UVR8: a plant UV-B photoreceptor

UVR8: a plant UV-B photoreceptor

Inaugural-Dissertation zur Erlangung der Doktorwürde der Fakultät

für Biologie der Albert-Ludwigs-Universität Freiburg im Breisgau

Vorgelegt von

Luca Rizzini

Freiburg, Dezember 2010

Dekan: Prof. Dr. Gunther Neuhaus

Promotionsvorsitzender: Prof. Dr. Samuel Rossel Prof. Dr. Stefan Rotter Prof. Dr. Karl-Friedrich Fischbach

Betreuer der Arbeit: Prof. Roman Ulm

Referent: Prof. Roman Ulm

Koreferent: PD Gerhard Leubner

Tag der Verkündigung des Prüfungsergebnisses: 21-02-2011

TABLE OF CONTENTS

SUMMARY ................................................................................................................. 5

LIST OF ABBREVIATIONS .................................................................................................. 7

1 INTRODUCTION ............................................................................................... 11

1.1 The Photoreceptors ............................................................................................... 12 1.1.1 Phytochromes ....................................................................................................... 13 1.1.2 Cryptochromes ..................................................................................................... 17 1.1.3 Phototropins ......................................................................................................... 22 1.1.4 LOV Domains and Zeitlupe Photoreceptors ........................................................ 24

1.1.5 Chimeric Photoreceptors ...................................................................................... 26 1.2 Photoreceptor Systems not Present in Plants ....................................................... 28

1.2.1 BLUF .................................................................................................................... 28 1.2.2 Rhodopsins ........................................................................................................... 28 1.2.3 The Aryl Hydrocarbon Receptor .......................................................................... 29

1.3 UV-B Radiation .................................................................................................... 29 1.3.1 UV-B Damage ...................................................................................................... 30 1.3.2 UV-B Damage Signaling ..................................................................................... 31 1.3.3 UV-B non-Damage Response .............................................................................. 32

1.3.4 UV-B Perception .................................................................................................. 35 1.4 Components of the Low-Fluence Rate UV-B Pathway ....................................... 36

1.4.1 HY5 ...................................................................................................................... 39 1.4.2 COP1 .................................................................................................................... 40 1.4.3 UVR8 ................................................................................................................... 42 1.5 Aim of This Work ................................................................................................ 45

2 MATERIALS AND METHODS .......................................................................... 46

2.1 Materials ............................................................................................................... 46 2.1.1 Plant Material and Media ..................................................................................... 46 2.1.2 Bacterial Strains and Media ................................................................................. 46 2.1.3 Yeast Strains and Media ....................................................................................... 47 2.1.4 Plasmids, Oligonucleotides and Antibodies ......................................................... 47

2.1.5 Enzymes and Reagents ......................................................................................... 51 2.2 Methods ................................................................................................................ 52 2.2.1 Plant Growth ........................................................................................................ 52 2.2.2 Plant Protein Extraction ....................................................................................... 52 2.2.3 Cell-Free Degradation Assay ............................................................................... 53 2.2.4 Yeast Growth and Transformation ....................................................................... 53

2.2.5 Yeast Protein Extraction ....................................................................................... 54 2.2.6 HEK293T Cells Growth and Transformation ...................................................... 54

2.2.7 Protein Extraction from Transfected HEK293T Cells ......................................... 55

2.2.8 UV-B Treatments ................................................................................................. 55 2.2.9 Agrobacterium Mediated Plant Transformation .................................................. 57

2.2.10 DNA Isolation ...................................................................................................... 57 2.2.11 PCR ...................................................................................................................... 58 2.2.12 Agarose Gel Electrophoresis ................................................................................ 58

2.2.13 Site-Directed Mutagenesis ................................................................................... 58 2.2.14 CPRG Assay ......................................................................................................... 59 2.2.15 SDS-Polyacrylamide Gel Electrophoresis (SDS-PAGE) ..................................... 60

2.2.16 Immunoblot Analysis ........................................................................................... 60 2.2.17 BiFC ..................................................................................................................... 61 2.2.18 Luciferase Measurement ...................................................................................... 61 2.2.19 Bioinformatic Analysis ........................................................................................ 62

3 RESULTS .......................................................................................................... 63

3.1 COP1-UVR8 Interaction in Yeast ........................................................................ 63

3.2 UVR8 Homodimer ............................................................................................... 69 3.3 UV-B-Dependent Monomerization of UVR8 ...................................................... 71

3.3.1 UV-B-Dependent Monomerization of UVR8 in HEK293T Cells ....................... 71 3.3.2 UV-B-Dependent Monomerization of UVR8 in Yeast ........................................ 75

3.3.3 UV-B Dependent Monomerization of UVR8 in Planta ....................................... 78

3.3.4 UV-B-Dependent UVR8 Degradation ................................................................. 81

3.4 Evolutionary and Structural Considerations......................................................... 83

3.5 Site-Directed Mutagenesis ................................................................................... 88 3.6 Mixing-Extracts Experiment ................................................................................ 92 3.7 Physcomitrella UVR8 Ortholog ........................................................................... 93

3.8 UVR8 and HY5 Compete for COP1 Interaction .................................................. 95

3.9 RUPs ..................................................................................................................... 96 3.9.1 RUPs UV-B-Dependent Interaction with UVR8 ................................................. 96

3.9.2 RUPs Mechanism ................................................................................................. 96

4 DISCUSSION .................................................................................................... 98

4.1 UVR8 and COP1 Interaction in Heterologous System ........................................ 98

4.2 UVR8 Self-Interaction and UV-B Dependent Monomerization .......................... 99

4.3 UVR8 Protein Putative Conformational Change ............................................... 101

4.4 Phylogenetic and Structural Considerations....................................................... 103

4.5 UV-B Perception by UVR8 ................................................................................ 104 4.6 UVR8 Mechanism .............................................................................................. 106 4.7 RUPs Mechanism ............................................................................................... 109 4.8 Conclusions and Outlook ................................................................................... 110

ACKNOWLEDGEMENTS ...................................................................................... 112

5 REFERENCES ................................................................................................ 113

Summary

Ultraviolet-B radiation is part of the sunlight spectrum reaching the Earth. The high

energy per photon of this wavelength range can cause ROS production, lipid

peroxidation, reduced photosynthetic activity, and DNA damage when absorbed by

the genetic material. To counter these negative effects, plants have evolved a UV-B

photoreceptor system which helps to minimize the UV-B-mediated damage through,

e.g., “sunscreen’” pigment synthesis, induction of repair mechanisms and enhanced

photomorphogenesis. It is known since over 30 years that plants are able to

specifically perceive UV-B radiation, but the molecular identity of the photoreceptor

remained elusive. The main difficulty in its identification is related to the property of

UV-B to be absorbed by almost all organic compounds. Therefore, it is often not clear

if the cellular UV-B signalling is due to a more general damage response or a

damage-independent direct perception, i.e., a UV-B-photoreceptor-specific pathway.

We approached the problem by working with very low fluence rate UV-B, to avoid

damage responses but to activate the UV-B photoreceptor responses specifically.

This approach led to the identification of the proteins UV-RESISTANCE LOCUS 8

(UVR8) and CONSTITUTIVELY PHOTOMORPHOGENIC 1 (COP1) as early

components of the UV-B-specific signalling pathway in Arabidopsis thaliana. It has

been shown that UVR8 and COP1 are able to interact in a UV-B-dependent manner

in planta. The E3 ubiquitin ligase COP1 is a general regulator of light responses,

whereas the β-propeller protein UVR8 seems to be a UV-B-specific plant signalling

component. In this work I show that UVR8 is able to interact with COP1 in a UV-B-

dependent manner in yeast. Moreover, I was able to show that UVR8 can

homodimerize. Herein I further show that UVR8 is present almost exclusively as a

homodimer in planta, and that the UV-B radiation is able to monomerize UVR8 in a

human cells line, in yeast and in planta. Furthermore, I reproduced the UVR8

monomerization after protein purification, showing the same kinetics as in total

extracts. UVR8 is able to monomerize in less than 5 seconds of UV-B treatment in

plant protein extracts on ice, suggesting a direct perception of UV-B by UVR8.

Moreover, the re-dimerization at room temperature takes much longer, as shown in

human cells culture total protein extracts, possibly giving the time for signal

transduction. In yeast, UVR8 also interacts UV-B-dependently with the WD40-repeat

proteins REPRESSOR OF UV-B PHOTOMORHOGENESIS (RUP) 1 and 2, negative

regulators of the UV-B-specific signalling pathway which reduce the interaction of

UVR8 with COP1 under UV-B in a negative feed-back loop. Moreover, we postulated

that UVR8 could directly perceive UV-B photons through tryptophan residues.

Indeed, a UVR8 protein mutant in one of the tryptophans is not capable anymore to

monomerize under UV-B light, and the same UVR8 protein mutant is not capable to

interact with COP1 in yeast anymore. Published data on UVR8, e.g., microarray

analysis and phenotypic characterization, together with all the evidences reported in

this work, strongly support the idea that UVR8 is a UV-B plant photoreceptor.

LIST OF ABBREVIATIONS

3D Three dimensional

35S promoter of the CaMV 35S RNS gene

6-4PP 6-4 photoproducts

AD Activation Domain

BD Binding Domain

bHLH basic Helix-Loop-Helix motif

BiFC Bimolecular Fluorescence Complementation assays

BLAST Blast Local Alignment Search Tool

BLUF Blue Light sensors Using FAD

bps base pairs

BR Brassinosteroid

bZIP basic leucine-Zipper motif

CaMV Cauliflower Mosaic Virus

CFP Cyan Fluorescent Protein

cGMP cyclic Guanosine MonoPhosphate

ChIP Chromatin Immunoprecipitation

CHS CHALCONE SYNTHASE

Col Arabidopsis thaliana Columbia accession

COP1 CONSTITUTIVE PHOTOMORPHOGENIC 1

CPD Cyclobutane Pyrimidine Dimers

cry1/2/3 Cryptochrome 1/2/3 (holoproteins)

CRY-DASH Cryptochrome subfamily (Drosophila, Arabidopsis,

Synechocystis, Humans)

CUL CULLIN

DAS DQXVP-Acid-STAES

DET1 DE-ETIOLATED 1

DSB Double-Strand Break

EAL Protein domain named after its conserved amino acids, also

known as Domain of Unknown Function (DUF2)

ECFP Enhanced Cyan Fluorescent Protein

eid6 empfindlicher im dunkelroten licht 6

EMS Ethyl Methyl Sulfonate

EYFP Enhanced Yellow Fluorescent Protein

FAD Flavin Adenine Dinucleotide

FHL FHY1-LIKE

FHY1 FAR-RED ELONGATED HYPOCOTYL1

FICZ 6-formylindolo[3,2-b]carbazole

FMN Flavin MonoNucleotide

GAF cGMP–specific and –stimulated phosphodiesterases, Anabaena

adenylate cyclases and Escherichia coli FhlA

GEF Guanine nucleotide-exchange factor

GFP GREEN FLUORESCENT PROTEIN

GR Glucocorticoid Receptor

GW Gateway

HFR1 LONG HYPOCOTYL IN FAR-RED LIGHT 1

HisKA HisK-ATPase, Histidine Kinase ATPase Superfamily Domain

HKRD Histidine Kinase–Related Domain

HR Homologous Recombination

HY5 ELONGATED HYPOCOTYL 5

HYH HY5-HOMOLOG

JA Jasmonic Acid

kDa kilodalton

LAF1 LONG AFTER FAR-RED LIGHT 1

LB Luria-Bertani (medium)

Ler Arabidopsis thaliana Landsberg erecta accession

LOV Light, Oxygen or Voltage (domain)

MS Murashige and Skoog (basal salt mixture)

MTHF Methenyl Tetrahydrofolate

NER Nucleotide Excision Repair

NES Nuclear Export Signal

NHEJ Non-homologous End Joining

NIS Nuclear Import Signal

nm nanometer

p plasmid

P Pterin

p53 tumour protein 53

PAH Polycyclic Aromatic Hydrocarbon

PAL PHENYLALANINE AMMONIUM LYASE

PAR Photosynthetically Active Radiation

PAS Per-ARNT-Sim domain

PBS Phosphate Buffered Saline

phot1/2 Phototropin 1/2 (holoproteins)

PHR Photolyase Homology Region

PHY Phytochrome-specific domain related to PAS domain

phyA/B/C/D/E Phytochrome A/B/C/D/E (holoproteins)

PIF3 Phytochrome Interacting Factor 3

PIN Pinformed

PKD Protein Kinase D (Serine-threonine protein kinase domain)

PLD PAS-like domain

PR1/2/5 PATHOGENESIS-RELATED GENE 1

Pro Promoter

PVDF Polyvinylidene Difluoride (membrane)

Ran Ras-related Nuclear protein

Ras Rho family, small GTP binding protein

RCC1 REGULATOR OF CHROMATIN CONDENSATION 1

RING REALLY INTERESTING NEW GENE

ROS Reactive Oxygen Species

RT Room Temperature

Rubisco Ribulose-1, 5-bisphosphate carboxylase/oxygenase

RUP1/2 REPRESSOR OF UV-B PHOTOMORPHOGENESIS 1 and 2

RUS1/2 ROOT UV-B SENSITIVE 1 and 2

SA Salicylic Acid

SAP Sequestered Areas of Phytochromes

SCF Skp, Cullin, F-box containing complex

SDM Site-Directed Mutagenesis

SPA1/4 SUPPRESSOR OF PHYA 1 to 4

SPYNE/SPYCE Split YFP N-terminal/C-terminal fragment expression

STH STO HOMOLOGUE

STO SALT TOLERANCE

TLP Twin Love Protein 1

ULI3 UV-B LIGHT INSENSITIVE 1

UV-A/B/C Ultraviolet-A/B/C

UVR8 UV-RESISTANCE LOCUS 8

WL White Light

Ws Arabidopsis thaliana Wassilewskija accession

YFP YELLOW FLUORESCENT PROTEIN

Introduction

1 Introduction

Light sensing is crucial for plant growth and survival because light is source of

and environmental information. Light is an energy source for all photoautotrophic

organisms (plants, algae and photosynthetic bacteria)

and used to transform carbon dioxide into organic compounds. However, light is also

a source of information and it is used to accomplish photomorphogenesis, a

light-mediated change in plant growth and development, as illustrated in Fig. I1

(Mohr, 1995; Taiz, 2002).

Figure I1: Representation of different phenotypes of mustard seedlingsphotomorphogenesis) or kept in the dark (right

The signal transduction pathways that originate from the photomorphogenic

processes are diverse and complex

photomorphogenesis, plants have evo

wavelengths of the sunlight spectrum

duration of the radiation.

wavelengths and to initiate a signal transduction pathway. In plants, well known

Light sensing is crucial for plant growth and survival because light is source of


organisms (plants, algae and photosynthetic bacteria), trapped by

transform carbon dioxide into organic compounds. However, light is also


mediated change in plant growth and development, as illustrated in Fig. I1

: Representation of different phenotypes of mustard seedlings exposed toin the dark (right - skotomorphogenesis) (Mohr, 1995)


processes are diverse and complex (Taiz, 2002). In order to accomplish

photomorphogenesis, plants have evolved perception systems to

the sunlight spectrum, which are able to assess quality,

. Photoreceptor proteins are able to perceive specific


11

Light sensing is crucial for plant growth and survival because light is source of energy


by photosynthesis,

transform carbon dioxide into organic compounds. However, light is also


mediated change in plant growth and development, as illustrated in Fig. I1

exposed to light (left - (Mohr, 1995).


. In order to accomplish

the different light

quality, quantity, and

able to perceive specific


Introduction 12

photoreceptors are phytochromes that perceive primarily red and far-red light and

cryptochromes and phototropins that perceive UV-A and blue light.

Light is not only source of energy and information but it is also causing damage. This

is particularly noteworthy for plants which are characterized by a sessile lifestyle.

Photomorphogenesis is an example of adaptation to the variable light qualities and

quantities, i.e. plants are able to switch between two developmental programs,

photomorphogenesis in the light and skotomorphogenesis in the dark (Fig. I1).

Skotomorphogenesis allows plants to escape from the dark to reach the light (e.g.

seed buried in soil). Once the seedling reaches appropriate light conditions, it

switches to photomorphogenesis, starting energy capture and biomass production

and, at the same time, avoiding higher light intensities able to cause damage

(Buchanan, 2000). Not only high intensities of visible light are able to cause damage,

but also UV-B radiation (Lumsden, 1997). UV-B radiation comprises a minor part of

the solar spectrum thanks to the stratospheric ozone layer (Chapman, 1930), but the

energy content per photon of such radiation, and its ability to interact with organic

compounds, make it very harmful for living organisms. UV-B is damaging mainly

DNA, but also RNA, protein and lipids. Plants show a specific response to UV-B

wavelengths that result in, e.g., accumulation of “sunscreen” pigments (like

flavonoids and anthocyanins) and enhanced photomorphogenesis. UV-B action

spectra on anthocyanins and flavonoids synthesis are reviewed (Beggs and

Wellmann, 1994). These data, together with other UV-B light specific responses, led

scientists to postulate the presence of a UV-B photoreceptor (Tevini and Teramura,

1989; Cen and Bornman, 1990; Stapleton, 1992; Beggs and Wellmann, 1994).

1.1 The Photoreceptors

Photoreceptors are proteins responsible for light perception, and they are able to

initiate a signalling cascade which results in light specific responses in a variety of

organisms. Usually the perception of light is mediated by a protein containing a

prosthetic group, called chromophore. The protein together with the chromophore

forms the photoreceptor holoprotein. The chromophore is able to perceive light

through absorption. The energy of light causes photoisomerization or photoreduction

of the chromophore, a physical change perceived by the apoprotein which initiates

Introduction 13

the light signal transduction. Different chromophores can bind to different

apoproteins, like retinal chromophore (e.g. rhodopsin in animal), flavin chromophore

(e.g. cryptochrome in plants and animal) and bilin chromophore (e.g. phytochrome in

plants).

In plants there are a variety of photoreceptors (Fig. I2), covering almost all the

sunlight spectrum. The phytochromes absorb in the range of red and far-red light

(phytochromes A, B, C, D and E), while cryptochromes (cryptochrome1 and

chryptochrome2) and phototropins (phototropin1 and phototropin2) absorb in the

range of UV-A and blue light.

Figure I2: Schematic representation of visible light spectrum and the main family of plant photoreceptors with their chromophores (above the photoreceptor models). Phytochromes, cryptochromes, and phototropins are shown (Jiao et al., 2007).

1.1.1 Phytochromes

Garner and Allard (Garner and Allard, 1920) coined the word photoperiodism to

describe that, e.g., flowering was induced by long days in some species and by short

days in others. Later on, it was discovered that a unique pigment was responsible for

photoperiodism and photomorphogenesis (Parker et al., 1946; Borthwick et al.,

1948). Thanks to studies of the action spectra of plants, it was postulated that the

chromophore responsible for this phenomena should absorb in the red/far-red range

of the light with an additionally minor absorption in the blue light. Such action spectra

were compatible with the chromophore phycobilin (Parker et al., 1946; Borthwick et

al., 1948; Parker et al., 1950). Furthermore, it has been discovered the red/far-red

reversibility of seed germination (Toole et al., 1953), which refers to the induction of

germination by red light that can be reversed when followed by far-red light

Introduction

irradiation, leading to inhibition of germination. The photorev

proof for photoperception, through a photoreversible chromophore, which results in

an adaptative development to the physical surroundings. The final evidence that

photoreversibility is achieved through the same photoreceptor was p

isolation of the phytochrome

activation and inactivation of plant phytochromes is the phytochromo

(Butler et al., 1959; Siegelman and Firer, 1964)

phytochromes converts to active P

photorevert to the Pr form upon far

1973), as shown in Fig. I3a. In Fig. I3b the domain structure of plant phytochromes is

presented. PLD, GAF and PHY are protein domains related to the PAS

(Per-ARNT-Sim) domain. PAS domains have important roles as sensory modules for

oxygen, tension, redox potential or light intensities

Moreover, PAS domains are involved in protein

bind to cofactors, like the GAF domain of phyt

et al., 1959; Siegelman and Firer, 1964)

for which the kinase activity has not yet been unequivocally demonstrated.

a)

b)

Figure I3: a) Photoreversible conversion of phytochromes from Pr to Pfr formversa in far-red light, and dark reversion structure: NTE, N-amino-terminal extension; PLD, PASto PAS and found in phytochromes and cGMPrelated to PAS and specific to phytochromes; HKRD, histidine kinase related domphosphoacceptor His residue and motifs characteristic of kinase A domain-related; HisK2008).

irradiation, leading to inhibition of germination. The photoreversibility was an amazing



photoreversibility is achieved through the same photoreceptor was p

isolation of the phytochrome (Butler et al., 1959). The chromophore responsible for

activation and inactivation of plant phytochromes is the phytochromo

(Butler et al., 1959; Siegelman and Firer, 1964). The non-active Pr form of the

phytochromes converts to active Pfr form upon red light illumination. The Pfr form can

photorevert to the Pr form upon far-red light illumination or in the dark

Fig. I3a. In Fig. I3b the domain structure of plant phytochromes is

d. PLD, GAF and PHY are protein domains related to the PAS

Sim) domain. PAS domains have important roles as sensory modules for

oxygen, tension, redox potential or light intensities (Ponting and Aravind, 1997)

Moreover, PAS domains are involved in protein-protein interactions and they can

bind to cofactors, like the GAF domain of phytochromes which binds to P

et al., 1959; Siegelman and Firer, 1964). HKRD is a histidine kinase related domain

hich the kinase activity has not yet been unequivocally demonstrated.

) Photoreversible conversion of phytochromes from Pr to Pfr form in red light, and dark reversion (Schafer and Bowler, 2002); b) Phytochrome domain

terminal extension; PLD, PAS-like domain; GAF, a domain distantly related to PAS and found in phytochromes and cGMP-specific phosphodiesterases; PHY, a domain distantly related to PAS and specific to phytochromes; HKRD, histidine kinase related domphosphoacceptor His residue and motifs characteristic of bona fide histidine kinases; HisKA, histidine

related; HisK-ATPase, histidine kinase ATPase superfamily domain

14

ersibility was an amazing



photoreversibility is achieved through the same photoreceptor was provided by the

. The chromophore responsible for

activation and inactivation of plant phytochromes is the phytochromobilin (PΦB)

active Pr form of the

fr form upon red light illumination. The Pfr form can

red light illumination or in the dark (Schmidt et al.,

Fig. I3a. In Fig. I3b the domain structure of plant phytochromes is

d. PLD, GAF and PHY are protein domains related to the PAS

Sim) domain. PAS domains have important roles as sensory modules for

(Ponting and Aravind, 1997).

protein interactions and they can

binds to PΦB (Butler

. HKRD is a histidine kinase related domain

hich the kinase activity has not yet been unequivocally demonstrated.

in red light, and vice ) Phytochrome domain

like domain; GAF, a domain distantly related specific phosphodiesterases; PHY, a domain distantly

related to PAS and specific to phytochromes; HKRD, histidine kinase related domain lacking a histidine kinases; HisKA, histidine

ATPase, histidine kinase ATPase superfamily domain (Sharrock,

Introduction 15

Phytochrome family of photoreceptor is widespread in living organisms, as shown in

Fig. I4. In Arabidopsis thaliana this family is composed of five members named

phytochrome A (phyA), phytochrome B (phyB), phytochrome C (phyC), phytochrome

D (phyD), and phytochrome E (phyE) (Sharrock and Quail, 1989; Clack et al., 1994).

Figure I4: Plant phys (plant phytochromes), BphPs (Bacterio-phytochromes), Cphs (Cyanobacterial phytochromes), Fphs (Fungal phytochromes) and Phy-like (Phytochrome-like proteins) (Karniol et al., 2005).

Three distinct response modes of phytochrome action have been characterized in

Arabidopsis thaliana, which differ for fluence requirement and red/far-red reversibility.

These are the high irradiation response (HIR), the low fluence response (LFR), and

the very low fluence response (VLFR). PhyB is responsible for the LFR together with,

but to a lesser extent, the other light stable phytochromes, phyC, phyD and phyE.

PhyA is responsible for the HIR response and VLFR response (Nagy and Schafer,

2002).

Introduction 16

PhyA and phyB localize to the cytoplasm and move to the nucleus upon light

irradiation (Sakamoto and Nagatani, 1996; Kircher et al., 1999). Similar to phyA and

phyB, also phyC, phyD and phyE localize to the cytosol in dark-grown seedlings and

move to the nucleus upon light perception (Kircher et al., 2002).

Because of the relationship between light perception and signalling, it is of relevance

that phytochromes move into the nucleus upon light activation, where they can

directly or indirectly activate transcription. Indeed, it has been discovered that nuclear

phyA and phyB interact, in a light-dependent fashion, with Phytochrome Interacting

Factor 3 (PIF3), a basic helix-loop-helix (bHLH) transcription factor (Ni et al., 1998;

Bauer et al., 2004). The interaction between phyA and phyB with PIF3 corroborates

the hypothesis that phytochromes move to the nucleus to activate light responses

through transcriptional activation. Moreover, it has been shown that phyA and phyB

move to the nucleus in their active Pfr form, underlying the link between

photoperception and signal transduction (Kircher et al., 1999; Yamaguchi et al.,

1999). However, the best proof that shows the nuclear import of phytochromes, as

mandatory step for light signal transduction, comes from the fusion protein

glucocorticoid receptor-phyB expressed in a phyB mutant background (Huq et al.,

2003). The fusion of the protein to the glucocorticoid receptor (GR) caused its

cytoplasmic retention; irrespective of the light condition, no signal transduction was

taking place. When Dex was applied to the medium, the GR-phyB fusion protein was

freed up from the cytoplasmic retention factors, allowing its translocation to the

nucleus, and upon red light irradiation, to recover the phytochrome-mediated

signalling.

Using particle bombardment of onion cells it was demonstrated that the E3 ubiquitin

ligase YFP-COP1, a central regulator of light signalling, co-localizes with phyA-CFP

in the nucleus. PhyA has also been shown to interact with COP1 in vitro (Seo et al.,

2004). Furthermore, COP1 is able to ubiquitinate phyA in vitro, and phyA shows

higher stability in cop1 mutant lines (Seo et al., 2004), indicating that the interaction

leads to proteasomal degradation of phyA. Despite the fact that there’s no definitive

evidence for in vivo interaction between phyA and COP1, this set of data points to a

possible pathway for light responses activated by phytochromes.

Another link between perception and signalling is given by in vitro data which shows

serine-threonine kinase activity of the histidine kinase related domain (HKRD) of

phytochromes (Yeh and Lagarias, 1998).

Introduction 17

To conclude, it has also to be mentioned that phytochromes are present as

homodimer and heterodimer in vivo (Brockmann et al., 1987; Sharrock and Clack,

2004). Recently, it has been shown that the homodimer is formed all along the

phytochrome protein structure (Li et al., 2010). In summary, herein are presented the

main properties of the oldest and most characterized plant photoreceptors, the

phytochromes. These properties include light dependent activation, and translocation

to the nucleus, which lead to transcriptional activation of light-responsive genes.

1.1.2 Cryptochromes

The cryptochromes are UV-A/blue light photoreceptors. In Arabidopsis thaliana there

are two cryptochromes, cryptochrome 1 (cry1) and cryptochrome 2 (cry2).

Cryptochromes are widespread across the kingdoms of life (Fig. I5). Fig. I5 also

includes the closest homologs of cryptochromes, namely 6-4 photolyases, CPD

photolyases and CRY-DASH proteins.

Introduction 18

Figure I5: Phylogenetic tree of cryptochromes and related sequences. A, archaea; B, bacteria; F, fungi; I, insects; P, plants; S, sponges; V, vertebrates (Lin and Todo, 2005).

Maarten Koornneef and coworkers isolated the hy4 mutant in a screen for

Arabidopsis thaliana mutants with an elongated hypocotyl in white light (Koornneef et

al., 1980). Later on, the hy4 mutant was characterized for having elongated hypocotyl

phenotype in white light and blue light, but not under red and far-red light, or in

Introduction 19

darkness (Ahmad and Cashmore, 1993). In the same work, HY4 was found to

encode a photolyase-like protein. Nevertheless, HY4 was tested negative for

photolyase activity that, together with other results, led to the conclusion that HY4 is

a UV-A/blue light photoreceptor and it was renamed cryptochrome 1 (Lin et al.,

1995a; Malhotra et al., 1995).

In parallel to Arabidopsis thaliana, a photolyase-related gene was discovered in

Synapis alba (Batschauer, 1993) that was later found to be a CRY1 ortholog. In this

work an EST library was prepared from white mustard and screened to identify plant

photolyase coding genes. For this reason HY4 was considered to be, in this work, a

photolyase protein.

It is interesting to note the similarity of cryptochromes to photolyases. Indeed, the

chromophore of photolyase proteins was thought, even before the discovery of HY4,

to be a candidate receptor for UV-A and blue light (Galland and Senger, 1988b, a). In

Arabidopsis thaliana there are three cryptochromes, as shown in Fig. I6. cry2 is very

similar to cry1 (Hoffman et al., 1996), while cryptochrome 3 (cry3 or A.t.CRY-DASH)

is more divergent and its function is not clear yet.

Figure I6: Domain structure of plant cryptochromes. Cryptochromes cofactors are shown as well: MTHF (pterin) and FAD (flavin) (Batschauer et al., 2007).

The central domain of the cryptochromes in Arabidopsis thaliana is called the

photolyase homology region (PHR). This region is highly conserved and similar to

photolyases, and like in photolyases, it can bind to chromophores. Nonetheless,

cryptochromes are divergent from photolyases in their C-terminal region, the so

called DAS domain (DQXVP-acidic-STAES) (Lin, 2002). In cry3 the DAS domain is

located in the N-terminal region.

The Arabidopsis thaliana cryptochromes have two chromophores, a flavin (FAD) and

a pterin (methenyltetrahydrofolate, MTHF) (Fig. I6). When CRY1, CRY2 and CRY3

Introduction 20

are expressed in Escherichia coli, they bind to FAD and to MTHF in a 1:1

stoichiometry (Lin et al., 1995b; Malhotra et al., 1995; Pokorny et al., 2005),

indicating that the binding to both chromophores is required for function.

The first crystallized full-length cryptochrome structure comes from Synechocystis

(Brudler et al., 2003). This is a CRY-DASH cryptochrome which contains only FAD. It

has been possible to decipher some properties of the cryptochrome from the

crystallized structure, like the differences from photolyases, substrate recognition,

and speculate on possible electron transfer events that are the basis for signal

perception. The only Arabidopsis thaliana crystallized cryptochrome is cry3 (Pokorny

et al., 2005). This crystal structure has shown a homodimeric conformation of cry3.

Cryptochromes are phosphorylated upon blue-light irradiation. The phosphorylation

has been found to be mandatory for signalling and to lead to degradation of cry2

(Shalitin et al., 2002; Bouly et al., 2003; Shalitin et al., 2003). These aspects of cry2

are reminiscent of phyA which, upon irradiation, move to the nucleus and it is subject

to proteasomal dependent degradation. In the same studies it has also been shown

that cry1 is able to autophosphorylate upon blue light irradiation. Because these

studies were performed in vitro, it was possible to demonstrate that the presence of

FAD is mandatory to achieve autophosphorylation of cry1.

cry1 and cry2 are similar to class I CPD photolyases, while cry3 is similar to 6-4

photolyases. The crystal structure of many class I CPD photolyases has been solved

(Park et al., 1995; Tamada et al., 1997; Komori et al., 2001). From this works it is

possible to understand the importance of FAD for the catalytic activity of the enzyme

and that MTFH is important to increase the DNA repair efficiency in low light.

Photolyases are able to repair DNA damage caused mainly by UV-B radiation. UV-B

can be absorbed by DNA causing the dimerization of pyrimidines. The main

photoproduct of pyrimidin dimerization is the cyclobutane pyrimidine dimer (CPD).

Photolyases are able to harness blue-light energy through the chromophore FAD

reducing it to FADH-. The electron that is now in the chromophore can be used to

destabilize CPD and break the bond to restore the integrity of DNA. Similarly to

photolyase mode of action, cryptochromes are able to capture blue-light energy but

using it for signalling rather than DNA repair (Malhotra et al., 1995; Cashmore et al.,

1999). It has been possible to demonstrate this hypothesis for cry1 (Giovani et al.,

2003). In this work, cry1 was synthesized in insect cells and subjected to laser

excitation. From the excitation kinetics and the reduced state of FAD and additional

Introduction 21

data, it was possible to conclude that the electron transfer was taking advantage from

a tyrosine radical and a tryptophan radical. Interestingly, in vitro and in vivo

experiments with amino acid substitution led to a better understanding on the

electron transfer that is taking place in cry1. Two substitutions of putative tryptophan

electron donors with redox inactive phenylalanine, T400F and T324F, impaired cry1

signalling (Zeugner et al., 2005). These mutants were also impaired in

autophosphorylation, and the characteristic phenotype with reduced hypocotyl growth

under blue light, showing a direct correlation between light absorption,

phosphorylation activity and downstream signalling.

Domain swapping experiments between cry1 and cry2 lead to the hypothesis that

cryptochromes are regulating their own degradation. The way by which cry2 gets

degraded is not yet clear but its interaction with the C-terminal WD-40 domain of

COP1 may suggest a proteasomal dependent degradation (Wang et al., 2001).

Moreover, in cop1 mutant seedlings cry2 is stabilized under blue light and the

phosphorylated cry2 is accumulating (Shalitin et al., 2002). It has to be noticed that

cry1 is not blue-light dependent degraded but it is also interacting with COP1 (Yang

et al., 2001). Unfortunately, there are still not enough data on COP1 mode of action

to understand the meaning of the interaction of the photoreceptors with COP1. cry1

has a light dependent subcellular localization being nuclear in the dark and mainly

cytoplasmic upon light irradiation (Cashmore et al., 1999; Yang et al., 2000). cry2 has

a different behavior being constitutively localized in the nucleus (Guo et al., 1999;

Kleiner et al., 1999). cry3 has been found to localize in chloroplast and mitochondria

(Kleine et al., 2003). The different degradation and subcellular localization of

cryptochromes in Arabidopsis thaliana is not enough to understand the function and

mode of action of these photoreceptors; more comprehensive work will be needed to

clarify their signal transduction.

The mode of action of cryptochromes could be explained by the homodimerization of

these photoreceptors. The overexpression of the C-terminus of cry1 and cry2 in wild

type Arabidopsis thaliana seedlings is giving a constitutively photomorphogenic

phenotype (Yang et al., 2000); while overexpression of the N-terminus of cry1 in wild

type Arabidopsis thaliana seedlings has a cryptochrome mutant phenotype (Sang et

al., 2005). In the same work the authors found that cryptochromes homodimerize in a

light independent fashion at their N-terminus. It is now becoming clear that

cryptochromes need to homodimerize to be functional and the overexpression of the

Introduction 22

C-terminus of cry2 was giving a constitutive response because of the GUS fusion.

Indeed, GUS is known to oligomerize in a way that the GUS fusion to the C-terminal

domain of cry2 was taking over the homodimerization function of the N-terminal

domain.

1.1.3 Phototropins

Phototropins are plasma membrane-associated UV-A/blue-light photoreceptors

present in plants, which control phototropism, light-induced stomatal opening and

chloroplast movements (Briggs and Christie, 2002; Kagawa, 2003; Celaya and

Liscum, 2005). In Arabidopsis thaliana there are two phototropins, originally named

NPL1 and NPH1, now known as phototropin 1 (phot1) and phot2, respectively (Huala

et al., 1997; Briggs et al., 2001; Jarillo et al., 2001a; Kagawa et al., 2001) (Fig. I7).

Figure I7: Phylogram of the phototropin family of blue light photoreceptors (Briggs et al., 2001). Putative phototropins and the neochrome PHY3 in Adiantum capillus-veneris are shown as well.

Introduction

Phototropins are AGC-type kinases inactive in darkness and activated upon blue-light

irradiation (Bogre et al., 2003)

photoreceptors is though

Phototropins perceive light through two N

domains, LOV1 and LOV2. LOV domains are PAS domains responsible for cofactor

binding and protein-protein interaction

the chromophore flavin mononucleotide (FMN) through the LOV domain, as

illustrated in Fig. I8 (Christie et

Figure I8: Schematic illustration of phototropinthe FMN bound to the LOV1 and LOV2 domains, PKD represent the serinedomain (Tokutomi et al., 2008).

phot1 and phot2 undergo autophosphorylation upon blue light irradiation

al., 1998). Mutations of a key amino acid in the phosphorylation domain of phot1 and

phot2 prevents phosphorylation when expressed in insect cells, demonstrating the

autophosphorylation property of this photoreceptor

domain of phot1 from Avena

important for autophosphorylation

capability of phot1 and phot2 is dark

1993; Salomon et al., 1997; Kinoshita et al., 2003)

LOV1 and LOV2 in phot1 suggest that LOV2 acts as a repressor of the kinase activity

of phot1 by intramolecular dimerization with LOV1. Indeed, in the absence of LOV2,

the main light sensor in phototropins

active (Harper et al., 2004; Kaiserli et al., 2009)

Upon irradiation, the LOV domain undergoes a conformational

spectroscopic studies (Swartz et al., 2002; Iwata et al., 2003; Nozaki et al., 2004)

Altogether, these data allow

conformational change activates the kinase activity in phototropins and subsequent

downstream signalling.

type kinases inactive in darkness and activated upon blue-light

(Bogre et al., 2003). The activation of the kinase domain of these

photoreceptors is thought to be the starting point of their light responses.

Phototropins perceive light through two N-terminal light, oxygen, voltage (LOV)


protein interaction (Taylor and Zhulin, 1999). Phototropins bind to

n mononucleotide (FMN) through the LOV domain, as

(Christie et al., 1999; Salomon et al., 2000).

: Schematic illustration of phototropin protein domains; The three fusedbound to the LOV1 and LOV2 domains, PKD represent the serine-threonine protein kinase

hot1 and phot2 undergo autophosphorylation upon blue light irradiation

. Mutations of a key amino acid in the phosphorylation domain of phot1 and


autophosphorylation property of this photoreceptor (Christie et al., 2002)

vena sativa is responsible for self-interaction, which could be

important for autophosphorylation (Salomon et al., 2004). The autophosphorylation

capability of phot1 and phot2 is dark-reversible (Short and Briggs, 1990; Hager et al.,

1993; Salomon et al., 1997; Kinoshita et al., 2003). Domain swapping experiments of



in light sensor in phototropins (Christie et al., 2002), LOV1

(Harper et al., 2004; Kaiserli et al., 2009).

Upon irradiation, the LOV domain undergoes a conformational change as shown in

(Swartz et al., 2002; Iwata et al., 2003; Nozaki et al., 2004)

Altogether, these data allow postulating a model for which the light dependent


23

type kinases inactive in darkness and activated upon blue-light

. The activation of the kinase domain of these

t to be the starting point of their light responses.

terminal light, oxygen, voltage (LOV)


. Phototropins bind to

n mononucleotide (FMN) through the LOV domain, as

domains; The three fused-hexagon represent threonine protein kinase

hot1 and phot2 undergo autophosphorylation upon blue light irradiation (Christie et

. Mutations of a key amino acid in the phosphorylation domain of phot1 and


(Christie et al., 2002). The LOV1

is responsible for self-interaction, which could be

autophosphorylation

(Short and Briggs, 1990; Hager et al.,

. Domain swapping experiments of



, LOV1 is constitutively

change as shown in

(Swartz et al., 2002; Iwata et al., 2003; Nozaki et al., 2004).

a model for which the light dependent


Introduction 24

1.1.4 LOV Domains and Zeitlupe Photoreceptors

The LOV domains are not only present in phototropins, but also in other blue light

photoreceptors in plants, fungi and bacteria.

The Zeitlupe (ZTL/ADO) family is composed of LOV domain photoreceptors, whose

name derives from their influence on circadian clock. The Zeitlupe photoreceptors in

Arabidopsis thaliana have only one LOV domain whereas phototropins have two LOV

domains (Fig. I9). ZTL/ADO photoreceptors localize to the nucleus and the cytosol

(Kiyosue and Wada, 2000; Yasuhara et al., 2004; Fukamatsu et al., 2005). The first

ztl mutant was identified by different groups (Kiyosue and Wada, 2000; Nelson et al.,

2000; Somers et al., 2000; Jarillo et al., 2001b). The ztl mutant phenotype is

characterized by a lengthened circadian period; indeed it is influencing, e.g.,

circadian regulated gene expression and flowering time. The ZTL family of

photoreceptors in Arabidopsis thaliana includes ZTL, FKF1, and LKP2. All these

photoreceptors use a flavin (FMN) as chromophore (Nelson et al., 2000; Schultz et

al., 2001). ZTL, FKF1 and LKP2 harbor a LOV domain followed by an F-box and a

Kelch repeats (Fig. I9). The F-box domain is found in adaptor proteins of the modular

E3 ubiquitin ligase SCF complex, which led to the assumption that ZTL and related

proteins are involved in the turnover of circadian clock components in Arabidopsis

thaliana. Indeed, it has been shown that Zeitlupe photoreceptors interact with the

SCF complex thanks to their F-box protein domain (Mas et al., 2003; Han et al.,

2004; Yasuhara et al., 2004).

An additional LOV containing protein, not related to ZTL/ADO family, has been found

in Arabidopsis thaliana (Crosson et al., 2003). This protein is not yet characterized

and has been named Twin LOV Protein 1 (TLP1).

Introduction

Figure I9: Domain organization of a representative phototropin and a representative Zeitlupephotoreceptor. In both classes of photoreceptors the LOV domain bound to an FMN molecule functions as the blue light sensor. PhototropiN-terminal region (LOV1 and LOV2) and a serine/tZeitlupe family photoreceptors harbor only one LOV domain at the Nmotif and six Kelch repeats (KELCH) in the CKelch repeats may serve as protein

As stated before, LOV domain

they are widespread across all kingdoms of life (Fig. I10).

Domain organization of a representative phototropin and a representative Zeitlupephotoreceptor. In both classes of photoreceptors the LOV domain bound to an FMN molecule functions as the blue light sensor. Phototropins harbor two FMN-binding LOV

(LOV1 and LOV2) and a serine/threonine kinase domain in the CZeitlupe family photoreceptors harbor only one LOV domain at the N-terminus, followed by an F

Kelch repeats (KELCH) in the C-terminal region. By analogy with other proteins the Kelch repeats may serve as protein–protein interaction domain (Demarsy and Fankhauser, 2009)

domain containing proteins are not only present

oss all kingdoms of life (Fig. I10).

25

Domain organization of a representative phototropin and a representative Zeitlupe-type photoreceptor. In both classes of photoreceptors the LOV domain bound to an FMN molecule

binding LOV domains in their hreonine kinase domain in the C-terminal part.

terminus, followed by an F-Box terminal region. By analogy with other proteins the

(Demarsy and Fankhauser, 2009).

containing proteins are not only present in planta but

Introduction 26

Figure I10: Phylogenetic tree reconstructed for LOV sequences from different taxa (Krauss et al., 2009).

1.1.5 Chimeric Photoreceptors

Interesting examples of chimeric photoreceptors are present in different species,

displaying different combinations of various chromophores and protein domains. A

new class of photoreceptors that combines red light perception by a phytochrome-like

domain and blue light perception by two phototropin-related domains has been found

in the fern Adiantum capillus-veneris and in the green algae Mougeotia scalaris, and

they have been named neochrome (Mougeotia) and PHY3 (Adiantum) (Nozue et al.,

1998; Suetsugu et al., 2005). In Adiantum capillus-veneris red light spore germination

can be reverted by blue light irradiation, indicating the dual specificity for red light and

Introduction

blue light of this photoreceptor

proven by heterologous expression of PHY3 in

mutant background, which confers

well (Kanegae et al., 2006)

cooperatively to mediate phototropism in

(Hayami et al., 1986). A protein domains representation of the neochrome is shown

in Fig. I11.

Figure I11: The domain structure of domain (PHY), light, oxygen or voltage (LOV) domain, STKD, serine(Christie, 2007).

In the fungus Neurospora

photoreceptors: WHITE COLLAR

et al., 1996; Linden and Macino, 1997)

domains, while WC-2 contains a LO

heterodimerize in the nucleus and are able to activate the transcription of light

regulated genes (Ballario et al., 1998; Talora et al., 1999; Schwerdtfeger and Linden,

2000).

In the stramenopile algae

(Phaeophyceae) a light-activated transcription factor composed of a basic

region/leucine zipper (bZIP) domain followed by a LOV domain has been identified

and named AUREOCHROME

In bacteria, LOV domains have broad functions and mode of actions, being coupled

to kinases, phosphodiesterases, response regulators, DNA

regulators of stress sigma factors

blue light of this photoreceptor (Furuya et al., 1997). Moreover, the dual specificity is

proven by heterologous expression of PHY3 in phot1/phot2 Arabidopsis

mutant background, which confers hypocotyl curvature under red and blue light

(Kanegae et al., 2006). Furthermore, phytochrome and blue light perception act

cooperatively to mediate phototropism in Adiantum capillus-veneris

. A protein domains representation of the neochrome is shown

: The domain structure of Adiantum capillus-veneris neochrome; phytochromedomain (PHY), light, oxygen or voltage (LOV) domain, STKD, serine-threonine kinase domain

Neurospora crassa, blue light responses are driven by two

WHITE COLLAR 1 (WC-1) and WHITE COLLAR 2 (WC

et al., 1996; Linden and Macino, 1997). WC-1 contains a LOV domain and two PAS

2 contains a LOV domain and a PAS domain. WC


(Ballario et al., 1998; Talora et al., 1999; Schwerdtfeger and Linden,

stramenopile algae Vaucheria frigida (Xanthophyceae) and

activated transcription factor composed of a basic


AUREOCHROME (Takahashi et al., 2007).


to kinases, phosphodiesterases, response regulators, DNA-binding motifs, and

ulators of stress sigma factors (Losi et al., 2004).

27

. Moreover, the dual specificity is

rabidopsis thaliana

hypocotyl curvature under red and blue light as

more, phytochrome and blue light perception act

veneris protonemata

. A protein domains representation of the neochrome is shown

neochrome; phytochrome-like PAS threonine kinase domain

, blue light responses are driven by two

2 (WC-2) (Ballario

1 contains a LOV domain and two PAS

V domain and a PAS domain. WC-1 and WC-2


(Ballario et al., 1998; Talora et al., 1999; Schwerdtfeger and Linden,

(Xanthophyceae) and Fucus distichus

activated transcription factor composed of a basic



binding motifs, and

Introduction 28

The chimeric photoreceptors are astonishing example of evolutionary adaptation to

different light conditions, and they underline the importance of light perception in

photosynthetic and non-photosynthetic organisms.

1.2 Photoreceptor Systems not Present in Plants

1.2.1 BLUF

BLUF (blue light sensors using FAD) domain photoreceptors are a novel class of blue

light receptors which use FAD as chromophore, first described for the AppA protein

from Rhodobacter sphaeroides (Gomelsky and Kaplan, 1998; Gomelsky and Klug,

2002). Next to prokaryotic members, BLUF photoreceptors have also been identified

in eukaryotes like euglenozoa and fungi (Iseki et al., 2002). BLUF domains occur

either in small proteins composed of a single BLUF domain or larger proteins where a

BLUF domain is coupled to different effector domains, frequently involved in cyclic

nucleotide metabolism, e.g., adenylate/guanylate cyclases and phosphodiesterases

(Gomelsky and Klug, 2002; Barends et al., 2009).

The AppA protein of Rhodobacter sphaeroides is a BLUF containing protein. AppA

binds to the the transcription factor PpsR in low light, after light perception PpsR is

released and it can act on photosynthetic gene expression (Metz et al., 2010). The

BlrP1 protein in Klebsiella pneumoniae has a BLUF sensor domain and an EAL

phosphodiesterase output domain. The light induced conformational changes could

be thus propagated from the BLUF domain to the phosphodiesterase effector

domain, modulating its enzymatic activity (Barends et al., 2009).

1.2.2 Rhodopsins

The oldest photoreceptors found in animals are rhodopsins (Boll, 1876). They are

membrane-bound photoreceptor (Kuehne, 1878b, a; Nathans, 1992), which use

retinal as chromophore (Wald, 1933; Nathans, 1992). Different from the

photoreceptors discussed before, rhodopsins strongly absorb green and blue light.

Light induced isomerization of the chromophore results in a conformational change of

Introduction 29

rhodopsin that activates associated G proteins which initiate light responses

(Hegemann et al., 1991; Lawson et al., 1991; Strader et al., 1994). Rhodopsins are

widespread in animals, bacteria, algae and Fungi (Oesterhelt and Stoecken, 1973;

Bogomolni and Spudich, 1982; Foster et al., 1984; Spudich et al., 2000; Hegemann,

2008).

1.2.3 The Aryl Hydrocarbon Receptor

Recently, the aryl hydrocarbon receptor (AhR) has been described as a cytoplasmic

target for UV-B in keratinocytes (Fritsche et al., 2007). AhR is a basic cytosolic

helix-loop-helix transcription factor that belongs to the family of PAS proteins. AhR

binds several chaperons in the cytoplasm, but, after ligand binding to polycyclic

aromatic hydrocarbon (PAH), it moves to the nucleus and activates transcription of

genes involved in PAH metabolism (Kahl et al., 1980; Knutson and Poland, 1980). A

PAH ligand with very high affinity for AhR is the 6-formylindolo[3,2-b]carbazole

(FICZ), a tryptophan photoproduct of UV-B radiation (Rannug et al., 1995; Oberg et

al., 2005). Production of FICZ upon UV-B radiation causes its binding to AhR,

allowing the release of the AhR transcription factor from cytoplasmic retention

factors, and the activation of responses in the nucleus.

1.3 UV-B Radiation

The solar spectrum comprises wavelengths in the UV range. The stratospheric ozone

layer is responsible for the decrease of UV wavelengths impinging on the earth

surface, resulting in a complete depletion of UV-C and high reduction of UV-B

radiation (Chapman, 1930). After studies on the accumulation of anthropogenic

compounds in the atmosphere, namely chlorofluorocarbons (CFC) (Lovelock and

Maggs, 1973), it has been found that the interaction between CFC and UV light

results in ozone depletion. Indeed, this interaction leads to the formation of atomic Cl

which is able to react with ozone (O3), reducing it to O2 (Molina and Rowland, 1974).

The ozone depletion is of main concern causing the so called “ozone hole”, where

Introduction 30

UV rays can travel undisturbed, hitting the earth surface and harming living

organisms (McKenzie et al., 2003).

1.3.1 UV-B Damage

UV-B wavelengths impinging on earth are highly variable with spatial and

time-dependent distribution (McKenzie et al., 2007). UV-B is a general damaging

agent because of its high energy content per photon, which has damaging effects on

biomolecules such as DNA, RNA, proteins and lipids, and the capability to induce the

generation of reactive oxygen species (ROS) (Björn, 1996; Allan and Fluhr, 1997;

Jansen et al., 1998; Hideg et al., 2002; Frohnmeyer and Staiger, 2003; Casati and

Walbot, 2004). Of main concern is the DNA damage responsible for inhibition of

replication and transcription, mutations, growth arrest and cell death. Plants are

unavoidably exposed to UV-B radiation, because they need light for photosynthesis

and have a sessile lifestyle. In plants, at physiological level, UV-B light causes altered

flowering time, promotion of branching, reduced fertility and reduced biomass

production (Tevini and Teramura, 1989; Rozema et al., 1997). Indeed, plants evolved

UV-B light “sunscreen” protection pigments, sophisticated DNA repair processes,

ROS scavenging systems and adaptive development.

As DNA damaging agent, UV-B light can generate two photoproducts, pyrimidine

pyrimidone photoproducts (6-4PP) and mainly cyclobutane pyrimidine dimers (CPDs)

(Britt, 2004). In case DNA repair mechanisms fail, plants can cope with such

photoproducts through dimer-bypass (Britt, 2004), which allows replication

progression despite the lesion. In normal conditions, plants can repair the damage

through different mechanisms.

The main repair pathway for CPDs and 6-4PP in prokaryotes and eukaryotes, except

placental mammals, is given by photolyases enzymes (Britt, 1999). Photolyases are

able to use the energy of UV-A and blue light to break CPD and 6-4PP bonds

thereby restoring the DNA sequence (Sancar, 2003). The Arabidopsis thaliana

genome encodes two photolyases, namely PHR1 (also named UVR2) and UVR3

(Ahmad et al., 1997).

Plants have also a light-independent DNA repair mechanism, the nucleotide excision

repair (NER) mechanism (Shuck et al., 2008). In NER the DNA helices are

Introduction 31

completely opened, the damaged DNA is removed, new DNA is synthesized and the

helices are closed again by ligation (Shuck et al., 2008).

The third mechanism used upon DNA damage is the recombinational repair

(Shinohara and Ogawa, 1995). Recombinational repair is involved in double strand

breaks (DSBs) repair of the DNA helices and single-stranded gaps. DSBs repair

relies on non-homologous end joining (NHEJ) and homologous recombination (HR)

repair mechanisms (Bray and West, 2005; Schuermann et al., 2005).

The integrity of the genetic information is crucial for living organisms’ survival and

proliferation. The huge number of genotoxic agents in natural environment and the

relevance of the genotoxic damage to organisms explain this plethora of DNA repair

mechanisms.

1.3.2 UV-B Damage Signaling

DNA repair mechanisms evolved in all kingdoms of life. In animals, damaged DNA

acts as a signal through ATM and ATR protein kinases. ATM and ATR are able to

recognize damaged DNA and to initiate a DNA damage response, which arrests cell

cycle progression, giving time to the cell to repair the DNA before replication takes

place (Sancar et al., 2004). Plant homologs of the ATR and ATM kinases were

identified (Garcia et al., 2003; Culligan et al., 2004). Arabidopsis thaliana mutants

lacking ATR are hypersensitive to UV-B light (Culligan et al., 2004), whereas

Arabidopsis thaliana mutants lacking ATM are not (Garcia et al., 2003). It seems that

ATR is specific for arresting cell cycle progression when there are DNA damages

caused by UV-B radiation (Culligan et al., 2004).

It has been demonstrated that ROS production increases under UV-B in plants

(Hideg and Vass, 1996; Allan and Fluhr, 1997; Dai et al., 1997). The source of the

ROS derived from UV-B irradiation of the plants is not clear yet, also because there

are different sources of ROS production in plants, like photosynthesis and respiration.

Nevertheless, it has been postulated that ROS production caused by UV-B radiation

could come from inhibition of photosynthesis caused by UV-B light damage to

protein, hence reduced ability to dissipate excitation energy (Barta et al., 2004).

Plants counteract enhanced ROS production under UV-B light increasing

Introduction 32

ROS-scavenging systems (Casati and Walbot, 2004; Brown et al., 2005; Ulm and

Nagy, 2005).

DNA damage is thus a source of information, through which cells can undergo cell

cycle arrest to prevent additional damage. On the other hand, ROS can also cause

damage, and they are source of information, but they can also been used as defence

in response to biotic and abiotic stresses (Apel and Hirt, 2004). Indeed, ROS

influence gene expression, for example decreasing expression of LHCB1 which can

be rescued by exogenous application of antioxidants (Surplus et al., 1998;

Mackerness et al., 2001).

Because DNA damage and ROS action can reprogram gene transcription, it is

difficult to extrapolate the signalling component specific for UV-B irradiation.

Moreover, most studies are performed under UV-B fluence rates well above the ones

present in natural environments, increasing the signalling component of the damage

response, and hiding, at the same time, a possible specific UV-B signalling

component. Furthermore, UV-B irradiation activates genes normally involved in

defence response and wounding (Mackerness, 2000; Brosche and Strid, 2003;

Izaguirre et al., 2003), like pathogen related protein (PR-1, PR-2 and PR-5), and

proteinase inhibitor genes. These genes are induced because UV-B light causes the

production of signalling molecules, mainly jasmonic acid (JA), ethylene, salicylic acid

(SA), brassinosteroids (BR) and ROS. In the mutants for these phytormones like

NahG, etr1, jar1 and bri1, respectively impaired in the synthesis of SA, ethylene, JA,

and brassinosteroids, the UV-B induction of genes involved in wounding and defence

response was reduced or even absent (Surplus et al., 1998; Mackerness, 2000;

Savenstrand et al., 2004). Moreover, ROS are signalling molecules in both defence

and wounding responses (Surplus et al., 1998; Mackerness et al., 2001).

The complex networks composed of cross-talking pathways complicates the isolation

of the UV-B light specific signal responses and the identification of a putative UV-B

light photoreceptor.

1.3.3 UV-B non-Damage Response

UV-B light is not a mere source of damage but also an informational source for

plants. Notwithstanding, it has to be noticed that information and damage are linked

Introduction 33

in a way that the information initiates a response, at lower UV-B fluence rate, which

acclimates the plant to avoid damage at higher UV-B fluence rate (Brosche and Strid,

2003; Frohnmeyer and Staiger, 2003; Paul and Gwynn-Jones, 2003; Ulm and Nagy,

2005; Favory et al., 2009). Indeed, the information component of the UV-B light is a

proactive defence response composed of transcriptional activation of genes encoding

for pigment biosynthesis (flavonoids and hydroxycinnamic acid esters), which acts as

“sunscreens” pigments absorbing UV-B radiation (Caldwell et al., 1983), genes

encoding for photolyases, and genes encoding for proteins involved in ROS

scavenging (Jenkins, 1997; Rozema et al., 1997; Jansen et al., 1998; Ulm and Nagy,

2005). Moreover, the impact of UV-B radiation on transcription is very broad

modifying the expression of genes encoding enzymes, membrane and cytoskeletal

proteins, transcription factors, signalling components and proteins involved in various

processes like photosynthesis, primary and secondary metabolism, cell wall

biosynthesis, stress protection, DNA-related processes, RNA processing, translation

and proteolysis (Brosche and Strid, 2003; Izaguirre et al., 2003; Casati and Walbot,

2004; Ulm et al., 2004).

As stated before, UV-B light responses are fluence rate dependent and can be

divided in a stress response at damaging UV-B fluence rate, and an acclimation

response at non-damaging UV-B (Kucera et al., 2003; Ulm et al., 2004; Favory et al.,

2009). Phenotypically, non-damaging UV-B light evokes photomorphogenic

responses, including hypocotyl growth inhibition, cotyledon expansion, phototropic

curvature, biosynthesis of anthocyanins and flavonoids, and stomatal opening

(Beggs and Wellmann, 1994; Kim et al., 1998; Boccalandro et al., 2001; Eisinger et

al., 2003; Suesslin and Frohnmeyer, 2003; Shinkle et al., 2004). It is tempting to

distinguish between a UV-B light damage-mediated pathway and a UV-B light

non-damage-mediated pathway, as shown in Fig. I12, ascribing the first one to a

general stress response activated by e.g. DNA damage and ROS production, and the

second one to a specific response activated by a putative UV-B light photoreceptor.

There are already some evidence for a UV-B light specific pathway for

photomorphogenesis and transcriptional induction, independent from the damage

pathway. Indeed, UV-B light photomorphogenic responses can be separated from

wounding response, defence response or, in general, stress responses. For instance,

UV-B light fluence rate of 0,1 µmol m-2 s-1, well under UV-B light fluence rate present

in sunlight, is causing hypocotyl growth inhibition (Kim et al., 1998; Boccalandro et

Introduction

al., 2001). Furthermore, UV

induced transcript of marker

under this condition CPDs formation is undetectable

light pulses shorter than one second are not enough to start any damage pathway,

endorsing the hypothesis of a specific damage

CHS transcript is also not induced by ROS, and antioxidant are not repressing

induction under UV-B light (Jenkins et al., 2001)

of a specific UV-B light pathway responsible for gene induction and

photomorphogenesis.

Figure I12: Illustration of the UVThe fluence rate dependence overlaps

Another question arising from the analysis of plant responses to UV

there’s a unique UV-B light photoreceptor or there are more photoreceptor systems

at different UV-B light fluence rate and/or wavelengths

Frohnmeyer and Staiger, 2003; Casati and Walbot, 2004; Shinkle et al., 2004; Ulm et

al., 2004). Indeed, UV-B light specific responses could initiate from a multitude of

factors ranging from DNA damage, lipid peroxidation, ROS production, phytormones

or different combination of all these factors. It wou

the sources of the UV-B light signal in order to identify in which measure each

component is contributing specifically to the UV

the existence of a specific response at

damage independent) was recently demonstrated in

. Furthermore, UV-B light pulses shorter than a second are enough to

induced transcript of marker genes like CHALCONE SYNTHASE

under this condition CPDs formation is undetectable (Frohnmeyer et al., 1999)


endorsing the hypothesis of a specific damage-independent UV-

transcript is also not induced by ROS, and antioxidant are not repressing

(Jenkins et al., 2001). All these data suggest the presence

B light pathway responsible for gene induction and

: Illustration of the UV-B light damage response and the UV-B light non-damage response. The fluence rate dependence overlaps in planta (Whitelam G.C., 2007).

Another question arising from the analysis of plant responses to UV

B light photoreceptor or there are more photoreceptor systems

B light fluence rate and/or wavelengths (Brosche and Strid, 2003;


B light specific responses could initiate from a multitude of


or different combination of all these factors. It would be really challenging to separate

B light signal in order to identify in which measure each

component is contributing specifically to the UV-B light response. Notwithstanding,

stence of a specific response at low fluence rate UV-B (1,5 µ

damage independent) was recently demonstrated in Arabidopsis thaliana

34

B light pulses shorter than a second are enough to

CHALCONE SYNTHASE (CHS), whereas

(Frohnmeyer et al., 1999). UV-B


-B light pathway.

transcript is also not induced by ROS, and antioxidant are not repressing CHS

. All these data suggest the presence

B light pathway responsible for gene induction and

B light damage response and the UV-B light non-damage response.

Another question arising from the analysis of plant responses to UV-B radiation is if

B light photoreceptor or there are more photoreceptor systems

(Brosche and Strid, 2003;


B light specific responses could initiate from a multitude of


ld be really challenging to separate

B light signal in order to identify in which measure each

B light response. Notwithstanding,

B (1,5 µmol m-2 s-1, i.e.

thaliana (Favory et

Introduction 35

al., 2009). The Fig. I13 shows the Venn diagram of a microarray analysis of

Arabidopsis thaliana wild type seedlings versus mutant seedlings for the genes uvr8

and cop1-4 at low fluence UV-B radiation.

Figure I13: Venn diagram of gene up- and down-regulated under low fluence rate UV-B for the given time in hours, in wild type, and cop1-4 and uvr8-6 mutants (Favory et al., 2009).

This experiment shows the specific deregulation of about 850 genes at 6 hours after

the UV-B light treatment in wild type seedlings, and almost no gene deregulation in

the uvr8 and cop1 mutant seedlings. It seems that at this non-damaging UV-B light

fluence rate only the UV-B light specific pathway is activated, which depends on the

UVR8 and COP1 proteins. The question now is if this pathway is the UV-B light

specific pathway and the other pathways described until now are general stress

response pathways, or if there are more UV-B light pathways at different fluence rate

and wavelengths. A possible indirect answer to this question could come from the

identification of the UV-B light photoreceptor(s).

1.3.4 UV-B Perception

How plants are able to perceive non-damaging UV-B light is unknown, but it doesn’t

seem to happen through known photoreceptors. CHS transcript induction under UV-B

light was unaffected in a cry1cry2 double mutant (Wade et al., 2001). Also single and

combinatorial phytochrome mutants are not altered in their UV-B light induction of

CHS transcript (Wade et al., 2001; Brosche and Strid, 2003; Ulm et al., 2004).

Introduction 36

Moreover, photomorphogenic UV-B light responses like cotyledon opening in phyB

mutant or hypocotyl growth reduction in phyAphyB double mutant are not affected

(Boccalandro et al., 2001; Suesslin and Frohnmeyer, 2003; Oravecz et al., 2006).

Interestingly, the DNA repair mutants uvr1, uvr2 and uvr3 also show no altered

hypocotyl growth inhibition under UV-B radiation (Kim et al., 1998; Boccalandro et al.,

2001). Moreover, low fluence UV-B light gene induction is not altered in the uvr2

mutant background (Ulm et al., 2004).

Action-spectra of UV-B radiation responses lead to postulate absorption maxima of

295-300 nm and 280-300 nm (Ensminger, 1993; Beggs and Wellmann, 1994; Brown

et al., 2009). In this UV-B wavelength range, pterins or flavins could act as

chromophore for a putative photoreceptor. Nevertheless, we don’t know if a

chromophore is needed under UV-B light, given that most of the biomolecules are

absorbing UV-B light. This is different for known photoreceptors because most of the

biomolecules are blind to visible light.

The maxima of the action-spectrum for UV-B light photomorphogenic response in

planta is at longer wavelengths compared to the maxima action-spectrum for UV-B

light damage response, the latter one corresponding to the maxima of UV-B

absorption by DNA (Ensminger, 1993; Ballare et al., 1995).

1.4 Components of the Low-Fluence Rate UV-B Pathway

A genetic screen for mutants with altered hypocotyl growth reduction under pulses of

low fluence UV-B irradiation identified the uli3 mutant (UV-B light insensitive 1). The

ULI3 gene encodes for a protein with limited similarity to a diacylglycerol kinase

present in humans and is transcriptionally induced by UV-B and UV-A. This could

explain why in the uli3 mutant CHS and PR-1 genes induction were impaired under

both UV-A and UV-B irradiation (Suesslin and Frohnmeyer, 2003). It can thus be

concluded that ULI3 is not specific for UV-B light signalling, excluding it as UV-B

photoreceptor candidate.

rus1 and rus2 mutants (root UVB sensitive 1 and root UVB sensitive 2) were

identified in a screen of T-DNA-insertion lines for mutants showing root-growth

defects (Tong et al., 2008; Leasure et al., 2009). Interestingly, the root of rus1 and

rus2 mutant plants showed root hypersensitivity to UV-B light and this was

Introduction 37

independent from other known photoreceptors. The root was identified as the organ

responsible for UV-B perception. Moreover RUS1 and RUS2 interact with each other

in a yeast two-hybrid assay. The authors postulated that these proteins act as

negative regulators of a UV-B signaling pathway. In a recent work, RUS2 was found

in a screen for alteration in the auxin reporter construct DR5rev:GFP (Ge et al.,

2010). In this work, RUS2 is shown to be involved in auxin transport and to maintain

PIN FORMED (PIN) protein level. Moreover, RUS2 has been shown in all plant

organs and in the plastids and, in this work, removal of UV-B light does not restore

the wild type phenotype, suggesting that other factors than UV-B light cause this

phenotype.

The narrowband UV-B light pathway in Arabidopsis thaliana has been identified by

weak UV-B irradiation at 1.5 µmol m-2 s-1 fluence rate. This fluence rate is enough to

alter gene expression in Arabidopsis thaliana wild type plants, but not in cop1-4 or

uvr8-6 mutant plants (Oravecz et al., 2006; Favory et al., 2009). Such UV-B light

fluence rate is extremely low compared to environmental UV-B light, as shown in

phytotron sunlight simulator experiments (Fig. I14). The mean UV-B biologically

effective (UV-BBE) (Caldwell, 1971) quantity applied in this experiment was UVBE 400

mW m−2 (Favory et al., 2009).

Introduction

Figure I14: 25-day-old Arabidopsis plants, wild type (WT), mutant (uvr8-7) grown in sunlight simulators under realistic conditions (+UV) or with the UV portion specifically filtered out (-UV) (Favory et al., 2009)

All these data point to a UV-B pathway started by plants at UV-B fluence rates

causing negligible DNA damage or ROS production. Indeed, given the acclimation

response of plants to UV-B radiation

response starts before the occurrence of damage, and prepare the plants to cope

with higher irradiation during the course of the day.

Identification of UV-B light response mu

reporter assay revealed two c

additional components of the UV-B photoregulatory pathway. This may indicate that

there is high redundancy in other factors or that the low fluence rate UV-B pathway

only uses a very limited number of

old Arabidopsis plants, wild type (WT), UVR8 overexpressor (Ox no. 2), and ) grown in sunlight simulators under realistic conditions (+UV) or with the UV portion

(Favory et al., 2009).


DNA damage or ROS production. Indeed, given the acclimation

response of plants to UV-B radiation (Favory et al., 2009), it is reasonable that the


with higher irradiation during the course of the day.

B light response mutants using a HY5-promoter driven luciferase

reporter assay revealed two cop1 mutant alleles and nine uvr8 mutant alleles, but no



only uses a very limited number of upstream key players (Favory et al., 2009)

38

overexpressor (Ox no. 2), and uvr8 ) grown in sunlight simulators under realistic conditions (+UV) or with the UV portion


DNA damage or ROS production. Indeed, given the acclimation

, it is reasonable that the


promoter driven luciferase

mutant alleles, but no




Introduction 39

1.4.1 HY5

The photomorphogenic UV-B light pathway has few defined upstream components.

One of these components is HY5, a bZIP transcription factor involved in light induced

morphogenesis under different light qualities (Oyama et al., 1997; Osterlund et al.,

2000). HY5 localizes to the nucleus where it induces transcription of light responsive

genes, and its action is modulated at the protein level through proteasomal

dependent degradation mediated by the E3 ubiquitin ligase COP1 (Osterlund et al.,

2000). It is thought that the regulation of the HY5 protein stability involves

nucleocytoplasmic alterations in COP1 localization (Osterlund et al., 1999; Yi et al.,

2002). In the dark COP1 is in the nucleus and HY5 is degraded, leading to

skotomorphogenesis, while in the light COP1 localizes to the cytoplasm, leading to

the stabilization of HY5, and induction of light responsive genes (Osterlund et al.,

2000). Under UV-B irradiation HY5 transcript is induced and it activates

photomorphogenesis (Ulm et al., 2004). The UV-B-dependent gene activation

through HY5 is independent of phytochromes, cryptochromes and phototropins (Ulm

et al., 2004). The UV-B-dependent activation of 127 genes requires HY5 (Fig. I15A),

which correlates with a reduced tolerance to UV-B stress in hy5 mutant seedlings

(Fig. I15B) (Oravecz et al., 2006).

Figure I15: A) Venn diagram of genes responding to UV-B radiation in Arabidopsis thaliana accession Landsberg erecta (Ler) and in the hy5-1 mutant in the same ecotype. The Venn diagram displays the number of UV-B light responding genes in either the wild type only (left; i.e., HY5-dependent genes), the wild type and mutant (centre; i.e., HY5-independent genes), or mutant only (right). B) Phenotypic characterization of wild type and hy5 mutant seedlings with and without UV-B irradiation (Oravecz et al., 2006).

Introduction

1.4.2 COP1

Another specific upstream component of the low fluence UV

ubiquitin ligase COP1 (Oravecz et al., 2006)

signal transduction in plants that is composed of a RING finger (a type of zinc finger

domain) responsible for target protein ubiquitination (a signal for proteasomal

degradation) and two protein

responsible for self-dimerization, and a WD

Deng et al., 1992).

Figure I16: Schematic representation of COP1 protein domains: RING finger domain (RING), coiled-coil domain (Coil), and β-

COP1 represses light-mediated development through degradation of light

transcription factors like HY5, HYH, HFR1, and LAF1

al., 2002; Seo et al., 2003; Jang et al., 2005; Yang et al., 2005)

responsible for light-dependent gene regulation for the majority of light

genome expression (Ma et

activate transcription, or the light

the degradation activity of COP1 on light

In white light, wild-type seedlings

including open and green

seedlings grown in darkness

and closed cotyledons forming an apical hook, and el

In contrast, cop1 mutant seedlings show a constitutive photomorphogenic phenotype

in darkness (hence the name

nother specific upstream component of the low fluence UV-B light pathway is the E3

(Oravecz et al., 2006). COP1 is a central component of light



degradation) and two protein-protein interaction domains, a coiled-

dimerization, and a WD-40 domain (Fig. I16) (Deng et al., 1991;

: Schematic representation of COP1 protein domains: RING finger domain (RING), -propeller domain (WD-40) (Torii et al., 1998).

mediated development through degradation of light

transcription factors like HY5, HYH, HFR1, and LAF1 (Osterlund et al., 2000; Holm et

al., 2002; Seo et al., 2003; Jang et al., 2005; Yang et al., 2005). Moreover, COP1 is

dependent gene regulation for the majority of light

(Ma et al., 2002). Is not known yet if COP1 itself is able to

activate transcription, or the light-controlled genome expression is a consequence of

the degradation activity of COP1 on light-responsive transcription factors.

type seedlings show a photomorphogenic growth phenotype,

cotyledons and reduced hypocotyl elongation. Wild

seedlings grown in darkness show the typical skotomorphogenic phenotype with pale

and closed cotyledons forming an apical hook, and elongated hypocotyls (Fig. I1

mutant seedlings show a constitutive photomorphogenic phenotype

in darkness (hence the name constitutively photomorphogenic 1) (Fig. I1

40

B light pathway is the E3

. COP1 is a central component of light



-coil domain, also

(Deng et al., 1991;

: Schematic representation of COP1 protein domains: RING finger domain (RING),

mediated development through degradation of light-responsive

(Osterlund et al., 2000; Holm et

. Moreover, COP1 is

dependent gene regulation for the majority of light-controlled

. Is not known yet if COP1 itself is able to

controlled genome expression is a consequence of

responsive transcription factors.

show a photomorphogenic growth phenotype,

cotyledons and reduced hypocotyl elongation. Wild-type

show the typical skotomorphogenic phenotype with pale

ongated hypocotyls (Fig. I17).

mutant seedlings show a constitutive photomorphogenic phenotype

) (Fig. I17).

Introduction

As central regulator of light signaling, COP1 is interconnecting the photoreceptors

signals and the light-responsive transcription factors. Indeed, COP1 has been shown

to interact with phyA, phyB, cry1 and cry2 and to ubiquitinate

photoreceptors phyA and cry2

2004; Chen et al., 2010; Jang et al., 2010)

regulator between photoreceptor and transcription factors is

figure indicates that the interaction of the photoreceptors with COP1 negatively

regulates COP1. This regulation adds a level of complexity to the system which

considers the nuclear-cytoplasmic partitioning of COP1, under different l

conditions, as a level of regulation of COP1 activity

Figure I18: COP1 interaction partners under different represses plant photomorphogenesicry2) and downstream transcription factors (HY5, HYH, HFR1 and LAF1).

Figure I17: Wild-type and seedlings phenotype in the dark and in white light (Osterlund et al., 1999)


responsive transcription factors. Indeed, COP1 has been shown

to interact with phyA, phyB, cry1 and cry2 and to ubiquitinate

photoreceptors phyA and cry2 (Yang et al., 2001; Shalitin et al., 2002; Seo et al.,

Chen et al., 2010; Jang et al., 2010). A schematic model with COP1 as central

regulator between photoreceptor and transcription factors is shown in Fig. I1



cytoplasmic partitioning of COP1, under different l

conditions, as a level of regulation of COP1 activity (Yi and Deng, 2005)

COP1 interaction partners under different wavelengths (Yi and Deng, 2005)represses plant photomorphogenesis by direct interaction with photoreceptors (phyA, phyB, cry1 and cry2) and downstream transcription factors (HY5, HYH, HFR1 and LAF1).

41

type and cop1 mutant seedlings phenotype in the dark and in

und et al., 1999).


responsive transcription factors. Indeed, COP1 has been shown

to interact with phyA, phyB, cry1 and cry2 and to ubiquitinate the light-labile

(Yang et al., 2001; Shalitin et al., 2002; Seo et al.,

. A schematic model with COP1 as central

shown in Fig. I18. The



cytoplasmic partitioning of COP1, under different light

(Yi and Deng, 2005).

(Yi and Deng, 2005). COP1 s by direct interaction with photoreceptors (phyA, phyB, cry1 and

Introduction 42

COP1 is not only present in higher plants but also in vertebrates, where it is involved

in the degradation of transcription factors like the tumor-suppressor protein p53 and

the protein c-Jun (Yi et al., 2002; Bianchi et al., 2003). Interestingly, human COP1 is

also involved in UV-B-induced signaling in keratinocytes (Kinyo et al., 2010).

In plants, in contrast to its role as a negative regulator of photomorphogenesis under

visible light, COP1 is considered a positive regulator of UV-B-induced

photomorphogenesis (Oravecz et al., 2006). This idea is based on microarray

analyses which show the lack of UV-B-induced gene activation in cop1-4 mutant

seedlings (Favory et al., 2009). This includes HY5-dependent genes, and HY5 itself,

indicating that COP1 is upstream of HY5 in the UV-B light signaling pathway (Fig.

I13).

Upon UV-B irradiation COP1 and HY5 protein levels are stabilized in the nucleus, two

contradictory events if we consider that HY5 is a substrate of COP1 activity (Oravecz

et al., 2006).

1.4.3 UVR8

Another upstream component of the UV-B light signaling in plants is the UV

RESISTANCE LOCUS 8 (UVR8). uvr8 has been found and characterized to be

hypersensitive to UV-B radiation and to lack CHS induction and flavonoids

accumulation under UV-B irradiation (Kliebenstein et al., 2002). Differently from HY5

and COP1, which are also involved in visible light signaling pathways, UVR8 seems

to be specific for the UV-B light response. Indeed, uvr8 mutant plants are unaltered in

CHS gene activation by non-light stimuli like low temperature and sucrose, as well as

red, far-red and blue light (Brown et al., 2005; Favory et al., 2009). The UVR8 protein

sequence is related to the human protein regulator of chromatin condensation 1

(RCC1), a β-propeller protein with guanine nucleotide-exchange factor (GEF) activity

for the small GTPase Ran (Ohtsubo et al., 1987; Bischoff and Ponstingl, 1991;

Kliebenstein et al., 2002). RCC1 is constitutively localized to the nucleus where it

binds to chromatin, and it generates a Ran-GTP/Ran-GDP gradient across the

nuclear envelope, which is required to drive active nucleo-cytoplasmic protein

transport and to regulate cell cycle and mitosis. There is no evidence that RCC1 is

involved in UV-B light responses or transcriptional regulation. Differently, UVR8

Introduction 43

shows a cytoplasmic and nuclear localization (Brown et al., 2005) with nuclear

enrichment under UV-B (Kaiserli and Jenkins, 2007). Moreover, UVR8 seems not be

involved in nucleo-cytoplasmic transport and mitotic regulation indeed, the uvr8

mutant grows normally in standard conditions, whereas RCC1 mutations in

Saccharomyces cerevisiae alter a wide variety of processes, including pre-mRNA

processing and transport (Aebi et al., 1990; Kadowaki et al., 1993), mating behaviour

(Clark and Sprague, 1989), initiation of mitosis (Matsumoto and Beach, 1991), and

chromatin decondensation (Sazer and Nurse, 1994). UVR8 has been tested negative

for Ran-GEF activity, and it is not able to interact with Arabidopsis thaliana Ran in

yeast two-hybrid assay (Brown et al., 2005). However, UVR8, like RCC1, is able to

bind chromatin (Brown et al., 2005; Cloix and Jenkins, 2008). The ability of UVR8 to

bind chromatin seems to be independent from UV-B irradiation. It is possible to

conclude that UVR8 and RCC1, despite the sequence homology, have different

functions.

RT-PCR analyses of uvr8 mutant versus wild type shows that plants lacking UVR8

are impaired in the UV-B-mediated induction of phenylpropanoid biosynthesis genes,

and in genes involved in terpenoid and alkaloid biosynthesis, all UV-B light absorbing

compounds, and in genes involved in protection against oxidative stress (like

gluthatione peroxidase) and photooxidative damage (like ELIP proteins) (Kliebenstein

et al., 2002; Brown et al., 2005). Microarray analyses of hy5 and uvr8 mutants

demonstrate that UVR8 acts upstream of HY5 in the UV-B signalling pathway, and

that approximately half of the genes regulated by UVR8 are regulated by HY5 (Brown

et al., 2005). It has also been shown that UVR8 accumulates in the nucleus under

UV-B irradiation and it binds to the HY5 promoter region, but the binding of UVR8 to

the promoter region of HY5 was shown to be independent from UV-B irradiation

(Brown et al., 2005; Kaiserli and Jenkins, 2007). uvr8 mutants lack

photomorphogenic response under low fluence rate, non-damaging UV-B irradiation,

as shown in Fig. I19. Under the same experimental conditions both uvr8 and cop1

mutants lack completely UV-B light-dependent gene expression, as shown in Fig. I13


Introduction

Figure I19 : Wild type seedlingssame ecotype under white light or white light supplemented with narro2009).

UVR8 overexpressor lines show higher resistance to UV

mutant phenotype under UV

with an enhanced UV-B response, e.g.

accumulation and hypocotyl growth inhibition

UVR8 has been shown to homodimerize constitutively, and to interact with COP1 in a

UV-B light dependent manner. The UV

COP1 starts after five to ten minutes of UV

the UV-B-induced photomorphogenic

: Wild type seedlings of Arabidopsis thaliana (Ws) and uvr8-7 mutant seedlings in the same ecotype under white light or white light supplemented with narrowband UV

overexpressor lines show higher resistance to UV-B irradiation

mutant phenotype under UV-B light (Fig. I14). The enhanced resistance is associated

B response, e.g. HY5 and CHS gene activation,

d hypocotyl growth inhibition (Favory et al., 2009). In the same work


B light dependent manner. The UV-B light dependent interaction of

COP1 starts after five to ten minutes of UV-B irradiation, defining an early event in

induced photomorphogenic pathway.

44

mutant seedlings in the band UV-B (Favory et al.,

B irradiation, and cop1-like

. The enhanced resistance is associated

gene activation, anthocyanins

. In the same work


B light dependent interaction of UVR8 and

B irradiation, defining an early event in

Introduction 45

1.5 Aim of This Work

The aim of a scientific work, in basic research fields, is in perpetual evolution. The

result of each experiment is telling to a scientist which experiment to do in the

following working days. The aim of our lab “UV-B perception and signaling in plants”,

as from the title of the lab home page, was clearly the findings of the plant UV-B

radiation photoreceptor.

A luciferase-based genetic screen, after EMS mutagenesis of Arabidopsis thaliana

plants, carried out in our laboratory by Dr. Agnieszka Brzezinska, didn’t identify any

new component of the UV-B radiation pathway. Indeed, the genetic screen identified

2 alleles of cop1 and 9 alleles of uvr8. This result may indicate that the UV-B pathway

in Arabidopsis has few upstream components, or redundancy of additional upstream

components. Thanks to this result, the lab focused on UVR8 and COP1, which led to

the finding of the UV-B dependent interaction of UVR8 with COP1. Is UVR8 and/or

COP1 or something upstream to these proteins the UV-B photoreceptor in plants?

With these questions I’ve started my PhD experience, checking the degradation of

UVR8 under UV-B light, and complementation experiments, cloning COP1 homologs

from the moss Physcomitrella patens, and transforming them in the cop1-4 mutant

line of Arabidopsis thaliana. Later on, I tried to reproduce the UV-B light dependent

interaction between UVR8 and COP1 in heterologous system, establishing the yeast

two-hybrid analysis for this specific experiment.

Material and Methods 46

2 Materials and Methods

2.1 Materials

2.1.1 Plant Material and Media

Two Arabidopsis thaliana wild-type accessions were used in this study: Columbia

(Col), and Wassilewskija (Ws). Different mutants and transgenic lines in these

backgrounds were used herein, as listed in Table M1.

Mutants Background Reference

cop1-4 Col (McNellis et al., 1994)

uvr8-6 Col (Alonso et al., 2003)

uvr8-9 Ws/ ProHY5:Luc+ (Favory et al., 2009)

hy5-215 Col (Rubio and Deng, 2005)

uvr8-8 Ws/ ProHY5:Luc+ (Favory et al., 2009)

Transgenic lines

Pro35S:A9RS92* uvr8-8/ ProHY5:Luc+ (This work)

Pro35s:CFP-UVR8 Col (Stec, unpublished)

Table M1: List of Arabidopsis thaliana mutants and transgenic lines used herein.

(*) A9RS92, UVR8 ortholog in Physcomitrella patens.

2.1.2 Bacterial Strains and Media

Escherichia coli Top10F’ (Invitrogen, Carlsbad, USA) was used for various cloning

procedures, including Gateway-based cloning. Escherichia coli DB3.1 (Invitrogen,

Carlsbad, USA) was used for the propagation of Gateway® plasmids containing the

ccdB gene.

Agrobacterium tumefaciens strain C58CIRifR containing the non-oncogenic Ti

plasmid pGV3101 was used for stable plant transformations.

Luria-Bertani (LB) medium consisting of 1% (w/v) Bacto-tryptone, 0.5% (w/v)

Bacto-yeast-extracts and 0.5% (w/v) NaCl was used for growing liquid cultures of

Escherichia coli and Agrobacterium tumefaciens. For solid media 1.5% (w/v) of

Bacto-agar was added. Following antibiotics were used for plasmid selection:


ampicillin (50 µg/ml), kanamycin (50 µg/ml), gentamycin (25 µg/ml), spectinomycin

(100 µg/ml), chloramphenicol (60 µg/ml) or rifampicin (100 µg/ml).

2.1.3 Yeast Strains and Media

Saccharomyces cerevisiae: strain PJ69-4A (MATa trp1-901 leu2-3,112 ura3-52

his3-200 gal4∆ gal80∆ LYS2::GAL1-HIS3 GAL2-ADE2 met2::GAL7-lacZ) was used

for yeast two-hybrid and yeast three-hybrid analyses.

Saccharomyces cerevisiae: strain L40 (MATa his3-∆200 trp1-901 leu2-3,112 ade2

LYS2::(LexAop)4-HIS3 URA3::(LexAop)8-lacZ) was used for yeast two-hybrid analysis.

Yeast was grown at 30°C on either YPDA medium (20 g /l peptone, 20 g/l glucose, 10

g/l yeast-extract, 40 mg/l adenine-hemisulfate) or SD minimal medium (20 g/l

glucose, 1.7 g/l yeast nitrogen base, 5 g/l ammonium sulfate, 10 g/l succinic acid, 6

g/l NaOH, 20 mg/l adenine, amino acids mix solution). The latter was supplemented

as indicated by the manufacturer with premixed CSM dropout media (FORMEDIUM,

Hunstanton, GB) lacking only specific amino acids as required. For solid media 16 g/l

Bacto-agar was added.

2.1.4 Plasmids, Oligonucleotides and Antibodies

Plasmids used in this study are listed in the following Table M2:

Name Type Reference/Manufacturer

General purpose

pDONR207 Gateway entry Invitrogen, Carlsbad, USA

pENTRY3C Gateway entry Invitrogen, Carlsbad, USA

Agrobacterium

pAlligator Gateway destination http://www.isv.cnrs-gif.fr/jg/alligator/vectors.html

pB2GW7 Gateway destination (Karimi et al., 2002)

BiFC

pE-SPYNE (Walter et al., 2004)

pE-SPYCE (Walter et al., 2004)


Yeast

pBTM116-D9 Gateway destination (Stelzl et al., 2005)

pGADT7_GW Gateway destination (Marrocco et al., 2006)

pGBT9_GW Gateway destination (Marrocco et al., 2006)

pAG-426GPD-ccdB Gateway destination (Alberti et al., 2007)

HEK293T Cells

pDEST27 Gateway destination Invitrogen, Carlsbad, USA

pcDNA-DEST40 Gateway destination Invitrogen, Carlsbad, USA

Table M2: List of plasmids used in this work.

All oligonucleotides used in this study were synthesized by Operon (Ebersberg,

Germany) and salt-free purified, except for the site-directed mutagenesis, where the

oligonucleotides were synthesized by Invitrogen and HPLC purified. Table M3 gives

an overview:

Name Sequence

Site-Directed Mutagenesis

W144F-gw gaaggagaggtccagagtttcggccgcaaccag

W144F_antisense-gw ctggttgcggccgaaactctggacctctccttc

Y194F-gw cagaagatggtgacctctttggatggggctg

Y194F_antisense-gw cagccccatccaaagaggtcaccatcttctg

Y246F-gw cctactctggagcattgtttacttatggatggagcaa

Y246F_antisense-gw ttgctccatccataagtaaacaatgctccagagtagg

Y248F-gw cctactctggagcattgtatacttttggatggagcaaat

Y248F_antisense-gw atttgctccatccaaaagtatacaatgctccagagtagg

W92F-gw aggcatggaagtctacagtttcggatggggtgattttgg

W92F_antisense-gw ccaaaatcaccccatccgaaactgtagacttccatgcct

W196L-gw gatggtgacctctatggattgggctgggga

W196L_antisense-gw tccccagcccaatccatagaggtcaccatc

W250L-gw ctggagcattgtatacttatggattgagcaaatatggacag

W250L_antisense-gw ctgtccatatttgctcaatccataagtatacaatgctccag

W300L-gw cattgacttcagatggaaaactatatggattgggttggaataagttt

W300L_antisense-gw aaacttattccaacccaatccatatagttttccatctgaagtcaatg

C127A-gw cggtattcggatcaagcagattgctgctggggatagtcat

C127A_antisense-gw atgactatccccagcagcaatctgcttgatccgaataccg

C132T-gw tgcttgtggggatagtcatactttggctgtcactatggaa


C132T_antisense-gw ttccatagtgacagccaaagtatgactatccccacaagca

W94A-gw gaagtctacagttggggagcgggtgattttgggag

W94A_antisense-gw ctcccaaaatcacccgctccccaactgtagacttcc

W198A-gw gacctctatggatggggcgcgggaagatacggaaattt

W198A_antisense-gw aaatttccgtatcttcccgcgccccatccatagaggtc

W233A-gw gaaaatgtcaatggttgcttgtggagcgcggcacacaata

W233A_antisense-gw tattgtgtgccgcgctccacaagcaaccattgacattttc

W250A-gw ggagcattgtatacttatggagcgagcaaatatggacagctagg

W250A_antisense-gw cctagctgtccatatttgctcgctccataagtatacaatgctcc

W285A-gw ctcccagatttcgggaggtgcgagacatacaatggcattg

W285A_antisense-gw caatgccattgtatgtctcgcacctcccgaaatctgggag

W302A-gw ggaaaactatatggatggggtgcgaataagtttggacaagtagg

W302A_antisense-gw cctacttgtccaaacttattcgcaccccatccatatagttttcc

W337A-gw agttcaagtctcatgtggagcgagacataccttggctgtc

W337A_antisense-gw gacagccaaggtatgtctcgctccacatgagacttgaact

W233F-gw gaaaatgtcaatggttgcttgtggattccggcacacaatatc

W233F_antisense-gw gatattgtgtgccggaatccacaagcaaccattgacattttc

W285F-gw ctcccagatttcgggaggtttcagacatacaatggcattg

W285F_antisense-gw caatgccattgtatgtctgaaacctcccgaaatctgggag

W337F-gw agttcaagtctcatgtggattcagacataccttggctgtc

W337F_antisense-gw gacagccaaggtatgtctgaatccacatgagacttgaact

Cloning

AT_COP1-WD-40-fw-gw ggggacaagtttgtacaaaaaagcaggcttaatgtatagcaacggccttgc

AT_COP1-BP-rev-gw ggggaccactttgtacaagaaagctgggtatcacgcagcgagtaccaga

AT_COP1-BP-fw-gw ggggacaagtttgtacaaaaaagcaggcttaatggaagagatttcgacggatcc

Atcop1H69Y-fw ctcacggcttgtggttatagtttctgc

Atcop1H69Y-rev gcagaaactataaccacaagccgtgag

Atcop1-4_Stop cggctcgagttacgaatctgacccactcagc

AtCOP1_EcoRI cggaattcatggaagagatttcgacgg

At3g26100_fw-gw ggggacaagtttgtacaaaaaagcaggcttcatgtgtaataaaagggtgatt

At3g26100_rev-gw ggggaccactttgtacaagaaagctgggtcctagctgagatcgatatccac

At3g15430_fw-gw ggggacaagtttgtacaaaaaagcaggcttcatggctgatcgaaactgtttg

At3g15430_rev-gw ggggaccactttgtacaagaaagctgggtctcaacaaagccggctacgaga

At1g19880_fw-gw ggggacaagtttgtacaaaaaagcaggcttcatggcggaagcgatgaattcg

At1g19880_rev-gw ggggaccactttgtacaagaaagctgggtcctaagacttacgtggccttcc

At5g60870_fw-gw ggggacaagtttgtacaaaaaagcaggcttcatggcagcgttaagccaccgc

At5g60870_rev-gw ggggaccactttgtacaagaaagctgggtcttaaggtgatcttgagactaa

At5g12350_fw-gw ggggacaagtttgtacaaaaaagcaggcttcatggcttcggatcttagtaga


At5g12350_rev-gw ggggaccactttgtacaagaaagctgggtctcagcgaggcaagtcctcact

rup1_nls-gw cctaagaagaagagaaaggttggaggaatggaggctttgttc

rup2_nls-gw cctaagaagaagagaaaggttggaggaatgaacactcttc

Fw_nls-gw ggggacaagtttgtacaaaaaagcaggcttcatgcctaagaagaagag

RUP1_rev-gw ggggaccactttgtacaagaaagctgggtcttagctttgtttgcccga

RUP2_rev-gw ggggaccactttgtacaagaaagctgggtcctatggttttcttttgcc

UVR8-Cterm-nls cgtgtacgaattcctaagaagaagagaaaggtttga

UVR8-Cterm-nls-gw ggggaccactttgtacaagaaagctgggtatcaaacctttc

Table M3: List of oligonucleotides used herein.

Standard restriction and ligation methods were used according to standard methods

(Sambrook and Russel, 2001). Nuclear localization signal was added by PCR

extension primers.

Gateway cloning was performed according to the Gateway manual (Invitrogen). After

Escherichia coli transformation, the isolated DNA was sequenced at GATC

(Konstanz, Germany).

All antibodies used in this study are presented in the following Table M4:

Name Host Peptide Sequence Company

Primary antibodies

α-UVR8 (P60) Rabbit CGDISVPQTDVKRVRI Eurogentec

α-UVR8 (FB4732) Rabbit a)CGDISVPQTDVKRVRI

b) MAEDMAADEVTAPPR

Eurogentec

α-UVR8 Rabbit VPDETGLTDGSSKGN Eurogentec on published

epitope (Kaiserli and

Jenkins, 2007)

α-UVR8 Guinea Pig CGDISVPQTDVKRVRI Eurogentec

α-Actin Mouse Sigma

α-GST Mouse Sigma

α-LexA Rabbit Millipore

α-HY5 Rabbit (Oravecz et al., 2006)

α-Plant-Ubiquitin Rabbit Bethyl Laboratories, Inc.

α-GFP Rabbit Invitrogen


Secondary antibodies

α-Mouse Rabbit Dako

α-Rabbit Swine Dako

α-Guinea Pig Goat Abcam

α-Mouse-Alexa 680 Goat Invitrogen

α-Rabbit IRDye® 800CW Donkey Li-COR biosciences

Table M4: List of antibodies used in this work.

2.1.5 Enzymes and Reagents

Restriction enzymes were purchased from New England Biolabs (Beverly, USA) or

Invitrogen (Carlsbad, USA). Buffers and enzymes for standard PCR were supplied by

Genaxxon; for high-fidelity cloning PCR Herculase II enzyme and buffer (Stratagene)

was used. GeneRulerTM 1kb DNA Ladder (Fermentas) was used as a size marker for

DNA separation, whereas the pre-stained Precision Plus Protein Dual Colour

Standards (Bio-Rad) was used as a size marker on protein gels. Following kits were

used: RNeasy RNA extraction kit (RNeasy Plant Mini Kit, Qiagen), Plasmid Miniprep

kit (E.Z.N.A.), Jetstar Plasmid Purification Kit (GENOMED), Nucleon PhytoPure Plant

Genomic DNA Extraction Kit (Amersham) and ECL plus immunoblot detection kit (GE

Healthcare).

Chemicals of analytical grade were manufactured by Fluka (Buchs, USA),

Sigma-Aldrich (St. Louis, USA), Merck (Darmstadt, Germany), Roth (Karlsruhe,

Germany), Duchefa (Haarlem, NL), Becton Dickinson (Heidelberg, Germany),

Bio-Rad (Hercules, USA) and Invitrogen (Carlsbad, USA).


2.2 Methods

2.2.1 Plant Growth

Arabidopsis thaliana seeds were surface-sterilized in 6% v/v sodiumhypochlorite with

0.1% (v/v) Tween 20, followed by 3 x washing with sterile distilled water. Seeds were

sawn on MS plates (0.43% [w/v] Murashige and Skoog basal salt mixture [Duchefa],

0.05% [w/v] MES buffer [Roth] pH = 5.7) containing 1% (w/v) sucrose and 0.8% (w/v)

agar, and were stratified for 2 days in the dark at 4°C. Seeds were germinated and

grown aseptically at 25°C either in a standard grow th chamber (MLR-350, Sanyo

Electric Co., Ltd.) under a 12 h dark / 12 h light cycle (fluence rate = 69 µmol m-2

sec-1) at 21°C/19°C, or under continuous irradiation in the narrowband UV-field at

23°C.

2.2.2 Plant Protein Extraction

For protein extract experiments, 250 mg of Arabidopsis thaliana seedlings were

harvested and snap frozen in liquid nitrogen. Seedling tissues were mixed with 5-7

glass beads and ground for 8 sec using a Silamat S5 mixer (Ivoclar Vivadent). 50 µl

protein extraction buffer (0.05 M TRIS-HCl, pH7.5; 2 mM EDTA, pH8; 0.15 M NaCl;

1% [v/v] Igepal; 1xComplete EDTA-free Protease Inhibitor Cocktail [Roche], 20 µM

MG132 [Sigma], and 20 µM ALLN [Sigma]) was added to each sample on ice. The

samples were thoroughly mixed for three times using the Silamat and centrifuged for

10 min with 20800 g at 4°C (Centrifuge 5804R; Eppen dorf), and the supernatant was

transferred to a pre-cooled eppendorf tube.

Protein concentrations were measured with the amido-black method (Moser et al.,

2000). Protein samples were diluted 1:50 in 200 µl distilled water, and a BSA

(Bio-Rad) standard sample dilution series of 10-250 µg/ml was also prepared in 200

µl solutions. 800 µl precipitation solution (10% [v/v] acetic-acid; 90% [v/v] methanol;

0.01% [w/v] Naphtol Blue Black [Amidoblack]) was added. After mixing by vortexing

samples were centrifuged for 15 min at RT at 20800 g. After washing with 1 ml

washing solution (10% [v/v] acetic-acid; 90% [v/v] ethanol) and centrifugation for 15

min at RT with 20800 g, precipitates were air dried for ~15 min at RT, and dissolved


in 250 µl 0.2 N NaOH. 200 µl of each sample were transferred to 96-well ELISA

plates and extinctions were measured at 630 nm in a MRX Microplate Reader 630

(Dynex Technologies). Protein sample concentrations were determined according to

the BSA calibration curve. The extract was heat treated at 100°C for 5 minutes or

not, as described for each experiment.

For immunoprecipitation assay protein were extracted as for total extract analysis.

The extract was incubated with appropriate antibodies as indicated for 2 h at 4 °C.

Then protein A-agarose beads (Roche Applied Science) were added for 1 hour and

washed three times in extraction buffer spinning each time at 1 g at +4°C. The

immunoprecipitate was stored at -20°C before analys is.

2.2.3 Cell-Free Degradation Assay

Seven-day-old Arabidopsis thaliana seedlings were UV-B treated and harvested as

described above for plant protein extraction. The protein extracts were then kept at

room temperature adding 10 µmol proteasome inhibitors, or adding DMSO, as mock

control, in the same volume of proteasome inhibitors (ALLN (Sigma), MG132

(Sigma), MG115 (Sigma), PS1 (Sigma)). After treatment the proteins were kept at

-80°C before western analysis.

2.2.4 Yeast Growth and Transformation

Yeast strains L40 and PJ69-4A were grown aseptically from glycerol stock on plates

supplemented with amino acids complete media, YPDA. Yeast were picked from

YPDA plates and grown in YPDA liquid culture to OD600 = 0.6, then yeast was

transformed according to Gietz and Woods (Gietz and Woods, 2002). After

transformation the yeast were grown on selective plates supplemented with drop-out

media lacking amino acids as required.


2.2.5 Yeast Protein Extraction

Transformed yeast were transferred to liquid 2 ml miniculture in media lacking

corresponding amino acids (-Leu and - Trp) and they were grown overnight at 30°C

with 150 rpm. Fifty-ml liquid culture lacking corresponding amino acids was

inoculated with the overnight pregrown miniculture, and it was grown at 30°C, 150

rpm until 0.6 OD600. Cells were then centrifuged and washed in distilled water. After,

the cells were centrifuged and resuspended in extraction buffer as for plant protein

extract supplemented with 0.1 M PMSF and 200 µl of 0.3 mm glass beads. The

extraction was done at +4°C vortexing the samples f or 1 min and another 1 min on

ice for a total of 10 min vortexing. Then the samples were centrifuged and +4 °C for

10 min and the supernatant was transferred in a new tube. The extract was heat

treated at 90°C for 3 min or not, as described for each experiment.

For immunoprecipitation assay protein were extracted as for total extract analysis.

The extract was incubated with appropriate antibodies as indicated for 2 h at 4°C.

Then protein A-agarose beads (Roche Applied Science) were added for 1 hour and

washed three times in extraction buffer, spinning down each time at 1 g at +4°C. The


2.2.6 HEK293T Cells Growth and Transformation

Overexpression of target proteins in HEK293T cells was achieved through transient

transfection. The day before cells’ transfection, HEK293T cells were split into 6 wells

plates. Splitting was conducted from a 10 cm mother plate with 70% confluence rate.

After removing the old medium the cells were treated for 2 minutes at 37°C with

Trypsin/EDTA in order to detach the cells from the surface. Then, the cells were

poured into a fresh well of a 6-well plate diluting 1:1 with new MEM +/+ medium. On

the following day, for each single transfection, 100 µl of serum free MEM -/- medium

was mixed with 3 µl of GeneJuice Transfection Reagent (Novagen, Darmstadt,

Germany), agitated vigorously and kept at RT for 5 min. Then, 1 µg of DNA of

interest (pDEST27-GST-UVR8, pcDNA-DEST40-UVR8 or both [0.5 µg each]) was

added to the mixture, mixed by gently pipetting and kept at RT for 5-15 min. Finally

the entire volume of GeneJuice reagent/DNA mixture was poured drop-wise on the


surface of the cell-containing medium. Transfected HEK293T cells were incubated for

72 hours at 37°C and 5% CO 2, and finally harvested. As positive control for

successful transfection, a vector for expression of EGFP was used. The qualitative

observation of GFP fluorescent cells accounted for the efficiency of transfection.

2.2.7 Protein Extraction from Transfected HEK293T Cells

Cells in each well of a 6-well plate were washed once with 1x PBS. 300 µl

CytoBuster extraction buffer (Novagen, Darmstadt, Germany) was added to each

well and incubated for 5 min on ice. The cell layer was scraped off from the bottom of

each well and the resulting lysate transferred to a reaction tube. After centrifugation

at 16,000g for 15 min at 4°C to remove insoluble de bris and chromosomal DNA the

remaining extract was stored at -20°C and used for subsequent experiments.

For GST immunoprecipitation, 30 µl total extract was incubated overnight at 4°C with

50 µl GSH-Sepharose beads (Amersham Biosciences). Beads were sedimented by

centrifugation at 100g, for 2 min at 4°C. After inc ubation, the beads were washed

three times in extraction buffer, spinning each time at 100g at +4°C. The


2.2.8 UV-B Treatments

The UV-B treatments of Arabidopsis thaliana extracts, yeast extracts and HEK293T

cell extracts were performed under the following UV-B fields:

I) Short term irradiation was performed under a UV-B light field designated as the

“broadband UV-B field” consisting of six broadband Philips TL 40W/12 RS UV

fluorescent tubes (λ_max = 310 nm, half-bandwidth = 40 nm, fluence rate = 7 W/m2,

or 18 µmol m-2 sec-1). The UV-B spectra was generated by filtering the emitted light

through 3-mm transmission cut-off filter WG303 with half-maximal transmission at

303 (WG303 Schott, Germany), as shown in Fig. M1. Plastic filter served as the

minus UV-B control, and WG303 as the weak UV-B treatment.


Figure M1: Spectral irradiance in the broadband UV-B field under the 303 cut-off. Spectral energy distributions of UV-B sources were measured with an OL 754 UV-visible spectroradiometer (Optronic Laboratories, Orlando, FL).

Unless otherwise stated, the following irradiation protocol was used for UV-B

treatments under this broadband UV-field: The protein extracts derived from plants or

yeast were put on ice during irradiation and treated for the indicated time for each

experiment, under plastic filter or WG303 filter.

II) The continuous UV-B treatment was performed under a white light field

supplemented with narrowband UV-B, designated as the “narrowband UV-B field”

consisting of six dimmable light tubes. The white light is provided by three Osram

L18W/30 tubes (3.6 µmol m-2 sec-1; measured with a LI-250 Light Meter, LI-COR

Biosciences, Lincoln, NE) that is supplemented with UV-B irradiation provided by

three Philips TL20W/01RS narrowband UV-B tubes (1.5 µmol m-2 sec-1; measured

with a VLX-3W Ultraviolet Light Meter equipped with a CX-312 sensor, Vilber

Lourmat, Marne-la-Vallée, France). The resulting spectrum is shown in Fig. M2.

Plastic filters serves as the minus UV-B control, the UV-B range was modulated by

the use of 3-mm transmission cut-off filters WG303 (WG303; Schott Glaswerke,

Mainz, Germany). Spectral energy distributions of UV-B sources were measured as

described above (Fig. M2).

0,00E+00

1,00E-05

2,00E-05

3,00E-05

4,00E-05

5,00E-05

6,00E-05

7,00E-05

0,00 200,00 400,00 600,00 800,00 1000,00

W/m

2

Wavelenghts


Figure M2: Spectral irradiance in the narrowband UV-B field under the 303 cut-off. Spectral energy distributions of UV-B sources were measured with an OL 754 UV-visible spectroradiometer (Optronic Laboratories, Orlando, FL).

Unless otherwise stated, the following irradiation protocol was used for UV-B

treatments under this narrowband UV-field: The protein extracts derived from

HEK293T cells were put on ice during irradiation and treated for the indicated time for

each experiment, under plastic filter or WG303 filter.

2.2.9 Agrobacterium Mediated Plant Transformation

Arabidopsis thaliana plants were transformed using Agrobacterium tumefaciens

harbouring the appropriate binary vector according to the ‘Floral dip’ method (Clough

and Bent, 1998). Transformants were selected dependent on their selection marker:

BASTA selection was performed on soil-grown plants by spraying at 7 DAG (day

after germination), while GFP selection of seeds was performed under stereo

microscope supplemented with UV light. After selection, the primary transformants

were transferred to single pots and grown to maturity.

2.2.10 DNA Isolation

High quality plant DNA was isolated using the Nucleon PhytoPure Genomic DNA

Extraction Kit (Amersham). Coding sequences were amplified from Col cDNA using

primers listed in table M3.

-2,00E-06

2,90E-19

2,00E-06

4,00E-06

6,00E-06

8,00E-06

1,00E-05

1,20E-05

0,00 200,00 400,00 600,00 800,00 1000,00

W/m

2

Wavelenghts


Plasmid DNA from Escherichia coli or Agrobacterium tumefaciens was extracted and

purified with the E.Z.N.A. Plasmid Miniprep Kit according to the manual. For high

quantities of plasmid DNA 100 ml liquid cultures of Escherichia coli were prepared

and submitted to the extraction procedure provided with the Jetstar Plasmid

Purification System (GENOMED).

2.2.11 PCR

High fidelity cloning PCR was performed according to the requirements for Herculase

II fusion DNA-polymerase (Stratagene) as described in the manufacturers’ manual.

2.2.12 Agarose Gel Electrophoresis

For DNA gel electrophoresis, 1% (w/v) agarose gels were made in 1x TAE

(Sambrook and Russel 2001) and 1 µl ethidium-bromide (1 mg/ml) was added

directly to 50 ml of gel solution for visualization of nucleic acid under UV. DNA

samples (PCR fragments or plasmid restrictions) were supplemented with 6x

DNA-loading buffer (6x TAE, 30% (v/v) glycerol, 0.125% (w/v) bromophenol blue,

0.125% (w/v) xylene cyanol) and the GeneRuler 1kb DNA Ladder (Fermentas) was

used as a size marker. The GFX PCR DNA and Gel Band Purification Kit (Amersham

Biosciences) was used to purify DNA bands from agarose gels, if needed.

2.2.13 Site-Directed Mutagenesis

Site-Directed mutagenesis was done on UVR8 coding sequence recombined by

Gateway technology in pDONR207. Specific primers were designed as listed in table

M3. The primers are specific on UVR8 sequence and contain the desired mutations.

The PCR amplification was done with Herculase II proof reading DNA polymerase, as

described above. After amplification, DpnI was added to the PCR mix leading to

degradation of parental plasmid. Then, the PCR mix was directly used for bacterial

transformation leading to nick repair, and transformants were analyzed, after plasmid

isolation, by sequencing at GATC (Konstanz, Germany).


2.2.14 CPRG Assay

To quantify protein-protein interaction in yeast a β-galactosidase assay using CPRG

as a substrate was performed. From the transformed mother plate, yeast cells were

streaked on two plates with selective media as described above. Each plate was

streaked three times, taking ten different colonies each time from the mother plate.

The plates were then putted under a narrowband UV-B field at 30°C, with plastic filter

or with WG303 filter respectively. The plates were incubated overnight. The following

day each streak on the plate was independently harvested, resuspended in 1.5 ml

YPDA, and OD600 was recorded. Yeast cultures were then spun down, and washed in

distilled water, and spun down again. The pellet was resuspended in 500 µl of CPRG

buffer (Per 100 ml solution: 2.38g HEPES, 0.9 g NaCl, 0.065 g L-aspartate hemi-Mg

[Sigma], 1 g BSA, 50 µl Tween 20; dissolve in 75 ml, adjust to pH 7.3, adjust volume

to 100 ml, filter sterilize). Then the pellet was spun down, and resuspended in 300 µl

CPRG buffer, and 100 µl of this were transferred to a new tube and frozen in liquid

nitrogen. The tube content was thaw in a termoblock at 37 °C and frozen, and this

cycle was repeated three times before adding 0.7 ml CPRG substrate in each tube

(27.1 mg CPRG [Roche] in 20 ml CPRG buffer). Then the tubes were put on a shaker

at 37°C and the time was recorded until development of the colour was achieved,

and the reaction was stopped by addition of 0.3 ml, ZnCl2 3 mM. The OD578 was

measured and the β-galactosidase units were calculated according to the formula:

β-galactosidase units = 600

578

ODVt

OD1000

⋅⋅⋅

t = elapsed time (in minutes) of incubation

V = 0.1 x concentration factor

Concentration factor = Volume of the starting culture for which OD600 was recorded

(1.5 ml) / Final volume used to resuspended the pellet (0.3 ml) = 5

For yeast two-hybrid analyses, genes were cloned either in the GAL4 binding domain

vector pGBT9_GW (for the strain PJ-69) or in the LexA DNA binding domain vector

pBTM116-D9 (for the L40 strain). The activator domain was the same for both

strains, pGADT7_GW vector. The yeast three-hybrid was done in the PJ-69 yeast

strain, which allows additionally selection on the nutrient marker –URA. The plasmid

used for the expression of the third protein was pAG-426GPD-ccdB (Alberti et al.,


2007). Empty-Vector controls were performed with empty (i.e. ccdB gene removed)

pBTM116-D9, pGBT9_GW and pGADT7_GW vectors (Bartels et al., 2009). In the

yeast three-hybrid system, RCC1 has been used as control in the vector

pAG-426GPD-ccdB.

2.2.15 SDS-Polyacrylamide Gel Electrophoresis (SDS-PAGE)

Approx. 20-30 µg of total cellular proteins were separated by sodium dodecyl sulfate

polyacrylamid gel electrophoresis in 8% gels (12% for HY5 protein gel) according to

standard methods (Sambrook and Russel, 2001) using the Mini Protean 3

Electrophoresis System (Bio-Rad). For protein size comparison Precision Plus

Protein Dual Colour Standard (Bio-Rad) was used or, for HEK293T cells experiment,

Pageruler Prestained Protein Ladder marker (Fermentas, St Leon-Rot, Germany)

was used.

2.2.16 Immunoblot Analysis

Gel separated proteins were electrophoretically transferred at RT for 70 min with 100

V to polyvinylidene difluoride (PVDF) membranes (Roth) by wet transfer (transfer

buffer: 3.03 g/l TRIS-HCl; 14.4 g/l glycine; 20% [v/v] ethanol; 0.015% SDS) in the

Mini Trans-Blot Cell system (Bio-Rad) according to the manufacturer’s instructions.

Membranes were blocked with 10% (w/v) non-fat dried milk and first antibodies were

diluted and incubated overnight in 5% (w/v) non-fat dried milk (rabbit α-UVR8

polyclonal 1:5000 (Eurogentec), guinea pig α-UVR8 polyclonal 1:5000 Eurogentec,

α-Actin monoclonal 1:20000 (Sigma), rabbit α-GST monoclonal 1:2000 (Sigma),

rabbit α-LexA polyclonal 1:5000 (Millipore)). Secondary antibodies were diluted

1:20000 and incubated for 1 h at RT (α-Mouse (Dako), α-Rabbit (Dako), α-Guinea

Pig (Abcam) α-Mouse-Alexa 680 (Invitrogen), α-Rabbit IRDye® 800CW (LI-COR

biosciences)). Washing steps were done in TBS-T (200mM Tris-HCl pH 7.6, 80 g/l

NaCl, 0,1% (v/v) Tween-20) and signal detection was performed as described in the

ECL plus Western detection kit (GE healthcare) except in HEK293T cells

experiments where detection was done through the fluorescent dye linked to the


secondary antibody using the Odyssey LI-COR system (Licor, Bad Homburg,

Germany). Before re-hybridisations with a different probe, the membranes were

stripped by 30 min incubation at 65°C in stripping buffer (62.5 mM TRIS-HCl, pH =

6.7; 2% [v/v] SDS, 100 mM β-Mercaptoethanol).

2.2.17 BiFC

Sinapis alba–based BiFC assays were performed using the biolistic PDS-1000/He

system (Bio-Rad) as described previously (Stolpe et al., 2005). A Pro35S:CFP

control plasmid was always co-bombarded to identify transformed cells prior to the

analysis of YFP fluorescence. UVR8 coding sequence was cloned with the Gateway

system into the pE-SPYNE-GW and pE-SPYCE-GW destination vectors. The

Empty-Vectors used as negative controls were generated by recombination with an

empty pENTRY3C, where the ccdB gene was removed (Bartels et al., 2009).

2.2.18 Luciferase Measurement

Transgenic plants were grown for 6 days in a SANYO MLR-350 chamber (under 12h

light / 12 h dark cycles) and then transferred to Top Count microtiter plates filled with

MS medium containing 1% sucrose and 1% agar using sterile forceps. For

luminescence detection 20 µl of sterile 0.5 mM luciferin (Biosynth AG; diluted in

sterile 0.01% Triton-X solution from the filter sterilized 50 mM luciferin stock solution)

was applied on the top of the the seedlings. The plates were then wrapped in foil,

and put back into the growth chamber for at least 16 hours. On the following day the

seedlings were irradiated using the “broadband UV field” under WG303 cut-off for 15

min. Afterwards plates were covered with sticky transparent foil and then the foil was

perforated creating 96 needle-size holes allowing air exchange. The parameters of

the measurements on the Top Count (PACKARD TOPCOUNT NXT 96 WELL PLATE

SCINTILLATION COUNTER) were the following: each well was measured for 1 sec

with 12 wells measured in parallel, cycle number was infinite, each plate and well

were measured once per cycle.


2.2.19 Bioinformatic Analysis

The accession numbers of the protein used in the multiple sequence alignment and

in the phylogenetic tree are given: Arabidopsis thaliana Q9FN03, Vitis vinifera

D1HKC1, Ricinus communis B9SAB0, Populus tremula B9HF48, Glycine max

C6TC00, Oryza sativa B8AJF0, Sorghum bicolor C5Y8Q8, Oryza sativa A2XTP3,

Physcomitrella patens A9RS92, Physcomitrella patens A9TJL3, Chlamydomonas

reinhardtii A8JGB3, Arabidopsis thaliana Q9LU80, Arabidopsis thaliana Q9LDU3,

Arabidopsis thaliana Q94CK7, Arabidopsis thaliana Q8L7B6, Arabidopsis thaliana

Q9FJG9, Homo sapiens P18754, Saccharomyces cerevisiae YGL097W, Selaginella

moellendorffii EFJ17371, Selaginella moellendorffii EFJ35396, Volvox carteri

EFJ39741.

UVR8 multiple sequence alignment is generated from the input by running ClustalW

as option of Jalview version 2.4.0.b2 (Thompson et al., 1994).

Secondary structure prediction of UVR8 and RCC1 was carried out with Jpred 3

(Cole et al., 2008). The secondary structure and the multiple alignment were edited

with Jalview (Waterhouse et al., 2009). The tertiary structure prediction was done

with the automated homology modeling server (PS)2 using RCC1, PDB entry 1A12,

chain A, as template (Chen et al., 2006). The predicted model was edited with

PyMOL v1.1 (The PyMOL Molecular Graphics System, Version 1.1, Schrödinger,

LLC).

The phylogenetic tree was inferred with MEGA4 (Tamura et al., 2007) on the multiple

alignment shown herein, and with the sequences presented in this section. The tree

was inferred with the Neighbor-Joining method (Saitou and Nei, 1987). A bootstrap

test on 500 replicates was conducted (Felsenstein, 1985). The evolutionary distances

were computed using the Poisson correction method (Zuckerkandl and Pauling,

1965).

Results

3 Results

3.1 COP1-UVR8 Interaction in

In order to understand if COP1

perception we tried successfully to reproduce the

yeast, using a yeast two-hybrid assay system

a histogram on β-galactosidase activity, and a qualitative assay as nutritional growth

on plates lacking histidine. Empty

grown at 30 °C under narrowband UV-B light

plastic cut-off or a WG303 filter.

detected for the COP1 control.

when co-expressing UVR8

weaker than the signal given

light supplemented with UV-B

was detectable in the corresponding

Figure R1: Yeast two-hybrid analysis on the interaction between binding domain, BD) and COP1is shown as β-galactosidase activity non-UV-B treatment and the EmpMiller Units.

COP1-UVR8 Interaction in Yeast

In order to understand if COP1 and/or UVR8 were possible candidate for UV-B

perception we tried successfully to reproduce their UV-B-dependent

hybrid assay system. Fig. R1 shows a quantitative assay as

osidase activity, and a qualitative assay as nutritional growth

on plates lacking histidine. Empty-Vector controls are shown as well.

at 30 °C under narrowband UV-B light , applying on the top of the petri dish

a WG303 filter. In the yeast growth assay a background signal

control. However, this background growth wa

co-expressing UVR8 in white light without UV-B (plastic cut

than the signal given by the interaction between UVR8 and

light supplemented with UV-B (WG303 cut-off). Moreover, no background activity

detectable in the corresponding β-galactosidase assay.

hybrid analysis on the interaction between UVR8 (fused to theCOP1 (fused to the GAL4 activation domain, AD). The

-galactosidase activity in Miller Units (CPRG assay), and yeast growth assay (-His).-UV-B treatment and the Empty-Vector controls display levels of β-galactosidase activity <1.0

63

or UVR8 were possible candidate for UV-B

dependent interaction in

a quantitative assay as

osidase activity, and a qualitative assay as nutritional growth

ector controls are shown as well. Yeast was

p of the petri dish a

a background signal was

was not apparent

(plastic cut-off), and it was

and COP1 in white

Moreover, no background activity

(fused to the LexA DNA . The protein interaction

(CPRG assay), and yeast growth assay (-His). The β-galactosidase activity <1.0

Results 64

We checked in which measure the narrowband UV-B irradiation was affecting yeast

growth treating untransformed yeast with or without UV-B. After UV-B treatment we

counted the number of colonies on plates grown under UV-B, and compared it to

colony growth under conditions devoid of UV-B. Yeast was grown for two days at

30°C under broadband UV-B (Fig. R2, left panel), an d under narrowband UV-B (Fig.

R2, right panel). Narrowband UV-B did not cause cell death. Notwithstanding, colony

growth was slightly affected, while broadband UV-B treatment was completely killing

the yeast cells.

Figure R2: Yeast viability assay. Colonies were counted after 2 days of continuous UV-B light treatment, shown as number of colonies per plate, and picture of a representative section of the plate. Left panel: broadband UV-B. Right panel: narrowband UV-B.

Moreover, the UV-B fluence rate dependence of the UV-B-dependent interaction

between COP1 and UVR8 in yeast was tested, under narrowband UV-B, and under

broadband UV-B respectively. Yeast was UV-B treated for the indicated time, as

shown in Fig. R3. Then, one hour without supplemental UV-B was given for

transcription and translation of the β-galactosidase reporter, followed by CPRG

assay. Under broadband UV-B the β-galactosidase activity was increasing faster

compared to narrowband UV-B radiation. Under broadband UV-B the signal was

decreasing after 30 min, probably because of cell-death, as shown by reduced cell

number after the UV-B treatment.

Results 65

Figure R3: Time-course of yeast two-hybrid interaction between UVR8 and COP1 under different UV-B irradiation conditions. Interaction strengths are displayed as β-galactosidase activities in Miller Units. Upper panel: time-course of the UVR8 interaction with COP1 under narrowband UV-B. Lower panel: time-course of the UVR8 interaction with COP1 under broadband UV-B. Under broadband UV-B the yeast cell growth was tested. Drops of media containing yeast were distributed on the plates and UV-B treated as for the time-course analysis. After broadband UV-B treatment, the yeast was grown for 2 days in the dark, and representative pictures were taken. After 30 min broadband UV-B irradiation, the yeast proliferation was affected compared to the non-UV-B control. At 60 min broadband UV-B irradiation yeast colonies are not detectable anymore.

Strong UV-B radiation causes cross-linking among proteins. We checked known

interactions in the yeast two-hybrid system to test if the UV-B treatment employed in

the COP1-UVR8 interaction assay was affecting the experiment (Fig. R4). These

interactions did not increase under UV-B light, but rather they showed a decrease of

the interaction strength compared to the non-UV-B control. Such decrease is likely

associated with the reduced yeast proliferation under narrowband UV-B irradiation.

Results 66

Figure R4: Yeast two-hybrid analysis of previously published protein-protein interactions. Upper left histogram: HY5 interaction with COP1 (Ang et al., 1998). Upper right histogram: SPA1 interaction with COP1 (Hoecker and Quail, 2001). Lower histogram: MAP kinases interactions with the phosphatase MKP1 (Ulm et al., 2002).

As control for the specificity of the interaction of COP1 with UVR8 we checked the

interaction among COP1 and plant UVR8 homologs, chosen by the BLAST algorithm,

with standard parameters, at the TAIR database (Fig. R5). Because of the negative

result, we additionally checked by western if the plant UVR8 homologs were

expressed in yeast.

Results

Figure R5: Yeast two-hybrid analysis of the interaction under narrowband UV-B. Upper panel: COP1 interaction with UVR8 β-Galactosidase activity and yeast growth assayUVR8 homologs in yeast.

Because uvr8 mutants uvr8-9

to be functional in planta and to

checked if the respective protein mutants

two-hybrid assay. Indeed,

interact UV-B-dependently with COP1

hybrid analysis of the interaction among COP1 and UVR8 Upper panel: COP1 interaction with UVR8 homologs

-Galactosidase activity and yeast growth assay (-His). Lower panel: Protein level

uvr8-9 (UVR8G202R) and uvr8-15 (UVR8G145S

and to lack interaction with COP1 (Favory et al., 2009)

spective protein mutants were able to interact with COP1

Indeed, UVR8G202R and UVR8G145S mutants were

with COP1 in yeast two-hybrid assay (Fig. R6

Figure R6: Yeast twoshown as β-galactosidase activityMiller Units and yeast growth assay(-His), of the interaction UVR8 mutant proteinsUVR8 mutants UVR8and UVR8G202R

analyzed.

67

COP1 and UVR8 plant homologs homologs shown as

. Lower panel: Protein level of UVR8 and

G145S) were shown not

(Favory et al., 2009), we

with COP1 in yeast

were not able to

Fig. R6).

Yeast two-hybrid analysis, β-galactosidase activity in

and yeast growth assay , of the interaction between mutant proteins and COP1. The

UVR8G145S (uvr8-15) G202R (uvr8-9) were

Results

We additionally checked if cop1

result in Fig. R7 shows that UVR8

COP1. Indeed, UVR8 is interacting with COP1

latter has been shown to have a

Moreover, UVR8 is not inte

(COP1G608R) which are respectively missing

and have a point mutation in the WD

cop1 mutants have been shown to lack UV

Favory et al., 2009).

Figure R7: Yeast two-hybrid analysis, shown as UVR8 and COP1 mutants. The right panel shows, in a schematic illustration, the domains of COP1 that are analyzed in each assay, and point mutation are of the COP1 domains form the upper wild type protein to the bottom:N-terminal domain with zinc-finger, and coiled-coil domainsthe WD-40 domain (COP1G608R

cop1eid6), C-terminal WD-40 domain of COP1 (

The data shown in this section

with COP1 in the heterologous yeast system, where no

is known, and neither UVR8 nor COP1 homologs are present. We can reasonably

speculate that these proteins

WD-40 C-terminal domain of COP1 is

UVR8.

cop1 protein mutants were able to interact with UVR8. The

shows that UVR8 is specifically interacting with the WD

interacting with COP1C340 and with COP1H69Y

have a functional UV-B response (Oravecz et al., 2006)

not interacting with cop1-4 (COP1N282) and with

) which are respectively missing completely the WD-40 domain of COP1

and have a point mutation in the WD-40 domain of COP1. The corresponding

been shown to lack UV-B responses (Oravecz et al., 2006;

hybrid analysis, shown as β-galactosidase activity of the interaction between The right panel shows, in a schematic illustration, the domains of COP1

and point mutation are indicated by arrows. Schematic representation form the upper wild type protein to the bottom: full length pr

-finger, and coiled-coil domains (COP1N282, cop1-4G608R, cop1-19), point mutation in the zinc-finger

), C-terminal WD-40 domain of COP1 (COP1C340).

shown in this section demonstrate the UV-B-dependent interaction of

COP1 in the heterologous yeast system, where no UV-B photoreceptor pathway


these proteins may be sufficient for UV-B perception. Moreover, the

C-terminal domain of COP1 is necessary and sufficient for the

68

mutants were able to interact with UVR8. The

specifically interacting with the WD-40 domain of H69Y (cop1eid6), the

(Oravecz et al., 2006).

) and with cop1-19

40 domain of COP1,

corresponding two

(Oravecz et al., 2006;

of the interaction between The right panel shows, in a schematic illustration, the domains of COP1

Schematic representation full length protein (COP1), cop1-4), point mutation in

domain (COP1H69Y,

dependent interaction of UVR8

photoreceptor pathway


perception. Moreover, the

the interaction with

Results

3.2 UVR8 Homodimer

UVR8 has an overall identity of 3

identity value resides in the “twilight zone” (20%

prediction. Despite the fact that UVR8 seems not to have Ran-GEF activity, which

characterizes RCC1, these proteins are structurally similar, as

secondary and tertiary structure prediction

structure prediction it is possible to

composed of four β-strands

Indeed, the first blade is completed by the C-terminal

β-propeller structure to close on its own. The tertiary structure prediction of UVR8

has been inferred, as in material and methods,

template. If the template option was not used and the three dimensional structure

was inferred from protein multiple alignment, the result was similar (data not shown).

Figure R8a: Secondary structure prediction of RCC1secondary structure prediction has been inferred with Jpred 3

omodimer

UVR8 has an overall identity of 30.6% compared to the human homolog RCC1. This

identity value resides in the “twilight zone” (20%-35%) of protein structure-function


RCC1, these proteins are structurally similar, as

nd tertiary structure prediction (Fig. R8a, Fig. R8b). In the secondary

it is possible to see the blades of RCC1 and UVR8, each blade is

s, except for the first blade which has only three

first blade is completed by the C-terminal β-strand allowing the

-propeller structure to close on its own. The tertiary structure prediction of UVR8

, as in material and methods, using RCC1 crystal structure as



: Secondary structure prediction of RCC1 (left panel) and UVR8 (right panel).secondary structure prediction has been inferred with Jpred 3 (Cole et al., 2008).

69

.6% compared to the human homolog RCC1. This

35%) of protein structure-function


RCC1, these proteins are structurally similar, as identified by

. In the secondary

RCC1 and UVR8, each blade is

, except for the first blade which has only three β-strand.

β-strand allowing the

-propeller structure to close on its own. The tertiary structure prediction of UVR8

using RCC1 crystal structure as



(left panel) and UVR8 (right panel). The

Results

Figure R8b: a and b: three dimensional structure of RCC1 dimensional structure prediction of UVR8inferred with the automated homology modeling sas template. Three central tryptophan

RCC1 is hypothesized to be functional in its

2006), even though the homodimerization of this

demonstrated. Because of the h

test if UVR8 was able to homodimerize. Indeed

in Fig. R9.

Figure R9: Left panel: yeast twoactivity and yeast growth assay. Rightexpression and bimolecular fluorescence complementation (BiFC) assay Empty-Vector controls are shown as well

: a and b: three dimensional structure of RCC1 (Renault et al., 1998)prediction of UVR8 (Chen et al., 2006). The tertiary structure prediction was

homology modeling server (PS)2 using RCC1, PDB entry 1A12, chain A, hree central tryptophans are highlighted in the predicted 3D structure of UVR8

be functional in its homodimeric conformation

ough the homodimerization of this protein has not yet been

. Because of the homology between UVR8 and RCC1

if UVR8 was able to homodimerize. Indeed, this turned out to be true

yeast two-hybrid analysis of UVR8 dimerization, shown as growth assay. Right panel: UVR8 homodimerization in Sinapis

bimolecular fluorescence complementation (BiFC) assay (Favory et al., 2009)are shown as well.

70

(Renault et al., 1998). c and d: three

The tertiary structure prediction was using RCC1, PDB entry 1A12, chain A,

in the predicted 3D structure of UVR8.

ic conformation (Kim et al.,

protein has not yet been

between UVR8 and RCC1, I’ve decided to

this turned out to be true, as shown

, shown as β-galactosidase inapis alba using transient


Results 71

3.3 UV-B-Dependent Monomerization of UVR8

3.3.1 UV-B-Dependent Monomerization of UVR8 in HEK293T Cells

After the finding of the UV-B dependent UVR8 and COP1 interaction in yeast, I have

started collaboration with Davide Faggionato (University of Freiburg, Laboratory of

Prof. Baumeister). Expressing GST-UVR8 in HEK293T cells, we noticed, on western

basis, a higher band compared to the expected molecular size of the GST-UVR8

monomer, when the protein extract was not boiled. We reasoned that the GST-UVR8

protein was mainly present as a homodimer if the total protein extract was not

denatured by boiling. However, when the total protein extract was treated with UV-B

radiation or boiled, the GST-UVR8 protein was mainly running at a molecular size

comparable to its monomeric conformation, indicating a UV-B-dependent

monomerization of GST-UVR8 (Fig. R10). The UV-B-dependent monomerization was

detected also after GST pull-down, where the purified protein, and not the total

extract, was UV-B treated. This let us to speculate that the UVR8 protein was

sufficient for UV-B perception, and maybe for UV-B-induced conformational change

of UVR8 leading to monomerization.

Figure R10: Western blot analysis of GST-UVR8 monomerization with or without 60 min narrowband UV-B light treatment. The HEK293T cells lysate was treated at 42°C or 95°C as shown. Left panel: total protein extract. Right panel: GST pull-down. Cross-reacting bands are marked (*).

Results 72

The GST protein is known to multimerize. To exclude that pDEST27-GST-UVR8

dimerization in HEK293T cells was an artefact due to the GST-tag, a non-tagged

pcDNA-DEST40-UVR8 was tested as well (Fig. R11). Moreover, to exclude that

UVR8 was not binding to different human proteins, pDEST27-GST-UVR8 and

pcDNA-DEST40-UVR8 were co-expressed in HEK293T cells and detected with the

respective antibodies coupled to different fluorescent dyes. As result, the GST-UVR8

homodimer and the UVR8 homodimer are visible, as well as the heterodimer

between GST-UVR8 and UVR8.

The GST tag has a molecular weight of 26 kDa. UVR8 has a molecular weight of 47

kDa.

Expected molecular weight:

UVR8 monomer = 47 kDa

UVR8 homodimer = 94 kDa

GST-UVR8 monomer = 73 kDa

GST-UVR8 homodimer = 146 kDa

GST-UVR8 / UVR8 heterodimer = 120 kDa

The UVR8 monomer and the GST-UVR8 monomer are running at the expected

molecular weight. The homodimers of GST-UVR8 and UVR8 and the heterodimer

GST-UVR8 with UVR8 are running lower than the expected molecular weight. It has

to be considered that the protein were not denatured and the three dimensional

conformation can influence the running of the protein in the gel. Interestingly, the

monomers are running at the proper size, as if their conformations are different from

the conformations of the respective dimers. Moreover, it is clear that UVR8 is binding

only to UVR8 and not aspecifically to other human proteins. Indeed, the shift of the

GST-UVR8 homodimer and the shift of the UVR8 homodimer are proportional

respectively to the presence and absence of the GST tag, i.e. higher shift for the

GST-UVR8 tagged version. The proof that UVR8 is self-binding is given by the

co-expression of GST-UVR8 with UVR8 which runs at an intermediate molecular

weight between the UVR8 homodimer and the GST-UVR8 homodimer. This band is

not present if only GST-UVR8 or only UVR8 are expressed in the human cells

culture.

Results 73

Figure R11: UVR8 monomerization in human cells culture. Western blot analysis of human cells culture protein extract expressing different combination of UVR8, GST-UVR8, and GST Empty-Vector. Upper panel: fluorescent dye bound to the secondary antibody for the detection of UVR8. Lower panel: fluorescent dye bound to the secondary antibody for the detection of the GST tag. Ladder (1st lane), GST-UVR8 (2nd-3rd lanes), GST-UVR8 and UVR8 (4th-5th lanes), UVR8 (6th-7th lanes), GST-UVR8 and GST-Empty-Vector (8th-9th lanes). Cross-reacting bands are shown as well (*). Molecular marker is shown in kDa.

In order to have a better resolution of the UVR8 UV-B-dependent monomerization,

time-course experiments were carried out. GST-UVR8 from total extract or purified

protein clearly shows a time dependent switch between the dimeric and monomeric

conformations under narrowband UV-B (Fig. R12).

Results 74

Figure R12: Western blot analysis of pDEST27-GST-UVR8 monomerization time-course in HEK293T cells. Upper panel: monomerization time-course in protein total extract, under narrowband UV-B, on ice. Lower panel: time-course of UVR8 UV-B-dependent monomerization of purified GST-UVR8 protein, under narrowband UV-B, on ice. The protein detection has been achieved with the P60 antibody in the upper panel, and with the anti-GST antibody in the lower panel.

Is UVR8 monomerization caused by UV-B dependent denaturation of the protein? To

address this question we tried to recover the UVR8 dimer after UV-B-dependent

monomerization in HEK293T cells protein total extract. Initially we treated the extract

under narrowband UV-B light for 60 min, which resulted in the complete

monomerization of UVR8. After the treatment, the extract was split and moved to a

dark box at room temperature. At different times aliquots of the extract were moved

to -20°C. Fig. R13 shows the monomerization of UVR8 in the protein extract (upper

panel) and the time dependent recovery of the dimer (lower panel). We cannot

exclude transcription and translation in the total extract, but it is unlikely that these

processes are taking place after more than 24 hours from protein extraction. For this

reason we conclude that UVR8 was not denatured after UV-B treatment and it was

able to recover to its dimeric conformation.

Results 75

Figure R13: Western blot analysis of pDEST27-GST-UVR8 re-dimerization, expressed in human cells culture. Upper panel: time-course of UVR8 monomerization under narrowband UV-B. Samples were heat treated at 42 °C for 30 min or at 95 °C for 5 min. Lower panel: subsequent recovery of the dimeric UVR8 protein in the dark at room temperature. No recovery of the UVR8 dimeric conformation for samples treated at 95 °C (data not shown). A cross-reacting band is shown as well (*).

With the experiments presented in this section, we were able to show that UVR8 is

able to undergo monomerization after UV-B exposure. The UVR8 monomerization is

taking place with the same kinetics irradiating purified proteins, indicating that UVR8

is able to perceive the UV-B light.

3.3.2 UV-B-Dependent Monomerization of UVR8 in Yeast

After demonstration of UV-B-dependent UVR8 monomerization in HEK293T cells, we

reasoned to confirm it with another system, especially in yeast were we could link the

monomerization to the interaction with COP1. To do this, UVR8 was expressed with

the same plasmid used for yeast two-hybrid analyses, pBTM116-D9, in the L40 yeast

strain. The plasmid contains the LexA DNA binding domain fused to the protein. In

this system it was possible to reproduce the UV-B-dependent monomerization,

irradiating yeast extract for 5 min with broadband UV-B on ice (Fig. R14). Similarly,

the UVR8 mutant proteins UVR8G145S and UVR8G202R were tested in yeast. These

mutant proteins were lacking the dimeric conformation, suggesting that the glycine

Results 76

mutations cause misfolding of the protein, which could be also the reason for the lack

of interaction with COP1 (Fig. R6). Similarly to the expression of UVR8 in human

cells culture, also in yeast UVR8 dimer is running lower than the expected molecular

weight.

Expected molecular weight:

LexA-UVR8 monomer = 72 kDa

LexA-UVR8 homodimer = 144 kDa

Figure R14: Western blot analysis of pBTM116-UVR8 monomerization in yeast total extract. LexA-UVR8 UV-B-dependent monomerization is shown, as well as UVR8 mutant proteins LexA-UVR8G145S and LexA-UVR8G202R. Degradation bands relative to LexA-UVR8 are marked (*). Molecular size is shown in kDa. Coomassie staining is shown for loading control.

We tried to reproduce the monomerization with a non-tagged UVR8 protein in yeast.

Astonishingly, the non-tagged UVR8 proteins under non-UV-B conditions were not

visible. Nevertheless, it was possible to see the accumulation of the monomeric

UVR8 protein after UV-B irradiation (Fig. R15). Considering that the work was carried

out on ice with the same amount of protein extract in each well of the protein gel,

there should be no difference in protein amount among the samples, and no

degradation of the protein. I have reasoned that the UVR8 dimer was not detectable,

possibly because the epitope was not accessible to the antibody in the dimeric

conformation of the protein.

Results 77

Figure R15: Western blot analysis of tagged and non-tagged UVR8 monomerization in yeast total protein extract. LexA-UVR8 monomerization and UV-B-dependent UVR8 accumulation are shown. Degradation products of LexA-UVR8 are marked (**). Proteins were detected with the P60 antibody. Molecular size is shown in kDa. Protein detection with P60 antibody.

Following the hypothesis that detection of the UVR8 homodimer was not possible

because of an inaccessibility of its epitope, I’ve attempted an in-gel monomerization

of UVR8. To do this, the protein samples were electrophoretically separated by SDS-

PAGE and the protein gel was then treated under broadband UV-B for 10 min before

transfer of the proteins to a PVDF membrane. According to the hypothesis, the

dimeric conformation of UVR8 may monomerize in the gel, revealing the epitope for

antibody-mediated protein detection. Indeed, a band at higher molecular weight now

became detectable, which could correspond to the UVR8 dimer (Fig. R16). Moreover,

it is possible to notice that, when UVR8 is expressed without any tag, no protein

degradation bands are visible.

Figure R16: Western blot analysis of non-tagged-UVR8 monomerization in yeast protein total extract. Acrylamide gel non-UV-B and broadband UV-B treated for 10 min are shown in the left and the right panels, respectively. Proteins were detected with the P60 antibody.

Non-tagged-UVR8 purified from yeast total extract was checked for monomerization.

The UVR8 protein was pulled-down with α-UVR8 P60 (host: rabbit) antibody and

Results 78

detected with the α-UVR8 (host: guinea pig) antibody. Also in this experiment the gel

was irradiated with broadband UV-B to see the dimer in non-UV-B samples (Fig.

R17).

Figure R17: Western blot analysis of non-tagged-UVR8 monomerization after protein purification from yeast total extract. Acrylamide gel non-UV-B and broadband UV-B treated are shown respectively in the left and in the right panel. Proteins were detected with P60 antibody.

3.3.3 UV-B Dependent Monomerization of UVR8 in Planta

In plant protein extract, as in yeast protein extract, it was possible to detect the

homodimeric conformation of UVR8 only in tagged proteins (Fig. R18).

Figure R18: Western blot analysis of CFP-UVR8 / UVR8 monomerization in plant total protein extract under broadband UV-B. CFP-UVR8 protein construct was inserted by Agrobacterium tumefaciens mediated transformation in an Arabidopsis thaliana wild type background. Proteins were detected with anti-GFP antibody. Molecular size is shown in kDa.

Also in plant protein extract there was the need of UV-B gel irradiation for non-tagged

UVR8 protein detection in non-UV-B treated samples. Nevertheless, in non-UV-B

treated samples the dimer was very weak even after UV-B irradiation of the gel. To

Results 79

confirm the presence of protein in non-UV-B treated samples the extract was

denatured at 95°C for 3 min (Fig. R19). Similarly t o the expression of UVR8 in human

cells culture and in yeast, also in planta the UVR8 dimer is running lower than the

expected molecular weight.

Figure R19: Western blot analysis of UV-B-dependent UVR8 monomerization under 5 min broadband UV-B in plant protein extracts. Samples heat treated at 95 °C for 3 min and samples not heat treated are shown. Protein detection with P60 antibody and anti-actin antibody. Molecular weight is shown in kDa.

The time-course of the protein total extract showed a clear accumulation of

monomeric UVR8 under UV-B irradiation (Fig. R20). Monomeric UVR8 accumulated

in less than 5 sec after UV-B irradiation of protein extract on ice. Such a fast reaction

on ice seems unlikely to be associated with post translational protein modifications,

and reinforces the hypothesis that UVR8 is able to directly perceive UV-B light.

Figure R20: Western blot analysis of the time-course of UVR8 monomerization in plant protein extract under broadband UV-B. Loading controls are shown with boiled extract after time-course irradiation of UVR8 and Actin. Detection with P60 and anti-actin antibodies.

Results 80

However, the protein amount of UVR8 monomer did not match the protein amount of

UVR8 dimer. Given that the protein extract was splitted among the wells of the

protein gel, this can be explained as i) UVR8 is in a higher molecular weight complex

and it is not transferred from the protein gel to the PVDF membrane, or ii) the

irradiation treatment of the gel is not completely unmasking the epitope for the

antibody. I tried then to detect the protein with an antibody generated against a

different C-terminal epitope (Kaiserli and Jenkins, 2007). This turned out to be

successful, and it was possible to visualize an amount of UVR8 dimer very close to

the amount of UVR8 monomer after irradiation (Fig. R21).

Figure R21: Western blot analysis of UVR8 monomerization in plant protein extract under broadband UV-B for 5 min. Denatured samples have been heat treated at 95°C for 3 min. A cross-reacting band just above UVR8 monomer, present also in the uvr8-6 mutant, is indicated (*). Detection with UVR8 specific antibody (Kaiserli and Jenkins, 2007) and anti-actin antibody.

The same C-terminal α-UVR8 antibody (Kaiserli and Jenkins, 2007) was used to

repeat the time-course of the UV-B-dependent UVR8 monomerization (Fig. R22). A

higher band at about 100 kDa was detected in this blot, and it was marked as

“UVR8?”. This band was not present in the mutant line and it appeared UV-B-

dependently. The band at 100 kDa was not present after UVR8 protein purification

and gel irradiation (data not shown). For these reasons, we can reasonably exclude

the possibility of multimerization of the monomeric UVR8. It is tempting to speculate

that UV-B activates UVR8 through monomerization, and that the UVR8 monomeric

conformation is able to interact with other partner proteins, resulting in the plant UV-B

response.

Results 81

Figure R22: Western blot analysis of the time-course of UVR8 monomerization in plant protein extract under broadband UV-B. Loading control with boiled samples after UV-B time-course treatment and Actin are shown. A cross-reacting band just above UVR8 monomer, present also in uvr8-6, is indicated (*). Detections with UVR8 specific antibody (Kaiserli and Jenkins, 2007) and anti-actin antibody.

3.3.4 UV-B-Dependent UVR8 Degradation

The level of UVR8 protein was checked under broadband UV-B radiation. A slight

decrease in UVR8 protein amount after broadband UV-B treatment of seven days old

seedlings was detected, which was partially recovered after removal of UV-B

irradiation (Fig. R23).

Figure R23: Western blot analysis of seven days old seedlings under broadband UV-B for the given time in minutes. In the 5th lane, after 15 min of broadband UV-B treatment, a recovery time of 60 min in white light was given.

Results 82

Considering the UV-B-dependent interaction of UVR8 with the E3 ubiquitin ligase

COP1, it was of interest to analyse whether UVR8 was susceptible to proteasome-

dependent degradation. For this purpose, a cell-free degradation experiment was

carried out. Interestingly, the two antibodies shown in Fig. R24 detected UVR8

protein levels differently. While the FB4732 revealed a slight decrease in UVR8

protein amount in DMSO (mock) treated samples, the P60 antibody showed a strong

reduction.

Figure R24: Cell-free degradation assay on plant total protein extract for the given time in min. Upper panel: detection with the final bleed FB4732 UVR8-specific antibody, after stripping the membrane presented in the lower panel, which was probed with the C-terminal P60 antibody.

Then, the UVR8 protein levels were analysed in wild type and in cop1-4 mutant

seedlings. As shown in Fig. R25, the protein level of UVR8 in 5-day-old seedlings

was lower in wild type compared to cop1-4, indicating that COP1 was responsible for

the degradation of UVR8. At the same time, proteasome inhibitors can stabilize the

UVR8 protein in wild-type seedlings but not in cop1-4 mutants. An anti-ubiquitin

antibody detected an accumulation of ubiquitinated proteins showing the efficacy of

the proteasome inhibitors treatment. It should be noted that also the actin protein

control was stabilized by the proteasome inhibitors treatment. The same protein

extract was probed with the antibody FB4732 giving the same result (data not

shown).

Results 83

Figure R25: UVR8 protein levels in wild type and in cop1-4 seedlings. The seedlings were soaked for 4 hours in liquid MS media, or MS plus DMSO as mock control, or MS plus proteasome inhibitors. Detection with anti-ubiquitin antibody, P60 antibody and anti-actin antibody.

The level of UVR8 protein thus seems to be dependent on COP1. Nevertheless, the

functional relevance of UVR8 degradation for the plant UV-B pathway remains to be

determined.

3.4 Evolutionary and Structural Considerations

RCC1 seems not to be functionally related to UVR8 (Brown et al., 2005).

Heterologous expression of UVR8 in yeast shows a dimeric conformation while

RCC1 is monomeric (data not shown). Moreover, there’s no experimental evidence

showing self interaction of RCC1.

UVR8 is conserved in the plant kingdom and it is also present in the unicellular green

algae like Chlamydomonas reinhardtii and Volvox carteri, as shown in the

phylogenetic tree (Fig. R26). The phylogenetic tree clearly shows that the UVR8

orthologs are clustering together, and they are less related to the closest homologs

RCC1 in human and the RCC1-related protein in yeast. Arabidopsis UVR8 homologs

are closer related each other than to Arabidopsis UVR8, its orthologs or RCC1.

Results 84

Figure R26: Evolutionary relationships among UVR8, UVR8 orthologs, UVR8 plant homologs, human RCC1 and the RCC1-like protein in yeast. The evolutionary history was inferred using the Neighbor-Joining method (Saitou and Nei, 1987). The optimal tree with the sum of branch length = 6.45 is shown. The percentage of replicate trees in which the associated clades clustered together in the bootstrap test (500 replicates) are shown next to the branches (Felsenstein, 1985). The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the Poisson correction method (Zuckerkandl and Pauling, 1965) and are in the units of the number of amino acid substitutions per site. All positions containing gaps and missing data were eliminated from the dataset (Complete deletion option). There were a total of 317 positions in the final dataset. Phylogenetic analyses were conducted in MEGA4 (Tamura et al., 2007).

The multiple alignment of the protein sequences from which the phylogenetic tree

was generated, is shown in Fig. R27a. In the multiple alignment tryptophans are

underlined. The tryptophans cluster in conserved patterns among the UVR8

orthologs; seven tryptophans reside in four patterns which can be summarized as

[YF]-X-[WYF]-G-W-X(2)-[YF], while other three tryptophans reside in three patterns

G-W-R-H-T. The percentage identity table presented in Fig. R27b shows that the

identity among UVR8 orthologs resides above the “twilight zone” (20%-35%) of

protein structure-function prediction.

Results

85

Results

Figure R27a: Multiple alignmenthomologs in Arabidopsis. Accession numbers are reported in Material and Methods. The multiple alignment was done with TCOFFEE (Waterhouse et al., 2009). Tryptophans are marked

alignment of UVR8, UVR8 orthologs, RCC1, RCC1-like in yeast,Accession numbers are reported in Material and Methods. The multiple

done with TCOFFEE (Notredame et al., 2000). The alignment was edited with Jalview ryptophans are marked.

86

like in yeast, and UVR8

Accession numbers are reported in Material and Methods. The multiple ment was edited with Jalview

Results 87

Figure R27b: Percentage identity among UVR8, UVR8 orthologs, RCC1, RCC1-like protein in yeast, and UVR8 homologs. Percentage identity calculated with MatGAT (Campanella et al., 2003).

The predicted three dimensional surface structure of UVR8 is shown (Fig. R28), and

the tryptophans are highlighted. The three tryptophans W233, W285, and W337 in

the G-W-R-H-T patterns (W233, W285 and W337), as well as the four tryptophans

conserved in the patterns [YF]-X-[WYF]-G-W-X(2)-[YF] (W94, W198, W250 and

W302) reside on the predicted protein surface structure (Fig. R28, left panel). The

other tryptophans are regularly distributed on the lateral surface of the predicted

structure (Fig. R28, right panel).

Results

Figure R28: In the left panel the predicted three dimensional surface structure of UVR8 is shown. Surface tryptophans highly conservedcartoon structure of UVR8 is shown. The tryptophans in the blue spheres, the conserved tryptophan of the four clusters [YF]-X-[WYF]-G-highlited as magenta spheres, and all the other tryptophans are highlited as red spheres. The image has been edited with PyMOL (The PyMOL Molecular Graphics System, Version 1.

3.5 Site-Directed M

If we assume that the UVR8 protei

perception could be achieved directly by its aromatic amino acids

address this question, we chose site

mutate single amino acid. I started a

substitutions based on homology with RCC1 and plant homolog proteins, to avoid

protein misfolding. This didn’t lead to any significa

mutants were still able to monomerize and to in

UVR8W300L, it was not homo

suggesting protein misfolding

: In the left panel the predicted three dimensional surface structure of UVR8 is shown. highly conserved in the amino acids clusters are highlighted. In the right panel a

cartoon structure of UVR8 is shown. The tryptophans in the cluster G-W-R-H-T are highlighted as blue spheres, the conserved tryptophan of the four clusters [YF]-X-[WYF]-G-

ghlited as magenta spheres, and all the other tryptophans are highlited as red spheres. The image has been edited with PyMOL (The PyMOL Molecular Graphics System, Version 1.1, Schrödinger, LLC).

Site-Directed Mutagenesis

If we assume that the UVR8 protein is intrinsically able to perceive UV-B, the

perception could be achieved directly by its aromatic amino acids (Creed, 1984)

address this question, we chose site-directed mutagenesis (SDM) to selectively

. I started a first series of SDMs with the amino acid


didn’t lead to any significant result because the UVR8 protein

mutants were still able to monomerize and to interact with COP1 or, in the case of

homodimerizing and it was not interacting with COP1

suggesting protein misfolding (Fig. R29).

88

: In the left panel the predicted three dimensional surface structure of UVR8 is shown.

in the amino acids clusters are highlighted. In the right panel a -R-H-T are highlighted as

blue spheres, the conserved tryptophan of the four clusters [YF]-X-[WYF]-G-W-X(2)-[YF] are ghlited as magenta spheres, and all the other tryptophans are highlited as red spheres. The image has

, Schrödinger, LLC).

intrinsically able to perceive UV-B, the

(Creed, 1984). To

directed mutagenesis (SDM) to selectively

first series of SDMs with the amino acid


because the UVR8 protein

teract with COP1 or, in the case of

and it was not interacting with COP1,

Results 89

Figure R29: Analysis of the UVR8 mutant proteins derived from SDM. In the upper panel, the western blot shows the monomerization of the different mutant versions. Protein degradation (**) and cross-reacting bands (*) are shown. In the lower panel, the β-galactosidase activity shows the level of interaction of the indicated UVR8 mutant proteins (BD-fusions) with COP1 fused to the activation domain.

Then, I’ve decided to focus on the analysis of the three dimensional structure of

UVR8, i.e. on the tryptophans present in the clusters, and to mutate the three

thryptophans in the pattern G-W-R-H-T, (W233, W285 and W337), to alanine and to

phenylalanine. I’ve chosen phenylalanine because it has a closer structure to

tryptophan, it has relatively low absorption in the UV-B wavelengths, and because it

is redox inert (unable to donate/accept electrons). These changes can be

summarized as: UVR8W233A/F, UVR8W285A/F, and UVR8W337A/F. Moreover, the four

Results 90

tryptophans conserved in the four clusters [YF]-X-[WYF]-G-W-X(2)-[YF], and residing

on the predicted protein surface, were changed to alanine (i.e., UVR8W94A,

UVR8W198A, UVR8W250A, UVR8W302A) (Fig. R30). These last four amino acid mutations

to alanine were compromising the dimerization at different levels, but they were still

responsive to the UV-B radiation, as shown by their interaction with COP1. This was

striking in the mutant UVR8W198A, where no dimer was visible, and the intensity of the

interaction with COP1 was comparable with the wild type UVR8 protein. All the amino

acid substitutions of the central tryptophans in the clusters G-W-R-H-T were impaired

in their interaction with COP1. Two amino acid substitutions were particularly

interesting, UVR8W285A/F. The change to alanine of this tryptophan, UVR8W285A, led to

a constitutive monomeric conformation, which was slightly interacting with COP1

under non-UV-B conditions, and the interaction was still slightly responsive to UV-B,

even if not at the level of the wild type UVR8 protein (Fig. R31). The same

tryptophan, but mutagenized to phenylalanine, UVR8W285F, was completely “blind” to

UV-B radiation being unable to monomerize under UV-B light, and unable to interact

with COP1 (Fig. 30 and Fig. 31). Moreover, the constitutive dimeric conformation of

UVR8W285F demonstrates that the amino acid substitution is not significantly

compromising the three dimensional structure of UVR8.

Furthermore, it can be noticed that the mutation UVR8W233A is monomeric without

UV-B and it dimerizes under UV-B. The same behavior, but with a weaker

dimerization under UV-B light, was also detected in the mutant UVR8W337A. This

indicated that UVR8W233A and UVR8W337A were still able to perceive UV-B radiation.

Without a crystal structure of the UVR8 protein it is presently not possible to interpret

these results. Given the needs of the tryptophan W285 for UV-B-dependent

monomerization of UVR8, which can be abrogated by its substitution to

phenylalanine, and the range of behaviors of the other UVR8 mutant proteins, I

would expect that they are due to the intrinsic property of the protein to directly

perceive the UV-B radiation.

Results 91

Figure R30: SDM Analysis of the UVR8 mutant proteins derived from SDM. In the upper panel the western blot shows the monomerization of the different UVR8 mutant versions. Protein degradation bands are shown (**). In the lower panel, the β-galactosidase activity shows the level of interaction of the different UVR8 protein mutant versions with COP1 fused to the activation domain.

A repetition of the yeast two-hybrid analysis for the mutants UVR8W285A and

UVR8W285F is shown in Fig. R31. Empty-Vector controls are shown as well.

Results 92

Figure R31: Yeast two-hybrid analysis of the UVR8 mutant proteins derived from SDM. Empty-Vector controls are shown as well. The β-galactosidase activity shows the level of interaction of UVR8 with COP1 compared to the interaction of the UVR8 mutant proteins with COP1.

3.6 Mixing-Extracts Experiment

We addressed the question if the UV-B irradiation of UVR8 was necessary and

sufficient for the interaction with COP1 to occur. I proposed to Dr. Favory to UV-B-

irradiate separately extracts containing either YFP-COP1 but not UVR8 (cop1

uvr8/Pro35S:YFP-COP1 line) or UVR8 but not YFP-COP1/COP1 (cop1 mutant) and

then mixed them with non-irradiated extracts containing the partner protein prior to

co-immunoprecipitation assays of UVR8 using anti-YFP antibodies (Fig. R32). The

results clearly showed that UV-B irradiation of extracts containing UVR8 was both

required and sufficient for the interaction with YFP-COP1, indicating a primary

function of UVR8 in UV-B signal perception. Moreover, 5 min broadband UV-B light

irradiation of protein total extract causes the complete monomerization of UVR8 (e.g.

Fig. R21). This implicates that the monomeric form of UVR8 interacts with COP1,

excluding any involvement of the monomerization process in the interaction with

COP1.

Results 93

Figure R32: Co-IP of UVR8 with anti-GFP-pulled-down YFP-COP1. Protein extracts were independently irradiated and then mixed before immunoprecipitation with GFP antibody.

3.7 Physcomitrella UVR8 Ortholog

As shown in the phylogenetic tree (Fig. R26), we postulated different orthologs of

UVR8 based on protein homology. To demonstrate the functional conservation of

UVR8 orthologs, we tested genetic complementation. Two UVR8 orthologs were

cloned from the moss Physcomitrella patens. The accession numbers for these

proteins are A9RS92 and A9TJL3. In western blot analysis, it was not possible to

detect any dimeric conformation of the Physcomitrella patens UVR8 othologs

expressing them in yeast (Fig. R33), even after longer exposure of the film (data not

shown).

Figure R33: Western blot of Physcomitrella UVR8 orthologs expressed in the L40 yeast strain with the plasmid pBTM116-D9 and subjected to white light or broadband UV-B irradiation. Protein detection with the anti-LexA antibody.

Results

Despite the lack of monomerization in yeast, the ortholog A9RS92 was able to rescue

the uvr8-8/ProHY5:Luc+ transgenic line (Fig. R34). The line

luciferase reporter driven by the

under UV-B irradiation (Ulm et al., 2004)

luciferase reporter is impaired in this line because of the

(data not shown). Tranformation of the UVR8 ortholog A9RS92 into this line led to the

restoration of UV-B-responsiveness of the luciferase reporter. Co

ProHY5:Luc+ in wild type background and non

seedlings (data not shown)

controls, respectively.

Figure R34: TopCount data with luminescence kinetics of transcriptional activation of HY5connect the crosses (X) shows normalized luminescence averaged from control plants (measured in a TopCount microplate readerfrom an individual T2 plant measured in a TopCount microplate reader.

Similarly to the SDM for the mutant protein UVR8

conformation in yeast, confirming that the dimeric conformation is not needed to

perceive UV-B light, and that the monomeric conformation is not sufficient to activate

the response, but it needs UV-B irradiation to get active. Hence, the dimerization is a

read out of a putative conformational change of the UVR8 protein after UV-B

perception.


transgenic line (Fig. R34). The line uvr8-8/Pro

luciferase reporter driven by the HY5 promoter, a gene known to be strongly induced

(Ulm et al., 2004). The UV-B-dependent induction of the

luciferase reporter is impaired in this line because of the uvr8-8 mutant background


responsiveness of the luciferase reporter. Co

in wild type background and non-transformed uvr8

(data not shown) were measured in parallel as positive and negative

: TopCount data with luminescence kinetics of the luciferase reporter illustrating HY5 gene promoter after broadband UV-B irradiation.

normalized luminescence averaged from control plants (icroplate reader. Each of the other curves show normalized luminescence

plant measured in a TopCount microplate reader.

Similarly to the SDM for the mutant protein UVR8W198A, also A9RS92 lack the dimeric

, confirming that the dimeric conformation is not needed to



e conformational change of the UVR8 protein after UV-B

94


ProHY5:Luc+ has the

promoter, a gene known to be strongly induced

nt induction of the

mutant background


responsiveness of the luciferase reporter. Control plants with

uvr8-8/ProHY5:Luc+

were measured in parallel as positive and negative

the luciferase reporter illustrating B irradiation. The curve which

normalized luminescence averaged from control plants (ProHY5:Luc+) normalized luminescence

, also A9RS92 lack the dimeric

, confirming that the dimeric conformation is not needed to



e conformational change of the UVR8 protein after UV-B

Results 95

3.8 UVR8 and HY5 Compete for COP1 Interaction

HY5 is known to interact with the WD-40 domain of COP1 (Holm et al., 2001), like

UVR8 (Fig. R7). Moreover, HY5 and COP1 proteins are accumulating under UV-B

radiation in the nucleus (Oravecz et al., 2006), which may be due to inactivation of

the E3 ligase activity of COP1. I’ve postulated the hypothesis of competition for

COP1 binding between UVR8 and HY5 under UV-B radiation. A yeast three-hybrid

assay (Fig. R35) showed that the HY5 and COP1 interaction was reduced by

co-expression of UVR8 under UV-B, reflecting potential competition for the binding

between the proteins. The control RCC1 did not interact with HY5 or COP1 (data not

shown). It has to be pointed out that the result was very difficult to reproduce, with

only one out of ten experiments showing a comparable result.

Figure R35: Yeast three-hybrid assay showing competition for the binding between HY5 and UVR8 for COP1. The interactions are shown with the β-galacosidase reporter. The RCC1 protein is used as control.

Results 96

3.9 RUPs

3.9.1 RUPs UV-B-Dependent Interaction with UVR8

The Repressor of UV-B Photomorphogenesis 1 and 2 (RUPs) are WD-40 β-propeller

proteins which negatively regulate the UV-B pathway in plant (Gruber et al.). These

proteins were shown to interact with UVR8 in plants. In this work, the interaction

between UVR8 and RUPs was also reproducibly detected in yeast (Fig. R36).

Additionally, in yeast these interactions were enhanced by UV-B radiation, reinforcing

the role of UVR8 as UV-B photoreceptor (Fig. R36).

Figure R36: Yeast two-hybrid analysis of the interaction between UVR8 and RUP1 and RUP2 proteins. The interactions are shown with the β-galacosidase reporter, Empty-Vector controls are shown as well.

3.9.2 RUPs Mechanism

RUP proteins interact UV-B-dependently with UVR8, similar to COP1. Then I thought

to the possibility of a competition between RUPs and COP1 for the binding of UVR8

under UV-B. This possibility was tested in a yeast three-hybrid competitive assay.

Results 97

Indeed, there was detectable competition for UVR8 binding in this assay (Fig. R37);

the UV-B-dependent interaction between UVR8 and COP1 was reduced by the

co-expression of RUP1 or RUP2 proteins. The control RCC1 did not interact with

COP1 or UVR8 (data not shown). The interaction between UVR8 and COP1 was

particularly affected by co-expression of RUP2. This is in agreement with the stronger

phenotype of rup2 versus rup1 single mutant plants under UV-B (Gruber et al.).

Figure R37: Yeast three-hybrid analysis of the interaction between UVR8 and COP1, co-expressing RUPs proteins or the RCC1 control in the plasmid pAG-426GPD-ccdB. The interaction is shown as quantitative assay with the β-galacosidase reporter.

Discussion 98

4 DISCUSSION

4.1 UVR8 and COP1 Interaction in Heterologous System

In yeast, UVR8 interacted with COP1 under UV-B radiation specifically (Fig. R1). It

should be noted that yeast does not contain a COP1 homolog (Yi et al., 2002), and

its closest UVR8 homolog is the RCC1-like protein YGL097W (Fig. R26)

(Fleischmann et al., 1991). There is also no evidence available for the presence of a

UV-B photoreceptor pathway in yeast. This strongly indicates that UVR8 and COP1

are sufficient for UV-B perception and heterodimerization. This is very similar to the

red and blue light-specific interactions of phytochrome and cryptochrome

photoreceptors with their early targets in yeast (Shimizu-Sato et al., 2002; Hiltbrunner

et al., 2005; Hiltbrunner et al., 2006; Liu et al., 2008). Moreover, the interaction in

yeast was specific for the UVR8 protein, as five Arabidopsis β-propeller proteins with

sequence similarity to UVR8 did not interact with COP1 under UV-B light (Fig. R5).

UV-B, a known cross-linking agent, also did not have a general influence on yeast

two-hybrid interactions as, for example, the established interaction of COP1 and HY5

(Ang et al., 1998), the established interactions of MAP kinases MPK3, MPK4 and

MPK6 with the MAP kinase phosphatase MKP1 (Ulm et al., 2002), and the

established interaction of SPA1 with COP1 (Hoecker and Quail, 2001) were not

affected under narrowband UV-B radiation (Fig. R4). Similarly to the evidence in

Arabidopsis (Favory et al., 2009), the UVR8 protein mutants UVR8G145S (uvr8-15)

and UVR8G202R (uvr8-9), impairing UV-B light-induced photomorphogenesis in vivo,

did not interact with COP1 in yeast (Fig. R6). Vice versa, non-functional mutant

COP1 versions representing cop1-4 (COP1N282) and cop1-19 (COP1G608R) were not

capable to interact with UVR8 (Fig. R7). In contrast, COP1H69Y still interacts with

UVR8 in a UV-B light-specific manner (Fig. R7), in agreement with the ability of the

corresponding mutant, cop1eid6, to respond to UV-B light (Oravecz et al., 2006). The

absence of UVR8 interaction with the N-terminal 282 amino acids (COP1N282) without

the C-terminal WD-40 repeats indicated a requirement of this domain for the

interaction. In agreement, expression of the C-terminal 340 amino acids (COP1C340)

comprising of the WD-40 repeats only, demonstrated that the WD-40 domain of

COP1 is sufficient for UV-B dependent interaction with UVR8 (Fig. R7). The UV-B

Discussion 99

dependent interaction of COP1 and UVR8 in yeast is in line with a direct role of

UVR8 and/or COP1 in UV-B perception. Complementary “mixing-extracts”

experiments were carried out to further dissect the roles of UVR8 and COP1.

Extracts containing either only YFP-COP1 (cop1 uvr8/Pro35S:YFP-COP1 line) or only

UVR8 (cop1 mutant) were irradiated with UV-B and then mixed with non-irradiated

extracts containing the partner protein before co-immunoprecipitation assay of UVR8

using anti-YFP antibody (Fig. R32). The data clearly showed that the UV-B irradiation

of extracts containing UVR8 was necessary and sufficient for the interaction with

YFP-COP1 to occur (Fig. R32), indicating UVR8 as primary candidate in UV-B

photoperception. Together, the “mixing-extracts” experiment and the UV-B specific

interaction of UVR8 with COP1 in yeast, support the idea that UVR8 may constitute

the plant UV-B photoreceptor. In Fig. R3, the time-course of the interaction in yeast

two-hybrid system between UVR8 and COP1 under narrowband and broadband

UV-B light is shown. These results are interesting because they indicate that the

interaction between UVR8 and COP1 increases proportionally under increasing

doses of UV-B. Moreover, it was noted before that other properties of UVR8 are

reminiscent of known photoreceptors (Favory et al., 2009).

4.2 UVR8 Self-Interaction and UV-B Dependent

Monomerization

The UVR8 protein homodimerizes as shown in BiFC experiments and in yeast

two-hybrid assay (Fig. R9) (Favory et al., 2009). Moreover, the dimeric conformation

of UVR8 is shown in HEK293T cells extract (Fig. R10) and in yeast extract (Fig.

R14). Particularly, in Fig. R11 it is possible to see the heterodimer between

GST-UVR8 and UVR8 which confirms that the interaction is indeed the dimerization

among UVR8 proteins and not an aspecific interaction between UVR8 and a human

protein. In HEK293T cells, in yeast and in Arabidopsis, it was possible to detect the

dimeric conformation of UVR8 in tagged proteins, if protein were not denatured by

boiling. The Laemmli buffer containing reducing agents (5% DTT or 5%

β-mercaptoethanol) and gel electrophoresis did not monomerize the UVR8 protein.

The analysis of the three dimensional surface structure let us speculate on the

possibility that a strong ionic interaction is responsible for the homodimerization of

Discussion

UVR8 proteins. Indeed, a strong ionic interaction could explain the persistence of the

dimer in the Laemmli buffer and during gel electrophoresis

Fig. D1 is shown an antiparallel distribution of positively and negatively charged

amino acids. The antiparallel distribut

an ionic homodimerization. Moreover, it could be noticed that UVR8 is a soluble

protein and the charged amino acids thought to be responsible for the ionic

interaction cannot give a strong interaction, becau

neutralized by counterions of the salts in solution. On the other hand

considered that these positively and negatively charged amino acids are surrounded

by aromatic amino acids and nonpolar amino acids, which could c

originate a hydrophobic environment favorable for the ionic interaction (Fig. D1).

a)

Figure D1: Predicted three dimensional surface structure of UVR8. aliphatic amino acids are shown in black.arginine, and surface negatively charged amino acids aspartate and glutamate are shown. with PyMOL (The PyMOL Molecular Graphics System, Version 1.

The UVR8 homodimer undergoes mo

was initially found in HEK293T cells (Fig. R11). It was possible to reproduce the

UV-B dependent monomerization also in yeast (Fig. R14). In HEK293T cells culture

(Fig. R10) and in yeast (Fig. R17), it was poss

with the same kinetics, UV-B irradiating the

suggesting that no other proteins are involve

indicates that the monomerization i

teins. Indeed, a strong ionic interaction could explain the persistence of the

dimer in the Laemmli buffer and during gel electrophoresis (Gentile et al., 2002)


amino acids. The antiparallel distribution of charged amino acids is crucial to achieve



interaction cannot give a strong interaction, because they are solvated and

neutralized by counterions of the salts in solution. On the other hand


by aromatic amino acids and nonpolar amino acids, which could c


b)

: Predicted three dimensional surface structure of UVR8. a) Surface aromatic and non-polar aliphatic amino acids are shown in black. b) Surface positively charged amino acids lysine and arginine, and surface negatively charged amino acids aspartate and glutamate are shown. with PyMOL (The PyMOL Molecular Graphics System, Version 1.1, Schrödinger, LLC).

The UVR8 homodimer undergoes monomerization after UV-B irradiation, and this



(Fig. R10) and in yeast (Fig. R17), it was possible to reproduce the monomerization,

with the same kinetics, UV-B irradiating the UVR8 proteins after purification,

suggesting that no other proteins are involved in the monomerization of UVR8;

indicates that the monomerization is an intrinsic property of the UVR8 protein

100

teins. Indeed, a strong ionic interaction could explain the persistence of the

(Gentile et al., 2002). In


ion of charged amino acids is crucial to achieve



se they are solvated and

neutralized by counterions of the salts in solution. On the other hand, it has to be


by aromatic amino acids and nonpolar amino acids, which could contribute to


urface aromatic and non-polar positively charged amino acids lysine and

arginine, and surface negatively charged amino acids aspartate and glutamate are shown. Image edited , Schrödinger, LLC).

nomerization after UV-B irradiation, and this



ible to reproduce the monomerization,

proteins after purification,

d in the monomerization of UVR8; this

of the UVR8 protein under

Discussion 101

UV-B radiation. A difference between HEK293T cells culture and yeast resided in the

UV-B irradiation conditions. Indeed, while in HEK293T cells it was possible to work

with narrowband UV-B, yeast required broadband UV-B treatment. The difference

was due to the strong protein degradation that was taking place in yeast, which

required fast manipulation and fast treatment of protein extracts. It was possible to

reproduce the UVR8 UV-B dependent monomerization also in plant extract (Fig.

R21). Fig. R21 shows UVR8 mainly homodimeric in the absence of UV-B radiation.

The result was achieved, as in HEK293T cells protein extract and in yeast, by

avoiding heat denaturation of the proteins before loading. Time-course experiments

on the UV-B-dependent UVR8 monomerization were conducted in HEK293T cells

protein extract under narrowband UV-B (Fig. R12), and in Arabidopsis protein extract

under broadband UV-B (Fig. R20 and Fig. R22). The result in Fig. R20 and Fig. R22

is particularly intriguing. Indeed, in a plant protein total extract on ice, it is possible to

see the monomerization after 5 sec of UV-B irradiation. Also phytochromes are found

to react to red light after few seconds of irradiation aggregating in the so called

sequestered areas of phytochromes (SAPs) (Speth et al., 1986). In such a short time,

and in this experimental set-up, it can be excluded that any post-translational protein

modification is taking place, underpinning the concept that UVR8 is able per se to

perceive UV-B radiation. An example of time needed for protein modification of a

photoreceptor is given by the cryptochromes. Indeed, autophosphorylation of CRY2

starts after 2.5 min to 5 min of blue light irradiation at RT (Shalitin et al., 2002), well

above the time needed for UVR8 monomerization.

4.3 UVR8 Protein Putative Conformational Change

I’ve postulated a putative UV-B-dependent conformational change of UVR8 from the

UV-B dependent monomerization of UVR8, and from the difference in antibody’

epitope availability in UV-B and non-UV-B treatment of the protein.

In protein extracts from HEK293T cells, the dimeric conformation of non-tagged

UVR8 was clearly detectable (data not shown). In Arabidopsis (Fig. R19), and in

yeast (Fig. R15) non-tagged UVR8 was not detectable in non-UV-B condition (i.e.

dimeric conformation), but it was only detectable after irradiation of the extract with

UV-B or heat denaturation of the protein extract, in the monomeric conformation.

Discussion 102

Then, I’ve tried to irradiate the gel just after running the protein, and before protein

transfer to the membrane. This experiment allowed the detection of the dimeric UVR8

in yeast (Fig. R16), and in Arabidopsis protein extracts (Fig. R19), probably causing

an in-gel monomerization of the dimeric UVR8. It has to be said that the dimeric

conformation of UVR8 migrated faster than predicted by molecular weight in

HEK293T cells culture, in yeast and in planta, but this is not unexpected given that

the proteins were not heat-denatured, and they conserved their three dimensional

structure. Moreover, the UVR8 dimerization was demonstrated by BiFC experiments,

yeast two-hybrid analysis and in HEK293T cell protein extracts, where the

homodimeric conformation is supported by co-expression of GST-UVR8 and UVR8,

which are shown to heterodimerize (Fig. R11). Nevertheless, the result in Arabidopsis

protein extracts (Fig. R19 and Fig. R20) was unsatisfactory, because the amount of

visible UVR8 dimer after UV-B gel irradiation was much less than the UVR8

monomer after UV-B irradiation. For this reason, another UVR8 specific antibody

synthesized against a different C-terminal epitope was tested (Fig. R21 and Fig. R22)

(Kaiserli and Jenkins, 2007), revealing an amount of UVR8 dimer in non-UV-B

treated samples very close to the amount of UVR8 monomer after UV-B irradiation of

the samples, underpinning the hypothesis of a conformational change of the protein

under UV-B radiation. Moreover, if the conformation of the protein can be changed

irradiating the gel with UV-B light, i.e. after protein separation, and after protein

purification (Fig. R17), we can reasonably exclude that other proteins are involved in

the monomerization process.

The UVR8 protein needs UV-B or heat denaturation to be detected (Fig. R21). It

could be possible to explain the in-gel UV-B-dependent protein detection assuming

that irradiation by UV-B leads to conformational change or protein denaturation, thus

resolving the dimer. We can exclude protein denaturation because, in protein extract

from HEK293T cells, after UV-B-dependent monomerization, it is possible to rescue

the dimeric conformation removing the UV-B radiation (Fig. R13).

Interestingly, the dimeric regulatory protein NPR1 shows a similar behavior. Indeed,

when the protein extract is not boiled, the tagged-NPR1 dimer is visible on western

basis, as it is for the tagged-UVR8 dimer (Mou et al., 2003). NPR1 dimer is not

detectable, on western basis, if the protein does not have a tag (Mou et al., 2003). An

interesting difference between NPR1 and UVR8 is that NPR1, a redox response

regulator, monomerizes under reducing agents like DTT or GSH. UVR8 is not

Discussion 103

monomerizing under reducing agents, indeed the application of Laemmli buffer

containing 5% β-mercaptoethanol or 5% DTT has no effect on the UVR8 dimer. This

is in agreement with the UV-B perception function of UVR8, which would be expected

to be independent from the redox state of the cell.

4.4 Phylogenetic and Structural Considerations

The phylogenetic analysis (Fig. R26) shows the evolutionary relationship among

Arabidopsis thaliana UVR8, representative orthologs, the UVR8 plant homologs,

which have been analyzed for lack of interaction with COP1 (Fig. R5), and the closest

homologs in human beings and Saccharomyces cerevisiae. The UVR8 orthologs

presented in the phylogenetic tree are clustering together, showing evolutionary

conservation among these proteins, which goes evolutionarily back to the unicellular

green algae, e.g., Volvox carteri and Chlamydomonas reinhardtii. Moreover, the

multiple alignment in Fig. R27a underpins the tryptophans conservation among UVR8

orthologs, while the Fig.27b shows the high percentage identity among these

proteins. In the orthologs, four clusters of aromatic amino acids are characterized by

the following pattern: [YF]-X-[WYF]-G-W-X(2)-[YF]. The third aromatic amino acid in

this pattern is always a tryptophan and in the predicted three dimensional surface

structure, these tryptophans are always located on the same side of the protein

(W94, W198, W250, W302) (Fig. R28). Moreover, the pattern G-W-R-H-T, which

contains a tryptophan, is present three times in the primary protein structure of UVR8

and its orthologs. The three tryptophans in this second pattern are clustering together

on the surface, in the central part of the predicted three dimensional structure (W233,

W285, W337) (Fig. R8 and Fig. R28). These patterns are not present in RCC1, in the

RCC1-like protein in yeast, and in the UVR8 protein homologs. Furthermore, in the

UVR8 orthologs there are fourteen tryptophans, while RCC1 has only four

tryptophans. None of the ten tryptophans present in clusters in the UVR8 predicted

structure are conserved in RCC1. Three tryptophans outside the clusters are

conserved among some of the homologs and RCC1, and the last one is specific for

UVR8 orthologs but in a C-terminal extension that is absent in the green algae (Fig.

R27b). The geometrical distribution of aromatic amino acids in these clusters let me

speculate on a putative antenna complex for UV-B perception.

Discussion 104

To confirm the structure-function evolutionary conservation of UVR8 orthologs I

cloned the moss ortholog A9RS92 and transformed it into an uvr8 mutant line of

Arabidopsis thaliana. The complementation experiment was successful, (Fig. R34),

and it indicates that the orthologs are structurally and functionally conserved proteins.

UV-B radiation reaches from 1 to 20 meters under water surfaces (Booth and

Morrow, 1997). This means that only superficial algae and terrestrial plants are

exposed to this radiation. Indeed, we found that the UVR8 orthologs, with the

characteristic clusters of aromatic amino acids previously described, are present in

green algae, mosses, and in lower and higher plants. The distribution of UVR8

orthologs evolutionarily starting in green algae, and conserved in lower and higher

plants, hints to the necessity of UV-B perception for water to land transition.

On the other hand, we didn’t find UVR8 orthologs in fungi, insects and animals, which

live in the shadow or can escape from direct sunlight exposure. Adaptation to UV-B

light in the green algae Chlamydomonas reinhardtii and Chlorella species has been

reported (Danilov and Ekelund, 2000; Estevez et al., 2001). Historically, the best

characterized effect of UV-B radiation in living organisms is the production of

“sunscreen” pigments (Rozema et al., 2002). Mosses have flavonoids, the

“sunscreen” pigments for UV-B light widespread in gymnosperm and angiosperm

(Melchert and Alston, 1965). Moreover, the distribution of “sunscreen” pigments for

UV-B (Rozema et al., 2002) is overlapping with the taxa containing UVR8 orthologs.

Recently, it has been found that the moss Physcomitrella patens posses the

secondary metabolite pathway for flavonoid biosynthesis, as well as UVR8 and

COP1 (Wolf et al., 2010).

4.5 UV-B Perception by UVR8

Many evidences support a role of UVR8 as UV-B photoreceptor. UVR8 has been

shown to be an early component in the UV-B pathway in a microarray analysis

between wild type and uvr8 mutant seedlings under UV-B light (Fig. I13) (Favory et

al., 2009). Additionally, the uvr8 mutant does not show a photomorphogenic

phenotype under UV-B light, as shown in Fig. I19 (Favory et al., 2009). Moreover, the

rapid UVR8 and COP1 UV-B-dependent interaction in planta (Favory et al., 2009)

and in heterologous system (Fig. R1), reinforce this idea. Nevertheless, the strongest

Discussion 105

molecular evidence for direct UV-B perception is the UV-B-dependent

monomerization (e.g. Fig. R11). The UV-B-dependent monomerization was

detectably in heterologous systems and after pull-down of the protein, underlying a

specific role in UV-B perception by UVR8.

A possible question is how the UVR8 protein can perceive the UV-B light. While the

known photoreceptors need a chromophore, as described in the introduction, the

short wave length UV-B radiation is able to interact with organic compounds. If most

of the organic compounds are able to absorb the UV-B light, which one is the

photoreceptor? This is also the reason which makes the discovery of the UV-B

receptor so difficult. It is possible that a protein is able per se to absorb the UV-B light

through its amino acids, like the GFP protein (Shimomura et al., 1962; Chalfie et al.,

1994; Heim et al., 1994). The aromatic amino acids are particularly suited for UV-B

light absorption, and above all tryptophans (Creed, 1984). Indeed, in the case of the

known UV-B aryl hydrocarbon photoreceptor in human keratinocytes, the

chromophore is a UV-B light photoproduct of the free amino acid tryptophan, the

6-formylindolo[3,2-b]carbazole (FICZ) (Rannug et al., 1995; Oberg et al., 2005).

We’ve already seen that UVR8 orthologs have specific clusters of aromatic amino

acids which contain tryptophans. Through site-directed mutagenesis I’ve mutated the

tryptophan W285 to phenylalanine. UVR8W285F was completely “blind” to UV-B

radiation. Indeed, this protein was not able to monomerize under UV-B light, and it

was also not able to interact with COP1 (Fig. R30 and Fig. R31). The dimeric

conformation was however intact, indicating that the amino acid substitution was not

compromising the three dimensional structure of the protein. Interestingly, all the

amino acid substitutions in the clusters G-W-R-H-T impair interaction with COP1. A

question that arises from this result is if the three central tryptophans of these

clusters are actually the antenna of UVR8, or if these tryptophans are the binding

domain for a putative chromophore. It is difficult to draw a conclusion on all the other

mutants because they are missing the dimeric conformation in non-UV-B condition,

which could indicate misfolding of the UVR8 protein. The only additional evidence is

given by the mutant proteins UVR8W198A, and UVR8W250A which have no dimeric

conformation but they are still interacting UV-B-dependently with COP1. This

suggests that the monomeric conformation of UVR8 is not enough for interaction with

COP1, and that the dimeric conformation of UVR8 is not needed for UV-B perception.

Hence, the monomerization may only be a read out of a UV-B dependent putative

Discussion

conformational change. Indeed, also A9R

patens seems not to form dimers

dependent HY5 induction in the

4.6 UVR8 Mechanism

COP1 is a repressor of photomorphogenesis,

promoting transcription factors, acting as a switch between light perception and

downstream signaling. A genetic model of COP1 mode of action is shown in Fig. D2.

Figure D2: Genetic model indicating that COP1 is a rewhereas light signals, perceived by photoreceptors, abrogate its repressive action 1999).

As already mentioned, HY5 is a known transcription factor involved in

photomorphogenesis and it is a substrate of COP1. In Fig. D3 the HY5 protein levels

under different light conditions are shown, in different photoreceptor mutant and

photoreceptors overexpressor lines. From this published data it is clear that the HY5

protein level depends on the protein level of the photoreceptor responsible for the

specific light condition.

conformational change. Indeed, also A9RS92, the UVR8 ortholog in

seems not to form dimers in yeast, but it is able to rescue the

in the uvr8-8/ProHY5:Luc+ Arabidopsis line

echanism

COP1 is a repressor of photomorphogenesis, which degrades photomorphogenesis -



Genetic model indicating that COP1 is a repressor of photomorphogenic development, whereas light signals, perceived by photoreceptors, abrogate its repressive action




xpressor lines. From this published data it is clear that the HY5

the protein level of the photoreceptor responsible for the

106

S92, the UVR8 ortholog in Physcomitrella

, but it is able to rescue the UV-B

line (Fig. R34).

which degrades photomorphogenesis -



pressor of photomorphogenic development, whereas light signals, perceived by photoreceptors, abrogate its repressive action (Osterlund et al.,




xpressor lines. From this published data it is clear that the HY5

the protein level of the photoreceptor responsible for the

Discussion 107

Figure D3 : Anti-HY5 western blots of seedlings grown in continuous red light (a), continuous far-red light (b) and continuous blue light (c). The seedlings include wild type (three ecotypes), cry1, cry2, cry1/cry2 double mutant, phyA, phyB, phyA/phyB double mutant, a PHYB overexpression line (PHYBOE, red light only), and a PHYA overexpression line (PHYAOE, far-red light only) (Osterlund et al., 2000).

Similarly to white light irradiation, HY5 is stabilized under UV-B light, and it

accumulates in the nucleus together with COP1 (Oravecz et al., 2006). HY5

accumulation under UV-B is impaired in uvr8 mutants, and UVR8 overexpressor lines

show a cop1-like mutant phenotype under UV-B in sun simulator experiments

(Favory et al., 2009). Moreover, under red light, a phytochromes quintuple mutant

shows a skotomorphogenic-like phenotype, but not under blue light (Strasser et al.,

2010). Similarly, cryptochrome mutant seedlings shows reduced hypochotyl

shortening under blue light but not under red light (Lin et al., 1996). It’s interesting

that, under UV-B, COP1 and its substrate HY5 are stabilized and accumulate in the

same subcellular compartment. It has been proposed that the interaction of CRY1

and CRY2 with COP1 inhibit the E3 ligase activity of COP1 (Wang et al., 2001; Yang

et al., 2001). The question is if the UV-B-dependent binding of UVR8 to COP1 may

inhibit HY5 degradation. The photoreceptors CRY1, CRY2, phyA and phyB bind to

Discussion

the WD-40 domain of COP1

factors responsible for photomorphogenesis bind

(Ang et al., 1998; Holm et al., 2001; Wang et al., 2001; Yang et al., 2001; Holm et al.,

2002; Seo et al., 2004; Jang et al.

COP1 (Fig. R7). The Fig. R35 suggests competition for the binding, between UVR8

and HY5 for COP1, which could result in the stabilization o

Arabidopsis. Moreover, COP1 is able to homodimerize and to autoubiquitinate

et al., 1998; Saijo et al., 2003)

inhibit also the autoubiquitination activity of COP1

stabilization. I would like to postulate a model where COP1 is inactivated under UV-B

by UVR8, which causes

Moreover, I would like to speculate that such model could also be applied to other

photoreceptors, which also bind to COP1, as shown in Fig. D4.

Figure D4: Schematic model indicating the excitation of sunlight spectrum impinging on earthphotoreceptors causes their interaction with the WD-40 domain of COP1 (WD-40), shown schematically in its domains: the RWD-40 domain (WD-40). The photomorphogenesis - promoting transcription factors, which also bind to the WD-40 domain of COP1, are competing with the photoreceptors in their interaction with COP1,which results in the stabilisation of these transcription factors

f COP1 (Yi and Deng, 2005). Interestingly, also the transcription

factors responsible for photomorphogenesis bind to the WD-40 domain of COP1


2002; Seo et al., 2004; Jang et al., 2005). UVR8 binds also to the WD-40 domain of


and HY5 for COP1, which could result in the stabilization of HY5

Arabidopsis. Moreover, COP1 is able to homodimerize and to autoubiquitinate

aijo et al., 2003). The UV-B dependent UVR8 binding to COP1 could

inhibit also the autoubiquitination activity of COP1, resulting in COP1 protein

. I would like to postulate a model where COP1 is inactivated under UV-B

COP1 and HY5 protein stabilization in the nucleus.


photoreceptors, which also bind to COP1, as shown in Fig. D4.

Schematic model indicating the excitation of UVR8, cry1, cry2, phyA and phyB by the on earth, indicated as light wavelength in nm. The activation of the

photoreceptors causes their interaction with the WD-40 domain of COP1 (WD-40), shown schematically in its domains: the RING finger domain (R), the coiled-coil domain (Coil), and the

. The photomorphogenesis - promoting transcription factors, which also bind to the WD-40 domain of COP1, are competing with the photoreceptors in their interaction with COP1,which results in the stabilisation of these transcription factors, and induction of photomorphogenesis

108

. Interestingly, also the transcription

40 domain of COP1


. UVR8 binds also to the WD-40 domain of


f HY5, under UV-B, in

Arabidopsis. Moreover, COP1 is able to homodimerize and to autoubiquitinate (Torii

. The UV-B dependent UVR8 binding to COP1 could

, resulting in COP1 protein

. I would like to postulate a model where COP1 is inactivated under UV-B

COP1 and HY5 protein stabilization in the nucleus.


UVR8, cry1, cry2, phyA and phyB by the . The activation of the

photoreceptors causes their interaction with the WD-40 domain of COP1 (WD-40), shown ING finger domain (R), the coiled-coil domain (Coil), and the

. The photomorphogenesis - promoting transcription factors, which also bind to the WD-40 domain of COP1, are competing with the photoreceptors in their interaction with COP1,

, and induction of photomorphogenesis.

Discussion

The model presented in Fig. D4 is very schematic and it is thought to postulate a

possible mechanism for COP1 function in light response. This model i

Fig. I18. The concepts here underpinned are

the UV-B radiation, and the competition for the binding among photoreceptors and

light responsive transcription factors for the interaction with the WD-40

COP1. Of course, each photoreceptor has its specificity in signaling. In this model,

the commonalities in light response refer exclusively to the control of the

photomorphogenic development through differential degradation of

photomorphogenesis - promoting transcription factors.

4.7 RUPs Mechanism

RUPs are negative regulators of the UV-B pathway in

transcript is induced under UV-B light

to UVR8 (Fig. R36). If UVR8 is UV-B

then there could be competition for the binding

R37 shows UV-B dependent competition for the interaction between RUPs and

COP1 with UVR8. This competition for the interaction coul

response (Fig. D5).

Figure D5: Schematic model depicting the competition for the binding between the WD-40 domain of COP1 and RUP2 with UVR8. If UVR8 bind to COP1 (solid line pathway), then HY5 cannot bind COP1, it is stabilized, and activates light responses. RUP2, transcriptionally induced under UV-B light, binds UVR8 (dashed line pathway) and HY5 can bind to COP1, leading to its proteasomal dependent degradation, and to repression of photomorphogenesis


possible mechanism for COP1 function in light response. This model i

. The concepts here underpinned are: the UVR8 protein as photoreceptor for

, and the competition for the binding among photoreceptors and

light responsive transcription factors for the interaction with the WD-40




promoting transcription factors.

echanism

RUPs are negative regulators of the UV-B pathway in Arabidopsis, and their

transcript is induced under UV-B light (Gruber et al.). RUPs bind UV-B dependently

to UVR8 (Fig. R36). If UVR8 is UV-B-dependently binding to RUPs and to COP1,

then there could be competition for the binding among these proteins. Indeed,

UV-B dependent competition for the interaction between RUPs and

COP1 with UVR8. This competition for the interaction could modulate the plant UV-B

Schematic model depicting the competition for the binding between the WD-40 domain of COP1 and RUP2 with UVR8. If UVR8 bind to COP1 (solid line pathway), then HY5 cannot bind

, and activates light responses. RUP2, transcriptionally induced under UV-B light, binds UVR8 (dashed line pathway) and HY5 can bind to COP1, leading to its proteasomal

, and to repression of photomorphogenesis.

109


possible mechanism for COP1 function in light response. This model is very similar to

the UVR8 protein as photoreceptor for

, and the competition for the binding among photoreceptors and

light responsive transcription factors for the interaction with the WD-40 domain of




Arabidopsis, and their

. RUPs bind UV-B dependently

dependently binding to RUPs and to COP1,

among these proteins. Indeed, Fig.

UV-B dependent competition for the interaction between RUPs and

d modulate the plant UV-B

Schematic model depicting the competition for the binding between the WD-40 domain of

COP1 and RUP2 with UVR8. If UVR8 bind to COP1 (solid line pathway), then HY5 cannot bind , and activates light responses. RUP2, transcriptionally induced under UV-B

light, binds UVR8 (dashed line pathway) and HY5 can bind to COP1, leading to its proteasomal

Discussion 110

4.8 Conclusions and Outlook

This work addressed the question if UVR8 is the plant UV-B photoreceptor. A series

of compelling evidences support this hypothesis. Nevertheless, many aspects related

to photoperception are still elusive.

UVR8 and COP1 have been shown to be upstream factors in the plant UV-B pathway

thanks to microarray analysis and phenotypic characterization under narrowband

UV-B. In the same work UVR8 and COP1 have been found to interact UV-B

dependently in the first minutes of UV-B irradiation, showing an early event in the

UV-B signal transduction pathway.

At this point, a main question was still open. Is UVR8 and/or COP1 or something

upstream to these proteins the UV-B photoreceptor?

The reproduction of the UV-B dependent interaction between UVR8 and COP1 in

yeast has been the first indication that UVR8 and/or COP1 could be the UV-B

photoreceptor, pointing to the absence of upstream factors involved in

photoperception. This finding has been followed by the finding of the UV-B

dependent monomerization of UVR8 in human cells culture, strongly indicating that

UVR8 was able to undergo conformational change upon UV-B perception. Later on,

the monomerization has been reproduced in yeast and in Arabidopsis protein

extracts. The necessity of protein gel irradiation for UVR8’ visualization, as dimer in

non-UV-B condition, and the monomerization after protein purification were additional

compelling evidences for the ability of UVR8 to direct UV-B perception. Moreover, the

“mixing-extracts” experiment exclude COP1 from photoperception, given that the

merely UV-B irradiation of UVR8 is necessary and sufficient for the UVR8 and COP1

interaction to occur.

The mutant protein UVR8W285F blind to UV-B radiation, is additional evidence that the

UVR8 protein is able to perceive UV-B, even if the action of a cofactor cannot be

excluded.

Also the UV-B dependent interaction of UVR8 with the RUPs protein in yeast, which

hinders the UV-B dependent interaction of UVR8 with COP1, is adding value to the

hypothesis. Indeed, the positive UVR8 and COP1 interaction for the UV-B plant

response can be hindered by interaction of UVR8 with these negative regulators of

the UV-B pathway.

Discussion 111

Other indirect evidences presented in this work suggest photoreceptor properties of

UVR8. The monomerization of UVR8 on ice, in less than 5 seconds, and its

re-dimerization at room temperature in HEK cells protein extract with a slow kinetic,

hints to the ability of fast light detection, which later give time to start a plant

response. The evolutionary distribution of the protein, from green algae to mosses,

and in lower and higher plants, partially confirmed by the complementation

experiment with the UVR8 ortholog A9RS92 of Physcomitrella patens in Arabidopsis,

could reflect the necessity of UV-B perception for water to land transition. In this way,

the UVR8 pathway and the “sunscreen” pigment production could have been a

competitive advantage for conquer of the land.

All this evidence strongly suggest UVR8 being UV-B photoreceptor.

Many questions are still open. How can UVR8 perceive UV-B light? Does UVR8 need

a cofactor? What’s causing the UV-B light dependent monomerization of the UVR8

protein? Is there a conformational change of the UVR8 protein upon UV-B light

irradiation? Is the competition for the binding among proteins sufficient to explain the

UVR8 and COP1 mode of action and the plant response?

Acknowledgements 112

Acknowledgements

A would like to thank Davide Faggionato for our funny time in the laboratory of Prof.

Baumeister, which led to the discovery of the UV-B light dependent monomerization

of UVR8, hence to the main hint of photoperception by UVR8, between 22:00 and

3:00 in the morning, when we were used to work on our “secret experiments”. The

next day we were working in our respective labs, waiting for the following night to

continue to play with science.

I would also like to thank Dr. Tim Kunkel which many useful discussions helped to

achieve the detection of the dimeric conformation of non-tagged UVR8 proteins in

yeast and in Arabidopsis.

A special thanks to Prof. Eberhard Schäfer, which has been a mentor in my PhD

experience.

Moreover, I want to thank all the co-workers which would be too many to mention,

who helped during the course of my PhD work.

References 113

5 References

Aebi, M., Clark, M.W., Vijayraghavan, U., and Abelson, J. (1990). A yeast mutant, PRP20, altered in messenger-RNA metabolism and maintenance of the nuclear-structure, is defective in a gene homologous to the human gene RCC1 which is involved in the control of chromosome condensation. Molecular & General Genetics 224, 72-80.

Ahmad, M., and Cashmore, A.R. (1993). HY4 gene of A. thaliana encodes a protein with characteristics of a blue-light photoreceptor. Nature 366, 162-166.

Ahmad, M., Jarillo, J.A., Klimczak, L.J., Landry, L .G., Peng, T., Last, R.L., and Cashmore, A.R. (1997). An enzyme similar to animal type II photolyases mediates photoreactivation in Arabidopsis. Plant Cell 9, 199-207.

Alberti, S., Gitler, A.D., and Lindquist, S. (2007). A suite of Gateway(R) cloning vectors for high-throughput genetic analysis in Saccharomyces cerevisiae. Yeast 24, 913-919.

Allan, A.C., and Fluhr, R. (1997). Two distinct sources of elicited reactive oxygen species in tobacco epidermal cells. Plant Cell 9, 1559-1572.

Alonso, J.M., Stepanova, A.N., Leisse, T.J., Kim, C.J., Chen, H.M., Shinn, P., Stevenson, D.K., Zimmerman, J., Barajas, P., Cheuk, R., Gadrinab, C., Heller, C., Jeske, A., Koesema, E., Meyers, C.C., Parker, H., Prednis, L., Ansari, Y., Choy, N., Deen, H., Geralt, M., Hazari, N., Hom, E., Karnes, M., Mulholland, C., Ndubaku, R., Schmidt, I., Guzman, P., Aguilar-Henonin, L., Schmid, M., Weigel, D., Carter, D.E., Marchand, T., Risseeuw, E., Brogden, D., Zeko, A., Crosby, W.L., Berry, C.C., and Ecker, J.R. (2003). Genome-wide Insertional mutagenesis of Arabidopsis thaliana. Science 301, 653-657.

Ang, L.H., Chattopadhyay, S., Wei, N., Oyama, T., Okada, K., Batschauer, A., and Deng, X.W. (1998). Molecular interaction between COP1 and HY5 defines a regulatory switch for light control of Arabidopsis development. Molecular Cell 1, 213-222.

Apel, K., and Hirt, H. (2004). Reactive oxygen species: Metabolism, oxidative stress, and signal transduction. Annu. Rev. Plant Biol. 55, 373-399.

Ballare, C.L., Barnes, P.W., and Flint, S.D. (1995). Inhibition of hypocotyl elongation by ultraviolet-B radiation in de-etiolating tomato seedlings .1. The photoreceptor. Physiologia Plantarum 93, 584-592.

Ballario, P., Talora, C., Galli, D., Linden, H., and Macino, G. (1998). Roles in dimerization and blue light photoresponse of the PAS and LOV domains of Neurospora crassa white collar proteins. Molecular Microbiology 29, 719-729.

Ballario, P., Vittorioso, P., Magrelli, A., Talora, C., Cabibbo, A., and Macino, G. (1996). White collar-1, a central regulator of blue light responses in Neurospora, is a zinc finger protein. Embo Journal 15, 1650-1657.

Barends, T.R.M., Hartmann, E., Griese, J.J., Beitlich, T., Kirienko, N.V., Ryjenkov, D.A., Reinstein, J., Shoeman, R.L., Gomelsky, M., and Schlichting, I. (2009). Structure and mechanism of a bacterial light-regulated cyclic nucleotide phosphodiesterase. Nature 459, 1015-1018.

Barta, C., Kalai, T., Hideg, K., Vass, I., and Hideg, E. (2004). Differences in the ROS-generating efficacy of various ultraviolet wavelengths in detached spinach leaves. Functional Plant Biology 31, 23-28.

Bartels, S., Anderson, J.C., Gonzalez Besteiro, M.A., Carreri, A., Hirt, H., Buchala, A., Metraux, J.-P., Peck, S.C., and Ulm, R. (2009). MAP KINASE PHOSPHATASE1 and PROTEIN TYROSINE PHOSPHATASE1 Are Repressors of Salicylic Acid Synthesis and SNC1-Mediated Responses in Arabidopsis. Plant Cell 21, 2884-2897.

References 114

Batschauer, A. (1993). A plant gene for photolyase - an enzyme catalyzing the repair of UV-light-induced DNA-damage. Plant J. 4, 705-709.

Batschauer, A., Banerjee, R., and Pokorny, R. (2007). Cryptochromes. In Light and Plant Development, W.G. C and H.K. J., eds (Blackwell Publishing), pp. 17-48.

Bauer, D., Viczián, A., Kircher, S., Nobis, T., Roland, N., Kunkel, T., Panigrahi, K.C.S., Ádám, É., Fejes, E., Schäfer, E., and Nagy, F. (2004). Constitutive Photomorphogenesis 1 and Multiple Photoreceptors Control Degradation of Phytochrome Interacting Factor 3, a Transcription Factor Required for Light Signaling in Arabidopsis. The Plant Cell 16, 1433-1445.

Beggs, and Wellmann. (1994). Photocontrol of flavonoids biosynthesis. In Photomorphogenesis in plants, Kendrick and Kronenberg., eds (Kluwer Academic Publishers), pp. 733-751.

Bianchi, E., Denti, S., Catena, R., Rossetti, G., Polo, S., Gasparian, S., Putignano, S., Rogge, L., and Pardi, R. (2003). Characterization of human constitutive photomorphogenesis protein 1, a RING finger ubiquitin ligase that interacts with Jun transcription factors and modulates their transcriptional activity. Journal of Biological Chemistry 278, 19682-19690.

Bischoff, F.R., and Ponstingl, H. (1991). Catalysis of guanine-nucleotide exchange on Ran by the mitotic regulator RCC1. Nature 354, 80-82.

Björn, L.O. (1996). Effects of ozone depletion and increased UV-B on terrestrial ecosystems. International Journal of Environmental Studies 51, 217 - 243.

Boccalandro, H.E., Mazza, C.A., Mazzella, M.A., Casal, J.J., and Ballare, C.L. (2001). Ultraviolet B radiation enhances a phytochrome-B-mediated photomorphogenic response in Arabidopsis. Plant Physiology 126, 780-788.

Bogomolni, R.A., and Spudich, J.L. (1982). Identification of a 3rd-rhodopsin-like pigment in phototactic Halobacterium-halobium. Proceedings of the National Academy of Sciences of the United States of America-Biological Sciences 79, 6250-6254.

Bogre, L., Okresz, L., Henriques, R., and Anthony, R.G. (2003). Growth signalling pathways in Arabidopsis and the AGC protein kinases. Trends in Plant Science 8, 424-431.

Boll, F. (1876). Zur anatomie und physiologie der retina. Monatsber. preuss. Akad. Wiss. Berlin, 783-787.

Booth, C.R., and Morrow, J.H. (1997). The penetration of UV into natural waters. Photochemistry and Photobiology 65, 254-257.

Borthwick, H.A., Hendricks, S.B., and Parker, M.W. (1948). Action spectrum for photoperiodic control of floral initiation of a long-day plant, wintex barley (Hordeum vulgare). Bot Gaz 110, 103-118.

Bouly, J.P., Giovani, B., Djamei, A., Mueller, M., Zeugner, A., Dudkin, E.A., Batschauer, A., and Ahmad, M. (2003). Novel ATP-binding and autophosphorylation activity associated with Arabidopsis and human cryptochrome-1. European Journal of Biochemistry 270, 2921-2928.

Bray, C.M., and West, C.E. (2005). DNA repair mechanisms in plants: crucial sensors and effectors for the maintenance of genome integrity. New Phytologist 168, 511-528.

Briggs, W.R., and Christie, J.M. (2002). Phototropins 1 and 2: versatile plant blue-light receptors. Trends in Plant Science 7, 204-210.

Briggs, W.R., Beck, C.F., Cashmore, A.R., Christie, J.M., Hughes, J., Jarillo, J.A., Kagawa, T., Kanegae, H., Liscum, E., Nagatani, A., Okada, K., Salomon, M., Rudiger, W., Sakai, T., Takano, M., Wada, M., and Watson, J.C. (2001). The phototropin family of photoreceptors. Plant Cell 13, 993-997.

Britt, A.B. (1999). Molecular genetics of DNA repair in higher plants. Trends in Plant Science 4, 20-25.

References 115

Britt, A.B. (2004). Repair of DNA damage induced by solar UV. Photosynthesis Research 81, 105-112.

Brockmann, J., Rieble, S., Kazarinovafukshansky, N., Seyfried, M., and Schafer, E. (1987). Phytochrome behaves as a dimer in vivo. Plant Cell and Environment 10, 105-111.

Brosche, M., and Strid, A. (2003). Molecular events following perception of ultraviolet-B radiation by plants. Physiologia Plantarum 117, 1-10.

Brown, B.A., Headland, L.R., and Jenkins, G.I. (2009). UV-B action spectrum for UVR8-mediated HY5 transcript accumulation in Arabidopsis. Photochemistry and Photobiology 85, 1147-1155.

Brown, B.A., Cloix, C., Jiang, G.H., Kaiserli, E., Herzyk, P., Kliebenstein, D.J., and Jenkins, G.I. (2005). A UV-B-specific signaling component orchestrates plant UV protection. Proceedings of the National Academy of Sciences of the United States of America 102, 18225-18230.

Brudler, R., Hitomi, K., Daiyasu, H., Toh, H., Kucho, K., Ishiura, M., Kanehisa, M., Roberts, V.A., Todo, T., Tainer, J.A., and Getzoff, E.D. (2003). Identification of a new cryptochrome class: Structure, function, and evolution. Molecular Cell 11, 59-67.

Buchanan, G., Jones. (2000). Biochemistry & molecular biology fo plants. (American society of plant physiologist).

Butler, W.L., Norris, K.H., Siegelman, H.W., and Hendricks, S.B. (1959). Detection, assay, and preliminary purification of the pigment controlling photoresponsive development of plants. Proceedings of the National Academy of Sciences of the United States of America 45, 1703-1708.

Caldwell, M. (1971). Solar UV irradiation and the growth and development of higher plants. In Photophysiology, G. AC, ed (New York: Academic Press), pp. 131-177.

Caldwell, M.M., Robberecht, R., and Flint, S.D. (1983). Internal filters: prospects for UV-acclimation in higher-plants. Physiologia Plantarum 58, 445-450.

Campanella, J., Bitincka, L., and Smalley, J. (2003). MatGAT: An application that generates similarity/identity matrices using protein or DNA sequences. Bmc Bioinformatics 4, 29.

Casati, P., and Walbot, V. (2004). Crosslinking of ribosomal proteins to RNA in maize ribosomes by UV-B and its effects on translation. Plant Physiology 136, 3319-3332.

Cashmore, A.R., Jarillo, J.A., Wu, Y.J., and Liu, D.M. (1999). Cryptochromes: Blue light receptors for plants and animals. Science 284, 760-765.

Celaya, R.B., and Liscum, E. (2005). Phototropins and associated signaling: Providing the power of movement in higher plants. Photochemistry and Photobiology 81, 73-80.

Cen, Y.P., and Bornman, J.F. (1990). The response of bean-plants to UV-B radiation under different irradiances of background visible-light. Journal of Experimental Botany 41, 1489-1495.

Chalfie, M., Tu, Y., Euskirchen, G., Ward, W., and Prasher, D. (1994). Green fluorescent protein as a marker for gene expression. Science 263, 802-805.

Chapman, s. (1930). A theory of upper atmospheric ozone. Mem. Royal. Meteorol. Soc. 3, 103-125.

Chen, C.-C., Hwang, J.-K., and Yang, J.-M. (2006). (PS)2: protein structure prediction server. Nucl. Acids Res. 34, W152-157.

Chen, M., Galvao, R.M., Li, M.N., Burger, B., Bugea, J., Bolado, J., and Chory, J. (2010). Arabidopsis HEMERA/pTAC12 initiates photomorphogenesis by phytochromes. Cell 141, 1230-U1237.

Christie, J.M. (2007). Phototropin blue-light receptors. Annu. Rev. Plant Biol. 58, 21-45.

References 116

Christie, J.M., Swartz, T.E., Bogomolni, R.A., and Briggs, W.R. (2002). Phototropin LOV domains exhibit distinct roles in regulating photoreceptor function. Plant J. 32, 205-219.

Christie, J.M., Salomon, M., Nozue, K., Wada, M., and Briggs, W.R. (1999). LOV (light, oxygen, or voltage) domains of the blue-light photoreceptor phototropin (nph1): Binding sites for the chromophore flavin mononucleotide. Proceedings of the National Academy of Sciences of the United States of America 96, 8779-8783.

Christie, J.M., Reymond, P., Powell, G.K., Bernasconi, P., Raibekas, A.A., Liscum, E., and Briggs, W.R. (1998). Arabidopsis NPH1: A flavoprotein with the properties of a photoreceptor for phototropism. Science 282, 1698-1701.

Clack, T., Mathews, S., and Sharrock, R.A. (1994). The phytochrome apoprotein family in Arabidopsis is encoded by 5 genes: the sequences and expression of PHYD and PHYE. Plant Molecular Biology 25, 413-427.

Clark, K.L., and Sprague, G.F. (1989). Yeast pheromone response pathway: characterization of a suppressor that restores mating to receptorless mutants. Molecular and Cellular Biology 9, 2682-2694.

Cloix, C., and Jenkins, G.I. (2008). Interaction of the Arabidopsis UV-B-specific signaling component UVR8 with chromatin. Molecular Plant 1, 118-128.

Clough, S.J., and Bent, A.F. (1998). Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16, 735-743.

Cole, C., Barber, J.D., and Barton, G.J. (2008). The Jpred 3 secondary structure prediction server. Nucl. Acids Res. 36, W197-201.

Creed, D. (1984). The photophysics and photochemistry of the near-UV absorbing amino acids: I. tryptophan and its simple derivatives. Photochemistry and Photobiology 39, 537-562.

Crosson, S., Rajagopal, S., and Moffat, K. (2003). The LOV domain family: Photoresponsive signaling modules coupled to diverse output domains. Biochemistry 42, 2-10.

Culligan, K., Tissier, A., and Britt, A. (2004). ATR regulates a G2-phase cell-cycle checkpoint in Arabidopsis thaliana. Plant Cell 16, 1091-1104.

Dai, Q.J., Yan, B., Huang, S.B., Liu, X.Z., Peng, S.B., Miranda, M.L.L., Chavez, A.Q., Vergara, B.S., and Olszyk, D.M. (1997). Response of oxidative stress defence systems in rice (Oryza sativa) leaves with supplemental UV-B radiation. Physiologia Plantarum 101, 301-308.

Danilov, R., and Ekelund, N. (2000). Effects of increasing doses of UV-B radiation on photosynthesis and motility in Chlamydomonas reinhardtii. Folia Microbiologica 45, 41-44.

Demarsy, E., and Fankhauser, C. (2009). Higher plants use LOV to perceive blue light. Current Opinion in Plant Biology 12, 69-74.

Deng, X.W., Caspar, T., and Quail, P.H. (1991). COP1 - A regulatory locus involved in light-controlled development and gene-expression in Arabidopsis. Genes & Development 5, 1172-1182.

Deng, X.W., Matsui, M., Wei, N., Wagner, D., Chu, A.M., Feldmann, K.A., and Quail, P.H. (1992). COP1, an Arabidopsis regulatory gene, encodes a protein with both a zinc-binding motif and a G-beta homologous domain. Cell 71, 791-801.

Eisinger, W.R., Bogomolni, R.A., and Taiz, L. (2003). Interactions between a blue-green reversible photoreceptor and a separate UV-B receptor in stomatal guard cells. American Journal of Botany 90, 1560-1566.

Ensminger, P.A. (1993). Control of development in plants and fungi by far-UV radiation. Physiologia Plantarum 88, 501-508.

References 117

Estevez, M.S., Malanga, G., and Puntarulo, S. (2001). UV-B effects on Antarctic Chlorella sp cells. Journal of Photochemistry and Photobiology B: Biology 62, 19-25.

Favory, J.J., Stec, A., Gruber, H., Rizzini, L., Oravecz, A., Funk, M., Albert, A., Cloix, C., Jenkins, G.I., Oakeley, E.J., Seidlitz, H.K., Nagy, F., and Ulm, R. (2009). Interaction of COP1 and UVR8 regulates UV-B-induced photomorphogenesis and stress acclimation in Arabidopsis. Embo Journal 28, 591-601.

Felsenstein, J. (1985). Confidence-limits on phylogenies: an approach using the bootstrap. Evolution 39, 783-791.

Fleischmann, M., Clark, M.W., Forrester, W., Wickens, M., Nishimoto, T., and Aebi, M. (1991). Analysis of yeast PRP20 mutations and functional complementation by the human homolog RCC1, a protein involved in the control of chromosome condensation. Molecular & General Genetics 227, 417-423.

Foster, K.W., Saranak, J., Patel, N., Zarilli, G., Okabe, M., Kline, T., and Nakanishi, K. (1984). A rhodopsin is the functional photoreceptor for phototaxis in the unicellular eukaryote Chlamydomonas. Nature 311, 756-759.

Fritsche, E., Schafer, C., Calles, C., Bernsmann, T., Bernshausen, T., Wurm, M., Hubenthal, U., Cline, J.E., Hajimiragha, H., Schroeder, P., Klotz, L.O., Rannug, A., Furst, P., Hanenberg, H., Abel, J., and Krutmann, J. (2007). Lightening up the UV response by identification of the arylhydrocarbon receptor as a cytoplasmatic target for ultraviolet B radiation. Proceedings of the National Academy of Sciences of the United States of America 104, 8851-8856.

Frohnmeyer, H., and Staiger, D. (2003). Ultraviolet-B radiation-mediated responses in plants. Balancing damage and protection. Plant Physiology 133, 1420-1428.

Frohnmeyer, H., Loyall, L., Blatt, M.R., and Grabov, A. (1999). Millisecond UV-B irradiation evokes prolonged elevation of cytosolic-free Ca2+ and stimulates gene expression in transgenic parsley cell cultures. Plant J. 20, 109-117.

Fukamatsu, Y., Mitsui, S., Yasuhara, M., Tokioka, Y., Ihara, N., Fujita, S., and Kiyosue, T. (2005). Identification of LOV KELCH PROTEIN2 (LKP2)-interacting factors that can recruit LKP2 to nuclear bodies. Plant and Cell Physiology 46, 1340-1349.

Furuya, M., Kanno, M., Okamoto, H., Fukuda, S., and Wada, M. (1997). Control of mitosis by phytochrome and a blue-light receptor in fern spores. Plant Physiology 113, 677-683.

Galland, P., and Senger, H. (1988a). The role of flavins as photoreceptors. Journal of Photochemistry and Photobiology B-Biology 1, 277-294.

Galland, P., and Senger, H. (1988b). The role of pterins in the photoreception and metabolism of plants. Photochemistry and Photobiology 48, 811-820.

Garcia, V., Bruchet, H., Camescasse, D., Granier, F., Bouchez, D., and Tissier, A. (2003). AtATM is essential for meiosis and the somatic response to DNA damage in plants. Plant Cell 15, 119-132.

Garner, W.W., and Allard, H.A. (1920). Effect of the relative length of day and night and other factors of the environment on growth and reproduction in plants. Monthly Weather Review 48, 415-415.

Ge, L., Peer, W., Robert, S., Swarup, R., Ye, S., Prigge, M., Cohen, J.D., Friml, J., Murphy, A., Tang, D., and Estelle, M. (2010). Arabidopsis ROOT UVB SENSITIVE2/WEAK AUXIN RESPONSE1 is required for polar auxin transport. Plant Cell, tpc.110.074195.

Gentile, F., Amodeo, P., Febbraio, F., Picaro, F., Motta, A., Formisano, S., and Nucci, R. (2002). SDS-resistant active and thermostable dimers are obtained from the dissociation of homotetrameric β-glycosidase from hyperthermophilic Sulfolobus solfataricus in SDS. Journal of Biological Chemistry 277, 44050-44060.

References 118

Gietz, R.D., and Woods, R.A. (2002). Transformation of yeast by lithium acetate/single-stranded carrier DNA/polyethylene glycol method. In Guide to Yeast Genetics and Molecular and Cell Biology, Pt B, pp. 87-96.

Giovani, B., Byrdin, M., Ahmad, M., and Brettel, K. (2003). Light-induced electron transfer in a cryptochrome blue-light photoreceptor. Nature Structural Biology 10, 489-490.

Gomelsky, M., and Kaplan, S. (1998). AppA, a redox regulator of photosystem formation in Rhodobacter sphaeroides 2.4.1, is a flavoprotein - Identification of a novel FAD binding domain. Journal of Biological Chemistry 273, 35319-35325.

Gomelsky, M., and Klug, G. (2002). BLUF: a novel FAD-binding domain involved in sensory transduction in microorganisms. Trends in Biochemical Sciences 27, 497-500.

Gruber, H., Heijde, M., Heller, W., Albert, A., Seidlitz, H.K., and Ulm, R. Negative feedback regulation of UV-B–induced photomorphogenesis and stress acclimation in Arabidopsis. Proceedings of the National Academy of Sciences.

Guo, H.W., Duong, H., Ma, N., and Lin, C.T. (1999). The Arabidopsis blue light receptor cryptochrome 2 is a nuclear protein regulated by a blue light-dependent post-transcriptional mechanism. Plant J. 19, 279-287.

Hager, A., Brich, M., and Bazlen, I. (1993). Redox dependence of the blue-light-induced phosphorylation of a 100-kDa protein on isolated plasma-membranes from tips of coleoptiles. Planta 190, 120-126.

Han, L.Q., Mason, M., Risseeuw, E.P., Crosby, W.L., and Somers, D.E. (2004). Formation of an SCFZTL complex is required for proper regulation of circadian timing. Plant J. 40, 291-301.

Harper, S.M., Christie, J.M., and Gardner, K.H. (2004). Disruption of the LOV-J alpha helix interaction activates phototropin kinase activity. Biochemistry 43, 16184-16192.

Hayami, J., Kadota, A., and Wada, M. (1986). Blue light-induced phototropic response and the intracellular photoreceptive site in Adiantum protonemata. Plant and Cell Physiology 27, 1571-1577.

Hegemann, P. (2008). Algal sensory photoreceptors. Annu. Rev. Plant Biol. 59, 167-189. Hegemann, P., Gartner, W., and Uhl, R. (1991). All-trans retinal constitutes the functional

chromophore in Chlamydomonas rhodopsin. Biophysical Journal 60, 1477-1489. Heim, R., Prasher, D.C., and Tsien, R.Y. (1994). Wavelength mutations and

posttranslational autoxidation of green fluorescent protein. Proceedings of the National Academy of Sciences of the United States of America 91, 12501-12504.

Hideg, E., and Vass, I. (1996). UV-B induced free radical production in plant leaves and isolated thylakoid membranes. Plant Science 115, 251-260.

Hideg, E., Barta, C., Kalai, T., Vass, I., Hideg, K., and Asada, K. (2002). Detection of singlet oxygen and superoxide with fluorescent sensors in leaves under stress by photoinhibition or UV radiation. Plant and Cell Physiology 43, 1154-1164.

Hiltbrunner, A., Tscheuschler, A., Viczian, A., Kunkel, T., Kircher, S., and Schafer, E. (2006). FHY1 and FHL act together to mediate nuclear accumulation of the phytochrome A photoreceptor. Plant and Cell Physiology 47, 1023-1034.

Hiltbrunner, A., Viczian, A., Bury, E., Tscheuschler, A., Kircher, S., Toth, R., Honsberger, A., Nagy, F., Fankhauser, C., and Schafer, E. (2005). Nuclear accumulation of the phytochrome A photoreceptor requires FHY1. Current Biology 15, 2125-2130.

Hoecker, U., and Quail, P.H. (2001). The phytochrome A-specific signaling intermediate SPA1 interacts directly with COP1, a constitutive repressor of light signaling in Arabidopsis. Journal of Biological Chemistry 276, 38173-38178.

References 119

Hoffman, P.D., Batschauer, A., and Hays, J.B. (1996). PHH1, a novel gene from Arabidopsis thaliana that encodes a protein similar to plant blue-light photoreceptors and microbial photolyases. Molecular & General Genetics 253, 259-265.

Holm, M., Hardtke, C.S., Gaudet, R., and Deng, X.W. (2001). Identification of a structural motif that confers specific interaction with the WD40 repeat domain of Arabidopsis COP1. Embo Journal 20, 118-127.

Holm, M., Ma, L.G., Qu, L.J., and Deng, X.W. (2002). Two interacting bZIP proteins are direct targets of COP1-mediated control of light-dependent gene expression in Arabidopsis. Genes & Development 16, 1247-1259.

Huala, E., Oeller, P.W., Liscum, E., Han, I.S., Larsen, E., and Briggs, W.R. (1997). Arabidopsis NPH1: A protein kinase with a putative redox-sensing domain. Science 278, 2120-2123.

Huq, E., Al-Sady, B., and Quail, P.H. (2003). Nuclear translocation of the photoreceptor phytochrome B is necessary for its biological function in seedling photomorphogenesis. Plant J. 35, 660-664.

Iseki, M., Matsunaga, S., Murakami, A., Ohno, K., Shiga, K., Yoshida, K., Sugai, M., Takahashi, T., Hori, T., and Watanabe, M. (2002). A blue-light-activated adenylyl cyclase mediates photoavoidance in Euglena gracilis. Nature 415, 1047-1051.

Iwata, T., Nozaki, D., Tokutomi, S., Kagawa, T., Wada, M., and Kandori, H. (2003). Light-induced structural changes in the LOV2 domain of Adiantum phytochrome3 studied by low-temperature FTIR and UV-visible spectroscopy. Biochemistry 42, 8183-8191.

Izaguirre, M.M., Scopel, A.L., Baldwin, I.T., and Ballare, C.L. (2003). Convergent responses to stress. Solar ultraviolet-B radiation and Manduca sexta herbivory elicit overlapping transcriptional responses in field-grown plants of Nicotiana longiflora. Plant Physiology 132, 1755-1767.

Jang, I.-C., Henriques, R., Seo, H.S., Nagatani, A., and Chua, N.-H. (2010). Arabidopsis PHYTOCHROME INTERACTING FACTOR proteins promote phytochrome B polyubiquitination by COP1 E3 ligase in the nucleus. Plant Cell 22, 2370-2383.

Jang, I.C., Yang, J.Y., Seo, H.S., and Chua, N.H. (2005). HFR1 is targeted by COP1 E3 ligase for post-translational proteolysis during phytochrome A signaling. Genes & Development 19, 593-602.

Jansen, M.A.K., Gaba, V., and Greenberg, B.M. (1998). Higher plants and UV-B radiation: balancing damage, repair and acclimation. Trends in Plant Science 3, 243-243.

Jarillo, J.A., Gabrys, H., Capel, J., Alonso, J.M., Ecker, J.R., and Cashmore, A.R. (2001a). Phototropin-related NPL1 controls chloroplast relocation induced by blue light. Nature 410, 952-954.

Jarillo, J.A., Capel, J., Tang, R.H., Yang, H.Q., Alonso, J.M., Ecker, J.R., and Cashmore, A.R. (2001b). An Arabidopsis circadian clock component interacts with both CRY1 and phyB. Nature 410, 487-490.

Jenkins, G.I. (1997). UV and blue light signal transduction in Arabidopsis. Plant Cell and Environment 20, 773-778.

Jenkins, G.I., Long, J.C., Wade, H.K., Shenton, M.R., and Bibikova, T.N. (2001). UV and blue light signalling: pathways regulating chalcone synthase gene expression in Arabidopsis. New Phytologist 151, 121-131.

Jiao, Y.L., Lau, O.S., and Deng, X.W. (2007). Light-regulated transcriptional networks in higher plants. Nature Reviews Genetics 8, 217-230.

Kadowaki, T., Goldfarb, D., Spitz, L.M., Tartakoff, A.M., and Ohno, M. (1993). Regulation of RNA processing and transport by a nuclear guanine-nucleotide release protein and members of the Ras superfamily. Embo Journal 12, 2929-2937.

References 120

Kagawa, T. (2003). The phototropin family as photoreceptors for blue light-induced chloroplast relocation. Journal of Plant Research 116, 77-82.

Kagawa, T., Sakai, T., Suetsugu, N., Oikawa, K., Ishiguro, S., Kato, T., Tabata, S., Okada, K., and Wada, M. (2001). Arabidopsis NPL1: A phototropin homolog controlling the chloroplast high-light avoidance response. Science 291, 2138-2141.

Kahl, G.F., Friederici, D.E., Bigelow, S.W., Okey, A.B., and Nebert, D.W. (1980). Ontogenetic expression of regulatory and structural gene-products associated with the Ah locus. Comparison of rat, mouse, rabbit and Sigmoden-hispedis. Developmental Pharmacology and Therapeutics 1, 137-162.

Kaiserli, E., and Jenkins, G.I. (2007). UV-B promotes rapid nuclear translocation of the Arabidopsis UV-B-specific signaling component UVR8 and activates its function in the nucleus. Plant Cell 19, 2662-2673.

Kaiserli, E., Sullivan, S., Jones, M.A., Feeney, K.A., and Christie, J.M. (2009). Domain swapping to assess the mechanistic basis of Arabidopsis phototropin 1 receptor kinase activation and endocytosis by blue light. Plant Cell 21, 3226-3244.

Kanegae, T., Hayashida, E., Kuramoto, C., and Wada, M. (2006). A single chromoprotein with triple chromophores acts as both a phytochrome and a phototropin. Proceedings of the National Academy of Sciences of the United States of America 103, 17997-18001.

Karimi, M., Inzé, D., and Depicker, A. (2002). GATEWAY(TM) vectors for Agrobacterium-mediated plant transformation. Trends in Plant Science 7, 193-195.

Karniol, B., Wagner, J.R., Walker, J.M., and Vierstra, R.D. (2005). Phylogenetic analysis of the phytochrome superfamily reveals distinct microbial subfamilies of photoreceptors. Biochemical Journal 392, 103-116.

Kim, B.C., Tennessen, D.J., and Last, R.L. (1998). UV-B-induced photomorphogenesis in Arabidopsis thaliana. Plant J. 15, 667-674.

Kim, W.K., Henschel, A., Winter, C., and Schroeder, M. (2006). The many faces of protein–protein interactions: a compendium of interface geometry. PLoS Comput Biol 2, e124.

Kinoshita, T., Emi, T., Tominaga, M., Sakamoto, K., Shigenaga, A., Doi, M., and Shimazaki, K. (2003). Blue-light- and phosphorylation-dependent binding of a 14-3-3 protein to phototropins in stomatal guard cells of broad bean. Plant Physiology 133, 1453-1463.

Kinyo, A., Kiss-Laszlo, Z., Hambalko, S., Bebes, A., Kiss, M., Szell, M., Bata-Csorgo, Z., Nagy, F., and Kemeny, L. (2010). COP1 contributes to UVB-induced signaling in human keratinocytes. Journal of Investigative Dermatology 130, 541-545.

Kircher, S., Kozma-Bognar, L., Kim, L., Adam, E., Harter, K., Schafer, E., and Nagy, F. (1999). Light quality-dependent nuclear import of the plant photoreceptors phytochrome A and B. Plant Cell 11, 1445-1456.

Kircher, S., Gil, P., Kozma-Bognar, L., Fejes, E., Speth, V., Husselstein-Muller, T., Bauer, D., Adam, E., Schafer, E., and Nagy, F. (2002). Nucleocytoplasmic partitioning of the plant photoreceptors phytochrome A, B, C, D, and E is regulated differentially by light and exhibits a diurnal rhythm. Plant Cell 14, 1541-1555.

Kiyosue, T., and Wada, M. (2000). LKP1 (LOV kelch protein 1): a factor involved in the regulation of flowering time in Arabidopsis. Plant J. 23, 807-815.

Kleine, T., Lockhart, P., and Batschauer, A. (2003). An Arabidopsis protein closely related to Synechocystis cryptochrome is targeted to organelles. Plant J. 35, 93-103.

Kleiner, O., Kircher, S., Harter, K., and Batschauer, A. (1999). Nuclear localization of the Arabidopsis blue light receptor cryptochrome 2. Plant J. 19, 289-296.

Kliebenstein, D.J., Lim, J.E., Landry, L.G., and Last, R.L. (2002). Arabidopsis UVR8 regulates ultraviolet-B signal transduction and tolerance and contains sequence

References 121

similarity to human Regulator of Chromatin Condensation 1. Plant Physiology 130, 234-243.

Knutson, J.C., and Poland, A. (1980). Keratinization of mouse teratoma cell-line XB produced by 2,3,7,8-tetrachlorodibenzo-p-dioxin: an invitro model of toxicity. Cell 22, 27-36.

Komori, H., Masui, R., Kuramitsu, S., Yokoyama, S., Shibata, T., Inoue, Y., and Miki, K. (2001). Crystal structure of thermostable DNA photolyase: Pyrimidine-dimer recognition mechanism. Proceedings of the National Academy of Sciences of the United States of America 98, 13560-13565.

Koornneef, M., Rolff, E., and Spruit, C.J.P. (1980). Genetic control of light-inhibited hypocotyl elongation in Arabidopsis thaliana. Zeitschrift fur Pflanzenphysiologie 100, 147-160.

Krauss, U., Minh, B.Q., Losi, A., Gartner, W., Eggert, T., von Haeseler, A., and Jaeger, K.E. (2009). Distribution and phylogeny of light-oxygen-voltage-blue-light-signaling proteins in the three kingdoms of life. Journal of Bacteriology 191, 7234-7242.

Kucera, B., Leubner-Metzger, G., and Wellmann, E. (2003). Distinct ultraviolet-signaling pathways in bean leaves. DNA damage is associated with beta-1,3-glucanase gene induction, but not with flavonoid formation. Plant Physiology 133, 1445-1452.

Kuehne, W. (1878a). Zur photochemie der netzhaut. Untersuchungen physiol. Inst. Univ. Heidelberg 1, 1-14.

Kuehne, W. (1878b). Ueber den sehpurpur. Untersuchungen physiol. Inst. Univ. Heidelberg, 15-103.

Lawson, M.A., Zacks, D.N., Derguini, F., Nakanishi, K., and Spudich, J.L. (1991). Retinal analog restoration of photophobic responses in a blind Chlamydomonas-reinhardtii mutant - evidence for an archaebacterial like chromophore in a eukaryotic rhodopsin. Biophysical Journal 60, 1490-1498.

Leasure, C.D., Tong, H.Y., Yuen, G.G., Hou, X.W., Sun, X.F., and He, Z.H. (2009). ROOT UV-B SENSITIVE2 acts with ROOT UV-B SENSITIVE1 in a root ultraviolet B-sensing pathway. Plant Physiology 150, 1902-1915.

Li, H., Zhang, J.R., Vierstra, R.D., and Li, H.L. (2010). Quaternary organization of a phytochrome dimer as revealed by cryoelectron microscopy. Proceedings of the National Academy of Sciences of the United States of America 107, 10872-10877.

Lin, C., Ahmad, M., and Cashmore, A.R. (1996). Arabidopsis cryptochrome 1 is a soluble protein mediating blue light-dependent regulation of plant growth and development. The Plant Journal 10, 893-902.

Lin, C., Ahmad, M., Gordon, D., and Cashmore, A.R. (1995a). Expression of an Arabidopsis cryptochrome gene in transgenic tobacco results in hypersensitivity to blue, UV-A, and green light. Proceedings of the National Academy of Sciences of the United States of America 92, 8423-8427.

Lin, C.T. (2002). Blue light receptors and signal transduction. Plant Cell 14, S207-S225. Lin, C.T., and Todo, T. (2005). The cryptochromes. Genome Biology 6. Lin, C.T., Robertson, D.E., Ahmad, M., Raibekas, A.A., Jorns, M.S., Dutton, P.L., and

Cashmore, A.R. (1995b). Association of flavin adenine-dinucleotide with the Arabidopsis blue-light receptor cry1. Science 269, 968-970.

Linden, H., and Macino, G. (1997). White collar 2, a partner in blue-light signal transduction, controlling expression of light-regulated genes in Neurospora crassa. Embo Journal 16, 98-109.

Liu, H.T., Yu, X.H., Li, K.W., Klejnot, J., Yang, H .Y., Lisiero, D., and Lin, C.T. (2008). Photoexcited CRY2 interacts with CIB1 to regulate transcription and floral initiation in Arabidopsis. Science 322, 1535-1539.

References 122

Losi, A., Ternelli, E., and Gartner, W. (2004). Tryptophan fluorescence in the Bacillus subtilis phototropin-related protein YtvA as a marker of interdomain interaction. Photochemistry and Photobiology 80, 150-153.

Lovelock, J.E., and Maggs, R.J. (1973). Halogenated hydrocarbons in and over atlantic. Nature 241, 194-196.

Lumsden. (1997). Plants and UV-B. (Cambridge university press). Ma, L.G., Gao, Y., Ou, L.J., Chen, Z.L., Li, J.M., Zhao, H.Y., and Deng, X.W. (2002).

Genomic evidence for COP1 as a repressor of light-regulated gene expression and development in Arabidopsis. Plant Cell 14, 2383-2398.

Mackerness, S.A.H. (2000). Plant responses to ultraviolet-B (UV-B : 280-320 nm) stress: What are the key regulators? Plant Growth Regulation 32, 27-39.

Mackerness, S.A.H., John, C.F., Jordan, B., and Thomas, B. (2001). Early signaling components in ultraviolet-B responses: distinct roles for different reactive oxygen species and nitric oxide. FEBS Lett. 489, 237-242.

Malhotra, K., Kim, S.T., Batschauer, A., Dawut, L., and Sancar, A. (1995). Putative blue-light photoreceptors from Arabidopsis-thaliana and Sinapis-alba with a high-degree of sequence homology to DNA photolyase contain the 2 photolyase cofactors but lack DNA-repair activity. Biochemistry 34, 6892-6899.

Marrocco, K., Zhou, Y.C., Bury, E., Dieterle, M., Funk, M., Genschik, P., Krenz, M., Stolpe, T., and Kretsch, T. (2006). Functional analysis of EID1, an F-box protein involved in phytochrome A-dependent light signal transduction. Plant J. 45, 423-438.

Mas, P., Kim, W.Y., Somers, D.E., and Kay, S.A. (2003). Targeted degradation of TOC1 by ZTL modulates circadian function in Arabidopsis thaliana. Nature 426, 567-570.

Matsumoto, T., and Beach, D. (1991). Premature initiation of mitosis in yeast lacking RCC1 or an interacting GTPase. Cell 66, 347-360.

McKenzie, R.L., Bjorn, L.O., Bais, A., and Ilyasd, M. (2003). Changes in biologically active ultraviolet radiation reaching the Earth's surface. Photochemical & Photobiological Sciences 2, 5-15.

McKenzie, R.L., Aucamp, P.J., Bais, A.F., Bjorn, L.O., and Ilyas, M. (2007). Changes in biologically-active ultraviolet radiation reaching the Earth's surface. Photochemical & Photobiological Sciences 6, 218-231.

McNellis, T.W., Vonarnim, A.G., Araki, T., Komeda, Y., Misera, S., and Deng, X.W. (1994). Genetic and molecular analysis of an allelic series of cop1 mutants suggests functional roles for the multiple protein domains. Plant Cell 6, 487-500.

Melchert, T.E., and Alston, R.E. (1965). Flavonoids from the moss Mnium affine bland. Science 150, 1170-1171.

Metz, S., Hendriks, J., Jäger, A., Hellingwerf, K., and Klug, G. (2010). In vivo effects on photosynthesis gene expression of base pair exchanges in the gene encoding the light-responsive BLUF domain of AppA in Rhodobacter sphaeroides. Photochemistry and Photobiology 86, 882-889.

Mohr, S. (1995). Plant physiology. (Springer). Molina, M.J., and Rowland, F.S. (1974). Stratospheric sink for chlorofluoromethanes:

chlorine atomic-catalysed destruction of ozone. Nature 249, 810-812. Moser, M., Schafer, E., and Ehmann, B. (2000). Characterization of protein and transcript

levels of the chaperonin containing tailless complex protein-1 and tubulin during light-regulated growth of oat seedlings. Plant Physiology 124, 313-320.

Mou, Z., Fan, W., and Dong, X. (2003). Inducers of plant systemic acquired resistance regulate NPR1 function through redox changes. Cell 113, 935-944.

Nagy, F., and Schafer, E. (2002). Phytochromes control photomorphogenesis by differentially regulated, interacting signaling pathways in higher plants. Annu. Rev. Plant Biol. 53, 329-355.

References 123

Nathans, J. (1992). Rhodopsin: structure, function, and genetics. Biochemistry 31, 4923-4931.

Nelson, D.C., Lasswell, J., Rogg, L.E., Cohen, M.A., and Bartel, B. (2000). FKF1, a clock-controlled gene that regulates the transition to flowering in Arabidopsis. Cell 101, 331-340.

Ni, M., Tepperman, J.M., and Quail, P.H. (1998). PIF3, a phytochrome-interacting factor necessary for normal photoinduced signal transduction, is a novel basic helix-loop-helix protein. Cell 95, 657-667.

Notredame, C., Higgins, D.G., and Heringa, J. (2000). T-Coffee: A novel method for fast and accurate multiple sequence alignment. Journal of Molecular Biology 302, 205-217.

Nozaki, D., Iwata, T., Ishikawa, T., Todo, T., Tokutomi, S., and Kandori, H. (2004). Role of Gln1029 in the photoactivation processes of the LOV2 domain in Adiantum phytochrome3. Biochemistry 43, 8373-8379.

Nozue, K., Kanegae, T., Imaizumi, T., Fukuda, S., Okamoto, H., Yeh, K.C., Lagarias, J.C., and Wada, M. (1998). A phytochrome from the fern Adiantum with features of the putative photoreceptor NPH1. Proceedings of the National Academy of Sciences of the United States of America 95, 15826-15830.

Oberg, M., Bergander, L., Hakansson, H., Rannug, U., and Rannug, A. (2005). Identification of the tryptophan photoproduct 6-formylindolo[3,2-b]carbazole, in cell culture medium, as a factor that controls the background Aryl hydrocarbon Receptor activity. Toxicol. Sci. 85, 935-943.

Oesterhelt, D., and Stoecken, W. (1973). Functions of a new photoreceptor membrane. Proceedings of the National Academy of Sciences of the United States of America 70, 2853-2857.

Ohtsubo, M., Kai, R., Furuno, N., Sekiguchi, T., Sekiguchi, M., Hayashida, H., Kuma, K., Miyata, T., Fukushige, S., Murotsu, T., Matsubara, K., and Nishimoto, T. (1987). Isolation and characterization of the active cDNA of the human cell-cycle gene (RCC1) involved in the regulation of onset of chromosome condensation. Genes & Development 1, 585-593.

Oravecz, A., Baumann, A., Mate, Z., Brzezinska, A., Molinier, J., Oakeley, E.J., Adam, E., Schafer, E., Nagy, F., and Ulm, R. (2006). CONSTITUTIVELY PHOTOMORPHOGENIC1 is required for the UV-B response in Arabidopsis. Plant Cell 18, 1975-1990.

Osterlund, M.T., Ang, L.H., and Deng, X.W. (1999). The role of COP1 in repression of Arabidopsis photomorphogenic development. Trends in Cell Biology 9, 113-118.

Osterlund, M.T., Hardtke, C.S., Wei, N., and Deng, X.W. (2000). Targeted destabilization of HY5 during light-regulated development of Arabidopsis. Nature 405, 462-466.

Oyama, T., Shimura, Y., and Okada, K. (1997). The Arabidopsis HY5 gene encodes a bZIP protein that regulates stimulus-induced development of root and hypocotyl. Genes & Development 11, 2983-2995.

Park, H.W., Kim, S.T., Sancar, A., and Deisenhofer, J. (1995). Crystal-structure of DNA photolyase from Escherichia coli. Science 268, 1866-1872.

Parker, M.W., Hendricks, S.B., and Borthwick, H.A. (1950). Action spectrum for the photoperiodic control of floral initiation of the long-day plant Hyoscyamus niger. Bot Gaz 111, 242-252.

Parker, M.W., Hendricks, S.B., Borthwick, H.A., and Scully, N.J. (1946). Action spectrum for the photoperiodic control of floral initiation of short-day plants. Bot Gaz 108, 1-26.

Paul, N.D., and Gwynn-Jones, D. (2003). Ecological roles of solar UV radiation: towards an integrated approach. Trends in Ecology & Evolution 18, 48-55.

References 124

Pokorny, R., Klar, T., Essen, L.O., and Batschauer, A. (2005). Crystallization and preliminary X-ray analysis of cryptochrome 3 from Arabidopsis thaliana. Acta Crystallographica Section F-Structural Biology and Crystallization Communications 61, 935-938.

Ponting, C.P., and Aravind, L. (1997). PAS: a multifunctional domain family comes to light. Current Biology 7, R674-R677.

Rannug, U., Rannug, A., Sjoberg, U., Li, H., Westerholm, R., and Bergman, J. (1995). Structure elucidation of two tryptophan-derived, high affinity Ah receptor ligands. Chemistry & Biology 2, 841-845.

Renault, L., Nassar, N., Vetter, I., Becker, J., Klebe, C., Roth, M., and Wittinghofer, A. (1998). The 1.7 angstrom crystal structure of the regulator of chromosome condensation (RCC1) reveals a seven-bladed propeller. Nature 392, 97-101.

Rozema, J., vandeStaaij, J., Bjorn, L.O., and Caldwell, M. (1997). UV-B as an environmental factor in plant life: Stress and regulation. Trends in Ecology & Evolution 12, 22-28.

Rozema, J., Björn, L.O., Bornman, J.F., Gaberscik, A., Häder, D.P., Trost, T., Germ, M., Klisch, M., Gröniger, A., Sinha, R.P., Lebert, M., He, Y.Y., Buffoni-Hall, R., de Bakker, N.V.J., van de Staaij, J., and Meijkamp, B.B. (2002). The role of UV-B radiation in aquatic and terrestrial ecosystems. An experimental and functional analysis of the evolution of UV-absorbing compounds. Journal of Photochemistry and Photobiology B: Biology 66, 2-12.

Rubio, V., and Deng, X.W. (2005). Phy tunes: Phosphorylation status and phytochrome-mediated signaling. Cell 120, 290-292.

Saijo, Y., Sullivan, J.A., Wang, H.Y., Yang, J.P., Shen, Y.P., Rubio, V., Ma, L.G., Hoecker, U., and Deng, X.W. (2003). The COP1-SPA1 interaction defines a critical step in phytochrome A-mediated regulation of HY5 activity. Genes & Development 17, 2642-2647.

Saitou, N., and Nei, M. (1987). The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution 4, 406-425.

Sakamoto, K., and Nagatani, A. (1996). Nuclear localization activity of phytochrome B. Plant J. 10, 859-868.

Salomon, M., Lempert, U., and Rudiger, W. (2004). Dimerization of the plant photoreceptor phototropin is probably mediated by the LOV1 domain. FEBS Lett. 572, 8-10.

Salomon, M., Zacherl, M., Luff, L., and Rudiger, W. (1997). Exposure of oat seedlings to blue light results in amplified phosphorylation of the putative photoreceptor for phototropism and in higher sensitivity of the plants to phototropic stimulation. Plant Physiology 115, 493-500.

Salomon, M., Christie, J.M., Knieb, E., Lempert, U., and Briggs, W.R. (2000). Photochemical and mutational analysis of the FMN-binding domains of the plant blue light receptor, phototropin. Biochemistry 39, 9401-9410.

Sambrook, J., and Russel, D.W. (2001). Molecular cloning: a laboratory manual. (cold spring harbor laboratory press).

Sancar, A. (2003). Structure and function of DNA photolyase and cryptochrome blue-light photoreceptors. Chemical Reviews 103, 2203-2237.

Sancar, A., Lindsey-Boltz, L.A., Unsal-Kacmaz, K., and Linn, S. (2004). Molecular mechanisms of mammalian DNA repair and the DNA damage checkpoints. Annu. Rev. Biochem. 73, 39-85.

Sang, Y., Li, Q.H., Rubio, V., Zhang, Y.C., Mao, J., Deng, X.W., and Yang, H.Q. (2005). N-terminal domain-mediated homodimerization is required for photoreceptor activity of Arabidopsis CRYPTOCHROME 1. Plant Cell 17, 1569-1584.

References 125

Savenstrand, H., Brosche, M., and Strid, A. (2004). Ultraviolet-B signalling: Arabidopsis brassinosteroid mutants are defective in UV-B regulated defence gene expression. Plant Physiology and Biochemistry 42, 687-694.

Sazer, S., and Nurse, P. (1994). A fission yeast RCC1-related protein is required for the mitosis to interphase transition. Embo Journal 13, 606-615.

Schafer, E., and Bowler, C. (2002). Phytochrome-mediated photoperception and signal transduction in higher plants. Embo Reports 3, 1042-1048.

Schmidt, W., Marme, D., Quail, P., and Schafer, E. (1973). Phytochrome: first-order phototransformation kinetics in vivo. Planta 111, 329-336.

Schuermann, D., Molinier, J., Fritsch, O., and Hohn, B. (2005). The dual nature of homologous recombination in plants. Trends in Genetics 21, 172-181.

Schultz, T.F., Kiyosue, T., Yanovsky, M., Wada, M., and Kay, S.A. (2001). A role for LKP2 in the circadian clock of Arabidopsis. Plant Cell 13, 2659-2670.

Schwerdtfeger, C., and Linden, H. (2000). Localization and light-dependent phosphorylation of white collar; 1 and 2, the two central components of blue light signaling in Neurospora crassa. European Journal of Biochemistry 267, 414-421.

Seo, H.S., Watanabe, E., Tokutomi, S., Nagatani, A., and Chua, N.H. (2004). Photoreceptor ubiquitination by COP1 E3 ligase desensitizes phytochrome A signaling. Genes & Development 18, 617-622.

Seo, H.S., Yang, J.Y., Ishikawa, M., Bolle, C., Ballesteros, M.L., and Chua, N.H. (2003). LAF1 ubiquitination by COP1 controls photomorphogenesis and is stimulated by SPA1. Nature 423, 995-999.

Shalitin, D., Yu, X.H., Maymon, M., Mockler, T., and Lin, C.T. (2003). Blue light-dependent in vivo and in vitro phosphorylation of Arabidopsis cryptochrome 1. Plant Cell 15, 2421-2429.

Shalitin, D., Yang, H.Y., Mockler, T.C., Maymon, M., Guo, H.W., Whitelam, G.C., and Lin, C.T. (2002). Regulation of Arabidopsis cryptochrome 2 by blue-light-dependent phosphorylation. Nature 418, 447-447.

Sharrock, R.A. (2008). The phytochrome red/far-red photoreceptor superfamily. Genome Biology 9.

Sharrock, R.A., and Quail, P.H. (1989). Novel phytochrome sequences in Arabidopsis thaliana: structure, evolution, and differential expression of a plant regulatory photoreceptor family. Genes & Development 3, 1745-1757.

Sharrock, R.A., and Clack, T. (2004). Heterodimerization of type II phytochromes in Arabidopsis. Proceedings of the National Academy of Sciences of the United States of America 101, 11500-11505.

Shimizu-Sato, S., Huq, E., Tepperman, J.M., and Quail, P.H. (2002). A light-switchable gene promoter system. Nature Biotechnology 20, 1041-1044.

Shimomura, O., Johnson, F.H., and Saiga, Y. (1962). Extraction, purification and properties of Aequorin, a bioluminescent protein from the luminous hydromedusan, Aequorea. Journal of Cellular and Comparative Physiology 59, 223-239.

Shinkle, J.R., Atkins, A.K., Humphrey, E.E., Rodgers, C.W., Wheeler, S.L., and Barnes, P.W. (2004). Growth and morphological responses to different UV wavebands in cucumber (Cucumis sativum) and other dicotyledonous seedlings. Physiologia Plantarum 120, 240-248.

Shinohara, A., and Ogawa, T. (1995). Homologous recombination and the roles of double-strand breaks. Trends in Biochemical Sciences 20, 387-391.

Short, T.W., and Briggs, W.R. (1990). Characterization of a rapid, blue light-mediated change in detectable phosphorylation of a plasma-membrane protein from etiolated pea (Pisum-sativum) seedlings. Plant Physiology 92, 179-185.

References 126

Shuck, S.C., Short, E.A., and Turchi, J.J. (2008). Eukaryotic nucleotide excision repair: from understanding mechanisms to influencing biology. Cell Research 18, 64-72.

Siegelman, H.W., and Firer, E.M. (1964). Purification of phytochrome from oat seedlings. Biochemistry 3, 418-&.

Somers, D.E., Schultz, T.F., Milnamow, M., and Kay, S.A. (2000). ZEITLUPE encodes a novel clock-associated PAS protein from Arabidopsis. Cell 101, 319-329.

Speth, V., Otto, V., and Schafer, E. (1986). Intracellular localization of phytochrome in oat coleoptiles by electron-microscopy. Planta 168, 299-304.

Spudich, J.L., Yang, C.S., Jung, K.H., and Spudich, E.N. (2000). Retinylidene proteins: Structures and functions from archaea to humans. Annual Review of Cell and Developmental Biology 16, 365-392.

Stapleton, A.E. (1992). Ultraviolet radiation and plants: burning questions. Plant Cell 4, 1353-1358.

Stelzl, U., Worm, U., Lalowski, M., Haenig, C., Brembeck, F.H., Goehler, H., Stroedicke, M., Zenkner, M., Schoenherr, A., Koeppen, S., Timm, J., Mintzlaff, S., Abraham, C., Bock, N., Kietzmann, S., Goedde, A., Toksöz, E., Droege, A., Krobitsch, S., Korn, B., Birchmeier, W., Lehrach, H., and Wanker, E.E. (2005). A human protein-protein interaction network: A resource for annotating the proteome. Cell 122, 957-968.

Stolpe, T., Susslin, C., Marrocco, K., Nick, P., Kretsch, T., and Kircher, S. (2005). In planta analysis of protein-protein interactions related to light signaling by bimolecular fluorescence complementation. Protoplasma 226, 137-146.

Strader, C.D., Fong, T.M., Tota, M.R., Underwood, D., and Dixon, R.A.F. (1994). Structure and function of G-protein-coupled receptors. Annu. Rev. Biochem. 63, 101-132.

Strasser, B., Sánchez-Lamas, M., Yanovsky, M.J., Casal, J.J., and Cerdán, P.D. (2010). Arabidopsis thaliana: life without phytochromes. Proceedings of the National Academy of Sciences 107, 4776-4781.

Suesslin, C., and Frohnmeyer, H. (2003). An Arabidopsis mutant defective in UV-B light-mediated responses. Plant J. 33, 591-601.

Suetsugu, N., Mittmann, F., Wagner, G., Hughes, J., and Wada, M. (2005). A chimeric photoreceptor gene, NEOCHROME, has arisen twice during plant evolution. Proceedings of the National Academy of Sciences of the United States of America 102, 13705-13709.

Surplus, S.L., Jordan, B.R., Murphy, A.M., Carr, J.P., Thomas, B., and Mackerness, S.A.H. (1998). Ultraviolet-B-induced responses in Arabidopsis thaliana: role of salicylic acid and reactive oxygen species in the regulation of transcripts encoding photosynthetic and acidic pathogenesis-related proteins. Plant Cell and Environment 21, 685-694.

Swartz, T.E., Wenzel, P.J., Corchnoy, S.B., Briggs, W.R., and Bogomolni, R.A. (2002). Vibration spectroscopy reveals light-induced chromophore and protein structural changes in the LOV2 domain of the plant blue-light receptor phototropin 1. Biochemistry 41, 7183-7189.

Taiz, Z. (2002). Plant Physiology. (sinauer associates). Takahashi, F., Yamagata, D., Ishikawa, M., Fukamatsu, Y., Ogura, Y., Kasahara, M.,

Kiyosue, T., Kikuyama, M., Wada, M., and Kataoka, H. (2007). AUREOCHROME, a photoreceptor required for photomorphogenesis in stramenopiles. Proceedings of the National Academy of Sciences of the United States of America 104, 19625-19630.

References 127

Talora, C., Franchi, L., Linden, H., Ballario, P., and Macino, G. (1999). Role of a white collar-1-white collar-2 complex in blue-light signal transduction. Embo Journal 18, 4961-4968.

Tamada, T., Kitadokoro, K., Higuchi, Y., Inaka, K., Yasui, A., deRuiter, P.E., Eker, A.P.M., and Miki, K. (1997). Crystal structure of DNA photolyase from Anacystis nidulans. Nature Structural Biology 4, 887-891.

Tamura, K., Dudley, J., Nei, M., and Kumar, S. (2007). MEGA4: Molecular evolutionary genetics analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24, 1596-1599.

Taylor, B.L., and Zhulin, I.B. (1999). PAS domains: Internal sensors of oxygen, redox potential, and light. Microbiology and Molecular Biology Reviews 63, 479-506.

Tevini, M., and Teramura, A.H. (1989). UV-B effects on terrestrial plants. Photochemistry and Photobiology 50, 479-487.

Thompson, J.D., Higgins, D.G., and Gibson, T.J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22, 4673-4680.

Tokutomi, S., Matsuoka, D., and Zikihara, K. (2008). Molecular structure and regulation of phototropin kinase by blue light. Biochimica et Biophysica Acta (BBA) - Proteins & Proteomics 1784, 133-142.

Tong, H.Y., Leasure, C.D., Hou, X.W., Yuen, G., Briggs, W., and He, Z.H. (2008). Role of root UV-B sensing in Arabidopsis early seedling development. Proceedings of the National Academy of Sciences of the United States of America 105, 21039-21044.

Toole, E.H., Borthwick, H.A., Hendricks, S.B., and Toole, V.K. (1953). Physiological studies of the effects of light and temperature on seed germination. Proc. Int. Seed Test Assoc 18, 267-276.

Torii, K.U., McNellis, T.W., and Deng, X.W. (1998). Functional dissection of Arabidopsis COP1 reveals specific roles of its three structural modules in light control of seedling development. Embo Journal 17, 5577-5587.

Ulm, R., and Nagy, F. (2005). Signalling and gene regulation in response to ultraviolet light. Current Opinion in Plant Biology 8, 477-482.

Ulm, R., Ichimura, K., Mizoguchi, T., Peck, S.C., Zhu, T., Wang, X., Shinozaki, K., and Paszkowski, J. (2002). Distinct regulation of salinity and genotoxic stress responses by Arabidopsis MAP kinase phosphatase 1. EMBO J 21, 6483-6493.

Ulm, R., Baumann, A., Oravecz, A., Mate, Z., Adam, E., Oakeley, E.J., Schafer, E., and Nagy, F. (2004). Genome-wide analysis of gene expression reveals function of the bZIP transcription factor HY5 in the UV-B response of Arabidopsis. Proceedings of the National Academy of Sciences of the United States of America 101, 1397-1402.

Wade, H.K., Bibikova, T.N., Valentine, W.J., and Jenkins, G.I. (2001). Interactions within a network of phytochrome, cryptochrome and UV-B phototransduction pathways regulate chalcone synthase gene expression in Arabidopsis leaf tissue. Plant J. 25, 675-685.

Wald, G. (1933). Vitamin A in the retina. Nature, 132-316. Walter, M., Chaban, C., Schütze, K., Batistic, O., Weckermann, K., Näke, C., Blazevic,

D., Grefen, C., Schumacher, K., Oecking, C., Harter, K., and Kudla, J. (2004). Visualization of protein interactions in living plant cells using bimolecular fluorescence complementation. The Plant Journal 40, 428-438.

Wang, H.Y., Ma, L.G., Li, J.M., Zhao, H.Y., and Deng, X.W. (2001). Direct interaction of Arabidopsis cryptochromes with COP1 in light control development. Science 294, 154-158.

References 128

Waterhouse, A.M., Procter, J.B., Martin, D.M.A., Clamp, M., and Barton, G.J. (2009). Jalview Version 2. A multiple sequence alignment editor and analysis workbench. Bioinformatics 25, 1189-1191.

Whitelam G.C., H.K.J. (2007). Light and plant developmnet. (Blackwell). Wolf, L., Rizzini, L., Stracke, R., Ulm, R., and Rensing, S.A. (2010). The molecular and

physiological responses of Physcomitrella patens to Ultraviolet-B Radiation. Plant Physiol. 153, 1123-1134.

Yamaguchi, R., Nakamura, M., Mochizuki, N., Kay, S.A., and Nagatani, A. (1999). Light-dependent translocation of a phytochrome B. GFP fusion protein to the nucleus in transgenic Arabidopsis. Journal of Cell Biology 145, 437-445.

Yang, H.Q., Tang, R.H., and Cashmore, A.R. (2001). The signaling mechanism of Arabidopsis CRY1 involves direct interaction with COP1. Plant Cell 13, 2573-2587.

Yang, H.Q., Wu, Y.J., Tang, R.H., Liu, D.M., Liu, Y., and Cashmore, A.R. (2000). The C termini of Arabidopsis cryptochromes mediate a constitutive light response. Cell 103, 815-827.

Yang, J.P., Lin, R.C., James, S., Hoecker, U., Liu, B.L., Xu, L., Deng, X.W., and Wang, H.Y. (2005). Light regulates COP1-mediated degradation of HFR1, a transcription factor essential for light signaling in arabidopsis. Plant Cell 17, 804-821.

Yasuhara, M., Mitsui, S., Takanabe, R., Tokioka, Y., Ihara, N., Komatsu, A., Seki, M., Shinozaki, K., and Kiyosue, T. (2004). Identification of ASK and clock-associated proteins as molecular partners of LKP2 (LOV kelch protein 2) in Arabidopsis. Journal of Experimental Botany 55, 2015-2027.

Yeh, K.C., and Lagarias, J.C. (1998). Eukaryotic phytochromes: Light-regulated serine/threonine protein kinases with histidine kinase ancestry. Proceedings of the National Academy of Sciences of the United States of America 95, 13976-13981.

Yi, C.L., and Deng, X.W. (2005). COP1 - from plant photomorphogenesis to mammalian tumorigenesis. Trends in Cell Biology 15, 618-625.

Yi, C.L., Wang, H.Y., Wei, N., and Deng, X.W. (2002). An initial biochemical and cell biological characterization of the mammalian homologue of a central plant developmental switch, COP1. Bmc Cell Biology 3.

Zeugner, A., Byrdin, M., Bouly, J.P., Bakrim, N., Giovani, B., Brettel, K., and Ahmad, M. (2005). Light-induced electron transfer in Arabidopsis cryptochrome-1 correlates with in vivo function. Journal of Biological Chemistry 280, 19437-19440.

Zhao, Q., Leung, S., Corbett, A.H., and Meier, I. (2006). Identification and characterization of the Arabidopsis orthologs of Nuclear Transport Factor 2, the nuclear import factor of Ran. Plant Physiol. 140, 869-878.

Zuckerkandl, and Pauling. (1965). Evolutionary divergence and convergence in proteins. In Evolving Genes and Proteins, Bryson and Vogel, eds (New York: Academic Press), pp. 97-166.

UVR8: a plant UV-B photoreceptor

Documents

Transcript of UVR8: a plant UV-B photoreceptor