220.0 0.1

Mean 293.8 0.1

IIIModerately

resistant

Maximum 937.5 0.4 Marzak, Algeria 7, Algeria2, Algeria 3 –Minimum 772.5 0.4

Mean 857.5 0.4

IVModerately

suscepti-ble

Maximum 1121.3 0.5 Toumouch, Algeria 4 –Minimum 1086.3 0.5

Mean 1014.6 0.5

VSusceptible

Maximum 1528.8 0.7 Algeria 5, 6, 8, Nasr, Salim,Maali,Moroccan varieties (Karim and Omrabia)

–Minimum 1356.3 0.6

Mean 1440.8 0.7

VIHighly

suscepti-ble

Maximum 1775.9 0.8 Algeria 9, Dhahbi, INRAT100, karim –Minimum 1576.3 0.7

Mean 1636.2 0.8

Fig. 4 PCA showing the majorcorrelated variability of genotypesas shown by axes 1 and 2. Thefirst Dimension1 accounted for98% of the total variabilityexpressed by quantitative traitswhile the second component(Dimension2) accounts only1.64% of the total variation. ACPrevealed 6 clusters at Beja region:Cluster 1: Very resistant; Cluster2: resistant; Cluster 3: moderatelyresistant; Cluster 4: moderatelysusceptible; Cluster 5: suscepti-ble; Cluster 6: very susceptible.Details about genotypes of eachgroup are shown in Table 3

J Plant Pathol

Table 4 Means and ranges of AUDPC and rAUDPC for all identified clusters at Cap Bon region

Clusters AUDPC rAUDPC Durum wheat genotypes Bread wheat genotypes

IHighly resistant

Maximum 500.0 0.2 Algeria 1 Ariana66, Byrsa, Carthage, Castan, Dougga,Inia66, Utique, Vaga,

From ISEPTON 10, to ISEPTON 31ISEPTON 34, 35, 36, 39, 40, 42, 43, 44,

48, 8, 9, 3, 4.

Minimum 0.0 0.0

Mean 5.2 0.0

IIResistant

Maximum 425.8 0.2 Salim, Karim, Florence Aurore, Haidra, Néapolis, Tahent,Mahon 73, ISEPTON 2, 24, 32, 33, 37,38,41, 45, 46, 47, 5, 7.

Minimum 22.5 0.0

Mean 232.9 0.1

IIIModerately

resistant

Maximum 686.3 0.3 Algeria 2, 3, 4,Sebou, Tomouch, Nasr.Minimum 449.0 0.2

Mean 591.3 0.3

IVModerately

susceptible

Maximum 1281.3 0.6 Algeria 5, Dhahbi, Maali, INRAT100 ISEPTON 1, 6, 49.Minimum 753.8 0.4

Mean 1138.6 0.5

VSusceptible

Maximum 1491.3 0.7 Marzak, Amal, Algeria 6, 7,8,9, Moroccan varieties(Karim and Om rabia)

Salambo, AmalMinimum 1110.0 0.5

Mean 1325.7 0.6

VIHighly

susceptible

Maximum 1907.5 0.9 – Arrehane, Aguilal, Marchouch, Farina ArbiMinimum 1671.3 0.8

Mean 1785.7 0.8

Fig. 5 PCA showing the majorcorrelated variability of genotypesas shown by axes 1 and 2accounting 98% and 1.64%respectively of the total variabilityexpressed by quantitative traits.ACP revealed 6 clusters at CapBon region: Cluster 1: Veryresistant; Cluster 2: resistant;Cluster 3: moderately resistant;Cluster 4: moderately susceptible;Cluster 5: susceptible; Cluster 6:very susceptible. Details aboutgenotypes of each group areshown in Table 4

J Plant Pathol

different responses towards STB exist in terms of host range.The disease is mostly prevalent on durum wheat in Tunisia(Gharbi et al. 2000) and on bread wheat inMorocco (Mazzouzet al. 1995) while it is a major threat for both durum and breadwheat in Algeria (Ayad et al. 2014).

Results of this study showed a good STB development at thetwo locations. PCA results showed that the four quantitativevariables (N, PC, rAUDPC and AUDPC) contributed in thetotal with 98% of variance, and high positive correlation wasrecorded between these measured parameters. These results arein agreement with Odlibekov et al. (2018) findingwhich report-ed that STB measured parameters affected by the disease in-creased upon disease progression. Similar studies conducted byKaristo et al. (2017) showed a positive correlation betweenquantitative variables (AUDPC and PC) and STB infection.

More important, a significant interaction between Genotype:Region was observed in this study suggesting a possible phys-iological specialization of the pathogen across studied regions(Boughalleb and Harrabi 1997). STB was nearly absent onISEPTON and the Tunisian commercial bread wheat cultivarsat Beja where they were rated as immune to highly resistantgroups (Class I, II and III, respectively), thereby confirmingprevious conclusions about the great level of resistance of breadwheat in Tunisia and/or the adaptation of Z. tritici isolates todurum wheat in Tunisia (Gharbi et al. 2000; Fakhfakh et al.2011). Interestingly, STB was also absent on Moroccan breadwheat varieties at Beja which shows again that Beja is not a hotspot region for STB on bread wheat.

In Cap Bon region, STB was present on Tunisian breadwheat but still insignificant compared to the bread wheat“Farina Arbi” which was considered as a susceptible check in

our study. In this context, Holloway (2014) and McDonald andMundt (2016) reported that when a very susceptible cultivarbecomes widely grown, STB will be more severe in the nextseason on the susceptible wheat. However, insignificant infec-tion was reported on Tunisian durum wheat Karim, Salim andNasr which were ranked as resistant class in this region. Thiscould be mainly associated with the limited cultivated areas ofdurum wheat which represent only 20% of the total cerealgrowing areas at El Haouaria region (Cap Bon area) comparedto ‘Farina Arbi’ that covers of more than 60%.

Surprisingly, STB was strongly present at Cap Bon regionon Moroccan bread and durum wheat genotypes and at Bejaonly on Moroccan durum wheat genotypes with the highestmean of PC, N and rAUDPC and were ranked as very suscep-tible (class VII). This data contrastedwith the finding of Zahiriand collaborators (Zahiri et al. 2014) that highlighted the re-sistance of Moroccan durum wheat and the susceptibility ofbread wheat to STB (Mazzouz et al. 1995; Jilbene 1996) whencultivated in Morocco. This could be related to the great ad-aptation of Z. tritici population to wheat species in each geo-graphic area (Aouini 2018).

As previously reported, STB populations from Cap Bonseem to be mostly specific to bread wheat genotypes (BelHadj Chedli et al. 2018) whereas STB population from Bejaseems to be more adapted to durum wheat genotypes where itoccurs annually (Gharbi et al. 2000). At the country level, thisopposite situation between Morocco and Tunisia could beexplained by the existence of host-species specificity inSeptoria (Kema et al. 1996; Kema et al. 2018). The resistancegenotypes identified in this study may possess different resis-tance genes that can be utilized in gene pyramiding and de-veloping cultivars with broad and durable resistance toSeptoria diseases (Aouini 2018; Medini et al. 2014) mayprove useful in breeding efforts to improve STB resistancein wheat (Zhang et al. 2001).

Future research on the genetic diversity and populationstructure of durum and bread wheat adapted Z. tritici inTunisia is underway. Finally, the analysis of population dy-namics of Z. tritici with respect to diversity and frequencydistribution of the resistance sources is essential to guide de-cisions on developing strategies for durable resistance.

Acknowledgements The authors thank “CRP WHEAT Tunisia SeptoriaPrecision Phenotyping Platform” for supporting this project. We kindlyacknowledgeDr. Abdennour Sbei for providing the Tunisian bread wheatseeds and Dr. Fatiha Bentata and Dr. Abdelkader Benbelkacem for pro-viding the Moroccan and Algerian seeds, respectively.

Compliance with ethical standards

Conflict of interest the authors declare that they have no conflict ofinterest.

This article does not contain any studies with human participants oranimals performed by any of the authors.

Fig. 6 Dimensional relationships among the measured parameters ofSTB infection showing a significant correlation between AUDPC,rAUDPC, N and PC as revealed by principal component analyses overtwo years

J Plant Pathol

Informed consent Informed consent was obtained from all individualparticipants included in the study.

References

Ammar K Gharbi MS, and Deghais M (2011) Wheat in Tunisia. p. 443–463. In Bonjean, APAngus, andWJ van Ginkel,M (eds.) The worldwheat book: a history of wheat breeding. Vol. 2. Lavoisier, Paris,France

Aouini L (2018) Durum wheat and septoria tritici blotch : gene andprospects for breeding. PhD thesis, Wageningen University,Wageningen, Netherlands: 1–225

Ayad D, Sayoud R, Benbelkacem K, et Bouznad Z (2014) La tâcheseptorienne du blé: Première signalisation de la présence enAlgérie des deux Mating types du téleomorphe Mycosphaerellagraminicola (Fuckel) Schröter, (anamorphe: Septoria tritici Rob.Ex Desm.) et diversité phénotypique de l’agent pathogène.“Nature & Technologie ". B- Sciences Agronomiques etBiologiques: 34–45

Bachta MS (2011) La céréaliculture en Tunisie Une politique derégulation à repenser, note d’analyse du CIHEAM, 64:3

Bel Hadj Chedli R, Ben M’Barek S, Yahyaoui A, Kehel Z, Rezgui S(2018) Occurrence of Septoria tritici blotch (Zymoseptoria tritici)disease on durum wheat, triticale, and bread wheat in NorthernTunisia. Chil J Agric Res 78(4):559–568. https://doi.org/10.4067/S0718-58392018000400559

Ben Hamouda H, Ben Youssef S, Sonia Bedhiaf S, Mohamed Annabi M,Zied Draief Z, Gharbi MS (2016) Status of agricultural innovations,innovation platforms, and innovations investment. Tunisia. 2015PARI project country report: republic of Tunisia. Forum for agricul-tural research in Africa (FARA), Accra, Ghana

Ben Hassine A, Hamada W (2014) First isolation of theMycosphaerellagraminicola teleomorph stage causing Septoria leaf blotch on wheatin Tunisia. New Dis Rep 29:18

BenMohamed L, Rouaissi M, Sebei A, Hamza S, Harrabi M (2000) Effetdu génotype, de la date de semis, de la fertilisation azotée etpotassique et des fongicides sur le développement de Septoria tritici.p. 350-356. In Royo, C., Nachit, M., Di Fronzo, N., and Araus, J.L.(eds.) Durumwheat improvement in the Mediterranean region: Newchallenges. CIEHAM, Zaragoza, Spain.(Options Méditerranéenne:Série A. Séminaires Méditerranéens; n. 40

Benbelkacem K, Bouznad Z, Benslimane H, Salhi NL (2011).Occurrence of septoria leaf blotch in Algéria and assessment ofwheat res is tance . 8ème in ternat ional symposium onMycrosphaerella and Stagnospora diseases of cereals, MexicoCity September: 10-14

Berraies S, Ammar K, Gharbi MS, Amor Y, Rezgui S (2014)Quantitative inheritance of resistance to Septoria tritici blotch indurum wheat in Tunisia. Chil J Agric Res 74:35-40

Boughalleb N, Harrabi M (1997) Physiologic specialization of Septoriatritici in North-Africa. Tropicultura 15(1):33–36

Boukef S (2012) Structure des populations, spécificité parasitaire etévaluation de la résistance aux fongicides chez Zymoseptoria triticiagent de la septoriose du blé en Tunisie. Institut NationalAgronomique de Tunisie:1–102

Chartrain L, Brading PA, Makepeace JC, Brown JKM (2004) Sources ofresistance to Septoria tritici blotch and implications for wheat breed-ing. Plant Pathol 53:454–460

Chartrain L, Berry ST, Brown JKM (2005) Resistance of wheat lineKavkaz-K4500 L.6.A.4 to septoria tritici blotch controlled byisolate-specific resistance genes. Phytopathology 95:664–671

Deghaïs M, Kouki M, Gharbi M.S, et El Felah M. 2007. Les Variétés decéréales cultivées en Tunisie. Editions INRAT, 445p

Duda RO, Hart PE (1973) Pattern classification and scene analysis.Wiley, New York

El Felah M, Gharbi MS, Ben Ghanem H, Elloumi M (2015) Les céréalesen Tunisie entre mythe et réalité. Annales de l’INRAT, 2èmeNuméro Spécial Centenaire, 88 :1–17

Fakhfakh MM, Rezgui S, Jarrahi T, Zouani, R, Bousalmi A, Sgatni K,Yahyaoui A (2011) Mapping distribution of Septoria allowedtargeting management options of the disease. 8th InternationalSymposium on Mycosphaerella and Stagonospora Diseases ofCereals, Mexico City 10–14 September 2011

Ferjaoui S, M’Barek SB, Bahri B, Slimane RB, Hamza S (2015)Identification of resistance sources to Septoria tritici blotch in olddurum wheat germplasm applied for the analysis of theZymoseptoria tritici-durum wheat interaction. J Plant Pathol 97(3):471–481

Gharbi MS, et Deghaies M (1997) Principaux enseignements à tirer de lacampagne céréalière 1995/1996. Actes des 3èmes journéesnationales sur les acquis de la recherche agronomique halieutiqueet vétérinaire, 29/11–01/12/1996, Nabeul, Tunisie

Gharbi MS, Deghais M, Ben Amar F (2000) Breeding for resistance toSeptoria tritici in durum wheat :397-401. In Royo C, Nachit M, DiFronzo N, and Araus JL (2000) durum wheat improvement in theMediterranean region: new challenges.: CIHEAM, Zaragoza, Spain.Options Méditerranéennes. Série a: Séminaires Méditerranéens; n.40

GharbiMS, Berraies S, Ammar K, Yahyaoui A (2011) Delivering diseaseresistant cultivars to enhance sustainability of durum wheat produc-tion in Tunisia. p. 60. In Duveiller E, Singh PK, et al. (eds.) 8thInternational Symposium on Mycosphaerella and StagonosporaDiseases of Cereals, Mexico City. 10–14 September 2011. Bookof abstracts. CIMMYT, Mexico

Hanson S (2016) Tunisia grain and feed annual. USDA ForeignAgricultural service, GAIN Report Number, pp 1–8

Holloway G (2014) Septoria tritici blotch of wheat. DEPI informationnote series may 2014. 2 p. Department of Environment and PrimaryIndustries (DEPI), Melbourne, Australia

Jilbene (1996) Etat des recherches sur la septoriose auMaroc. Proceedingdu Symposium régional sur les Maladies des céréales et lesLégumineuses Alimentaires Edit. INRA Rabat : 11–14

Karisto P, Hund A, Yu K, Anderegg J, Walter A, Mascher F, McDonaldBA, et Alexey Mikaberidze A (2017) Ranking quantitative resis-tance to Septoria tritici blotch in elite wheat cultivars using automat-ed image analysis.bioRxiv: 3-44

Kema GHJ, Silfhout CH (1997) Genetic variation for virulence and re-sistance in the wheat–Mycosphaerella graminicola pathosystem III.Comparative seedling and adult plant experiments. Phytopathology87:266–272

Kema GHJ, Annone JG, Sayoud R, Van Silfhout CH, Van Ginkel M, DeBree J (1996) Genetic variation for virulence and resistance in thewheat–Mycosphaerella graminicola pathosystem I. Interactions be-tween pathogen isolates and host cultivars. Phytopathology 86:200–212

Kema GHJ, Gohari AM, Aouini L, Gibriel HAY, Ware SB et al (2018)Stress and sexual reproduction affect the dynamics of the wheatpathogen effector AvrStb6 and strobilurin resistance. Nat Genet50:375–380

Lawson J (2016) Daewr: design and analysis of experiments with R. Rpackage version 1:1–7 https://CRAN.R-project.org/package=daewr

Russell V. Lenth (2016) Least-squares means: The R Package lsmeans.Journal of Statistical Software, 69(1), 1–33. https://doi.org/10.18637/jss.v069.i01

Mazzouz H, Saadaoui M, Jilbène M, Lyamani A (1995) Importance desseptorioses du blé au Maroc en 1991. Al Awamia 91:63–69

McDonald BA, Mundt CC (2016) How knowledge of pathogen popula-tion biology informs management of Septoriatritici blotch.Phytopathology 106(9):948–955

J Plant Pathol

https://doi.org/10.4067/S0718-58392018000400559

https://doi.org/10.4067/S0718-58392018000400559

https://doi.org/10.1007/s42161-00563-

https://doi.org/10.18637/jss.v069.i01

https://doi.org/10.18637/jss.v069.i01

Meamiche HN, Aouini L, Bouznad Z, Gert HJ (2018) Equal distributionof mating type alleles and the presence of strobilurin resistance inAlgerian Zymoseptoria tritici field populations. Plant Disease :1-27

MediniM, Ferjaoui S, Bahri B, MhriW, Hattab S, Sonia Hamza S (2014)Bulk segregant Analysis and marker-trait association reveal com-mon AFLP markers for resistance to Septoria leaf blotch inTunisian old durum wheat. BASE Biotechnol Agron Soc Environ,18(1):3–10

Mojerlou S, Safaie N, Alizadeh A, Khelghatibana F (2009) Measuringand modeling crop loss of wheat caused by septoria leaf blotch inseven cultivars and lines in Iran. J Plant Prot Res 49:257–262

Odlibekov F, Armoniené R, Henriksson T, Chwade A (2018) ProximalPhenotyping and machine learning methods to identify SeptoriaTritici blotch disease symptoms in wheat. Front Plant Sci 9:1–11

R Core Team (2017) R: a language and environment for statistical com-puting. R Foundation for Statistical Computing, Vienna, Austriahttps://www.R-project.org/

Rastoin JL, et Ben Abderrazik H (2014) Céréales et oléoprotéagineux auMaghreb : Pour un co-développement de filières territorialisées.Tunisie : le poids des institutions. Editions Institut de ProspectiveEconomique du Monde Méditerranéen (IPEMED), Maroc, 37p.Rapilly F. 1991. L’épidémiologie en pathologie végétale : mycosesaériennes. Institut National de la Recherche Agronomique 11–36

SaadeME (1996) Adoption and impact of high yieldingwheat varieties innorthern Tunisia. CIMMYT. Economics working paper 96-03.CIMMYT, Mexico D.F

Saari EE, Prescott JM (1975) A scale for appraising the foliar intensity ofwheat diseases. Plant Dis Rep 59:377–380

SAS Institute 2014. ‘JMP® 11 scripting guide.’ 2nd edn (SAS InstituteInc.: Cary, NC, USA)

Siah A, cedex L, Elbekali AY, Ramdani A, Reignault P, Torriani SFF,Brunner PC, Halama P (2015) QoI resistance and mitochondrialgenetic structure of Zymoseptoria tritici in Morocco. Plant Dis, 98(8): 1138–1144

Simko I, Piepho HP (2012) The area under the disease progress stairs:calculation, advantage, and application. PHYTO 102(4):381–389

Yahyaoui A, Hakim S, Al-Naimi M, Nachit MM (2000) Multiple diseaseresistance in durum wheat (Triticum turgidum L. var. durum). p.387-392. In Royo C, Nachit M, Di Fronzo N, Araus JL (eds.).Durum wheat improvement in the Mediterranean region: new chal-lenges. CIHEAM, Zaragoza, Spain. Options Méditerranéennes.Série a: Séminaires Méditerranéens; n. 40

Zadoks JC, Chang TT, Konzak CF (1974) A decimal code for the growthstages of cereals. Weed Res 14(6):415–421

Zahiri S, Farih A, Douira A (2014) Statut des principales maladiescryptogamiques foliaires du blé au Maroc en 2013. J. Appl, Biosci

Zhang X, Haley SD, Jin Y (2001) Inheritance of Septoria Tritici blotchresistance in winter wheat. Crop Sci 41:323–326

Publisher’s note Springer Nature remains neutral with regard to jurisdic-tional claims in published maps and institutional affiliations.

J Plant Pathol

https://doi.org/10.1007/s42161-00563-

Spécificité de Zymoseptoria tritici en Tunisie

Documents

Transcript of Spécificité de Zymoseptoria tritici en Tunisie