original article

918 www.moleculartherapy.org vol. 20 no. 5, 918–926 may 2012

© The American Society of Gene & Cell Therapy

Due to shortage of donor tissue a cure for type 1 diabetes by pancreas organ or islet transplantation is an option only for very few patients. Gene therapy is an alterna-tive approach to cure the disease. Insulin generation in non-endocrine cells through genetic engineering is a promising therapeutic concept to achieve insulin inde-pendence in patients with diabetes. In the present study furin-cleavable human insulin was expressed in the liver of autoimmune-diabetic IDDM rats (LEW.1AR1/Ztm-iddm) and streptozotocin-diabetic rats after portal vein injection of INS-lentivirus. Within 5–7 days after the virus injec-tion of 7 × 109 INS-lentiviral particles the blood glucose concentrations were normalized in the treated animals. This glucose lowering effect remained stable for the 1 year observation period. Human C-peptide as a marker for hepatic release of human insulin was in the range of 50–100 pmol/ml serum. Immunofluorescence staining of liver tissue was positive for insulin showing no signs of transdifferentiation into pancreatic β-cells. This study shows that the diabetic state can be efficiently reversed by insulin release from non-endocrine cells through a somatic gene therapy approach.

Received 9 September 2011; accepted 13 January 2012; advance online publication 21 February 2012. doi:10.1038/mt.2012.8

IntroductIonDiabetes mellitus is a degenerative disease caused by a relative or absolute lack of insulin. The endocrine pancreas is unable to provide sufficient insulin to fulfill the needs of the organism.

Due to shortage of donor tissue a cure of the disease through pancreas organ or islet transplantation is an option only for very few patients.1,2 The only option for the great majority of patients with diabetes is the life-long supplementation of insulin by injec-tion therapy leaving these patients without a cure of the disease.3,4

A potential approach, theoretically providing an option for a cure for diabetic patients with insulin deficiency is the restoration of endogenous insulin production through expression of the insu-lin gene in another organ by a somatic gene therapy approach.

During many years in the past, attempts have been made to establish effective gene therapeutical approaches by insulin gene expression in different cell types of the organism using naked DNA or various virally based systems. These studies aimed at the in vivo transduction of target cells with the insulin gene for the expression of the insulin protein to be released from the produc-ing cells.5–10 Due to various reasons, none of these approaches, however, have been satisfying so far.

Most of the gene therapy studies recently performed were based on adenoviral vectors due to their capability to transduce quiescent nondividing cells and the simplicity to produce high virus titers, which are necessary for in vivo transduction.5,6,9,10 The therapeutic success in these studies was limited because insu-lin expression was only transient and the adenoviruses induced severe host immune responses.5,6 Use of adeno-associated viruses for insulin expression in muscle, which has been studied more recently, yielded a more stable integration with an insulin gene expression lasting several months.11

The expression of an insulin mutant with a lentiviral system in the liver of diabetic rats resulted in a long-lasting normogly-cemia, accompanied by a transdifferentiation of the liver cells into a β-cell like cell type apparently containing insulin secretory granules.12 A transformation of hepatocytes into a β-cell like phe-notype, however, should not be the aim of such a gene therapy approach; rather it should be the aim to maintain the status of the liver cell enabling it to fulfill the whole range of its classical duties as a hepatocyte only with the additional task to express the insulin gene at this atypical site in the organism and to produce sufficient insulin which, when released, can satisfy the insulin needs of the organism.

In the present study, we transduced the liver of strepto-zotocin (STZ)-diabetic and autoimmune-diabetic IDDM rats (LEW.1AR1/Ztm-iddm rats) (a model of the human type 1 dia-betes) in vivo with the complementary DNA (cDNA) encoding for human proinsulin by a third generation lentiviral vector sys-tem.13 To achieve a long-lasting blood glucose normalization even in severely diabetic rats the virus concentration was optimized to obtain a virus titer of 7 × 109 infectious particles per ml to allow treatment of animals with a single injection into the portal vein.

Correspondence: Sigurd Lenzen, Institute of Clinical Biochemistry, Hannover Medical School, 30623 Hannover, Germany. E-mail: lenzen.sigurd@mh-hannover.de

Reversal of Diabetes Through Gene Therapy of Diabetic Rats by Hepatic Insulin Expression via Lentiviral TransductionMatthias Elsner1, Taivankhuu Terbish1, Anne Jörns1,2, Ortwin Naujok1, Dirk Wedekind3, Hans-Jürgen Hedrich3 and Sigurd Lenzen1

1Institute of Clinical Biochemistry, Hannover Medical School, Hannover, Germany; 2Centre of Anatomy, Hannover Medical School, Hannover, Germany; 3Institute of Laboratory Animal Science, Hannover Medical School, Hannover, Germany

Molecular Therapy vol. 20 no. 5 may 2012 919

© The American Society of Gene & Cell TherapyDiabetes Gene Therapy

The hepatocytes did not show any signs of transdifferentiation or immune cell infiltration after this lentiviral transduction.

resultsreversal of a mild and severe diabetic metabolic state in stZ-diabetic rats through transduction with a low dose Ins-lentivirusThrough a single intravenous STZ injection, a mild diabetic state (35 mg/kg b.wt. (body weight) STZ) (Figure 1a) with stable hyper-glycemia of 12 ± 2 mmol/l or a severe diabetic state (55 mg/kg b.wt. STZ) (Figure 1b) with stable hyperglycemia of 24 ± 2 mmol/l was induced. Five days later both groups of STZ-diabetic rats received a single intraportal injection of INS-lentivirus with a low titer (5 × 107/ml) into the portal vein. This INS-lentivirus administration resulted in a fast decrease of the blood glucose concentration by around 6 mmol/l in the case of the mildly diabetic rats and around 12 mmol/l in the case of the severely diabetic rats within 5 days, reaching a stable glycemia of 6–7 and 12–13 mmol/l, respectively, which was maintained during the 1 year observation period (Figure 1a,b). Concentrations of human C-peptide were 49 ± 7 pmol/l in the groups of mildly and 46 ± 9 pmol/l of severely dia-betic rats (Figure 1). In rats treated with enhanced green fluorescent protein (EGFP) lentivirus human C-peptide was not detectable.

Control rats, both mildly and severely diabetic, showed no decrease of the blood glucose concentration after injection of an EGFP control lentiviral vector without insulin cDNA. These animals could not be maintained longer than 14 days due to the severe diabetic metabolic complications in the absence of insulin (Figure 1a,b).

In mildly diabetic animals the rat C-peptide concentration was 54 ± 18 pmol/l. In severely diabetic animals rat C-peptide was below the detection limit (Figure 1).

Glucose tolerance in stZ-diabetic rats transduced with a low dose of Ins-lentivirusIn severely and mildly diabetic rats, which were transduced with a low dose of lentivirus an oral glucose tolerance test (OGTT) (2 g/kg b.wt.) was performed. In the group of mildly diabetic rats (Figure 2b) the immediate increase in the blood glucose concen-tration was from 4 mmol/l up to values of around 13 mmol/l 15 minutes after glucose administration and in the severely diabetic rats from 9 mmol/l to values of around 30 mmol/l (Figure 2a). The blood glucose decrease during the OGTT in the severely STZ-diabetic rats (Figure 2a), which were lacking an endogenous pancreatic insulin secretion, was more sluggish than in mildly STZ-diabetic rats (Figure 2b) with residual pancreatic insulin secretion.

The antihyperglycemic effect of the hepatic insulin release was considerable when the blood glucose concentrations of INS-lentivirus transduced rats were compared with rats which were transduced with control EGFP-virus. One hour after adminis-tration of the oral glucose load the blood glucose was 7 mmol/l lower in the INS-lentivirus transduced rats compared with con-trol rats transduced with EGFP-lentivirus. Owing to the release of insulin produced in the transduced liver blood glucose values were nearly normalized (Figure 2b). The rat C-peptide concen-trations were not significantly different in the two groups (INS-

rats 52 ± 16 pmol/ml, control EGFP-rats 55 ± 20 pmol/ml). The concentration of human serum C-peptide from rats transduced with INS-lentivirus was on average around 50 pmol/l and did not significantly change during the OGTT indicating that human insulin was released from the liver in a constitutive non-regulated manner (Figure 2c,d). In rats transduced with EGFP-lentivirus the human serum C-peptide concentration was below the detec-tion limit (<0.5 pmol/l).

The results of the OGTT were in concordance with those obtained after glibenclamide treatment of the rats. Both INS- transduced and EGFP-transduced mildly diabetic rats reacted with a similar decrease in blood glucose after glibenclamide

15

10

Blo

od g

luco

se (

mm

ol/l)

Blo

od g

luco

se (

mm

ol/l)

Lentivirus

Lentivirus

INS-virusEGFP-virus

INS-virusEGFP-virus

5

0

15

20

25

10

5

0

−5 0 5 10Days

15 20 25 30 3 6Months

9 12

−5 0 5 10Days

15 20 25 30 3 6Months

9 12

a

b

Figure 1 reversal of a (a) mild and (b) severe diabetic metabolic state in stZ-diabetic rats through stable transduction of the liver by low titer Ins-lentivirus injection. A stable mild diabetic state with blood glucose values in the range of 10 and 12 mmol/l was achieved through a single intravenous STZ injection (35 mg/kg b.wt.) five days before the lentiviral administration to hepatocytes by intraportal injection (day 0). Virus preparations were concentrated to a titer of 5 × 107/ml by ultrafiltration with Amicon Ultra columns. Stable persis-tent blood glucose normalization during a 1 year observation period was achieved after a single INS-lentivirus injection at day 0 within 5–10 days (closed circles). Administration of control EGFP-lentivirus did not cure diabetic rats (open circles). In comparable experiments with severely STZ-diabetic rats (55 mg/kg b.wt.) reduction of hyperglycemia with values above 20 mmol/l to stable persistent blood glucose values between 10 and 12 mmol/l for 1 year were achieved albeit glycemia was not fully normalized (closed circles). Blood glucose concentrations are presented as mean values ± SEM of six rats. The administration of INS-lentivirus resulted in human C-peptide concentrations of 49 ± 7 pmol/l for the mildly diabetic rats and 46 ± 9 pmol/l for the severely diabetic rats. In control rats treated with EGFP-lentivirus human C-peptide was not detectable. In mildly diabetic animals the rat C-peptide concentra-tion was 54 ± 18 pmol/l. In severely diabetic animals rat C-peptide was below the detection limit. b.wt., body weight; EGFP, enhanced green fluorescent protein; STZ, streptozotocin.

920 www.moleculartherapy.org vol. 20 no. 5 may 2012

© The American Society of Gene & Cell TherapyDiabetes Gene Therapy

injection (0.5 mg/kg b.wt. intraperitoneally) indicating that the insulin secretory capacity of the residual β-cell mass was not sig-nificantly different in both groups of rats (Figure 2f). The overall lower blood glucose concentration in INS-lentivirus transduced rats in comparison to EGFP-lentivirus transduced rats is evidence for the hepatic insulin release. In the severely STZ-diabetic rats no residual β-cell function was detectable as documented by the unchanged blood glucose concentration after glibenclamide administration (Figure 2e). This conclusion could be confirmed by morphological analyses which revealed a pancreas completely

devoid of β-cells in the islets of all groups of rats treated with a low or high dose of lentivirus.

reversal of a severe diabetic metabolic state in stZ-diabetic rats through transduction with Ins-lentivirusA severe diabetic state with stable hyperglycemia of 24 ± 1 mmol/l (Figure 3a) or 25 ± 3 mmol/l (Figure 3b) was achieved by a single intravenous STZ injection (55 mg/kg b.wt.). Five days later one group of STZ-diabetic rats received a single intraportal injec-tion of 7 × 109 INS-lentiviruses (Figure 3a) and a second group

0 15 45 75 1350

20

40

60

80 INS-virus

EGFP-virus

n.d. n.d. n.d. n.d.n.d.

minutes

Ser

um C

-pep

tide

(pm

ol/m

l)

Ser

um C

-pep

tide

(pm

ol/m

l)

0 30 60 120 1800

20

40

60

80

minutes

0 60 120 180

0

10

20

30

minutes

Blo

od g

luco

se(m

mol

/l)

Blo

od g

luco

se(m

mol

/l)

0 60 120

0

5

10

15

20

minutes

Severely diabetic Mildly diabetic

a b

0 60 120 180 240

0

10

20

30

minutes

0 60 120 180 240

0

5

10

15

minutes

Blo

od g

luco

se(m

mol

/l)

Blo

od g

luco

se(m

mol

/l)

c d

e f

Figure 2 Blood glucose and human c-peptide concentrations in stZ-diabetic rats transduced with a low dose of Ins-lentivirus or control eGFP-lentivirus after an oral glucose tolerance test (oGtt) or a glibenclamide test. (a,b) An OGTT (2 g/kg b.wt.) was performed 60 days after injection of INS-lentivirus (closed circles) or 10 days after injection of EGFP-lentivirus (open circles) in severely STZ-diabetic (55 mg/kg b.wt.) and mildly STZ-diabetic (35 mg/kg b.wt.) rats. (c,d) Human serum C-peptide was measured in parallel in the animals. (e,f) Glibenclamide (0.5 mg/kg b.wt.) was injected intraperitoneally 30 days after injection of INS-lentivirus (closed circles) or 10 days after injection of EGFP-lentivirus (open circles) in mildly diabetic (35 mg/kg b.wt.) rats. Severely STZ-diabetic (in a, c, and e) rats and mildly STZ-diabetic rats (in b, d, and f) were treated with a low dose of INS-lentivirus 5 × 107 infectious particles. Values are presented as mean values ± SEM of 4–6 rats. b.wt., body weight; EGFP, enhanced green fluorescent protein; n.d., not detect-able; STZ, streptozotocin.

Molecular Therapy vol. 20 no. 5 may 2012 921

© The American Society of Gene & Cell TherapyDiabetes Gene Therapy

an injection of 7 × 109 mut-INS-lentiviruses (Figure 3b). In the mutated insulin histidine at position 10 was replaced with aspartic acid, which reduces the proteolytic activity of the insulin-degrad-ing enzyme resulting in a prolonged insulin half-life.14 Both INS-lentivirus and mut-INS-lentivirus administrations resulted in a fast decrease of the blood glucose concentration to values around 7 ± 1 mmol/l within 5–7 days which were maintained during the 1 year observation period (Figure 3a,b). There was no significant difference in the blood glucose reduction achieved between the two treatment groups.

reversal of a severe diabetic metabolic state in autoimmune-diabetic IddM rats by transduction with Ins-lentivirusAutoimmune-diabetic IDDM rats (LEW.1AR1-iddm), a rat model of human type 1 diabetes, with a severe diabetic metabolic state,

as documented by a mean blood glucose concentration of 26 ± 2 mmol/l, received 5–7 days after diabetes manifestation a single intraportal injection of a high dose of INS-lentivirus (7 × 109/ml) for the transduction of hepatocytes (Figure 4). Within 1 week after virus administration blood glucose concentrations were reduced to a mean value of 7 ± 1 mmol/l. Blood glucose normalization was retained during the 1 year observation period.

On the basis of the results it is possible to calculate a dose of 4 × 107–2 × 109 infectious particles required to reduce the blood glucose concentration by 1 mmol/l and per kg body weight. This provides an indication also for the amount of infectious particles required for the treatment of larger animals.

Glucose tolerance of severely stZ-diabetic rats and autoimmune-diabetic IddM rats transduced with Ins-lentivirusThe effect of an oral glucose load (2 g/kg b.wt.) on the blood glucose concentrations of severely STZ-diabetic and autoim-mune-diabetic IDDM rats transduced with INS-lentivirus was comparable. The blood glucose concentrations increased to val-ues of 27–29 mol/l in both groups of animals (Figure 5a,b). In diabetic rats from both groups transduced with EGFP-lentivirus blood glucose concentrations increased to values of around 33 mol/l (Figure 5a,b). Within 3 hours blood glucose concen-tration decreased again continuously to values in the range of 9–12 mmol/l (closed circles in Figure 5a,b). This was a decrease by 17–18 mmol/l, which was significantly lower than in diabetic rats transduced with EGFP-lentivirus in which the blood glu-cose concentrations were reduced only to values in the range of 23–25 mmol/l (open circles in Figure 5a,b). This was a decrease of only 7–9 mmol/l.

Immunofluorescence staining and ultrastructure of liver from IddM and stZ-diabetic rats transduced with Ins-lentivirus or eGFP-lentivirusHepatocytes in representative areas of the liver from IDDM rats transduced with INS-virus showed a faint to moderate insu-lin immunofluorescence staining in the cytoplasm (Figure 6a) whereas EGFP-virus transduced animals revealed only a faint to moderate EGFP immunofluorescence expression in the cytoplasm (Figure 6b) and no insulin staining. The ratios between human insulin and human proinsulin in the transduced liver tissue were determined by enzyme-linked immunosorbent assay in the cyto-solic cell fractions and revealed a value of 0.11 ± 0.03 (n = 5) in the group of IDDM rats transduced with INS-lentivirus. In severely and mildly STZ-diabetic rats transduced with INS-lentivirus the ratio was 0.15 ± 0.03 (n = 5) and 0.12 ± 0.02 (n = 5), respectively. In animals transduced with EGFP-lentivirus neither human insu-lin nor proinsulin could be detected by enzyme-linked immuno-sorbent assay in cytosol preparation of the liver tissue.

Ultrastructural analyses of hepatocytes after transduction with INS-lentivirus and EGFP-lentivirus of STZ-diabetic (Figure 7a,b) and diabetic IDDM rats (Figure 7d) in comparison to non-trans-duced hepatocytes from diabetic control IDDM rats (Figure 7c) clearly showed that all cell organelles including a prominent num-ber of mitochondria and the glycogen pool were well preserved. Secretory granules as potential signs of transdifferentiation were

−5 0 5 10 15 20 25 300

5

10

15

20

25 INS-virusEGFP-virus

Days

Blo

od g

luco

se (

mm

ol/l)

3 6 9 12

Months

−5 0 5 10 15 20 25 30

Days

3 6 9 12

Months

0

5

10

15

20

25 mut-INS-virusEGFP-virus

Blo

od g

luco

se (

mm

ol/l)

Lentivirus

Lentivirusb

a

Figure 3 reversal of a severe diabetic metabolic state in stZ-diabetic rats through stable transduction of the liver by (a) high titer Ins-lentivirus injection and (b) in comparison high titer mut-Ins-lenti-virus injection. A stable diabetic state was achieved through a single intravenous STZ injection (55 mg/kg b.wt.) 5 days before the lentiviral administration to hepatocytes by intraportal vein injection. Virus prepa-rations were concentrated to a titer of 7 × 109/ml by tangential crossflow ultrafiltration. Persisting stable blood glucose normalization during a 1 year observation period was achieved after a single INS-lentivirus injec-tion at day 0 within 5–7 days (closed circles). Administration of control EGFP-lentivirus did not cure diabetic rats (open circles). Blood glucose concentrations are presented as mean values ± SEM of six rats. The administration of INS-lentivirus or mut-INS-lentivirus resulted in human C-peptide concentrations of 101 ± 11 pmol/l and 101 ± 16 pmol, respec-tively. In control rats treated with EGFP-lentivirus human C-peptide was not detectable. The rat C-peptide concentration was in all groups of animals below the detection limit. b.wt., body weight; EGFP, enhanced green fluorescent protein; STZ, streptozotocin.

922 www.moleculartherapy.org vol. 20 no. 5 may 2012

© The American Society of Gene & Cell TherapyDiabetes Gene Therapy

not found in the hepatocytes. No signs of immune cell infiltration were observed in the liver parenchyma, neither in the periportal region nor in the central area from the hepatic lobe.

reverse transcription-Pcr gene expression analyses of β-cell specific transcription factorsThese results of the ultrastructural investigations are in agree-ment with reverse transcription-PCR gene expression analyses, which revealed that in none of the virally transduced livers, both from IDDM rats (Figure 8) and from STZ-diabetic rats (data not shown) an expression of β-cell specific transcription factors like

pancreatic and duodenal homeobox 1 (Pdx1), neurogenic differ-entiation 1 (Neurod1), and homeobox protein Nkx-6.1 (Nkx6.1) was detectable.

To verify whether lentiviral transduction occurs also in organs other than in the liver DNA was isolated from heart and kidney of rats treated by portal vein virus injection. The DNA samples were analyzed for viral DNA integration by TaqMan quantitative PCR assay.15 In none of the animals a lentiviral transduction of heart or kidney was detectable.

dIscussIonIn this study we show that a single injection of lentivirus particles, encoding for recombinant human insulin (INS-lentivirus) into the portal vein of diabetic rats caused a quick reduction of diabetic hyperglycemia. Hepatic insulin expression returned blood glu-cose concentrations to the normal range within 5–7 days without a transdifferentiation of liver cells into a β-cell like phenotype. The therapeutic effect was maintained during an observation period of 1 year.

The achievement of stable hepatic insulin release through INS-lentivirus injection represents a significant progress in comparison to previous studies using adenoviral vectors where the therapeutic effect was only transient due to the lack of integration of the ther-apeutic gene into the host genome, maintaining normoglycemia for only a few weeks.5–10 An adeno-associated viral transduction in the skeletal muscle of STZ-diabetic mice has been reported to result in a more stable integration with an insulin gene expression lasting several months 11. Nevertheless, adeno- associated viral vectors can remain episomally without a stable integration into the genome of the host cells 16. This can again result in a decreased expression of the transgene over time.16

We observed no hypoglycemic episodes in spite of using an expression system, which is not glucose regulated and we did not observe tumor formation in any of the animals treated with INS-lentivirus at the end of the 1 year observation period.

The liver is an ideal target organ for ectopic insulin expression and release.9 Due to the anatomy of the liver it is easy to transduce

−5 0 5 10 15 20 25 300

5

10

15

20

25 INS-virusEGFP-virus

Days

Blo

od g

luco

se (

mm

ol/l)

3 6 9 12

Months

Lentivirus

Figure 4 reversal of a severe diabetic metabolic state in autoimmune- diabetic IddM rats through stable transduction of the liver by high dose Ins-lentivirus injection. Severely diabetic IDDM rats were treated 5–7 days after diabetes induction with an intraportal vein injection of len-tivirus for the transduction of hepatocytes. Virus preparations were con-centrated to titers of 7 × 109/ml by tangential crossflow ultrafiltration. Persisting stable blood glucose normalization during a 1 year observa-tion period was achieved after a single INS-lentivirus injection at day 0 within 5–7 days (closed circles). Administration of control EGFP-lentivirus did not cure diabetic rats (open circles). Blood glucose concentrations are presented as mean values ± SEM of 4–6 rats. The administration of INS-lentivirus resulted in human C-peptide concentrations of 111 ± 11 pmol/l. In control rats treated with EGFP-lentivirus human C-peptide was not detectable. The rat C-peptide concentration was in both groups of animals below the detection limit. EGFP, enhanced green fluorescent protein.

0 60 120 180

0

10

20

30

a b

minutes

Blo

od g

luco

se(m

mol

/l)

Blo

od g

luco

se(m

mol

/l)

0 60 120 180

0

10

20

30

minutes

Figure 5 Blood glucose concentrations in (a) severely stZ-diabetic rats or (b) autoimmune-diabetic IddM rats transduced with a high dose Ins-lentivirus or control eGFP-lentivirus after oGtt. An OGTT (2 g/kg b.wt.) was performed 60 days after injection of INS-lentivirus (closed circles) or 10 days after injection of EGFP-lentivirus (open circles) into diabetic rats. The virus dose in both groups of rats was 7 × 109 infectious particles per rat. Blood glucose concentrations are presented as mean values ± SEM of 4–6 rats. EGFP, enhanced green fluorescent protein; OGTT, oral glucose tolerance test; STZ, streptozotocin.

Molecular Therapy vol. 20 no. 5 may 2012 923

© The American Society of Gene & Cell TherapyDiabetes Gene Therapy

a high number of cells by a single injection. Constitutive secretion is more efficient in the liver than in other organs (e.g., muscle).17

We have taken different technological and methodological measures to optimize INS-lentivirus transduction:

a) A tenfold higher virus titer of the injection solution was achieved by use of an improved virus concentration method based on tangential ultrafiltration, as compared to conventional ultracentrifugation techniques.12

b) The sustained curative effect of a single injection of this INS-lentivirus preparation was achieved without unde-sirable procedures such as partial hepatectomy or clamp-ing-of hepatic veins before the virus injection in order to improve transduction efficiency.12,18

c) In this study we used the latest third generation lentiviral vector system, which under the aspects of efficiency and biosafety is the vector system of choice.19 The transduction was enhanced with the two viral elements cPPT (central polypurine tract) and WPRE (woodchuck hepatitis virus posttranscriptional regulatory element).20,21 The viral vec-tor system lacks, in contrast to that used in the study of Ren and collaborators,12 the expression of the HIV tran-scription factor tat, which may cause undesirable side effects since it can induce transcription of other genes in the host genome that may be detrimental to the cells and to the organism.22,23 This approach might explain why we did not observe any transdifferentiation of liver cells even 1 year after viral transduction, neither in the INS-lentivirus nor in the mut-INS-lentivirus treated group of rats. The performed ultrastructural analyses of the virally transduced livers clearly demonstrated the preserved hepatocyte characteristics without signs of fat deposits or necrosis.24

INS-virus transduceda

b d

c

Negative controlNegative control

EGFP-virus transduced

30 µm

Figure 6 Immunofluorescence staining of liver tissue from IddM rats transduced with (a,b) Ins-lentivirus or (c,d) eGFP-lentivirus. Hepatocytes were positively stained either for insulin (a; red) or EGFP (c; green) in the specifically transduced cells and counterstained with DAPI (blue) in representative areas of paraffin sections. In control sections, in which EGFP-transduced liver tissue was stained for insulin, no immunofluo-rescence was detectable in d as well as in samples from INS-transduced liver tissue, which were stained for EGFP in b. DAPI, 4′,6-diamidino-2- phenylindole; EGFP, enhanced green fluorescent protein.

STZ: EGFP-virus transduced STZ: INS-virus transduced

IDDM: Diabetic control IDDM: INS-virus transduced

a

c

b

d

Figure 7 ultrastructure of liver tissue from stZ-diabetic and IddM rats transduced with (a) eGFP-lentivirus or (b,d) with Ins-lentivirus in comparison to (c) no transduction. EGFP, enhanced green fluores-cent protein; G, glycogen; M, mitochondria; STZ, streptozotocin.

Normal liver

EGFP lentivirustransduced liver

INS lentivirallytransduced liver

Rat islets

Pdx

1

Neu

rod1

Nkx

6-1

rlns

hlns

EG

FP

Act

b

Figure 8 rt-Pcr expression analyses of β-cell transcription factors in liver tissue of diabetic IddM rats after transduction with Ins- or eGFP-lentivirus. One year after transduction of diabetic IDDM rats with INS-lentivirus or 10 days after transduction of diabetic IDDM rats with EGFP-lentivirus RNA was isolated from liver tissue, reverse tran-scribed, and analyzed for expression of the following genes by PCR: pancreatic and duodenal homeobox 1 (Pdx1), neurogenic differentia-tion 1 (Neurod1), homeobox protein Nkx-6.1 (Nkx6-1), rat insulin 1 (rIns), human insulin (hIns), or enhanced green fluorescent protein (EGFP), β-actin (Actb). EGFP, enhanced green fluorescent protein; RT-PCR, reverse transcription-PCR.

924 www.moleculartherapy.org vol. 20 no. 5 may 2012

© The American Society of Gene & Cell TherapyDiabetes Gene Therapy

Our data are at variance from the report of Ren and collabora-tors12 who observed transdifferentiation of most of the hepatocytes towards insulin-producing cells after transduction with the mut-INS-virus. The cells showed the characteristic insulin secretory granules and the expression of several β-cell specific transcription factors. These authors used in their study a lentiviral vector system which expresses several HIV accessory proteins.12 This system is critical due to the potential risk of replication competent viruses occurring after gene recombination with wild-type viruses.19,25

In the present study, we administered the INS-lentivirus not only to rats made diabetic by injection of the pancreatic β-cell toxic diabetogenic agent STZ26 but also to diabetic IDDM rats with an autoimmune-mediated insulin-dependent diabetes.27

The IDDM rat (LEW.1AR1/Ztm-iddm rat) is an animal model of human type 1 diabetes, which shares with human type 1 diabe-tes the etiopathology of an autoimmune disease and has features closely resembling the human disease.27,28 When the INS-lentivirus was administered the animals had high blood glucose values of around 25 mmol/l with a C-peptide level below the detection limit providing evidence for a complete loss of endogenous insu-lin production in their endocrine pancreas. In these animals, the antidiabetic therapy with a single injection of INS-lentivirus was successful returning the blood glucose levels permanently to the normal range.

In spite of the persisting autoimmunity the hepatocytes expressing the insulin protein were not attacked and destroyed by immune cells, as documented by a complete lack of immune cell infiltration in the liver.29,30 Thus, hepatocytes expressing insulin are apparently not a target for autoimmune-mediated destruction. Therefore, long-term normoglycemia could be maintained by this gene therapy approach.

In this study, we show that normalization of the blood glucose concentration through lentiviral transduction of the liver with insulin is an attractive approach without the risk such as viral rep-lication and transdifferentiation of liver cells.12

Insulin expression in liver as presented in this report is also a promising therapeutic principle for treatment of human diabe-tes. Though theoretically suited for full replacement of the insulin requirements of the organism such a constitutive release should be particularly valuable for the purpose of partial insulin replace-ment to provide the organism with the basal needs for insulin.

Indications for such an insulin gene therapy could start with replacement of a few percent of the total needs of insulin to replace the loss of residual β-cell function, which is very valuable to maintain metabolic stability in type 1 diabetes patients. This is documented by the fact that diabetes management becomes much more difficult when patients have lost this residual insulin secre-tory capacity typically years after clinical onset of the disease.31 Insulin gene therapy by such an approach could also serve as a substitute to supply the organism with basal needs of insulin, which are in the range of 50% and typically covered by insulin substitution therapy via administration of long-acting insulin to the diabetic patients.32

The supply of insulin in a glucose-dependent fashion at meal-times could in this situation be provided either by transplanta-tion of islets from a single organ donor, thereby eliminating the need for a large volume of islets as they can be obtained only from

few donors to achieve insulin independence in a type 1 diabetes patient.33

The approach of a partial replacement of the insulin require-ments could be particularly attractive in type 2 diabetes mellitus patients where the disease is not immune mediated. Such a basal supply of insulin from transduced liver cells would lessen the work load of the remaining β-cell mass of the pancreas, thereby allowing the residual β-cells to recover from work overload; the β-cells would then only need to supply the postprandial glucose-dependent insulin supply of the organism. A pharmacological suppression of the immune system would not be required in this case, at variance from any therapeutic approach where insulin-secreting cells of allogeneic origin are transplanted.34

In the present study, the use of an advanced lentiviral vector system in which genes with tumorigenic potential were removed from the vector system proved its safety in the treatment of dia-betic rats. All these potential insulin-replacement therapies by constitutive release from liver cells should be suited therefore in principle in the human situation.

Regulated promoters, which have been considered, are too slow in their responsiveness and provide no benefit over a sys-tem with a constitutive release of insulin.35,36 Further development of glucose or insulin-regulated promoter elements with faster responsiveness might in the future allow the supply of insulin also for short-term needs after the meal.

MaterIals and MethodsCloning human proinsulin cDNA. Human proinsulin cDNA was ampli-fied from a human cDNA library using Pfu proofreading polymerase (Agilent, Waldbronn, Germany) with the composite primers (hINS-KpnI- fw (5′ GTACAGGTACCATGGCCCTGTGGATGCG 3′), hINS-BamHI-rv (5′ TGCTAGGATCCCTAGTTGCAGTAGTTCTCCAGCTGG 3′)) to introduce KpnI and BamHI restriction sites for cloning into the plasmid pcDNA3 (Invitrogen, Darmstadt, Germany). By a PCR-based site-directed mutagenesis technique37 furin recognition sites between the proinsulin B–C junction (primer K29R 5′ TACACACCCAGGACCCGCCGG 3′) and A–C junction (primer L62R 5′ GAGGGGTCCCTGCAGAAGCGT 3′) were introduced as described elsewhere.14 For the generation of a naturally occur-ring insulin mutant with an extended biological half-life the same muta-genesis technique was used to replace additionally the histidine at position 10 with an aspartic acid (H10D).14 The resulting two cDNA sequences cod-ing for the human furin-sensitive proinsulin and the human furin-sensitive proinsulin with H10D mutation were subcloned at first into the pcDNA3 plasmid. These plasmids served as templates for a PCR in which the cyto-megalovirus promoter (CMV) and the respective proinsulin DNA sequences were amplified with the following composite primer CMV-ClaI-fw (5′ GTATCGATCGATGTACGGGCCAGATATACG 3′) and hINS-SalI-rv (5′ TAGTCGACCTAGTTGCAGTAGTTCTCCAGCTGG 3′). The DNA fragments were subcloned into the CalI/SalI site of the lentiviral transfer plasmid pWPT (Addgene, Cambridge, MA). All DNA sequences were veri-fied by sequencing.

Preparation of lentiviral vectors. Lentiviral vector particles were pro-duced according to Zufferey et al.13 In brief, 5 × 106 293FT cells were trans-fected with the packaging plasmid pPAX2 (37.5 µg), the envelope plasmid pcDNA-MDG (7.5 µg), and the transfer plasmids pWPT-Fur-hINS, pWPT-Fur-hINS-mutH10D or pWPT-EGFP (22.5 µg) by calcium phosphate pre-cipitation. The virus particles were harvested from the culture medium 48 hours later and purified by ultrafiltration columns at 3,000 g for 25 minutes (Amicon Ultra Ultracel-100K; Millipore, Schwalbach, Germany). Virus titers (typically 5 × 107 infectious particles) were quantified by a TaqMan

Molecular Therapy vol. 20 no. 5 may 2012 925

© The American Society of Gene & Cell TherapyDiabetes Gene Therapy

quantitative PCR assay.15 For the preparation of high-concentrated lenti-viral vector particles with titers up to 7 × 109 infectious particles per ml tangential ultrafiltration modules were used according to the manufac-turer’s instructions (KROS Flo Minikros Sampler, PS/0.05 µm; Spectrum Laboratories, Breda, Netherlands). For the preparation of 7 × 109 infectious particles per ml, 350–400 ml culture medium supernatant of the 293FT producer were necessary.

Lentiviral transduction of hepatocytes in vivo. LEW.1AR1 and LEW.1AR1/Ztm-iddm rats (IDDM rats)27 were bred in the facilities of the Institute for Laboratory Animal Science, Hannover Medical School. Rats were housed in a barrier sustained facility at 22 ± 2 °C and 50 ± 5% humidity with a 14:10 hours light:dark cycle and ad libitum access to food and water. To induce a severe diabetes (blood glucose concentration >24 mmol/l) male LEW.1AR1 rats (200–220 g b.wt.) were injected with 55 mg/kg b.wt. STZ (dissolved in citrate-buffered phosphate-buffered saline, pH 4.5) into the penis vein. Mild diabetes (blood glucose concentration 10–15 mmol/l) was induced by injection of 35 mg/kg b.wt. STZ. Rats were starved for 4 hours before and 4 hours after injection of STZ. The residual average β-cell area of the mildly STZ-diabetic rats was morphometrically determined using CellP analysis software (Olympus Optical, Hamburg, Germany). In rats treated with INS-lentivirus the area was 14.3 ± 2.7 % (n = 5) of normo-glycemic control rats (100.0 ± 5.2%; n = 4). The value was in the same range as in rats injected with EGFP-virus (12.6 ± 2.7%; n = 4).

The IDDM rat spontaneously develops a severe diabetes (blood glucose concentration >25 mmol/l) at a mean age of 60 days. Four to six days after diabetes manifestation lentivirus preparations (5 × 107 or 7 × 109 infectious particles/ml) were injected into the portal vein. Bleeding was prevented by covering the injection site with a hemostatic topical dressing (Tabotamp; Johnson & Johnson Medical, Norderstedt, Germany).

Body weight and blood glucose concentrations (determined by the glucose oxidase method; Glucometer Contour; Bayer, Leverkusen, Germany) were monitored during the first month after virus injection three times a week, thereafter once a week. There were no significant differences in weight gain in all groups of INS-lentivirus injected rats during the 1 year observation period (213 ± 5 g–492 ± 22 g) apart from the group of severe STZ-diabetic rats treated with a low dose of INS-lentivirus in which the mean body weight was 332 ± 21 g after 1 year. Rats injected with insulin-lentivirus were killed 1 year after treatment, whereas diabetic control rats injected with EGFP-lentivirus were killed 14 days after treatment, because these animals could no longer be maintained due to the severe diabetic metabolic state in the absence of insulin supplementation. The animal procedures were conducted in accordance with the German Animal Welfare Act. All experimental procedures were approved by the District Government of Hannover (LAVES, 509.6-42502-03/684 & 509.6-42502-08/1514).

Functional in vivo studies. An OGTT was performed 60 days after virus injection on rats injected with INS-lentivirus or 10 days after virus injec-tion on diabetic control rats treated with EGFP-lentivirus. After a 4-hour fasting period a glucose load (2 g/kg b.wt.) was administered orally. Blood glucose was determined 0, 15, 45, 75, 105, 135, and 180 minutes after administration. To determine the secretory capacity of the residual β-cell mass in mildly diabetic (35 mg/kg b.wt. STZ) rats, glibenclamide (0.5 mg/kg b.wt.) was injected intraperitoneally 30 days after INS-virus injection or 10 days after EGFP-virus injection. Blood glucose concentrations were measured at the time points 0, 30, 60, 120, 180, and 240 minutes. Human and rat serum C-peptide were quantified with the microplate Mercodia Ultrasensitive C-peptide enzyme-linked immunosorbent assay kit and the Mercodia rat C-peptide enzyme-linked immunosorbent assay kit (Mercodia, Uppsala, Sweden).

Immunofluorescence staining and electron microscopy. Liver tissue from INS-virus or EGFP-virus transduced rats was removed, fixed, and immu-nostained for immunofluorescence analysis by microscopy as previously

described.30 For insulin detection a guinea pig polyclonal antibody against porcine insulin (A565; Dako, Hamburg, Germany) and for EGFP a mouse monoclonal GFP antibody (ab1218; Abcam, Cambridge, UK) was used. These primary antibodies were detected with specific secondary antibodies labeled with Cy3 or Cy2. Images were recorded with the Olympus BX61 microscope (Olympus Optical, Hamburg, Germany) using the appropriate fluorescence filters.

For electron microscopy, small tissue samples from liver after the different transduction strategies were fixed with 2% paraformaldehyde and 2% glutaraldehyde in 0.1 mol/l cacodylate buffer, pH 7.3, postfixed in 1% OsO4 and finally embedded in Epon.30 Thin sections were contrast-stained with saturated solutions of lead citrate and uranyl acetate and viewed in an electron microscope.30

Gene expression analysis by RT-PCR. RNA was isolated from explanted liver tissue of killed rats with the RNeasy Universal Isolation Kit (Qiagen, Hilden, Germany) according to the manufacturer’s manual. Two micro-gram total RNA were reverse transcribed with the RevertAid First Strand cDNA Synthesis Kit (Fermentas, St Leon-Rot, Germany) and random hexamer primer; 2 µl of the cDNA solution were analyzed by PCR (40 cycles at 94 °C, 60 °C, 72 °C each step for 30 seconds, Promega GoTaq Polymerase Kit, Promega, Mannheim, Germany) for the expression of the following genes with the specified primer: rat pancreatic and duodenal homeobox 1 (Pdx1-fw 5′-GAGGGGTCCGGTGCCAGAGT-3′, Pdx1-rv 5′-CGTTCCCAGCGAGCCTGCAA-3′), rat neurogenic differentiation 1 (Neurod1-fw 5′-GCCCACGCAGAAGGCAAGGT-3′, rat Neurod1-rv 5′-CATCAGCCCGCTCTCGCTGT-3′), rat homeobox protein Nkx-6.1 (Nkx6.1-fw 5′-GGTGATGCAGAGCCCGCCTT-3′, Nkx6.1-rv 5′-TGC TGGCCGGAGAATGTGGGT-3′), rat proinsulin 1 (rINS-fw 5′-CCCG GCAGAAGCGTGGCATT-3′, rINS-rv 5′-CATTGCAGAGGGGTGGGC GG-3′), human proinsulin (hIns-fw 5′-GTGCGGGGAACGAGGCTT CT-3′, hIns-rv 5′-GACCCCTCCAGGGCCAAGGG-3′), enhanced green fluorescent protein (EGFP-fw 5′-AGCCGCTACCCCGACCACAT-3′, EGFP-rv 5′-ACCTCGGCGCGGGTCTTGTA-3′), rat β-actin (Actb-fw 5′-GCGTCCACCCGCGAGTACAA-3′, Actb-rv 5′-TTGCACATGCCGG AGCCGTT-3′). The PCR amplification products were separated on 1.5 % agarose gel stained with ethidium bromide.

Statistical analyses. Data are expressed as mean values ± SEM. Unless stated otherwise statistical analyses were performed using ANOVA fol-lowed by Bonferroni’s test for multiple comparisons or t-test for paired cor-relations using the Prism analysis program (GraphPad, San Diego, CA).

acKnoWledGMentsThe excellent technical assistance of Martin Wirth and Monika Funck is acknowledged. We are very grateful to Sir Roy Calne, Cambridge, UK for in-depth discussion of the results and critical reading of the manu-script. The authors declared no conflict of interest.

reFerences1. Paty, BW, Ryan, EA, Shapiro, AM, Lakey, JR and Robertson, RP (2002). Intrahepatic islet

transplantation in type 1 diabetic patients does not restore hypoglycemic hormonal counterregulation or symptom recognition after insulin independence. Diabetes 51: 3428–3434.

2. Bailey, CJ, Davies, EL and Docherty, K (1999). Prospects for insulin delivery by ex-vivo somatic cell gene therapy. J Mol Med 77: 244–249.

3. Calne, RY, Gan, SU and Lee, KO (2010). Stem cell and gene therapies for diabetes mellitus. Nat Rev Endocrinol 6: 173–177.

4. Naujok, O, Burns, C, Jones, PM and Lenzen, S (2011). Insulin-producing surrogate ß-cells from embryonic stem cells: are we there yet? Mol Ther 19: 1759–1768.

5. Dong, H, Morral, N, McEvoy, R, Meseck, M, Thung, SN and Woo, SL (2001). Hepatic insulin expression improves glycemic control in type 1 diabetic rats. Diabetes Res Clin Pract 52: 153–163.

6. Olson, DE, Paveglio, SA, Huey, PU, Porter, MH and Thulé, PM (2003). Glucose-responsive hepatic insulin gene therapy of spontaneously diabetic BB/Wor rats. Hum Gene Ther 14: 1401–1413.

7. Shaw, JA, Delday, MI, Hart, AW, Docherty, HM, Maltin, CA and Docherty, K (2002). Secretion of bioactive human insulin following plasmid-mediated gene transfer to non-neuroendocrine cell lines, primary cultures and rat skeletal muscle in vivo. J Endocrinol 172: 653–672.

926 www.moleculartherapy.org vol. 20 no. 5 may 2012

© The American Society of Gene & Cell TherapyDiabetes Gene Therapy

8. Park, YM, Woo, S, Lee, GT, Ko, JY, Lee, Y, Zhao, ZS et al. (2005). Safety and efficacy of adeno-associated viral vector-mediated insulin gene transfer via portal vein to the livers of streptozotocin-induced diabetic Sprague-Dawley rats. J Gene Med 7: 621–629.

9. Dong, H, Altomonte, J, Morral, N, Meseck, M, Thung, SN and Woo, SL (2002). Basal insulin gene expression significantly improves conventional insulin therapy in type 1 diabetic rats. Diabetes 51: 130–138.

10. Auricchio, A, Gao, GP, Yu, QC, Raper, S, Rivera, VM, Clackson, T et al. (2002). Constitutive and regulated expression of processed insulin following in vivo hepatic gene transfer. Gene Ther 9: 963–971.

11. Mas, A, Montané, J, Anguela, XM, Muñoz, S, Douar, AM, Riu, E et al. (2006). Reversal of type 1 diabetes by engineering a glucose sensor in skeletal muscle. Diabetes 55: 1546–1553.

12. Ren, B, O’Brien, BA, Swan, MA, Koina, ME, Nassif, N, Wei, MQ et al. (2007). Long-term correction of diabetes in rats after lentiviral hepatic insulin gene therapy. Diabetologia 50: 1910–1920.

13. Zufferey, R, Dull, T, Mandel, RJ, Bukovsky, A, Quiroz, D, Naldini, L et al. (1998). Self-inactivating lentivirus vector for safe and efficient in vivo gene delivery. J Virol 72: 9873–9880.

14. Groskreutz, DJ, Sliwkowski, MX and Gorman, CM (1994). Genetically engineered proinsulin constitutively processed and secreted as mature, active insulin. J Biol Chem 269: 6241–6245.

15. Sastry, L, Johnson, T, Hobson, MJ, Smucker, B and Cornetta, K (2002). Titering lentiviral vectors: comparison of DNA, RNA and marker expression methods. Gene Ther 9: 1155–1162.

16. Warnock, JN, Daigre, C and Al-Rubeai, M (2011). Introduction to viral vectors. Methods Mol Biol 737: 1–25.

17. Kafri, T, Blömer, U, Peterson, DA, Gage, FH and Verma, IM (1997). Sustained expression of genes delivered directly into liver and muscle by lentiviral vectors. Nat Genet 17: 314–317.

18. Park, F, Ohashi, K, Chiu, W, Naldini, L and Kay, MA (2000). Efficient lentiviral transduction of liver requires cell cycling in vivo. Nat Genet 24: 49–52.

19. Dull, T, Zufferey, R, Kelly, M, Mandel, RJ, Nguyen, M, Trono, D et al. (1998). A third-generation lentivirus vector with a conditional packaging system. J Virol 72: 8463–8471.

20. Park, F and Kay, MA (2001). Modified HIV-1 based lentiviral vectors have an effect on viral transduction efficiency and gene expression in vitro and in vivo. Mol Ther 4: 164–173.

21. Zufferey, R, Donello, JE, Trono, D and Hope, TJ (1999). Woodchuck hepatitis virus posttranscriptional regulatory element enhances expression of transgenes delivered by retroviral vectors. J Virol 73: 2886–2892.

22. Demarchi, F, Gutierrez, MI and Giacca, M (1999). Human immunodeficiency virus type 1 tat protein activates transcription factor NF-kappaB through the cellular

interferon-inducible, double-stranded RNA-dependent protein kinase, PKR. J Virol 73: 7080–7086.

23. Maggirwar, SB, Tong, N, Ramirez, S, Gelbard, HA and Dewhurst, S (1999). HIV-1 Tat-mediated activation of glycogen synthase kinase-3beta contributes to Tat-mediated neurotoxicity. J Neurochem 73: 578–586.

24. Pavelka, M and Roth, J (2010). Functional Ultrastructure. Springer: Vienna. pp. 140–141.25. Pauwels, K, Gijsbers, R, Toelen, J, Schambach, A, Willard-Gallo, K, Verheust, C et al.

(2009). State-of-the-art lentiviral vectors for research use: risk assessment and biosafety recommendations. Curr Gene Ther 9: 459–474.

26. Lenzen, S (2008). Oxidative stress: the vulnerable beta-cell. Biochem Soc Trans 36(Pt 3): 343–347.

27. Lenzen, S, Tiedge, M, Elsner, M, Lortz, S, Weiss, H, Jörns, A et al. (2001). The LEW.1AR1/Ztm-iddm rat: a new model of spontaneous insulin-dependent diabetes mellitus. Diabetologia 44: 1189–1196.

28. Jörns, A, Günther, A, Hedrich, HJ, Wedekind, D, Tiedge, M and Lenzen, S (2005). Immune cell infiltration, cytokine expression, and beta-cell apoptosis during the development of type 1 diabetes in the spontaneously diabetic LEW.1AR1/Ztm-iddm rat. Diabetes 54: 2041–2052.

29. Arndt, T, Wedekind, D, Weiss, H, Tiedge, M, Lenzen, S, Hedrich, HJ et al. (2009). Prevention of spontaneous immune-mediated diabetes development in the LEW.1AR1-iddm rat by selective CD8+ T cell transfer is associated with a cytokine shift in the pancreas-draining lymph nodes. Diabetologia 52: 1381–1390.

30. Jörns, A, Rath, KJ, Terbish, T, Arndt, T, Meyer Zu Vilsendorf, A, Wedekind, D et al. (2010). Diabetes prevention by immunomodulatory FTY720 treatment in the LEW.1AR1-iddm rat despite immune cell activation. Endocrinology 151: 3555–3565.

31. Bolli, GB (2006). Insulin treatment in type 1 diabetes. Endocr Pract 12 (suppl. 1): 105–109.

32. Pickup, JC and Williams, G, (eds). (2003). Textbook of Diabetes. Blackwell Science Ltd: Oxford. pp. 43.1–43.5.

33. Sutherland, DE, Gruessner, AC, Carlson, AM, Blondet, JJ, Balamurugan, AN, Reigstad, KF et al. (2008). Islet autotransplant outcomes after total pancreatectomy: a contrast to islet allograft outcomes. Transplantation 86: 1799–1802.

34. Fiorina, P, Shapiro, AM, Ricordi, C and Secchi, A (2008). The clinical impact of islet transplantation. Am J Transplant 8: 1990–1997.

35. Burkhardt, BR, Parker, MJ, Zhang, YC, Song, S, Wasserfall, CH and Atkinson, MA (2005). Glucose transporter-2 (GLUT2) promoter mediated transgenic insulin production reduces hyperglycemia in diabetic mice. FEBS Lett 579: 5759–5764.

36. Hsu, PY, Kotin, RM and Yang, YW (2008). Glucose- and metabolically regulated hepatic insulin gene therapy for diabetes. Pharm Res 25: 1460–1468.

37. Picard, V, Ersdal-Badju, E, Lu, A and Bock, SC (1994). A rapid and efficient one-tube PCR-based mutagenesis technique using Pfu DNA polymerase. Nucleic Acids Res 22: 2587–2591.