Proteomic screening identifies a YAP-driven signaling network linked to tumor cell proliferation in...

Proteomic screening identifies a YAP-driven signaling network linkedto tumor cell proliferation in human schwannomas

Alizee Boin†, Anne Couvelard†, Christophe Couderc, Isabel Brito, Dan Filipescu, Michel Kalamarides, Pierre Bedossa,Leanne De Koning, Carine Danelsky, Thierry Dubois, Philippe Hupe, Daniel Louvard, and Dominique Lallemand

Centre National de la Recherche Scientifique, Institut Curie, Paris, France (A.B., C.C., D.Lo., D.La.); Institut National de la Sante et de laRecherche Medicale, Paris, France (I.B., P.H.); Mines ParisTech, Fontainebleau, France (P.H.); Breast Cancer Biology Group, Institut Curie,Paris, France (T.D.); Reverse Phase Protein Array Platform, Institut Curie, Paris, France (C.D., L.D.K.); Centre National de la RechercheScientifique, Institut Curie, Paris, France (D.F.); Department of Neurosurgery, Assistance Publique-Hopitaux de Paris, Hopital Beaujon,Clichy, France (M.K.); Unite Institut National de la Sante et de la Recherche Medicale, Fondation Jean Dausset, Paris, France (M.K.);Pathology Department Beaujon-Bichat, AP-HP, Hopital Bichat, Paris, France (A.C.); Universite Paris Diderot, Sorbonne Paris Cite, Paris,France (A.C.); Pathology Department Beaujon-Bichat, AP-HP, Hopital Beaujon, Clichy, France (P.B.); Universite Paris Diderot, Sorbonne ParisCite, Paris, France (M.K.)

Corresponding Author: Dominique Lallemand, PhD, UMR144, Institut Curie, 26 Rue d’Ulm, 75248 Paris Cedex 05, France ([email protected]).†These authors contributed equally to this work.

Background. Inactivation of the NF2 gene predisposes to neurofibromatosis type II and the development of schwannomas. In vitrostudies have shown that loss of NF2 leads to the induction of mitogenic signaling mediated by receptor tyrosine kinases (RTKs), MAPkinase, AKT, or Hippo pathways. The goal of our study was to evaluate the expression and activity of these signaling pathways inhuman schwannomas in order to identify new potential therapeutic targets.

Methods. Large sets of human schwannomas, totaling 68 tumors, were analyzed using complementary proteomic approaches. RTKarrays identified the most frequently activated RTKs. The correlation between the expression and activity of signaling pathways andproliferation of tumor cells using Ki67 marker was investigated by reverse-phase protein array (RRPA). Finally, immunohistochemistrywas used to evaluate the expression pattern of signaling effectors in the tumors.

Results. We showed that Her2, Her3, PDGFRß, Axl, and Tie2 are frequently activated in the tumors. Furthermore, RRPA demonstratedthat Ki67 levels are linked to YAP, p-Her3, and PDGFRß expression levels. In addition, Her2, Her3, and PDGFRß are transcriptional targetsof Yes-associated protein (YAP) in schwannoma cells in culture. Finally, we observed that the expression of these signaling effectors isvery variable between tumors.

Conclusions. Tumor cell proliferation in human schwannomas is linked to a signaling network controlled by the Hippo effector YAP.Her2, Her3, PDGFRß, Axl, and Tie2, as well as YAP, represent potentially valuable therapeutic targets. However, the variability oftheir expression between tumors may result in strong differences in the response to targeted therapy.

Keywords: Neurofibromatosis type 2, proteomic, schwannoma, signaling, YAP.

Biallelic inactivation of the NF2 tumor suppressor gene leads tothe development of intracranial tumors such as schwannomas,meningiomas, and ependymomas. These lesions can be sporadicor develop in the context of an inherited familial disease calledneurofibromatosis type 2. Patients who are born heterozygousfor NF2 are predisposed to the development of multiple tumorsupon subsequent loss of the second allele.1

To this day, surgery and radiotherapy remain the most frequentoptions for treatment. The use of chemotherapy has long been hin-dered by the lack of clearly identified therapeutic targets. Since the

discovery of the NF2 gene in 1993,2 a major effort has been madeto understand how merlin, the NF2 gene product, regulates cellproliferation and tumor growth. Several proteins playing key rolesin these processes have emerged as candidate therapeutic targets.The inactivation of NF2 was shown to trigger the activation of Rasand Rac and the stimulation of downstream mitogenic p42/44MAPK and PAK1/2 pathways.3,4 It has also been demonstratedthat loss of merlin expression induces the activity and surface ex-pression of various receptor tyrosine kinases (RTKs). In the lattercase, it is due to an increase of their transport to the plasma

Received 29 January 2014; accepted 29 January 2014# The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Neuro-Oncology. All rights reserved.For permissions, please e-mail: [email protected].

Neuro-OncologyNeuro-Oncology 2014; 0, 1–14, doi:10.1093/neuonc/nou020

1 of 14

Neuro-Oncology Advance Access published February 20, 2014 by guest on February 21, 2014

http://neuro-oncology.oxfordjournals.org/D

ownloaded from

http://neuro-oncology.oxfordjournals.org/


membrane,5 – 7 leading to stimulation of promitogenic signalingpathways. Recently, a new function for merlin in the nucleus wasdiscovered.8 In this compartment, the binding of merlin to D-Caf1abolishes its ubiquitin ligase activity and leads to the inhibition ofproliferation. Finally, the regulation of the Hippo signaling pathwayby merlin has emerged in recent years as a major mechanism con-trolling cell proliferation and survival in various organisms and tis-sues.9,10 Indeed, in several models, loss of merlin expression leadsto nuclear accumulation of Yes-associated protein (YAP), which isthe major effector of the Hippo pathway.11,12 There, it stimulatestranscription of a wide set of promitogenic and anti-apoptotic tar-get genes.13 Hence, the growth advantage conferred by the loss ofNF2 appears to be the consequence of an accumulation of distinctsignaling dysfunctions.

The relevance of these mechanisms of growth control by mer-lin has also been tested on tumor cell cultures derived fromhuman biopsies. Receptors such as IGF1R, Axl, or PDGFRß and sig-naling pathways such as MAPK, Rac/PAK, JNK, or b-catenin wereshown to be activated in response to merlin loss of expression.14–16

However, the tumor cell cultures always represent a simplifiedmodel of their tumor of origin. In this context, evaluation of theexpression and activity of signaling pathways in surgical biopsiesrepresents a necessary complement to the previous approaches.Immunohistological evaluation of the expression and activity ofsignaling proteins in tumor sections has provided important infor-mation on the biology of NF2-related tumors.17 – 19 Nevertheless,new proteomic approaches such as reverse phase protein arrays(RPPA) allow more precise means for quantifying signaling proteinexpression and activity on large sets of biological samples.20

Therefore, combining different types of proteomic analysis forthe study of tumors constitutes a powerful approach for identify-ing the signaling events that promote their growth.

Using a set of more than 40 human schwannomas, we haveanalyzed the status of several major signaling pathways thatwere previously shown to be regulated by merlin. First, using re-ceptor tyrosine kinase (RTK) arrays and Western blotting, wehave identified which RTKs are the most frequently activated inschwannomas and could therefore represent a potential thera-peutic target. Then, RPPA was used on our tumor set to measurethe expression and activity of 35 proteins comprising the majormitogenic signaling pathways. Our results showed that expressionlevels of YAP and several of its target genes, notably several recep-tors identified through RTK arrays, are linked to proliferation. How-ever, immunohistochemical analysis revealed a strong variabilityof protein expression from tumor to tumor, suggesting that the re-sponse to targeted chemotherapy would likely be highly variable.Altogether, our work identifies a signaling network associated withYAP protein and linked to schwannoma cell proliferation that couldrepresent a set of valuable therapeutic targets.

Statement of translational relevance

Patients affected by the familial syndrome Neurofibromatosistype 2 develop multiple tumors when the NF2 suppressor geneis inactivated. Schwannomas are the most frequent ones andthe number of chemotherapeutic options is yet very limited.Hence, the identification of potential therapeutic targets is amajor objective of the research effort on this tumor type. In thisstudy, we have combined several proteomic approaches to inves-tigate the expression and activity of mitogenic signaling

pathways regulated by NF2. Our work shows that proliferationof tumor cells is correlated to the activation of a signaling net-work linked to the Hippo effector Yap and several of its targetgenes. Hence, our study provides evidences that Yap as well asits target genes PDGFRß, Her3, Her2 and Axl represent potentiallynew therapeutic targets for the treatment of schwannomas.

Material and Methods

Tumors and Patients

Sixty-eight patients (33 women and 35 men) who underwent sur-gery for a schwannoma in Beaujon Hospital (Clichy, France) wereretrospectively studied (Supplementary Table 2). Fourteenpatients had a NF2 disease, while the other patients had devel-oped sporadic tumors. For all patients, the diagnosis was estab-lished with routine formalin-fixed, paraffin-embedded material(hematoxylin and eosin sections). Frozen material was availablefor 33 tumors and stored at 2808C. The study was conductedafter approval by the Comite Consultatif des Personnes Participanta une Recherche, and samples were obtained from participantswho provided informed consent.

Immunoblotting

All extracts from HEI193 cells or human schwannomas were pre-pared with a RPPA extraction buffer (see Reverse Phase ProteinArrays section). Using a dounce homogenizer, tumor biopsieswere lysed until complete solubilization. Following clarificationof the extracts by centrifugation (20 000 g for 10 min at 48C), pro-tein concentration was measured by Bradford assay (Biorad). ForWestern blotting, proteins were separated by SDS-PAGE andtransferred to nitrocellulose. Membranes were incubated with pri-mary antibodies overnight at 48C in phosphate-buffered saline,Tween 0.1%, and fetal bovine serum 10%. Antibodies directedagainst phospho-Akt473, phospho-MAPK202/204, phospho-GSK3ß9,Axl, PDGFRß, EGFR, YAP, and Stat3 are described in the Immuno-histochemistry section. We also used antibodies to mtor (2972;Cell Signaling Technology CST; Ozyme), phospho-mtor2481

(2971; CST), JNK (9252; CST), phospho-JNK183/185 (9251; CST),AKT1 (9272; CST), MAPK (9102; CST), GSK3ß (9332; CST), p38SAPK180/182 (9212; CST), phospho-STAT3705 (9131; CST), IGF1R(3027; CST), c-Met (3127; CST), Her2 (2165; CST), MST1 (3681;CST), phospho-MST1/2183/180 (3681; CST), Lats1 (3477; CST),phospho-Lats1909 (9157; CST), phospho-YAP127 (4911; CST),phospho-Taz89 (sc-17610; Santa Cruz/Tebu-Bio), Tie2 (C-20;Santa Cruz), Her3 (C-17; Santa Cruz), MST2 (pab0892-P; Covalab),Lats2 (pab0891-P; Covalab), Taz (pab0893-P; Covalab), survivin(614701; Biolegend), and Actin (A3853; Sigma Aldrich).

Immunofluorescence

HEI193 cells were infected with a lentivirus expressing GFP-YAP(Genecopoeia EX-Z0483-Lv122; Tebu-Bio) and selected with5 mg/mL of puromycine. Cells were fixed on glass coverslips for20 minutes in 4% paraformaldehyde. Coverslips were mountedon a glass slide with Citifluor mounting media containing4’,6-diamidino-2-phenylindole (Citifluor Ldt). Pictures wereacquired using a Leica DM 6000B epifluorescence microscopeand a 63X oil immersion objective.

Boin et al.: Proteomic study of signaling events in human schwannomas

2 of 14 Neuro-Oncology

by guest on February 21, 2014http://neuro-oncology.oxfordjournals.org/

Dow

nloaded from

http://neuro-oncology.oxfordjournals.org/lookup/suppl/doi:10.1093/neuonc/nou020/-/DC1



Luciferase Activity Assay

HEI GFP-YAP cells were seeded in a 25 mm dish and transfected24 hours later under the following conditions: 1 mg of8_GTIIC-Luc vector (kind gift from S. Piccolo laboratory) orp∂51-Luc, 0.5 mg of pRL-TK vector (Promega) was added to100 mL NaCl 150 mM and 4 mL of Lipofectamine 2000 (Life Tech-nologies). Luciferase activity was quantified 48 hours later usingthe Dual-Luciferase Reporter Assay System (Promega) accordingto the manufacturer’s recommendations. Experiments were per-formed in triplicate.

Immunohistochemistry

Tissue microarrays (TMAs) were constructed from representativeblocks from 14 NF2 partients and 31 sporadic patients. The con-struction of these TMAs was performed using a tissue arrayer(Beecher). In order to obtain a representative sampling of thetumors, each specimen was represented by three 1 mm cores,taken randomly in the tissue microarray block. In total, 2 blocksof TMA were constructed (including 45 tumors).

Sections of TMA blocks (3 mm) were immunolabeled(streptavidin-peroxidase protocol; immunostainer BenchMarkVentana) with antibodies to: ErbB2 (Ab-17; LabVision), ErbB3(SGP1; LabVision) EGFR (2232; CST), PDGFR-ß (3162; CST),phospho-MAPK202/204 (9101; CST), Stat3 (9132; CST), phospho-Akt473 (D9E; 4060; CST), phospho-GSK3ß9 (9331; CST), YAP(H-125; Santa Cruz/Tebu-Bio), Axl (C-20; Santa Cruz), andß-catenin (clone 14; 610153; BD Biosciences). All antibodies arereactive in paraffin-embedded sections. Immunostaining of par-affin sections was done after dewaxing and rehydrating slides.Antigen retrieval was conducted by pretreatment at 958C.Endogenous peroxidase was blocked with 0.5% hydrogen perox-ide in water for 30 minutes. Substitution of the primary antibodywith phosphate-buffered saline was used as a negative control.

For staining evaluation, 3 sections of each tumor were evalu-ated independently by 2 investigators (AC and DL). The percent-age of positive cells was evaluated for each protein. The patternof expression (cytoplasmic, membranous, and nuclear) wasnoted. All cores were evaluated separately; the mean score calcu-lated was used to represent the whole immunoreactivity intumors. Tumors were considered negative for a marker if nostained cells were detected in the 3 sections.

Receptor Tyrosine Kinase Arrays

Tumors were extracted in the provided extraction buffer using adounce homogenizer. Following clarification of the extracts bycentrifugation (20 000 g for 10 min at 48C), protein concentrationwas measured by Bradford assay (Biorad). Proteome Profiler RTKArrays (R&D) were incubated O/N with 1 mg of tumor extract anddeveloped following the guidelines from the manufacturer.

Reverse Phase Protein Arrays

Sample Preparation

Tissue samples were disrupted in Laemmli buffer (50 mM Tris[pH¼ 6.8], 2% SDS, 5% glycerol, 2 mM DTT, 2.5 mM EDTA,2.5 mM EGTA, 1x HALT phosphatase inhibitor (78420; Perbio), pro-tease inhibitor cocktail complete MINI EDTA-free (1836170;

Roche; 1 tablet/10 mL), 2 mM Na3VO4, and 10 mM NaF) using aTissueLyser (Qiagen), and two 5 mm stainless beads per sample.Extracts were then boiled for 10 minutes at 1008C, passedthrough a fine needle to reduce viscosity and centrifuged for10 minutes at 15 000 rpm. The supernatant was harvested andstored at 2808C. Protein concentration was determined (ref23252; Pierce BCA reducing agent compatible kit). Sampleswere deposited onto nitrocellulose-covered slides (Schott Nexter-ion NC-C) using a dedicated arrayer (2470 Arrayer; Aushon Biosys-tems). Four serial dilutions, ranging from 500 to 62.5 mg/mL, and3 technical replicates per dilution were deposited for each sam-ple. Arrays were revealed with specific antibodies (see Supple-mentary Table 3 for a complete list of antibodies references) orwithout primary antibody (negative control), using AutostainerPlus (Dako). Briefly, slides were incubated with avidin, biotin,and peroxidase-blocking reagents (Dako) before saturation withTBS (Tris-buffered saline) containing 0.1% Tween-20 and 5% bo-vine serum albumin (BSA) (TBST-BSA). Slides were then probedovernight at 48C with primary antibodies diluted in TBST-BSA.After washes with TBST, arrays were probed with horseradishperoxidase-coupled secondary antibodies (Jackson ImmunoRe-search Laboratories) diluted in TBST-BSA for 1 hour at room tem-perature (RT). To amplify the signal, slides were incubated withBio-Rad Amplification Reagent for 15 minutes at RT. The arrayswere washed with TBST, probed with Alexa647-Streptavidin (Mo-lecular Probes) diluted in TBST-BSA for 1 hour at RT, and washedagain in TBST. For staining of total protein, arrays were incubated15 minutes in 7% acetic acid and 10% methanol, rinsed twice inwater, incubated 10 minutes in Sypro Ruby (Invitrogen), andrinsed again. The processed slides were dried by centrifugationand scanned using a GenePix 4000B microarray scanner (Molecu-lar Devices). Spot intensity was determined with MicroVigenesoftware (VigeneTech Inc).

Data Processing

Intensities are measured on a serial dilution for each sample inorder to evaluate the dynamic range of detection for each anti-body. Data were quantified by computing a relative protein ex-pression level for each sample, followed by a normalization stepthat corrected for nonbiological bias using negative control slidesand Syro Ruby slides. Quantification and normalization were sim-ultaneously performed by NormaCurve.49 An additional normal-ization step removed variability due to array effect and wasperformed by median loading. All primary antibodies used inRPPA had been previously tested by Western blotting to assesstheir specificity for the protein of interest.

RNA Extraction and Quantitative Real Time PolymeraseChain Reaction

Total RNA from HEI193 control and stably expressing GFP-YAPwere extracted using RNeasy Mini kit (Qiagen) according themanufacturer’s instructions. One microgram of extracted RNAwas reverse transcribed with random primers following themanufacturer’s protocol (Invitrogen; SuperScript III). For the Q-RT-PCR, 10 ng of cDNA was added in a reaction mix containing0.5 mM of each primer in the LightCycler SybR green master mix(Roche) with RNase-free water adjusted to a total volume of25 ml. The PCR program included a denaturation step at 958C


Neuro-Oncology 3 of 14


Dow

nloaded from





for 5 minutes followed by 45 cycles of 958C for 10 seconds, 608Cfor 15 seconds, and 728C for 5 seconds. All reactions were per-formed in sextuplicate in 96-well plates. The quantification wasdone using the DDCt method by comparing the expression ofthe target genes in GFP-YAP cells versus normal cells relative tothe endogenous reference, the 18S ribosomal RNA (Eukaryotic18S rRNA Endogenous Control; Applied Biosystems/Invitrogen).The following primer pairs were designed, validated, and used:survivin: (F) CAGTGTTTCTTCTGCTTCAAGG and (R) CTTATTGTTGGTTTCCTTTGCAT; erbb2: (F) CTTTGCTGTCCTGTTCACCA and (R)TCATCATCTTCACATTGAGTAGGC; erbb3: (F) CTGATCACCGGCCTCAATand (R) GGAAGACATTGAGCTTCTCTGG; PDGFR: (F) CATCTGCAAAACCACCATTG and (R) GAGACGTTGATGGATGACACC.

Statistical Analysis

For tissue microarrays and RPPA results analysis, the Spearman’rank correlation coefficient was used to assess the independentsignificance of the various markers. The critical level of statisticalsignificance was set at a P value of ,.05.

Results

A Limited Set of Receptor Tyrosine Kinases Are FrequentlyActivated in Human Schwannomas

From Drosophila eye to mammalian Schwann cells, merlinappears to be a major regulator of RTK homeostasis. In these tis-sues, loss of merlin expression leads to increased RTK-mediatedsignaling, either due to accumulation of RTKs at the plasmamembrane or loss of proper downregulation of receptor activ-ity.6,7 The misregulation of RTK activity is believed to be an import-ant step in schwannoma development and growth. Hence,deciphering the landscape of activated RTKs in this type oftumor should help to identify possible therapeutic targets forwhich inhibitors already exist. We used RTK array technology ona set of 29 human sporadic schwannomas to generate the activ-ity profile of 42 different RTKs (out of an estimated total of about60 RTKs). We considered as activated, receptors that gave a signalthat was above the signal of any of the negative controls. Threereceptors were found activated in more than 50% of the tumorsHer3 (86%), Axl (55%), and Ron (86%). Four more receptors werefound activated in 25%–50% of the samples: EGFR (48%), Her2(31%), ROR2 (45%), and Tie2 (34%). Activated PDGFRß, Her4,and VEGFR3 were detected in 21%, 21%, and 17%, respectively.Finally, five receptors were found at least once in our tumor set:Tyro3 (3%), FGFR2a (7%), c-Ret (7%), EphB2 (3%), and MuSK (3%)(Fig. 1A and B and Supplementary Table 1). To confirm expressionof the detected active receptors, we performed Western blots onextracts from a subset of the schwannomas used for RTK arrays.The expression of EGFR, Her2, Her3, PDGFRß, Tie2, and Axl wereconfirmed (Fig. 1C). Interestingly, the expression levels variedwidely from one tumor to another. We could not confirm the ex-pression of Ron and ROR2 using 2 different antibodies to each re-ceptor, although these antibodies were able to detect theproteins overexpressed in cell culture (not shown). We also exam-ined the expression of several other RTKs that were not found tobe activated by RTK arrays. IGFR1 was expressed in schwannoma,and we could detect low levels of c-Met (Supplementary Fig. 1A).This result may be due to the lack of sensitivity of arrays for these

receptors or to their weak activation in the tumors. Nevertheless,this suggests that additional RTKs may be active in the tumorsbut not detected with RTK array. Because Western blot and RTKarrays are performed using extracts from tumors that may con-tain a fraction of nontumor tissue that also expresses RTKs, theyare susceptible to generating false-positive signals. For example,PDGFRß signal could come from endothelial cells of blood vesselsand not from tumor cells per se. We used immunohistochemistry(IHC) to evaluate the tissue expression pattern of the most fre-quently activated RTKs on a tissue microarray regrouping of 40schwannoma biopsies (partially overlapping with the set usedfor RTK arrays and Western blots; see Supplementary Table 2).Her2, Her3, PDGFRß, and Axl were detected in tumor cells, al-though at variable levels (Fig. 2). Surprisingly, EGFR was notfound in any of the samples, although it was easily seen in a con-trol placental tissue (Fig. 2). This result suggests that EGFR signalobtained by Western blot and RTK arrays may have come fromcontaminating tissues. In conclusion, our analysis demonstratesthat Her2, Her3, Axl, Tie2, and PDGFRß, but not EGFR, are fre-quently activated in the tumors, therefore defining the profile ofRTKs that could be targeted for the treatment of schwannomas.

Expression and Activity of Major Mitogenic SignalingPathways Are Heterogeneous in Human Schwannomas

Loss of NF2 leads to activation of several major mitogenic signal-ing pathways.4,9,21 – 23 We used Western blotting to evaluate theexpression of P42/44 MAPK, P38 SAPK, P46/55 JNK, mTor, Akt,STAT3, GSK3ß, and YAP in our human schwannoma biopsies(Fig. 3A). All tumors tested were positive for the various proteins.All of them also expressed several other components of the Hipposignaling pathway such as the cotranscription factor Taz and thekinases MST1/2 (Supplementary Fig. 1B). In contrast, Lats1/2 ex-pression was rarely observed in schwannomas (SupplementaryFig. 1B). Specific expression in the tumor cells was assessed byIHC on schwannoma sections. All proteins were found to beexpressed in more than 90% of the tumors. Phosphorylatedforms of P42/44, P38, Akt, m-Tor, and Stat3 were also observedin most tumors by Western blot (Fig. 3A) or by IHC (Fig. 3B). Acti-vated YAP was found in the nucleus of schwannoma cells in alltumors (Fig. 3B). However, despite being detected in 98% of thetumors, ß-catenin was only found in the cytoplasm, suggestingthat the canonical Wnt pathway is not activated in schwannomas(Fig. 3B and Supplementary Fig. 2A). This was in clear contrast tothe nuclear signal that we observed in a pancreatic tumor thatwas used as a positive control (Supplementary Fig. 2B). Remark-ably, although most tumors expressed signaling proteins andtheir phosphorylated forms, we noticed great variability in thepercentage of positive cells in each tumor (Fig. 4A). As presentedin Fig. 4B, this percentage can fluctuate from less to 25% to morethan 75% depending on the receptor tested. For example, Her3was expressed in more than 75% of the cells in 42.5% of thetumors. Axl presented a more homogeneous distribution with79% of the tumors presenting positive staining in more than75% of the cells. In contrast, only 14% of tumors showed morethan 75% of positive labeling for PDGFRß. We also observed thatnearly two-thirds of the tumors (69%) expressed Her2 in morethan 50% of the cells; however, the active phosphorylated formof Her2 was detected in more than 50% of cells in only 34% of thetumors (not shown). This result confirmed the differences we




Dow

nloaded from











Fig. 1. Only a limited set of receptor tyrosine kinases (RTKs) are frequently activated in human schwannomas. (A) Four examples of RTK arraysmembrane incubated with extracts from human vestibular schwannomas. RTKs were considered activated when the signal was more intense thanthe control immunoglobulin spots. Strong signals at each corner correspond to a phosphotyrosine positive control. (B) Quantification of thepercentage of tumors expressing specific activated RTKs. Fifteen out of 42 RTKs were detected in their activated form. The active RTKs that werenot detected are also indicated. (C) Expression of EGFR, Her2, Her3, Axl, PDGFRß, and Tie2 were confirmed by Western blot in a series of 12 humanschwannoma extracts. Extracts from HEI193 human schwannoma cell line (SC) were used for comparison. Actin was used as a loading control.




Dow

nloaded from



observed between Western blot and RTK arrays results for the ex-pression of total and activated receptors. They suggest that theamount of receptor expressed will not necessarily reflect its activ-ity in the tumor. Finally, for all the proteins tested by IHC, wecouldn’t find any significant differences in the expression patternsbetween sporadic and familial schwannomas.

Most tumors expressed phospho-P42/44 MAPK202/204, nuclearStat3, and nuclear YAP in ,50% of cells. Only phospho-AKT473

was detected in more than 50% of cells in a large majority ofthe tumors. Altogether, a surprisingly large fraction of tumorsexpressed detectable levels of signaling effectors in ,50% ofthe tumor cells (Fig. 4C). This heterogeneity was observed bothin Antoni A and B areas as shown for YAP staining in Supplemen-tary Fig. 2C. We next determined if the percentage of positive cellsfor the various markers was linked or if it fluctuated independent-ly. Using the Spearman correlation test, we found no significantcorrelation between the percentages of cells expressing nuclearYAP protein (Table 1) with any other marker tested. However,we showed that the percentage of cells expressing Her3, Her2,and PDGFRß were correlated (Table 1). We also observed that

phospho-P42/44 MAPK202/204 and cytoplasmic phospho-Akt473

were linked to activated (nuclear) STAT3. In both cases, these cor-relations suggest that the expression of growth factor receptorsand the activation of signaling pathways might be coregulatedin the tumors. Indeed, in the case of nuclear phospho-P42/44MAPK202/204 and STAT3, double labeling on the same sectionsshowed coexpression at the cellular level (see SupplementaryFig. 2D).

In conclusion, we observed that the expression levels for mostof the signaling effectors we tested are very heterogeneous inschwannomas. Hence, signaling effectors in which expressionlevels or activity are correlated to clinical parameters such astumor cell proliferation would likely represent the most relevanttargets for therapy.

Proliferation of Tumor Cells Is Correlated with a SignalingNetwork Linked to YAP

RPPA is a powerful technique that allows precise quantification ofthe expression levels and the activity (using phospho-specificantibodies) of proteins in tumor extracts.20 As an approach toidentifying pathways that could be linked to the proliferation oftumor cells, we applied this technique to study our schwannomasamples. We used a set of 35 antibodies (Supplementary Table 3)to identify correlations between the expression of RTKs, effectorsof major signaling pathways, their phosphorylated forms, and thelevels of Ki67 (a key indicator of tumor cell proliferation). The ana-lysis was performed on 30 human sporadic schwannomas. Weshowed that the expression of Ki67 correlated with the level ofonly 5 markers (Fig. 5A). Hence, Ki67 correlated positively withphospho-Her31289, PDGFRß, phospho-PDGFRß1021, and YAP andnegatively to phospho-Stat3. In addition, the analysis indicatedthat YAP levels are correlated with PDGFRß and phospho-PDGFRß1021. Interestingly, phospho-Her31289 expression wasalso linked to phospho-P38180/182, phospho-Her2877, andphospho-Met1234/1235. YAP activity is notably inhibited by phos-phorylation on serine 127 upon activation of the Hippo signalingpathway, which prevents its nuclear localization. However, Ki67was not linked to phosphorylated YAP127 (P¼ .7) but to the ex-pression level of YAP. Using IHC, we observed that the majorityof tumors with strong cytoplasmic YAP staining also displayedelevated levels of nuclear YAP. Similarly, low cytoplasmic YAPstaining was usually associated with low levels of nuclear YAP(Fig. 5B). When we used the Spearman correlation test on cyto-plasmic and nuclear YAP intensity, we observed a significant cor-relation between them (P¼ .00009, r¼ 0.38). These resultsindicate that the activity of YAP in tumors, which is mediated bythe nuclear pool, is primarily controlled by its expression level inthe cells.

PDGFRß ligand PDGF, Axl and its ligand Gas6, and Her2 weredescribed as transcriptional targets of YAP in different celltypes.24 – 26 In order to test the role of YAP in the activation ofreceptors and signaling pathways linked to the Ki67 in schwanno-mas, we overexpressed GFP-YAP in the human schwannoma cellline HEI19327 (Fig. 6A). By Western blot, we found that YAP stimu-lated PDGFRß and Her2 expression. However, Axl levels remainedessentially unaffected. More surprisingly, Her3 levels were strong-ly increased in GFP-YAP expressing cells, although this receptorwas never listed as a transcriptional target of YAP (Fig. 6B).Using quantitative PCR, we showed that YAP overexpression

Fig. 2. Immunohistochemical evaluation of receptor tyrosine kinaseexpression in human schwannomas. The expression of Her2, Her3, Axl,PDGFRß, and EGFR was evaluated by immunohistochemistry onschwannoma sections. The percentage of positive tumors is indicatedon the right. No EGFR was detected in schwannomas, although theantibody gave a clear signal in the control placenta section (insert).




Dow

nloaded from








stimulated the transcription of PDGFRß and Her2. Survivin, whichis a well-characterized transcriptional target of YAP, was used as acontrol and showed a robust response to GFP-YAP (Fig. 6C). Onceagain, Axl showed no induction upon YAP overexpression. Veryinterestingly, Her3 transcription was the most strongly stimulatedby YAP. Furthermore, when HEI cells expressing GFP-YAP weretreated with verteporfin, (a drug that blocks YAP transcriptionalactivity by dissociating it from the Tead DNA-binding proteins),we observed a decrease of PDGFRß and Her3 by Western blotand quantitative PCR (6D and 6E). Hence, it appears that the ex-pression of PDGFRß, Her3, and Her2 is under the control of YAP in

schwannomas, the first two depending on YAP/Tead interaction.Altogether, our results suggest that the proliferation of tumorcells in human schwannomas is under the control of a limited sig-naling network linked to YAP.

DiscussionIn the present study, we have combined Western blotting, IHC,RTK arrays, and RPPA to identify signaling modules that are linked

Fig. 3. Major mitogenic signaling pathways are active in human schwannomas. (A) The expression and phosphorylation of major signaling pathwaysknown to be regulated by merlin were evaluated by Western blot in a series of 12 human schwannomas. HEI193 extracts were used for comparison.Actin was used as a loading control. (B) Immunohistochemistry was used to evaluate the expression of phosphorylated Akt473, GSK3ß9, and MAPK202/204

as well as YAP, STAT3, and ß-catenin in human schwannoma sections. The enlarged insert for ß-catenin clearly shows negative nuclear staining. Thepercentage of tumor with a positive detection of the markers is indicated.




Dow

nloaded from



to tumor cell proliferation in human schwannomas and could re-present potential therapeutic targets.

Our screening of activated RTK is the first to provide a preciselandscape of RTK activation in a large series of human schwanno-mas. We showed that only 6 RTKs (out of 42 studied) are found tobe activated in more than 20% of the tumors (Her2, Her3 andHer4, Axl, PDGFRß, and Tie2). It has been known for a long time

that ErbB receptors are important for Schwann cell biology. Thisfamily of receptors was also shown to be expressed in schwanno-mas and to support schwannoma cell proliferation in culture.28,29

In addition, Neuregulin1, the ligand of Her3, was shown to beexpressed in human schwannomas and to promote tumor cellproliferation via an autocrine loop.18,30 Remarkably, Her3 is phos-phorylated in a large majority of the tumors. Her3 does not

Fig. 4 Schwannomas are very heterogeneous for the percentage of cells expressing signaling effectors. (A) The heterogeneity of the expression of Her2,Her3, PDGFRß, phospho-MAPK202/204, STAT3, and YAP was evaluated by immunohistochemistry. The top panel provides an example of a low percentageof positive cells, whereas the lower panel represents tumors with a high percentage of labeled cells. (B) The graph represents the percentage of tumorsthat express Her2, Her3, PDGFRß, or Axl in ,25%, between 25% and 50%, between 50% and 75%, and in more than 75% of cells. (C) The sameexperiment was performed for the activated forms of MAPK, Akt, STAT3, and YAP. The phosphorylated forms of MAPK and Akt were independentlyevaluated in the cytoplasm and in the nucleus.




Dow

nloaded from



possess intrinsic tyrosine kinase activity and cannot homodimer-ize.31 It is phosphorylated on tyrosines primarily through dimer-ization with other ErbB family members. Therefore, its frequentphosphorylation may reflect dimerization with other activatedHer members. This hypothesis is supported by RPPA data indicat-ing that the levels of phosphorylated Her31289 and phosphory-lated Her2877 are correlated. Nevertheless, most of the tumorstested showed an activation of Her3 in the absence of activatedHer2 or Her4, as assessed by RTK arrays (Supplementary Table 1).It is possible that Her3 dimerized with other receptors in thetumors. It has been shown that Her3 can associate withc-Met.32 We could detect c-Met by Western blot in only a subsetof tumors (see Supplementary Fig. 1). RPPA analysis showed apositive correlation between phospho-Her31289 and phospho-Met1234/1235. However, the activated receptor was not detectedby RTK array, suggesting that it might be expressed at low levelsand only be weakly activated in schwannomas. c-Met expressionhas been reported in schwannomas in several studies,33,34 and itsexpression even at a low level could have a significant role inschwannoma development. EGFR is another candidate for dimer-ization with Her3. The question of EGFR expression in schwanno-mas has been the object of conflicting reports.28,35 Our IHC clearlydemonstrated that schwannomas do not express detectablelevels of EGFR. This absence of EGF receptor expression likelyexplains the failure to inhibit schwannoma growth of patientstreated with the EGFR inhibitor Erlotinib.36 Hence, our results con-firm that this receptor is unlikely to be an efficient therapeutic tar-get in human schwannomas. In the case of Her2, our results mayhelp to explain the outcome of a recent clinical trial using lapati-nib,37 an inhibitor of both EGFR and Her2. The impact of this treat-ment on schwannoma growth is likely to result from the soleinhibition of Her2, given the absence of EGFR expression that weobserved. Upon lapatinib administration, 23.5% of the patientsshowed significant tumor reduction.37 This number is close tothe percentage of tumors in which we detected an activatedform of Her2 by RTK arrays. It is also similar to the percentage

of tumors that express Her2 in more than 75% of cells. Whetherthe clinical response to lapatinib is linked to these parametersremains speculative at this point but deserves further investiga-tion. In conclusion, our results point to Her3 as a promising thera-peutic target for the treatment of schwannomas. Furthermore,dual Her2/Her3 inhibitors may show a greater efficacy for a subsetof patients.

The inhibition of angiogenesis remains the unique che-motherapeutic strategy for treating schwannomas to this day.Targeting VEGF has demonstrated some efficacy, although re-sponse to treatment is not seen for all patients.38 Very interest-ingly, our analysis of RTK expression shows that, in addition toVEGFR, 3 other receptors involved in angiogenesis regulationare frequently expressed in schwannomas (ie, Axl, Tie2 andPDGFRß). Axl is a member of the TAM (tyro3-Axl-Mer) family ofreceptors. It is involved in many biological processes such as sur-vival, proliferation or migration, and its expression is altered inmany different types of cancers.39 In Schwann cells, stimulationby its ligand, Gas6, promotes proliferation and survival through aFAK/Src/NFkappaB pathway.17,40 Axl was also shown to promoteangiogenesis. One mechanism proposed is that Axl stimulatesthe expression of angiopoıetin-2 (Ang2), which is a ligand ofTie2 receptor.41 Tie2 has 2 ligands: Ang1 and Ang2. Ang1 stimu-lates Tie2 and leads to blood vessel stabilization, whereas Ang2acts antagonistically and promotes vessel sprouting. Ang1 andAng2 display both antitumorigenic and protumorigenic effects.Nevertheless, concomitant inhibition of Ang2 or Tie2 and VEGFefficiently induces apoptosis of endothelial cells and appearsto be a promising strategy for the inhibition of angiogenesis. In-deed, several clinical trials based on this principle are currently inprogress.42

Studies performed on cultured cells have increased the under-standing of how merlin controls proliferation at the molecularlevel. Defining which signaling pathways are correlated with pro-liferation in tumors represents an important step for identifyingpotential therapeutic targets. Therefore, we decided to use

Table 1. Correlation between the percentages of positive cells in human schwannomas

Her2Her3 0.036–0.33PDGFRß 0.006–0.42Axlp-MAPK

cyto.p-MAPKnucl. 2.84E-27–0.98STAT3 nucl. 0.044–0.32 0.033– 0.35 0.017–0.38 0.023–0.36YAP nucl.p-AKT473

cyto.0.05–0.33 0.002–0.49

P-AKT473nucl.

0.038–0.35

Her2 Her3 PDGFRß Axl p-MAPK cyto. p-MAPKnucl.

STAT3 nucl. YAPnucl.

p-AKT473cyto.

p-AKT473nucl.

Immunohistochemistry was used to evaluate the percentage of positive cells in each schwannoma for the indicated signaling effectors. The P valueand correlation coefficients are indicated when they are significant (P ,.05). The results suggest that several receptors and signaling pathways arecoregulated in the tumors.




Dow

nloaded from





RPPA to evaluate protein expression in tumor biopsies. RPPA hasbeen used to study signaling in various types of cancers,43 butthis is the first time this strategy has been applied to the studyof human schwannomas. We observed that a small set of signal-ing effectors correlates positively with the proliferation markerKi67 levels. These include YAP, phospho-Stat3705, PDGFRß,phospho-PDGFß1021, and phospho-Her31289. The inverse correl-ation of phospho-Stat3705 to Ki67 levels is unexpected, giventhat activation of Stat3 appears essentially pro-proliferative and

anti-apoptotic in cancer cells and schwannoma cells in cul-ture.21,44 However, several reports showing that the activationof Stat3 is linked to a better prognosis in various cancers,45 indi-cate that its role in tumorigenesis depends on the tumor type. YAPis the main effector of the Hippo signaling pathway. Upon loss ofNF2, YAP is dephosphorylated, allowing its entry into the nucleuswhere it activates the transcription of pro-proliferative and anti-apoptotic targets. Remarkably, Ki67 correlates with the amountof YAP but not with the level of phospho-YAPS127. It is possible

Fig. 5. Reverse phase protein array analysis of human schwannomas reveals signaling network correlated with proliferation marker ki67. (A) Theexpression of YAP, PDGFRß, phospho-PDGFRß1021, phospho-Her31289, and Phospho-STAT3705 are correlated with the expression of Ki67 in humanschwannoma samples. The P value and correlation coefficient are indicated for each correlation. For these 5 markers, the other significantcorrelations are indicated. (B) YAP intensity in the nucleus and the cytoplasm were scored by immunohistochemistry. High nuclear staining wasprimarily associated with high cytoplasmic staining and vice versa. The percentage of tumors represented in each case is provided. A Spearmancorrelation test indicates that the intensities in the nucleus and the cytoplasm are linked (P¼ .0009), suggesting that the activity of YAP is afunction of its expression level.




Dow

nloaded from



that variations of YAP levels in the tumors are from transcriptionalorigin. However, changes in YAP levels could also be due to modu-lation of its degradation. Indeed, CK1 and LKB1, as well as Lats,have been shown to play a major role in YAP degradation.46,47

A remarkable aspect of the present study is the fact that 3 ofthe most frequently activated RTKs in our tumor samples are

potential targets of YAP. First, a recent work showed that PDGFis transcriptionally upregulated by YAP.24 A second study identi-fied PDGFRß promoter sequences by ChIP-onChIP, using anti-bodies to YAP and TEAD suggesting that PDGFRß is atranscriptional target of YAP.26 We previously observed that thePDGFRß receptor is transcriptionally upregulated in Schwann

Fig. 6. The most frequently activated receptor tyrosine kinases in schwannomas are transcriptional targets of YAP. (A) A HEI193 human schwannomacell line was created that stably overexpresses GFP-YAP contructs. The fusion protein accumulates in the nucleus (left). Western blot confirms theoverexpression of GFP-YAP in the cells. (B) Western blot shows that the expression of Her2, Her3, PDGFRß, and survivin is markedly induced uponGFP-YAP expression. Axl levels appear essentially unaffected. (C) Quantitative Real Time-PCR confirms that the induction of Her2, Her3, and PDGFRßby GFP-YAP is of transcriptional orgin. Survivin, a known target gene of YAP, was used as a positive control. On the contrary, Axl is not induced byYAP. The average induction folds are indicated. The graph is representative of 6 experiments. (D) HEI193 cells overexpressing GFP-YAP treated withthe YAP/Tead dissociating compound verteporfin show a strong decrease in Tead-mediated transcriptional activity measured by luciferase reporterassay. (E) The protein levels of Her3, PDGFRß, and survivin decrease in response to treatment with verteporfin. (F) Similarly, quantitative RealTime-PCR indicates that verteporfin treatment of HEI193 GFP-YAP cells reduces mRNA levels of survivin, Her3, and PDGFRß. Her2 expression isunaffected. (*¼ P value ,.05; N/S¼ not significant)




Dow

nloaded from



cells and schwannomas upon NF2 inactivation.48 In this report,we confirm that overexpression of YAP in the HEI193 humanschwannoma cell line induces PDGFRß mRNA and protein levels.

In addition, the overexpression of YAP strongly induces Her2 andHer3 levels in Hei193 cells. The fact that YAP is a cotranscriptionfactor, together with the decrease in mRNA levels in response to

Fig. 7. Model of signaling pathway regulation in human schwannomas. When expressed in Schwann cells, merlin inhibits growth factor receptordelivery at the plasma membrane, as we previously demonstrated (1). Merlin also blocks YAP nuclear accumulation (2) leading to the inhibition ofproliferation (3). In schwannomas, where merlin expression is lost (4), YAP accumulates in the nucleus (5) and stimulates the expression of PDGFRß,Her2, Her3, and possibly Axl as well as some of their ligands such as PDGF and Gas6 (6). In the absence of merlin, these receptors accumulate at the cellsurface (7) where they stimulate mitogenic signaling pathway (8) proliferation and survival (9). In parallel, Tie2 expression may stimulate thedevelopment of new blood vessels (10) contributing to tumor development.




Dow

nloaded from



YAP inhibitor verteporfin, supports the idea that Her3 and PDGFRßcould be transcriptional targets of YAP/Tead in schwannomas. In-deed, promoter sequence analysis shows several Tead-bindingsequences for PDGFRß and Her3 (data not shown). The absenceof Her2 response to verteporfin suggests that Her2 expressionrequires a DNA binding partner distinct from Tead. Due to thelack of antibodies specific enough, we could not use RPPA toevaluate whether Axl expression was linked to Ki67 or to othermarkers. However, Axl receptor and its ligand Gas6 were previous-ly shown to be bona fide target genes of YAP.25 Taken together,our observations strongly suggest that the proliferation oftumor cells in human schwannomas is, at least in part, underthe control of a signaling module where the Hippo effector YAPstimulates the expression of several target genes, notably Her3,PDGFRß, PDGF, and probably Her2 and Axl. These receptors,once activated by their ligands (some of which are known targetsof YAP) would stimulate mitogenic downstream signaling path-ways that contribute to tumor growth (see Fig. 7 for a model).

Schwannomas are usually considered to be a histologicallyhomogenous type of tumor. However, their response to anti-VEGFor anti-Her2 therapies proved to be variable. One parameter thatmay account for this result is the heterogeneity in the expressionlevel of the target proteins. This is likely to be an important par-ameter for evaluating a candidate therapeutic target. Our IHCstudy of human schwannomas has shown that these tumorsare remarkably heterogeneous in the expression of most signal-ing effectors as tested. Although they were detected in almost alltumors, the percentage of positive cells was frequently less than50% and some even less than 25%. We can only speculate aboutthe origins of this observed variability, but our results suggest thata therapeutic strategy focusing on a single target is unlikely to beefficacious for the majority of patients. Indeed, this prediction hasbeen confirmed by the results of a clinical trial targeting Her2.37

One option for overcoming this limitation could be to target sev-eral pathways simultaneously. In this case, inhibiting targets thatare not coregulated in the tumors might prove to be the most ef-ficient strategy.

Altogether, our work shows that combining proteomic strat-egies to measure protein expression and activity in NF2- deficienttumors is a powerful approach for identifying and evaluating can-didate therapeutic targets. It also provides important clues thatcan be used to better understand the mechanisms that promotetumor growth. This type of analysis could also be used to studyother NF2-deficient tumors such as meningiomas or ependymo-mas. Their comparison with schwannomas could tell if the forcesthat sustain tumor growth are common. Similarly, comparingsporadic to inherited tumors, or NF2-deficient to NF2-expressingtumors would certainly provide important informations on themechanisms of tumor development and the role of Merlin inthis process. Finally, a proteomic study comparing schwannomasand meningiomas would certainly lead to the identification oftherapeutic targets common to both types of tumors. Thiswould be of great relevance for NF2 patients who frequently de-velop several tumors of both types simultaneously.

Supplementary MaterialSupplementary material is available online at Neuro-Oncology(http://neuro-oncology.oxfordjournals.org/).

FundingThis work was supported by Institut National du Cancer (INCA), Associ-ation pour la recherche sur le Cancer (ARC), Ligue contre le Cancer (LCCto A.B.), Association Neurofibromatose et Recklinghausen (ANR).

AcknowledgmentsWe are grateful to Fatima Mechta-Grigoriou for her help, fruitfuldiscussions, and comments. We would like to thank Bruno Tesson foradvice on statistical analysis; Aurelie Barbet, Lamine Coulibaly, andEmily Henry for RPPA experiments; and Fanny Coffin from the Bio-informatics and Computational Systems Biology of Cancer at CurieInstitute for RPPA data normalization. We are indebted to SandrineCouroble and Sylvie Mosnier for their skillful assistance in TMAconstruction and IHC preparation. We gratefully acknowledge the tumorbiobank “Tissutheque Beaujon” (Pathology Department, BeaujonHospital) for technical support. We thank Marco Giovannini and FabriceChareyre for providing HEI193 cells.

Conflict of interest statement: none declared.

References1. Asthagiri AR, Parry DM, Butman JA, et al. Neurofibromatosis type 2.

Lancet. 2009;373(9679):1974–1986.

2. Rouleau GA, Merel P, Lutchman M, et al. Alteration in a new geneencoding a putative membrane-organizing protein causesneuro-fibromatosis type 2. Nature. 1993;363(6429):515–521.

3. Morrison H, Sperka T, Manent J, et al. Merlin/neurofibromatosis type 2suppresses growth by inhibiting the activation of Ras and Rac. CancerRes. 2007;67(2):520–527.

4. Shaw RJ, Paez JG, Curto M, et al. The Nf2 tumor suppressor, merlin,functions in Rac-dependent signaling. Dev Cell. 2001;1(1):63–72.

5. Curto M, Cole BK, Lallemand D, et al. Contact-dependent inhibition ofEGFR signaling by Nf2/Merlin. J Cell Biol. 2007;177(5):893–903.

6. Maitra S, Kulikauskas RM, Gavilan H, et al. The tumor suppressorsMerlin and Expanded function cooperatively to modulate receptorendocytosis and signaling. Curr Biol. 2006;16(7):702–709.

7. Lallemand D, Curto M, Saotome I, et al. NF2 deficiency promotestumorigenesis and metastasis by destabilizing adherens junctions.Genes Dev. 2003;17(9):1090–1100.

8. Li W, You L, Cooper J, et al. Merlin/NF2 suppresses tumorigenesis byinhibiting the E3 ubiquitin ligase CRL4(DCAF1) in the nucleus. Cell.2010;140(4):477–490.

9. Hamaratoglu F, Willecke M, Kango-Singh M, et al. Thetumour-suppressor genes NF2/Merlin and Expanded act throughHippo signalling to regulate cell proliferation and apoptosis. NatCell Biol. 2006;8(1):27–36.

10. Yu J, Zheng Y, Dong J, et al. Kibra functions as a tumor suppressorprotein that regulates Hippo signaling in conjunction with Merlinand Expanded. Dev Cell. 2010;18(2):288–299.

11. Zhang N, Bai H, David KK, et al. The Merlin/NF2 tumor suppressorfunctions through the YAP oncoprotein to regulate tissuehomeostasis in mammals. Dev Cell. 2010;19(1):27–38.

12. Zhao B, Wei X, Li W, et al. Inactivation of YAP oncoprotein by theHippo pathway is involved in cell contact inhibition and tissuegrowth control. Genes Dev. 2007;21(21):2747–2761.




Dow

nloaded from








13. Zhao B, Kim J, Ye X, et al. Both TEAD-binding and WW domains arerequired for the growth stimulation and oncogenic transformationactivity of yes-associated protein. Cancer Res. 2009;69(3):1089–1098.

14. Ammoun S, Hanemann CO. Emerging therapeutic targets inschwannomas and other merlin-deficient tumors. Nat Rev Neurol.2011;7(7):392–399.

15. Kaempchen K, Mielke K, Utermark T, et al. Upregulation of the Rac1/JNK signaling pathway in primary human schwannoma cells. HumMol Genet. 2003;12(11):1211–1221.

16. Ammoun S, Provenzano L, Zhou L, et al. Axl/Gas6/NFkB signalling inschwannoma pathological proliferation, adhesion and survival.Oncogene. 2013;33(3):336–346.

17. Hilton DA, Ristic N, Hanemann CO. Activation of ERK, AKT and JNKsignalling pathways in human schwannomas in situ.Histopathology. 2009;55(6):744–749.

18. Hansen MR, Linthicum FH Jr. Expression of neuregulin and activationof erbB receptors in vestibular schwannomas: possible autocrineloop stimulation. Otol Neurotol. 2004;25(2):155–159.

19. Plotkin SR, Stemmer-Rachamimov AO, Barker FG 2nd., et al. Hearingimprovement after bevacizumab in patients with neurofibromatosistype 2. N Engl J Med. 2009;361(4):358–367.

20. Gujral TS, Karp RL, Finski A, et al. Profiling phospho-signalingnetworks in breast cancer using reverse-phase protein arrays.Oncogene. 2012;32(29):3470–3476.

21. Scoles DR, Nguyen VD, Qin Y, et al. Neurofibromatosis 2 (NF2) tumorsuppressor schwannomin and its interacting protein HRS regulateSTAT signaling. Hum Mol Genet. 2002;11(25):3179–3189.

22. James MF, Han S, Polizzano C, et al. NF2/merlin is a novel negativeregulator of mTOR complex 1, and activation of mTORC1 isassociated with meningioma and schwannoma growth. Mol CellBiol. 2009;29(15):4250–4261.

23. Bosco EE, Nakai Y, Hennigan RF, et al. NF2-deficient cells depend onthe Rac1-canonical Wnt signaling pathway to promote the loss ofcontact inhibition of proliferation. Oncogene. 2010;29(17):2540–2549.

24. Hao Y, Chun A, Cheung K, et al. Tumor suppressor LATS1 is a negativeregulator of oncogene YAP. J Biol Chem. 2008;283(9):5496–5509.

25. Xu MZ, Chan SW, Liu AM, et al. AXL receptor kinase is a mediator ofYAP-dependent oncogenic functions in hepatocellular carcinoma.Oncogene. 2011;30(10):1229–1240.

26. Zhao B, Ye X, Yu J, et al. TEAD mediates YAP-dependent geneinduction and growth control. Genes Dev. 2008;22(14):1962–1971.

27. Hung G, Li X, Faudoa R, et al. Establishment and characterization of aschwannoma cell line from a patient with neurofibromatosis 2. Int JOncol. 2002;20(3):475–482.

28. Doherty JK, Ongkeko W, Crawley B, et al. ErbB and Nrg: potentialmolecular targets for vestibular schwannoma pharmacotherapy.Otol Neurotol. 2008;29(1):50–57.

29. Ammoun S, Cunliffe CH, Allen JC, et al. ErbB/HER receptor activationand preclinical efficacy of lapatinib in vestibular schwannoma. NeuroOncol. 2010;12(8):834–843.

30. Hansen MR, Roehm PC, Chatterjee P, et al. Constitutive neuregulin-1/ErbB signaling contributes to human vestibular schwannomaproliferation. Glia. 2006;53(6):593–600.

31. Hynes NE, Horsch K, Olayioye MA, et al. The ErbB receptor tyrosinefamily as signal integrators. Endocr Relat Cancer. 2001;8(3):151–159.

32. Engelman JA, Zejnullahu K, Mitsudomi T, et al. MET amplificationleads to gefitinib resistance in lung cancer by activating ERBB3signaling. Science. 2007;316(5827):1039–1043.

33. Moriyama T, Kataoka H, Kawano H, et al. Comparative analysis ofexpression of hepatocyte growth factor and its receptor, c-met, ingliomas, meningiomas and schwannomas in humans. Cancer Lett.1998;124(2):149–155.

34. Torres-Martin M, Lassaletta L, San-Roman-Montero J, et al.Microarray analysis of gene expression in vestibular schwannomasreveals SPP1/MET signaling pathway and androgen receptorderegulation. Int J Oncol. 2013;42(3):848–862.

35. Wickremesekera A, Hovens CM, Kaye AH. Expression of ErbB-1 and 2in vestibular schwannomas. J Clin Neurosci. 2007;14(12):1199–1206.

36. Plotkin SR, Halpin C, McKenna MJ, et al. Erlotinib for progressivevestibular schwannoma in neurofibromatosis 2 patients. OtolNeurotol. 2010;31(7):1135–1143.

37. Karajannis MA, Legault G, Hagiwara M, et al. Phase II trial of lapatinibin adult and pediatric patients with neurofibromatosis type 2 andprogressive vestibular schwannomas. Neuro Oncol. 2012;14(9):1163–1170.

38. Plotkin SR, Merker VL, Halpin C, et al. Bevacizumab for progressivevestibular schwannoma in neurofibromatosis type 2: aretrospective review of 31 patients. Otol Neurotol. 2012;33(6):1046–1052.

39. Verma A, Warner SL, Vankayalapati H, et al. Targeting Axl and Merkinases in cancer. Mol Cancer Ther. 2011;10(10):1763–1773.

40. Li R, Chen J, Hammonds G, et al. Identification of Gas6 as a growthfactor for human Schwann cells. J Neurosci. 1996;16(6):2012–2019.

41. Li Y, Ye X, Tan C, et al. Axl as a potential therapeutic target in cancer:role of Axl in tumor growth, metastasis and angiogenesis. Oncogene.2009;28(39):3442–3455.

42. Hashizume H, Falcon BL, Kuroda T, et al. Complementary Actions ofInhibitors of Angiopoietin-2 and VEGF on Tumor Angiogenesis andGrowth. Cancer Res. 2010;70(6):2213–2223.

43. Gujral TS, Karp RL, Finski A, et al. Profiling phospho-signalingnetworks in breast cancer using reverse-phase protein arrays.Oncogene. 2012;32(29):3470–3476.

44. Frank DA. STAT3 as a central mediator of neoplastic cellulartransformation. Cancer Lett. 2007;251(2):199–210.

45. Pectasides E, Egloff AM, Sasaki C, et al. Nuclear localization of signaltransducer and activator of transcription 3 in head and necksquamous cell carcinoma is associated with a better prognosis.Clin Cancer Res. 2010;16(8):2427–2434.

46. Zhao B, Li L, Tumaneng K, et al. A coordinated phosphorylation byLats and CK1 regulates YAP stability through SCFb-TRCP. GenesDev. 2010;24(1):72–85.

47. Nguyen HB, Babcock JT, Wells CD, et al. LKB1 tumor suppressorregulates AMP kinase/mTOR-independent cell growth andproliferation via the phosphorylation of Yap. Oncogene. 2012;32(35):4100–4109.

48. Lallemand D, Manent J, Couvelard A, et al. Merlin regulatestransmembrane receptor accumulation and signaling at theplasma membrane in primary mouse Schwann cells and in humanschwannomas. Oncogene. 2009;28(6):854–865.

49. Troncale S, Barbet A, Coulibaly L, et al. NormaCurve: aSuperCurve-based method that simultaneously quantifies andnormalizes reverse phase protein array data. PLoS One. 2012;7(6):e38686.




Dow

nloaded from



Proteomic screening identifies a YAP-driven signaling network linked to tumor cell proliferation in...

Documents

Transcript of Proteomic screening identifies a YAP-driven signaling network linked to tumor cell proliferation in...