Retinal Photoreceptor Arrangement, SWS1 and LWSOpsin Sequence, and Electroretinography in theSouth American Marsupial Thylamys elegans(Waterhouse, 1839)Adrian G. Palacios,1* Francisco Bozinovic,2 Alex Vielma,1 Catherine A. Arrese,3 David M. Hunt,4 andLeo Peichl51Centro de Neurociencia de Valparaıso, Facultad de Ciencias, Universidad de Valparaıso, Valparaıso 2370006, Chile2Centro de Estudios Avanzados en Ecologıa & Biodiversidad, Departamento de Ecologıa, Facultad de Ciencias Biologicas, PUC,Santiago 6513677, Chile3School of Animal Biology, University of Western Australia, Crawley, Western Australia 6009, Australia4UCL Institute of Ophthalmology, London EC1V 9EL, United Kingdom5Max Planck Institute for Brain Research, 60528 Frankfurt am Main, Germany

ABSTRACTWe studied the retinal photoreceptors in the mouse opos-sum Thylamys elegans, a nocturnal South American mar-supial. A variety of photoreceptor properties and color vi-sion capabilities have been documented in Australianmarsupials, and we were interested to establish what sim-ilarities and differences this American marsupial showed.Thylamys opsin gene sequencing revealed two coneopsins, a longwave-sensitive (LWS) opsin and a shortwave-sensitive (SWS1) opsin with deduced peak sensitivities at560 nm and 360 nm (ultraviolet), respectively. Immunocy-tochemistry located these opsins to separate cone popu-lations, a majority of LWS cones (density range 1,600–5,600/mm2) and a minority of SWS1 cones (density range100–690/mm2). With rod densities of 440,000–590,000/mm2, the cones constituted 0.4–1.2% of thephotoreceptors. This is a suitable adaptation to nocturnal

vision. Cone densities peaked in a horizontally elongatedregion ventral to the optic nerve head. In ventral—but notdorsal—retina, roughly 40% of the LWS opsin-expressingcones occurred as close pairs (double cones), and onemember of each double cone contained a colorless oildroplet. The corneal electroretinogram (ERG) showed ahigh scotopic sensitivity with a rod peak sensitivity at 505nm. At mesopic light levels, the spectral ERG revealed thecontributions of a UV-sensitive SWS1 cone mechanismand an LWS cone mechanism with peak sensitivities at 365nm and 555 nm, respectively, confirming the tuning pre-dictions from the cone opsin sequences. The two spectralcone types provide the basis for dichromatic color vision,or trichromacy if the rods contribute to color processing atmesopic light levels. J. Comp. Neurol. 518:1589–1602,2010.

© 2009 Wiley-Liss, Inc.

INDEXING TERMS: retina; electroretinogram; cone opsin; photoreceptors; UV vision; marsupials

Among Marsupials, the order of Didelphimorphia (com-mon opossums) is one of the most diverse in phylogeneticand geographic habitat specialization (Eduardo Palma etal., 2002). American marsupials are primitive metatherianmammals that separated from eutherian mammals around125 Myr ago during the Cretaceous, and from the Austra-lian marsupial lineage about 60 Myr ago in the Eocene/Paleocene when Australia separated from Antarctica.

Mammals have a “duplex” retina with rod photorecep-tors for scotopic vision and cone photoreceptors for pho-topic vision and color vision. The photoreceptors show

considerable variation in number and retinal topographyacross species, correlating with the predominant diel ac-tivity pattern, whether diurnal, crepuscular, or nocturnal(Ahnelt and Kolb, 2000; Peichl, 2005). The typical mamma-

Grant sponsor: Comision Nacional de Investigacion Cientıfica y Tecno-logica (CONICYT); Grant number: PBCT-ACT45 (to A.G.P.); Grant sponsor:Australian Research Council; Grant number: Discovery grant DP0662985(to D.M.H./C.A.A.); Grant sponsor: Leverhulme Trust; Grant number:F/07134 (to D.M.H.).

*CORRESPONDENCE TO: Adrian G. Palacios, Ph. D., Centro de Neuro-ciencia de Valparaıso, Universidad de Valparaıso, Facultad de Ciencias,P.O. Box 5030, Valparaıso, Chile. E-mail: adrian.palacios@yahoo.com

Received 14 August 2009; Revised 1 October 2009; Accepted 19 November 2009DOI 10.1002/cne.22292Published online December 8, 2009 in Wiley InterScience (www.interscience.wiley.com).© 2009 Wiley-Liss, Inc.

RESEARCH ARTICLE

The Journal of Comparative Neurology ! Research in Systems Neuroscience 518:1589–1602 (2010) 1589

lian retina contains two spectral cone types, a majority ofmiddle-to-long-wave-sensitive (LWS) cones and a minorityof short-wave-sensitive (SWS) cones expressing either theSWS2 pigment, as found in monotremes (Davies et al.,2007; Wakefield et al., 2008), or the SWS1 pigment, asfound in all other mammals (for review, see Jacobs, 1993;Bowmaker and Hunt, 2006). Depending on species, theLWS cones have their peak sensitivity in the green to yel-low part of the spectrum (!max range about 500–560 nm),the SWS1 cones in the blue to ultraviolet part (!max rangeabout 360–450 nm), and the SWS2 cones at 440 nm (Da-vies et al., 2007).

Whereas the basic pattern in eutherian mammals iscone dichromacy with two types of cone visual pigment,there is recent evidence that some Australian marsupialspossess three spectral cone types and are potentialtrichromats (Arrese et al., 2002, 2006a,b; Cowing et al.,2008), although only two cone opsin genes have beenfound (Strachan et al., 2004; Cowing et al., 2008). How-ever, a second rod opsin gene was found in the Australianfat-tailed dunnart, and if that were expressed in a subpopu-lation of cones, it could account for the trichromacy (Cow-ing et al., 2008). There are only a few studies on the pho-toreceptors of American marsupials. Walls (1939)provided their first description, by using the North Ameri-can opossum Didelphis virginiana and the mouse opossumMarmosa mexicana. Kolb and Wang (1985) quantified rodand cone densities in Didelphis virginiana by conventionalhistology, and Ahnelt et al. (1995) analyzed the distributionof photoreceptors in the South American opossum Didel-phis marsupialis aurita with SWS1 and LWS opsin-specificantibodies. Recently Hunt et al. (2009) showed that twonocturnal American opossum species (Monodelphis do-mestica and Didelphis aurita, order Didelphimorphia, sub-family Didelphinae) have SWS1 and LWS opsins with !max

around 360 nm (UV) and 550 nm, respectively. In addition,the Monodelphis genome possesses a single rod or Rh1opsin gene. In contrast therefore to Australian marsupials,in which a second rod opsin gene has been found that mayaccount for the trichromacy, this is not the case for SouthAmerican marsupials, and the expectation would be thatthey are dichromats.

Cone topographies vary markedly across marsupials.Among the Australian marsupials, the Tammar wallaby hasthe highest LWS cone densities in a horizontal “visualstreak” and in the ventral peripheral retina, whereas thehighest SWS1 cone densities occur in the dorsal periphery(Hemmi and Grunert, 1999). The fat-tailed dunnart, thequenda, and the quokka also have horizontal LWS conevisual streaks, albeit with different locations in either thecentral or dorsal retina, whereas the honey possum has amore radially symmetric LWS cone density gradient peak-ing in central retina (Arrese et al., 2003, 2005). In the

fat-tailed dunnart, quenda, and quokka, the SWS1 conespeak in the dorsal peripheral retina, with an additionalventral peak in the quenda; in contrast, in the honey pos-sum, the highest SWS1 cone density is a ring around theretinal periphery (Arrese et al., 2003, 2005). Among theAmerican marsupials, Didelphis marsupialis aurita has anLWS cone peak in a temporally located area centralis, andrelatively high LWS cone densities in a ventrally locatedhorizontal streak; SWS1 cones are unevenly distributedacross the retina, with highest densities in the dorsal pe-riphery (Ahnelt et al., 1995). In Didelphis virginiana, totalcone density also peaks in a temporal area centralis, butfalls off rather symmetrically toward the periphery withoutshowing a horizontal streak (Kolb and Wang, 1985; thisstudy did not identify the spectral cone types).

Given these differences and the phylogenetic position ofmarsupials, further elucidation of the photoreceptor prop-erties of South American marsupials is crucial for under-standing the evolution of mammalian photoreceptor char-acteristics. We have studied the elegant fat-tailed mouseopossum Thylamys elegans (Didelphinae) from an as yetunstudied genus by using a combination of molecular, im-munohistochemical, and electrophysiological techniques.Thylamys is a strictly nocturnal species (Meserve, 1981)from central Chile, with a partly arboreal habit. It feedsprimarily on insects but occasionally on seeds and fruits.

MATERIALS AND METHODSAnimals

Adult male mouse opossums (Thylamys elegans) werecaptured in the wild from central Chile, and brought to thelaboratory and individually maintained in wire cages in astandard animal facility at the Universidad de Valparaiso(Chile). Each cage contained a food dispenser and shelter,provided by cardboard tubes filled with cotton. Animalswere acclimated for 1 week after capture to prevailingnatural conditions of temperature (15–18°C) and photo-period, and fed ad libitum with commercial cat food (Whis-kas, Waltham, UK). All experiments were approved by thebioethics committee of the Universidad de Valparaiso andcomplied with the international Guide for the Care and Useof Laboratory Animals (National Academy Press, 1996).Permission to work on collected specimens was under au-thorization #3014 from the Chilean Servicio Agricola y Ga-nadero (SAG). To obtain retinae for the molecular and his-tological analysis, animals were euthanized by anintraperitoneally injected lethal dose of ketamine and xy-lazine.

Retinal RNA preparationTotal RNA was extracted from freshly dissected retinae

by using the EpiCentre MasterPure RNA Purification Kit

Palacios et al. ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------

1590 The Journal of Comparative Neurology ! Research in Systems Neuroscience

(EpiCentre, Madison, WI). Purification of mRNA was per-formed by using Oligotex Spin Columns (Qiagen, Valencia,CA). Single-stranded cDNA was synthesized by using anoligo-d(T) anchor primer and Superscript III RT Polymerase(Invitrogen, Carlsbad, CA).

PCR, cloning, and sequencingPrimers LWSF1 and MLWSR972 (Table 1) were used to

generate a 971-bp fragment. The 3" sequence was com-pleted with primers F672 and 3" adapter primer. Polymer-ase chain reaction (PCR) products were visualized by aga-rose gel electrophoresis and cloned into a Promega(Madison, WI) pGEM T-Easy plasmid. Positive colonieswere sequenced by using T7 and SP6 primers. Sequencingwas carried out on both strands by using Big Dye Termina-tor Version 3.1 and an ABI 3730 sequencer.

PhylogeneticsNeighbor-joining (Saitou and Nei, 1987) was used to

construct a phylogenetic tree from opsin nucleotide se-quences after alignment with Clustal X (Higgins et al.,1996). The degree of support for internal branching wasassessed by bootstrapping with 1,000 replicates by usingthe MEGA2 computer package (Kumar et al., 2001).

Retinal histology and opsinimmunocytochemistry

The eyes of three animals were used for immunocyto-chemistry. Directly post mortem, the orientation of theeyes was marked by a ventral perforation of the cornea;the eyes were rapidly enucleated, placed in 4% paraformal-dehyde in 0.1 M phosphate buffer (PB; pH 7.4) overnight,and then transferred to PB. After recording of the eye di-mensions, the eyes were completely opened, and the ret-inae were carefully dissected. Pieces of retina were usedfor transverse 14-#m cryostat sections; other pieces fromdefined retinal regions and three whole retinae were im-munoreacted free-floating. Immunocytochemistry fol-lowed previously described protocols (Peichl et al., 2000,2004). Briefly, adhering remains of the retinal pigment ep-ithelium were bleached, and then the tissue was preincu-bated for 1 hour in PB with 0.5% Triton X-100 and 10%normal goat serum or normal donkey serum, depending on

the secondary antibodies used. Subsequent incubation inthe primary antibody/antiserum solution was for 3–4 days(free-floating tissue) or overnight (sections on the slide) atroom temperature. Rods were labeled with the rod opsin-specific mouse monoclonal antibody rho4D2 (dilution1:500), kindly provided by R. S. Molday (Hicks and Molday,1986).

The LWS cone opsin was detected with the rabbit anti-serum JH 492 (dilution 1:2,000), and the SWS1 cone opsinwith the rabbit antiserum JH 455 (dilution 1:5,000) or thegoat antiserum sc-14363 (dilution 1:500). The rabbit anti-sera were kindly provided by J. Nathans (Wang et al.,1992), and the goat antiserum was purchased from SantaCruz Biotechnology (Heidelberg, Germany). Binding sitesof the primary antibodies were detected by indirect immu-nofluorescence, with a 1-hour incubation in Alexa goatanti-mouse IgG, Alexa goat anti-rabbit IgG, or Alexa donkeyanti-goat IgG, respectively (dilution 1:500–1:1,000; Mo-lecular Probes, Eugene, OR). Double-labeling for LWS coneand SWS1 cone opsin was performed by incubating thetissue in a mixture of antisera JH 492 and sc-14363. In thiscase visualization was by incubation with a mixture of Al-exa 488-conjugated donkey anti-goat IgG and Cy5-conjugated donkey anti-rabbit IgG (dilution 1:250; JacksonImmunoResearch/Dianova, Hamburg, Germany).

In the whole retinae that were used for the topographi-cal analysis of cone densities, incubation with the primaryantisera was followed by an overnight incubation in goatanti-rabbit IgG, an overnight incubation in a rabbitperoxidase-antiperoxidase (PAP) complex, and visualiza-tion with 3,3"-diaminobenzidine (DAB) and H2O2. All of theabove variations of the staining protocol gave consistentresults. Whole retinae and retinal pieces were flattenedonto slides with the photoreceptor side up. All tissue wascoverslipped with an aqueous mounting medium (AquaPoly/Mount, Polysciences, Warrington, PA).

Tissue was analyzed with a Zeiss Axioplan 2 microscope.Micrographs were taken with a CCD camera and the Axio-vision software (Carl Zeiss Vision, Oberkochen, Germany).Images were adjusted for brightness and contrast by usingAdobe (San Jose, CA) Photoshop 7.0. Densities of LWS andSWS1 cones were assessed in the PAP/DAB-reacted reti-nae. At sample fields across the retinae, cones werecounted with a $63 oil immersion objective. At some po-sitions in these retinae, rods could also be counted byusing Nomarski optics and a $100 oil immersion objec-tive. Photoreceptor densities were not corrected forshrinkage, because shrinkage was negligible in the tissuemounted with the aqueous medium.

A piece of dorsal midperipheral retina was processed forsemithin transverse sections. It was dehydrated with eth-anol and propylene oxide and embedded in Epon 812. Withan ultra-microtome, 1-#m sections were cut perpendicular

TABLE 1.Sequences of Oligonucleotide Primers

Primer Sequence (5! to 3!)

LWSF1 ATGACACAGGCATGGGACCMLWSR972 ATGGGGTTGTAGATRGTGCCF672 CAGTCCTACATGATTGTCCTCSWS1F GCGCGAATTCCACCATGTCAGGGGATGAGGAGTTCSWS1R CGGCGTCGACGCACTAGGGCCAACTTGGCTGGAGG

------------------------------------------------------------------------------------------------------------------------------------ Retinal photoreceptors of thylamys elegans

The Journal of Comparative Neurology ! Research in Systems Neuroscience 1591

to the retinal surface, collected on slides, and stained withtoluidine blue.

Specificity of antibodiesThe specificity and characterization of the opsin anti-

bodies have been described. For the rod opsin antibodyrho4D2, rat rod outer segments (OS) were used as im-munogen, and its epitope was mapped to the rhodopsinN-terminus (Hicks and Molday, 1986; Laird and Molday,1988). This antibody has been proven effective to specifi-cally label rod OS in the retina of mammals. In Thylamys,the rod opsin antibody rho4D2 labeled photoreceptorouter segments strongly, and other parts of the photore-ceptor faintly. This is the typical rho4D2 labeling patternobserved in the rods of many mammals, indicating that inThylamys the labeling also is rod-specific. The LWS opsinantiserum JH 492 and the SWS1 antiserum JH 455 wereraised against epitopes of the human red and blue coneopsin, respectively. DNA segments encoding the last 38amino acids of the human red cone opsin (all of which areshared by the human green cone opsin) and the last 42amino acids of the human blue cone opsin were separatelyinserted into the polylinker of the T7 gene 10 expressionvector pGEMEX (Promega). Each cone opsin-derived pep-tide was produced as a carboxy-terminal extension of theT7 gene 10 protein. The fusion proteins were purified andused to immunize rabbits.

Antisera were tested by immunofluorescent staining oftransiently transfected tissue culture cells expressing re-combinant human cone pigments. Each was observed tostain cells transfected with the corresponding cDNA clonebut not untransfected cells (Wang et al., 1992). The SWS1opsin marker sc-14363 is an affinity-purified goat poly-clonal antibody raised against a 20-amino-acid syntheticpeptide mapping within amino acids 1–50 of the humanblue cone opsin (EFYLFKNISSVGPWDGPQYH), as deter-mined from sequencing and mass spectrometry of itsblocking peptide (Santa Cruz Biotechnology; sc-14363 P)by Schiviz et al. (2008). These cone opsin antisera havebeen used in a range of mammals by various laboratoriesand have reliably labeled the respective cone types. JH 492and JH 455 have also been successfully used in Australianmarsupials (Hemmi and Grunert, 1999; Arrese et al., 2003,2005). All cone opsin labeling was localized to photorecep-tor outer segments. Specificity of the antibodies for therespective Thylamys cone opsins was supported by thefact that double-labeling with JH 492 and sc-14363 re-vealed no cones labeled by both antisera. Controls double-labeled with the two SWS1-specific antisera JH 455 (raisedagainst a C-terminal epitope) and sc-14363 (raised againstan N-terminal epitope) showed complete colocalization ofthe labels. Preadsorption of sc-14363 with the peptideagainst which it was raised (sc-14363P) resulted in no

labeling. Omission of the primary antibodies from the im-munostaining protocol resulted in no labeling, showing thespecificity of the secondary antibodies.

Electroretinogram (ERG)The retinal spectral sensitivity was measured by using

the ERG under scotopic and photopic conditions in fourindividuals. Animals were anesthetized with an intraperito-neal injection of ketamine (120 mg/kg) and xylazine (4mg/kg). A few drops of a local cornea anesthetic (1% lido-caine) and of 1% atropine for pupil dilation were applied tothe eye before a contact (Ag/AgCl) electrode was placedon the cornea. The body temperature was maintained at32°C by means of a regulated thermal bed. The proce-dures, the optical system, and the ERG system have beendescribed previously (Chavez et al., 2003; Peichl et al.,2005). In brief, the optical system consisted of a quartzlamp (250 W, ORIEL, Stratford, CT), a monochromator(1,200 lines/mm grating, ORIEL, 20 nm half-bandwidth),an electronic shutter (Uniblitz, Vincent Associates) for theflash duration, and an optical quartz wedge (0–4 OD) toattenuate the incident number of photons. Scotopic exper-iments were done after 20 minutes of dark adaptation. Alight background was obtained by a fiberoptic illuminator(150 W) giving 57.8 #W/cm2 at the cornea for the pho-topic conditions and 0.620 #W/cm2 for our “mesopic”condition. Conventionally a mesopic condition corre-sponds to a background illumination between 0.05 and 0.5#W/cm2 at a wavelength close to 500 nm (Wyszecki andStiles, 1982). The sensitivity of the ERG response wasmeasured as S! % rpeak/i; were i is the flash photon flux atthe cornea, and rpeak is the b-wave peak amplitude result-ing from an average response of n (20–50) dim flashes atwavelengths from 340 to 640 nm. Individual intensity-response functions were normalized by their half-saturating response & value obtained by fitting experimen-tal data to a Hill equation of the form r/rmax % i/i ' &;where i is the flash intensity.

Modeling the ERGThe ERG is the result of a complex (additive or subtrac-

tive) neural integration, and the visual mechanisms con-tributing to the sensitivity cannot be estimated intuitively.We use here an iterative fitting procedure (built in Math-ematica Software, Wolfram Research, Champaign, IL; Her-rera et al., 2008) that combines numerical visual templatesand provides a formal high resolution plot of the full spec-tral sensitivity of visual pigments including the (- and)-absorption bands (Stavenga et al., 1993; Palacios et al.,1998; Govardovskii et al., 2000). The !max of the )-bandwas estimated by using the equation )-band !max % 123 '0.429 !max (-band, based on measurements of isolatedphotoreceptors from several vertebrates (Palacios et al.,

Palacios et al. ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------

1592 The Journal of Comparative Neurology ! Research in Systems Neuroscience

1998). Therefore the spectral response of the ERG is re-produced by:

PERG*!+ " "i%1

n

kipi (l)

where n is the number of different photoreceptor types, itheir corresponding index, ki their relative contribution,and pi the absorption spectra of photoreceptors. The long-wavelength increase in sensitivity by self-screening for ax-ial absorbance is expected to be between 0.1 and 0.3 (vanRoessel et al., 1997) and was ignored in our analysis.

Spectral transmission of the eye lensAnimals (n % 3, with one also used for ERG) were eutha-

nized by an overdose of halothane and decapitated; thenthe eyes were removed. The isolated lens (n % 4 lensesmeasured) was immersed in mineral oil and centered in aplastic holder with a central aperture, and immersed in aquartz block able to transmit visible and UV light. Lenstransmission was measured with a calibrated spectrome-ter (Thermospectronic, Rochester, NY) and a USB4000spectrophotometer device (Ocean Optics, Dunedin, FL) atwavelengths from 260 to 700 nm in 20-nm intervals.

RESULTSCone visual pigments

For ease of comparison, the numbering of all opsinamino acid sequences follows the bovine rod opsin num-bering. For actual residue numbers, subtract 5 from theThylamys SWS1 sequence and add 16 to the Thylamys LWSsequence.

SWS1 opsin coding sequencesThe coding sequence for the Thylamys SWS1 opsin was

PCR-amplified from retinal cDNA and has been depositedin GenBank (accession number DQ356245). Amino acidsequence alignments with other marsupial SWS1 pig-ments, together with representative UVS (mouse) and VS(bovine) pigments from placental mammals, are shown inFigure 1. The phylogenetic tree was generated byneighbor-joining (Saitou and Nei, 1987) from nucleotidesequence data of SWS1 opsins. This shows that the codingsequence forms a clade with other South American mar-supial species (Hunt et al., 2009).

The !max of the SWS1 class of visual pigments rangesfrom UV (generally around 360 nm) to violet (,390 nm),depending on the particular vertebrate species understudy. Previous work (Cowing et al., 2002) has shown thatthe amino acid present at site 86 is critical for determiningthe spectral location of the pigment, such that when Phe ispresent, the peak is in the UV (Hunt et al., 2004). As shown

in Figure 1, Phe86 is present in the SWS1 pigment of Thyl-amys, indicating it is UV-sensitive (UVS). Along with twoother South American marsupials, Monodelphis domesticaand Didelphis aurita, the SWS1 pigment of Thylamys pos-sesses Ala rather than Ser at site 90 (Hunt et al., 2009).Nevertheless, the in vitro expression of the pigment fromDidelphis confirmed UV sensitivity, and this extended tothe Thylamys pigment, as confirmed by the ERG data (seebelow).

LWS opsin coding sequencesThe coding sequence for the Thylamys LWS opsin was

PCR-amplified from retinal cDNA and fully sequenced. De-tails have been deposited in GenBank (accession numberDQ356244). Amino acid sequence alignments with otherSouth American marsupial LWS pigments, together withthe Tammar wallaby, fat-tailed dunnart, and human M andL coding sequences, are shown in Figure 2. A phylogenetictree generated by neighbor-joining (Saitou and Nei, 1987)from the nucleotide coding sequences of LWS opsinsshows that the Thylamys LWS sequence forms a groupwithin the other South American marsupials.

The major tuning sites for LWS pigments are at positions164, 261, 269, and 292 in the opsin protein (Yokoyama andRadlwimmer, 1999). Identical to the LWS pigments of Mono-delphis and Didelphis (Hunt et al., 2009), the Thylamys pig-ment has Ala164, Tyr261, Thr269, and Ala292. This is identi-cal to the LWS pigments in two other marsupials, the honeypossum and quenda (Arrese et al., 2006b; Cowing et al.,2008). The !max for these latter pigments was determined bymicrospectrophotometry to be 557 nm and 551 - 10 nm,respectively (Arrese et al., 2002, 2005), so a similar !max

would be expected for the Thylamys pigment.

Eye structure and immunohistochemicalidentification of rods and cones

The Thylamys eyes had an axial length of about 5.3 mmand an equatorial diameter of about 5.4 mm. Vertical sec-tions of Thylamys retina showed that the outer nuclearlayer (ONL) is the thickest of the retinal layers (Fig. 3A). Asfound in other mammals, this indicates a strong predomi-nance of rod photoreceptors. This was confirmed by im-munolabeling for rod opsin, which in vertical sectionsshowed an intense labeling of a dense, practically contin-uous band of outer segments. Inspection of flattened reti-nae by Nomarski optics at the level of the photoreceptorinner segments also revealed a densely packed array ofsmall rod profiles and only a small population of largercone profiles (Fig. 3B). Such flat views were used to assesstotal photoreceptor densities and cone proportions (seebelow).

Immunolabeling for cone opsins revealed two relativelysparse cone populations (Fig. 4). The more numerous cone

------------------------------------------------------------------------------------------------------------------------------------ Retinal photoreceptors of thylamys elegans

The Journal of Comparative Neurology ! Research in Systems Neuroscience 1593

type showed exclusive LWS opsin labeling, whereas thesparser type showed exclusive SWS1 opsin labeling. Coex-pression of both opsins was not observed in any cones.The LWS cones showed a peculiar pattern. In the ventralretina, they often occured as closely neighboring pairs (ar-rowheads in Fig. 4) that we term double cones followingprevious descriptions of marsupial cones (Walls, 1939; Ah-nelt et al., 1995). In the dorsal retina, most of the LWSpigment was located in single cones, with only a very lowincidence of double cones. All SWS1 cones were singlecones, and no examples of a double cone expressing LWSin one member and SWS1 in the other were seen. Inspec-tion of opsin-labeled flattened retinae by Nomarski opticsrevealed that one member of each double cone pair con-

tained an oil droplet in its inner segment just below thelevel of the immunolabeled outer segment (Fig. 5). An oildroplet was never found in both members of a pair, nor insingle LWS cones or SWS1 cones. In line with the distribu-tion of double cones, oil droplets were frequent in theventral retina but rare in the dorsal retina. However, tissueconditions did not allow us to monitor oil droplets in allparts of the retina, so it is possible that some single coneswith oil droplets were missed. In fixed unstained retinae,the oil droplets appeared colorless.

Cone topographies and rod/cone ratiosCone density distributions were quantified in whole flat-

tened retinae that had been single-labeled for either LWS

Figure 1. The SWS1 coding sequences. A: Marsupial SWS1 cone opsin amino acid sequences aligned with the orthologous sequences frommouse and bovine. The seven transmembrane regions are boxed. The key tunings sites 86 and 90 are identified by arrows. B: Phylogenetic treeof SWS1 cone opsins. The nucleotide sequences were aligned by Clustal X (Higgins et al., 1996), and the tree was generated by the neighbor-joining method (Saitou and Nei, 1987) with 1,000 bootstrap replications. The Kimura two-parameter model for multiple substitutions was applied.The mouse rod sequence forms an outgroup to root the tree. The calibration bar shows substitutions per site. GenBank accession numbers:Thylamys, DQ356245; Monodelphis, DQ352181; Didelphis, DQ352182; AY772471; honey possum, AY772472; tammar wallaby, AY286017;fat-tailed dunnart, AY442173; mouse, NM_007538; bovine, NM_174567; human, NM_001708; mouse rod, NM 145383.

Palacios et al. ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------

1594 The Journal of Comparative Neurology ! Research in Systems Neuroscience

or SWS1 opsin. Each double cone was considered a pairand counted as two cones. Figure 6A shows the isodensitycurves for the total LWS cone population in one retina.Peak LWS cone densities were 5,300–5,600/mm2 in aregion ventral and nasal to the optic nerve head, whereasthe lowest LWS cone densities of 1,600–1,900/mm2 werefound in the dorsal periphery. The isodensity lines are hor-

izontally elongated, indicating a weak “visual streak” ofLWS cones in ventral midperipheral retina. A second retinashowed a somewhat shallower LWS cone density gradient,with highs of 4,300–4,600/mm2 in nasal and ventral mid-periphery and lows of 2,100–2,400/mm2 in dorsal periph-ery. The broken horizontal line in Figure 6A delineates therather sharp border between the ventral half-retina where

Figure 2. The LWS coding sequences. A: Marsupial LWS cone opsin amino acid sequences aligned with the M and L human variants. The seventransmembrane regions are boxed. The key tunings sites 164, 261, 269, and 292 are identified by arrows. B: Phylogenetic tree of the LWS coneopsin in monotreme, metatherian and eutherian species. The nucleotide sequences were aligned by Clustal X (Higgins et al., 1996), and the treewas generated by the neighbor-joining method (Saitou and Nei, 1987) with 1,000 bootstrap replications. The Kimura two-parameter model formultiple substitutions was applied. The mouse rod sequence forms an outgroup to root the tree. The calibration bar shows substitutions per site.GenBank accession numbers: Thylamys, DQ356244; Monodelphis, DQ352179; Didelphis, DQ352180; honey possum, AY772470; pygmy possum,AY772471; quokka, AY745192; tammar wallaby, AY286018; bandicoot, AY745193; numbat, DQ111870; fat-tailed dunnart, AY430816; platypus,EF050078; mouse, NM_008106; bovine, AF280398; human M, NM_000513; human L, NM_020061; mouse rod, NM_145383.

------------------------------------------------------------------------------------------------------------------------------------ Retinal photoreceptors of thylamys elegans

The Journal of Comparative Neurology ! Research in Systems Neuroscience 1595

about 40% of the LWS cones were joined as double cones,and the dorsal half-retina where only few double coneswere present.

The SWS1 cones were present at much lower densities,with highs of 530–690/mm2 in a horizontally elongatedregion nasal and ventral to the optic nerve head, and lowsof 100–200/mm2 in dorsal retina (Fig. 6B). The SWS1cone densities showed larger local variations than the LWScones, and are better visualized by a dot plot than by iso-density lines. Comparison of LWS and SWS1 cone densi-ties in sample fields in a retina double-labeled for LWS andSWS1 opsins (cf. Fig. 4) showed that SWS1 cones com-prised about 7% of all cones in ventral retina, 8–12% inmidretina, and 6–22% in dorsal retina. The large dorsalvariation of SWS1 cone percentages is due to their partic-ularly large local density variation in that region.

Rod densities were assessed by Nomarski optics (cf.Fig. 3B) at suitable positions across the retinae, but no fulltopographic mapping was attempted. Their density rangewas 440,000–590,000/mm2, with large local variationsand a trend toward higher rod densities in dorsal retina andlower densities in central and mid-ventral retina. Evalua-tion of sample fields in which the cones were immunola-

Figure 5. Double cones and oil droplets. Micrograph from theventral part of a flat-mounted retina double immunofluorescencelabeled for LWS opsin (magenta) and SWS1 opsin (turquoise).Superimposed is the Nomarski image showing the oil droplets(black arrows) and the numerous unstained rod outer segments asphase images. An oil droplet is present in each LWS double cone(white arrowheads), but not in LWS or SWS1 single cones. Scalebar % 20 #m.

Figure 3. Thylamys retinal morphology and photoreceptors.A: Transverse 1-#m section from mid-dorsal retina, stained with tolu-dine blue. The thick outer nuclear layer (ONL) containing the photo-receptor somata indicates high rod densities. The long outer andinner segments of the photoreceptors (OS, IS) are typical for noctur-nal retinae. CH, choroid; RPE, retinal pigment epithelium; OPL, outerplexiform layer; INL, inner nuclear layer; IPL, inner plexiform layer;GCL, ganglion cell layer. B: On-view of the layer of photoreceptorinner segments in a flattened retina (Nomarski optics); the field is inthe nasal midperiphery. The rods with their smaller cross sections aredensely packed; a few cones are recognized by their larger crosssections (presumably oil droplets; two indicated by arrowheads).Scale bar % 50 #m in A; 10 #m in B.

Figure 4. Thylamys spectral cone types. Micrograph from a flat-mounted retina double immunofluorescence labeled for the twocone opsins. LWS opsin label (antiserum JH 492) is shown inmagenta, and SWS1 opsin label (antiserum sc 14363) in green.Only the respective cone outer segments are labeled. The twoopsins are expressed in separate cone populations; there is nocoexpression of the opsins in any cones. The picture is a collapsedimage stack of several focal levels; the two white structures thatmight signify colocalization of the two labels are in fact separatecone outer segments that happen to partly overlap. The micro-graph is from ventral retina, in which a substantial proportion ofthe LWS cones occur as double cones with closely adjoining outersegments (some indicated by arrowheads). The SWS1 cones forma minority. Scale bar % 50 #m.

Palacios et al. ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------

1596 The Journal of Comparative Neurology ! Research in Systems Neuroscience

beled and the rods visible by Nomarski optics showed thatcones constituted 0.4–1.2% of the photoreceptors, withthe higher percentages in ventral retina (where cone den-sities are higher and rod densities lower) and the lowerpercentages in dorsal retina.

Lens transmittanceThylamys is nocturnal, and the efficiency of retinal pho-

ton catch relies in part on the light transmission propertiesof its eyes. Furthermore, spectral lens transmission deter-mines which light wavelengths reach the retina. Thylamyslens transmittance is 25% at 700 nm and drops to 5% at320 nm (Fig. 7, average for three individuals). Hence lenstransmission is below half-maximum (.12%) in thenear-UV range (.400 nm). This is relatively low but wouldstill allow UV cones to be stimulated. A more detailed com-parison of the three individuals shows individual variationsin the 50% cutoff values (half-maximum) of 343 - 1.95 nm(n % 3 independent measures), 363 - 12.2 nm (n % 6),and 401 - 30.2 nm (n % 7). A possible explanation for thevariation in mean values could be age differences betweensubjects, but this could not be assessed.

ERG recordingsTo assess the contribution of rods and cones to the

spectral sensitivity of the eye, a series of ERG recordingswas carried out under scotopic and mesopic conditions.Under our current experimental conditions, we were un-able to evoke any photopic ERG response, and this may be

Figure 6. Topographic distribution of cones. A: Isodensity map ofLWS cones. The bold contours are isodensity lines, and the numbersgive densities in cones/mm2. Each LWS-labeled outer segment wascounted as one cone; hence double cones were counted as twocones. The broken horizontal line marks the sharp border betweenthe ventral region with a high incidence of double cones and oildroplets and the dorsal region with very few double cones and oildroplets (see text for details). B: Density map of SWS1 cones. Eachdot represents a sample field, and the dot area the local density;corresponding densities in the inset are given in cones/mm2. In bothmaps, the fine contour outlines the retinal flatmount, and the finecentral circle marks the position and size of the optic nerve head. D,dorsal; V, ventral; T, temporal; N, nasal. Scale bar % 3 mm in A (alsoapplies to B).

Figure 7. Lens spectral transmission in Thylamys. The mean lenstransmission is given in percent (black dots - SD); it was obtainedfrom three individuals and four lenses sampled several times (n %2–7 times) and averaged. The wavelength of half-maximal transmis-sion (50% cutoff value) was calculated for each individual and yieldedvalues of 343 - 1.95 nm; 363 - 12.2 nm; and 401 - 30.2 nm,respectively.

------------------------------------------------------------------------------------------------------------------------------------ Retinal photoreceptors of thylamys elegans

The Journal of Comparative Neurology ! Research in Systems Neuroscience 1597

accounted for by the presence of only a very small numberof cones (about 1%) in the Thylamys retina (see Cone to-pographies and rod/cone ratios section above). A repre-

sentative scotopic ERG family response to ! % 480 nm and5-ms-duration flashes of increasing intensities is shown inFigure 8A. Figure 8B shows a normalized response inten-sity function of the b-wave amplitude for three animals.The continuous line is the best fit to the data by using a Hillequation (see Materials and Methods). The response in-creases first as a linear function of the intensity and thenreaches a saturating plateau.

The changes in sensitivity of the eye during dark adaptationconstitute a crucial property of the visual system, and theshift from cone to rod sensitivity provides important informa-tion on the potential for visual adaptation to natural light con-ditions. The sensitivity of the b-wave elicited by dim ! % 500nm and 5-ms flashes was followed during dark adaptation forthree individuals (Fig. 8C). After turning the light off (timezero), there was a rapid increase in sensitivity with a slope,depending on the individual, of about 1 log unit at 60 secondsand between 1 to 3 log units at 5 minutes. In these experi-ments we were not able to maintain stable recordings beyond10 minutes. Furthermore, we noticed that not all three ani-mals gave a similar slope and only one showed a sensitivityincrease by 3 log units. As explained previously, a photopicERG response could not be obtained, so the starting point forthe dark adaptation experiments was at a mesopic level, andthis may explain the variability in final sensitivity. However, incases of longer dark adaptation times, as for the scotopicspectral sensitivity experiments (Fig. 9A), in which the ani-mals were dark-adapted for 20–30 minutes before an exper-iment, the mean eye sensitivity was around 3 log units higher(n % 4) than the mesopic level.

The scotopic spectral sensitivity, after correction forlens spectral transmission, in four individuals is shown inFigure 9A. The open circles represent the mean b-waveamplitude (- SEM) for 5–10 ms (depending on sensitivity),dim flashes (averages of n % 10–20), and wavelengths

Figure 8.

Figure 8. Electroretinography response and dark adaptation exper-iments: A: ERG b-wave family response to monochromatic flashes(! % 480 nm, duration 5 ms, delivered at t % 100 ms) of increasingintensity: 0.008 (average of n % 15 flashes), 0.02 (n % 15), 0.04 (n %10), 0.08 (n % 10), 0.19 (n % 10), 0.38 (n % 10), 0.75 (n % 10), 1.88(n % 10), 3.76 (n % 10), and 7.49 (n % 10) photons #m/2 deliveredat the cornea. B: Normalized scotopic response intensity functionsfrom three animals. Stimuli were monochromatic flashes with ! %480 nm (empty symbols) or ! % 500 nm (filled symbols) and 5-msduration, delivering an increasing number of photons. Each valueresults from an average of 10–30 flashes. The three functions werealso normalized in the intensity axis by using individual & valuesderived from the best Hill fit equation (see Materials and Methods).C: Dark adaptation functions for three individuals. Time zero corre-sponds to light off after an extended mesopic adaptation. Stimuli(n % 5 on average) were monochromatic flashes (! % 480 nm, du-ration 5 ms) of decreasing intensities. The continuous line in eachcase is a best fit using an exponential decay function from the ORIGINstatistics package (Origin, Northampton, MA).

Palacios et al. ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------

1598 The Journal of Comparative Neurology ! Research in Systems Neuroscience

between 340 and 640 nm at 20-nm intervals. The contin-uous solid thick line represents the best rod visual tem-plate (see Materials and Methods). A !max (peak sensitiv-ity) of 505 nm for the (-band was estimated by the best fit(r2 % 0.97) to the experimental data. We observed a smalldeviation in sensitivity around 420–450 nm from the rodtemplate, and a possible contribution from cones cannotbe discounted, although the small number of individualsstudied precludes any firm conclusion. The !max is in therange of the rod peak sensitivity described for other mar-supials (Cowing et al., 2008).

American marsupials would appear to be dichromats,whereas some Australians species appear to be conetrichromats (Arrese et al., 2003, 2006b). Hence we carriedout experiments designed to establish the photopic spec-tral capacity of the Thylamys retina. We initially used aphotopic background illumination, but were unable to ob-tain a clear photopic ERG response. We therefore used amesopic condition (see Materials and Methods), in whichthe potential of rod and cone contributions to the ERG canbe ascertained. Figure 9B shows the mesopic spectral sen-sitivity for four individuals, after correction for lens spec-tral transmission (c.f. Fig. 7). The open circles representthe mean b-wave amplitude (- SEM) for 5–30 ms (depend-ing on sensitivity), dim flashes (averages of n % 10–20),and wavelengths between 340 and 640 nm at 20-nm in-tervals. As expected in a situation in which both cones androds contribute, a single template with !max at about 500nm was unable to explain the complete sensitivity func-tion. To uncover the individual mechanisms that contributeto the ERG, a fitting procedure based on the additive mix-ture of different visual templates was used (see Materialsand Methods). In the four individuals tested, we observedthat the best fit (r2 % 0.93) was achieved by the additivemixture (solid thick line) of three visual templates with!max % 365 nm (broken line, 9% relative contribution);!max % 505 nm (solid thin line, 64%), and !max % 555 nm(dotted line, 27%). For both groups, the modeling of themesopic spectral ERG curve suggests an SWS1 conemechanism with !max around 365 nm (near UV) and anLWS cone mechanism with !max around 555 nm, togetherwith an Rh1 rod mechanism with !max around 505 nm.

DISCUSSIONThe present molecular, immunocytochemical, and phys-

iological findings show that the retina of the nocturnalSouth American marsupial Thylamys elegans possesses asmall population of cones in an otherwise rod-dominantretina. The high rod densities of 440,000–590,000/mm2

indicate a retina that is well adapted to nocturnal vision(for reviews, see Ahnelt and Kolb, 2000; Peichl, 2005).Cones make up around 1% or less of the photoreceptorsand are composed of two spectral types, characterized bya longwave-sensitive LWS pigment (!max 555 nm) and aUV-sensitive SWS1 pigment (!max 365 nm), respectively.As expected, the amino acid sequences of the two coneopsins show highest homology to the orthologues of otherSouth American marsupials, with a slightly lower homologyto the orthologues of Australian marsupials. No evidencecould be obtained for the expression of additional coneopsin genes in the Thylamys retina, consistent with thepresence of only a single LWS gene and a single SWS1 genein the Monodelphis genome (Hunt et al., 2009).

Figure 9. ERG spectral sensitivity functions. Spectral sensitivitiesassessed from the ERG b-wave under (A) scotopic and (B) mesopicconditions; each circle represents the mean spectral sensitivity -SEM from four individuals. A: Values were arbitrarily shifted on thesensitivity axis for better visualization. The continuous curve repre-sents the best fit (see Materials and Methods) to the experimentaldata. The best fit (r2 % 0.97) was obtained for !max % 505 nm, hencerepresenting a conventional rod visual pigment template. B: In themesopic condition, the best fit (r2 % 0.93) was achieved by theadditive mixture (solid thick line) of three visual templates with!max % 365 nm (SWS1 pigment, broken line, 9% relative contribu-tion); !max % 505 nm (rod pigment, solid thin line, 64%); and !max %555 nm (LWS pigment, dotted line, 27%). Flashes were 5–30 ms induration and n %10–20 on average.

------------------------------------------------------------------------------------------------------------------------------------ Retinal photoreceptors of thylamys elegans

The Journal of Comparative Neurology ! Research in Systems Neuroscience 1599

Cone types and oil dropletsImmunocytochemistry locates the two cone opsins to sep-

arate cone populations, a more numerous one with exclusiveLWS opsin expression and a sparser one with exclusive SWS1opsin expression (roughly 10% of the cones). There is no co-expression of the two opsins in any cones. LWS cones occuras either single cones or double cones, and as we have nomolecular indication for two variants of the LWS opsin (whichmight both be recognized by antiserum JH 492), we concludethat the single cones and both members of the double coneexpress the same opsin. The only visible difference betweenthe two members is the presence of an oil droplet in one butnot the other. The oil droplets appear colorless in fixed tissue.We assume that they are also colorless in the living retina,because pigeon oil droplets keep their colors after parafor-maldehyde fixation (own unpublished observation). This ar-gues against a filter property of the oil droplets in the long-wave region of the spectrum and suggests that bothmembers of the LWS double cone have the same spectralsensitivity.

Colorless oil droplets and double cones are typical conefeatures of both Australian and American marsupials, butthere are differences in detail. In Thylamys, the oil dropletsappear confined to the double cones, whereas Didelphisvirginiana and Marmosa mexicana have colorless oil drop-lets in double cones and in some single cones (Walls,1939). Didelphis marsupialis has a colorless oil droplet inthe double cones and in some LWS single cones, but not inSWS1 cones (Ahnelt et al., 1995), whereas Australian mar-supials have a colorless oil droplet in each cone, irrespec-tive of spectral type (tammar wallaby: Hemmi and Grunert,1999; fat-tailed dunnart and honey possum: Arrese et al.,2003; quokka and quenda: Arrese et al., 2005).

The functions of the colorless oil droplets in marsupialsare unknown. In nonmammalian vertebrates, many oildroplets are colored and act as spectral filters matched tothe spectral absorbance of the visual pigment in the conetype (see, e.g., Hart, 2001; Jacobs and Rowe, 2004). Inmarsupials and in monotremes, they are considered a ves-tige from the ancestral reptilian design, which was thenlost in eutherian retinae (for review, see Ahnelt and Kolb,2000). It has been suggested that oil droplets are also lightcollectors that enhance the photon capture in cone outersegments (Young and Martin, 1984). This property wouldbe advantageous in mesopic conditions, as it may shift theworking range of cones to lower light levels, and may beone reason why the mostly nocturnal marsupials have re-tained oil droplets (Ahnelt et al., 1995).

Spectral sensitivity of Thylamysphotoreceptors

The spectral ERG measurements were conducted at me-sopic light levels because no clear photopic ERG response

could be obtained. One reason for this could be that the coneproportion among photoreceptors and the total cone numberper retina is too low to produce an above-noise signal in thebulk retinal response recorded by the corneal ERG. A similarproblem has been encountered in ERG recordings of bat eyes,which also have low cone numbers (Muller et al., 2009). How-ever, this may not pose a problem for Thylamys cone-basedvision. The mammalian retinal circuitry is well equipped toisolate the cone signals, as it specifically and selectively tapsthem by the cone bipolar cells.

The peak sensitivities of the two Thylamys cone pig-ments at 365 nm for the SWS1 pigment and 555 nm for theLWS pigment are separated by 190 nm, and a similar sep-aration is seen in two other American marsupials, Mono-delphis and Didelphis (Hunt et al., 2009). In eutherianmammals, however, the separation is generally less. UVSSWS1 pigments (!max around 365 nm) are retained bycertain rodents, but in these cases, the separation is re-duced to around 150 nm by the tuning of the LWS pigmentto shorter wavelengths (around 510 nm); in carnivores andartiodactyls, the SWS1 pigments are tuned to the blueregion (!max around 440 nm) but with LWS pigments tunedto approximately 555 nm (data reviewed in Jacobs, 1993).A noticeable exception is found in the Microchiroptera,which also show a separation of about 200 nm betweenthe UV-sensitive SWS1 and the LWS pigment (Wang et al.,2004; Muller et al., 2009; Zhao et al., 2009). Further stud-ies are needed to elucidate the respective advantages anddisadvantages of these different spectral spacings.

Taken together, our data demonstrate that Thylamys is acone dichromat and suggest that it has dichromatic colorvision at photopic light levels. Potential trichromatic colorvision at mesopic light levels, at which the rods may alsocontribute to color vision, would have to be assessed bybehavioral studies.

Thylamys photoreceptors and ecologyScotopic vision is mediated by the rod system, and Thyl-

amys has suitably high rod densities. However, all mammalshave “duplex retinae” containing rods and cones; even themost nocturnal mammals have retained sparse cone popula-tions (for reviews, see Ahnelt and Kolb, 2000; Peichl, 2005),and Thylamys is no exception. One reason may be that the rodpathway of the mammalian retina “piggy-backs” on the conepathway (for reviews, see Sharpe and Stockman, 1999;Wassle, 2004) and cannot function without at least a rudi-mentary cone pathway. Cone vision may also be adaptive innocturnal mammals that are sometimes exposed to mesopicand photopic light levels when they chance into dawn anddusk, or when they are disturbed during their diurnal rest. It ispossible that a degree of color vision at low light levels wouldalso be an advantage. The Thylamys eye shows a functionalcontribution of rods and cones in the mesopic condition that

Palacios et al. ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------

1600 The Journal of Comparative Neurology ! Research in Systems Neuroscience

probably matches the natural background light at dawn anddusk.

Rods and nocturnal vision.Thylamys rod densities are somewhat higher than those

of other nocturnal didelphids: 440,000–590,000/mm2

compared with 200,000–500,000/mm2 in D. marsupialisaurita (Ahnelt et al., 1995) and 310,000–485,000/mm2 inD. virginiana (Kolb and Wang, 1985). Interestingly the in-crease in sensitivity after dark adaptation is faster in Thyl-amys than in rodents. For example, the nocturnal cururo, asubterranean rodent (Peichl et al., 2005) and the nocturnalOctodon bridgesi (Chavez et al., 2003) increase their sen-sitivity by 0.5 and 1 log units, respectively, at 5 minutesand by 2 and 2.5 log units at 15–20 minutes of dark adap-tation, compared with 1 log unit at 1 minute and 1–3 logunits at 5 minutes in Thylamys. Another feature of noctur-nal adaptation in the Thylamys eye is that the rods showthe inverted nuclear architecture typical for nocturnalmammals, which may improve light guidance to thepigment-containing outer segments (Solovei et al., 2009).

Cone topography and ecology.Thylamys cone densities (about 2,000–7,000/mm2) and

cone proportions (0.4–1.2% of the photoreceptors) are com-parable to those of other nocturnal didelphids (2,000–8,000/mm2 and 0.8–2% in D. virginiana, Kolb and Wang,1985; 1,500–3,000/mm2 and 01% in D. marsupialis aurita,Ahnelt et al., 1995). The roughly 10% proportion of SWS1cones is similar in Thylamys and D. marsupialis aurita (Ahneltet al., 1995). In Thylamys, the highest LWS cone densitiesoccur in a horizontally extended region located 1–2 mm be-low the optic nerve head (combined single and double conecounts; Fig. 6A). Such a “visual streak” of LWS cones hasbeen found in several marsupials, but its position in the retinadiffers between species (see Introduction). In contrast to thesituation in other Australian and American marsupials, Thyl-amys SWS1 cones also have their highest densities in theventral streak region (Fig. 6B). This suggests improved me-sopic and photopic visual capabilities in the midventral retina,corresponding to a region in the upper half of the visual field.The double cones also show a concentration in the ventralhalf-retina, where about 40% of the LWS cones are doublecones. Whatever their particular function is, it also is tied tothe upper visual field. Good vision in the upper visual fieldsuggests that events in this region are particularly important.

This appears advantageous, as the major predators arethe great horned owl and the burrowing owl (Palma, 1997).Unlike other owls, the burrowing owl often hunts duringthe day, with some preference for the twilight hours, andThylamys may also be active at these times, so retention ofcones and photopic vision may be a significant advantagein predator avoidance. A major terrestrial predator is the

culpeo fox, but Thylamys is partially arboreal and buildsnests in trees as well as under rocks or in abandonedrodent burrows (Palma, 1997), so fox attacks may be lessdangerous than owl attacks. Moreover, for a small animallike Thylamys, a larger terrestrial predator would also ap-pear in the upper visual field. In contrast, the much largerDidelphis virginiana has its peak photoreceptor and gan-glion cell densities in a central area in dorsotemporal ret-ina (Kolb and Wang, 1985), suggesting a greater emphasison active vision.

To further substantiate the claim of improved Thylamysvision in the upper visual field, the topography of the retinalganglion cells has to be known as well, because their den-sities and receptive field sizes determine the region of bestvision. Unfortunately, Thylamys ganglion cell data are notavailable. In all mammals, a correspondence of ganglioncell and LWS cone peaks, and hence a lower convergencerate, is considered advantageous for spatial acuity, andthis also applies to marsupials, whereas an adequate mixof LWS and SWS1 cones in other retinal regions would berequired for color discrimination in the correspondingparts of the visual field (Kolb and Wang, 1985; Ahnelt et al.,1995; Arrese et al., 2003). The colocalization of high den-sities of both cone types in the ventral retina of Thylamyssuggests that visual acuity and color discrimination may bebest in this region.

ACKNOWLEDGMENTSThe skilled technical assistance of Stefanie Heynck is

gratefully acknowledged. Antisera JH492 and JH455 werekindly provided by J. Nathans (Baltimore, MD); the rod op-sin antibody rho4D2 was kindly provided by R. S. Molday(Vancouver, BC, Canada). During the elaboration of themanuscript, A.G.P. was a Senior Researcher associatedwith the INRIA-CORTEX team and CREA Ecole Polytech-nique, France, and the general support during his stay isvery much appreciated.

LITERATURE CITEDAhnelt PK, Kolb H. 2000. The mammalian photoreceptor mosaic-

adaptive design. Prog Retin Eye Res 19:711–777.Ahnelt PK, Hokoc JN, Rohlich P. 1995. Photoreceptors in a prim-

itive mammal, the South American opossum, Didelphis mar-supialis aurita: characterization with anti-opsin immunolabel-ing. Vis Neurosci 12:793–804.

Arrese CA, Hart NS, Thomas N, Beazley LD, Shand J. 2002.Trichromacy in Australian marsupials. Curr Biol 12:657–660.

Arrese CA, Rodger J, Beazley LD, Shand J. 2003. Topographies ofretinal cone photoreceptors in two Australian marsupials. VisNeurosci 20:307–311.

Arrese CA, Oddy AY, Runham PB, Hart NS, Shand J, Hunt DM, Bea-zley LD. 2005. Cone topography and spectral sensitivity in twopotentially trichromatic marsupials, the quokka (Setonixbrachyurus) and quenda (Isoodon obesulus). Proc Biol Sci 272:791–796.

------------------------------------------------------------------------------------------------------------------------------------ Retinal photoreceptors of thylamys elegans

The Journal of Comparative Neurology ! Research in Systems Neuroscience 1601

Arrese CA, Beazley LD, Ferguson MC, Oddy A, Hunt DM. 2006a.Spectral tuning of the long wavelength-sensitive cone pig-ment in four Australian marsupials. Gene 381:13–17.

Arrese CA, Beazley LD, Neumeyer C. 2006b. Behavioural evi-dence for marsupial trichromacy. Curr Biol 16:R193–194.

Bowmaker JK, Hunt DM. 2006. Evolution of vertebrate visual pig-ments. Curr Biol 16:R484–489.

Chavez AE, Bozinovic F, Peichl L, Palacios AG. 2003. Retinal spec-tral sensitivity, fur coloration, and urine reflectance in thegenus Octodon (rodentia): implications for visual ecology. In-vest Ophthalmol Vis Sci 44:2290–2296.

Cowing JA, Poopalasundaram S, Wilkie SE, Robinson PR, Bow-maker JK, Hunt DM. 2002. The molecular mechanism for thespectral shifts between vertebrate ultraviolet-and violet-sensitive cone visual pigments. Biochem J 367:129–135.

Cowing JA, Arrese CA, Davies WL, Beazley LD, Hunt DM. 2008.Cone visual pigments in two marsupial species: the fat-taileddunnart (Sminthopsis crassicaudata) and the honey possum(Tarsipes rostratus). Proc Biol Sci 275:1491–1499.

Davies WL, Carvalho LS, Cowing JA, Beazley LD, Hunt DM, ArreseCA. 2007. Visual pigments of the platypus: a novel route tomammalian colour vision. Curr Biol 17:R161–163.

Eduardo Palma R, Rivera-Milla E, Yates TL, Marquet PA, MeynardAP. 2002. Phylogenetic and biogeographic relationships ofthe mouse opossum Thylamys (Didelphimorphia, Didelphidae)in southern South America. Mol Phylogenet Evol 25:245–253.

Govardovskii VI, Fyhrquist N, Reuter T, Kuzmin DG, Donner K. 2000. Insearch of the visual pigment template. Vis Neurosci 17:509–528.

Hart NS. 2001. The visual ecology of avian photoreceptors. ProgRetin Eye Res 20:675–703.

Hemmi JM, Grunert U. 1999. Distribution of photoreceptor typesin the retina of a marsupial, the tammar wallaby (Macropuseugenii). Vis Neurosci 16:291–302.

Herrera G, Zagal JC, Diaz M, Fernandez MJ, Vielma A, Cure M,Martinez J, Bozinovic F, Palacios AG. 2008. Spectral sensitiv-ities of photoreceptors and their role in colour discriminationin the green-backed firecrown hummingbird (Sephanoidessephaniodes). J Comp Physiol A Neuroethol Sens Neural Be-hav Physiol 194:785–794.

Hicks D, Molday RS. 1986. Differential immunogold-dextran la-beling of bovine and frog rod and cone cells using monoclonalantibodies against bovine rhodopsin. Exp Eye Res 42:55–71.

Higgins DG, Thompson JD, Gibson TJ. 1996. Using CLUSTAL formultiple sequence alignments. Methods Enzymol 266:383–402.

Hunt DM, Cowing JA, Wilkie SE, Parry JW, Poopalasundaram S,Bowmaker JK. 2004. Divergent mechanisms for the tuning ofshortwave sensitive visual pigments in vertebrates. Photo-chem Photobiol Sci 3:713–720.

Hunt DM, Chan J, Carvalho LS, Hokoc JN, Ferguson MC, ArreseCA, Beazley LD. 2009. Cone visual pigments in two species ofSouth American marsupials. Gene 433:50–55.

Jacobs GH. 1993. The distribution and nature of colour visionamong the mammals. Biol Rev Camb Philos Soc 68:413–471.

Jacobs GH, Rowe MP. 2004. Evolution of vertebrate colour vision.Clin Exp Optom 87:206–216.

Kolb H, Wang HH. 1985. The distribution of photoreceptors, do-paminergic amacrine cells and ganglion cells in the retina ofthe North American opossum (Didelphis virginiana). VisionRes 25:1207–1221.

Kumar S, Tamura K, Jakobsen IB, Nei M. 2001. MEGA2: molecularevolutionary genetics analysis software. Bioinformatics 17:1244–1245.

Laird DW, Molday RS. 1988. Evidence against the role of rhodop-sin in rod outer segment binding to RPE cells. Invest Ophthal-mol Vis Sci 29:419–428.

Meserve PL. 1981. Trophic relationships among small mammalsin a Chilean semiarid thorn scrud community. J Mammal 62:304–314.

Muller B, Glosmann M, Peichl L, Knop GC, Hagemann C, Ammer-muller J. 2009. Bat eyes have ultraviolet-sensitive cone pho-toreceptors. PLoS ONE 4:e6390.

Palacios AG, Srivastava R, Goldsmith TH. 1998. Spectral andpolarization sensitivity of photocurrents of amphibian rods inthe visible and ultraviolet. Vis Neurosci 15:319–331.

Palma E. 1997. Thylamys elegans. Mammalian Species 552:1–4.Peichl L. 2005. Diversity of mammalian photoreceptor proper-

ties: adaptations to habitat and lifestyle? Anat Rec A DiscovMol Cell Evol Biol 287:1001–1012.

Peichl L, Kunzle H, Vogel P. 2000. Photoreceptor types and distribu-tions in the retinae of insectivores. Vis Neurosci 17:937–948.

Peichl L, Nemec P, Burda H. 2004. Unusual cone and rod prop-erties in subterranean African mole-rats (Rodentia, Bathyergi-dae). Eur J Neurosci 19:1545–1558.

Peichl L, Chavez AE, Ocampo A, Mena W, Bozinovic F, Palacios AG.2005. Eye and vision in the subterranean rodent cururo (Spala-copus cyanus, Octodontidae). J Comp Neurol 486:197–208.

Saitou N, Nei M. 1987. The neighbor-joining method: a newmethod for reconstructing phylogenetic trees. Mol Biol Evol4:406–425.

Schiviz AN, Ruf T, Kuebber-Heiss A, Schubert C, Ahnelt PK. 2008.Retinal cone topography of artiodactyl mammals: influence ofbody height and habitat. J Comp Neurol 507:1336–1350.

Sharpe LT, Stockman A. 1999. Rod pathways: the importance ofseeing nothing. Trends Neurosci 22:497–504.

Solovei I, Kreysing M, Lanctot C, Kosem S, Peichl L, Cremer T,Guck J, Joffe B. 2009. Nuclear architecture of rod photorecep-tor cells adapts to vision in mammalian evolution. Cell 137:356–368.

Stavenga DG, Smits RP, Hoenders BJ. 1993. Simple exponentialfunctions describing the absorbance bands of visual pigmentspectra. Vision Res 33:1011–1017.

Strachan J, Chang LY, Wakefield MJ, Graves JA, Deeb SS. 2004.Cone visual pigments of the Australian marsupials, the stripe-faced and fat-tailed dunnarts: sequence and inferred spectralproperties. Vis Neurosci 21:223–229.

van Roessel P, Palacios AG, Goldsmith TH. 1997. Activity of long-wavelength cones under scotopic conditions in the cyprinidfish Danio aequipinnatus. J Comp Physiol [A] 181:493–500.

Wakefield MJ, Anderson M, Chang E, Wei KJ, Kaul R, Graves JA,Grutzner F, Deeb SS. 2008. Cone visual pigments ofmonotremes: filling the phylogenetic gap. Vis Neurosci 25:257–264.

Walls GL. 1939. Notes on the retinae of two opossum genera. J.Morphol 64:67–87.

Wang D, Oakley T, Mower J, Shimmin LC, Yim S, Honeycutt RL,Tsao H, Li WH. 2004. Molecular evolution of bat color visiongenes. Mol Biol Evol 21:295–302.

Wang Y, Macke JP, Merbs SL, Zack DJ, Klaunberg B, Bennett J,Gearhart J, Nathans J. 1992. A locus control region adjacent tothe human red and green visual pigment genes. Neuron9:429–440.

Wassle H. 2004. Parallel processing in the mammalian retina. NatRev Neurosci 5:747–757.

Wyszecki G, Stiles WS. 1982. Color science: concepts and meth-ods, quantitative data and formulae. New York: John Wiley &Sons.

Yokoyama S, Radlwimmer FB. 1999. The molecular genetics of redand green color vision in mammals. Genetics 153:919–932.

Young SR, Martin GR. 1984. Optics of retinal oil droplets: a modelof light collection and polarization detection in the avian ret-ina. Vision Res 24:129–137.

Zhao H, Rossiter SJ, Teeling EC, Li C, Cotton JA, Zhang S. 2009.The evolution of color vision in nocturnal mammals. Proc NatlAcad Sci U S A 106:8980–8985.

Palacios et al. ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------

1602 The Journal of Comparative Neurology ! Research in Systems Neuroscience