Production of antimicrobial metabolite from a local Penicillium sp. novel strain

Current Research in Microbiology and Biotechnology Vol. 3, No. 5 (2015): 725-732 Research Article Open Access

IISSSSNN:: 22332200--22224466

Production of antimicrobial metabolite from a local Penicillium sp. novel strain

Mohammed F. Al-Jawad1, Mohammad J. Al-Jassani2* and Rabab O. Al-Jelawi3

1 Green University of Al Qasim, Babylon, Iraq. 2 DNA research center, University of Babylon, P.O. Box 4, ‎Babylon, Iraq. 3 Department of Biology, College of Science, University of Babylon, P.O. Box 4, ‎Babylon, Iraq. * Corresponding author: Mohammad J. Al-Jassani; e-mail: [email protected]

ABSTRACT Fungi were the first producers of antibiotics since 1928. Penicillium is one of the most important antibiotic producers that need to be thoroughly investigated for antibiotic production. The effect of different pH, temperature and duration for production of the antimicrobial metabolite were investigated using four natural liquid media. The mold isolate (P1ROR) was identified morphologically and by sequencing the ITS region as a novel Penicillium sp. strain. The mold isolate was found active in producing an antibiotic against both pathogenic penicillin resistant bacteria and pathogenic molds. The potato infusion with added table sugar was the best and economic liquid medium for antimicrobial metabolite production, while the optimum fermentation conditions were pH 6.5 at 30°C for 5 days. The produced antimicrobial metabolite with its valuable properties is highly needed especially with the emergence of resistant strains and need to put in practice.

Keywords: Antimicrobial, Penicillium, novel strain, sequencing.

1. INTRODUCTION The term ‘antibiotic’ literally means ‘against life’, it defined as secondary metabolites isolated from microbe exhibit either antimicrobial (antibacterial, antifungal, antiprotozoal), antitumor and/or antiviral activities. More than 16500 antibiotics are known up to date where 29% of them produced by fungi [1]. The ability to produce antibiotics has been found mainly in molds of the order Aspergillales [2]. Perhaps one of the few most important discoveries regarding the beneficial use of fungi for humans was the identification in 1928 by Sir Alexander Fleming, that an isolate of Penicillium notatum produced a substance capable of killing Gram positive bacteria [3]. From that time, antibiotics produced by molds are widely used in current chemotherapy especially the penicillin, cephalosporin and fusidic acid, which have both antibacterial and antifungal activity [4]. Different species or strains of Penicillium is a producer of many antibiotics including antibacterial, antifungal and antitumor [5-7]. The internal transcribed spacer (ITS) region (i.e. ITS1, 5.8S and ITS2) of fungal rRNA genes is an increasingly used sequence region for fungal

molecular taxonomy studies for its high variability that yield more resolution [8; 9]. The ability of fungal strains to produce antimicrobial substances is influenced by different conditions of nutrition and cultivation significantly. Therefore, the medium constitution together with the metabolic capacity of the producing mold are significantly affect the synthesis of bioactive metabolites. Several environmental factors, such as temperature, pH, and incubation period, play the major role in the production of antimicrobial agent(s) [10]. The emergence of antibiotic resistant pathogenic strains made an urgent need for a new antibiotic discovery. The present study is an attempt for a new antibiotic producing mold screening, and optimization of culture conditions for production. In addition to, finding more efficient and economic medium for production because, cost-effectiveness is a crucial issue in the industrial field.

Received: 20 July 2015 Accepted: 16 August 2015 Online: 01 September 2015

http://crmb.aizeonpublishers.net/content/2015/5/crmb725-732.pdf 725

mailto:[email protected]

726 http://crmb.aizeonpublishers.net/content/2015/5/crmb725-732.pdf

Mohammed F. Al-Jawad et al. / Curr Res Microbiol Biotechnol. 2015, 3(5): 725-732

2. MATERIALS AND METHODS Pure alkaline (pH8) soil molds isolates, different pathogenic bacteria and molds (preserved in Amies transport medium (ATM)) were obtained from the biotechnology and genetic engineering advanced research unit, college of science, University of Babylon. 2.1 Screening for antagonistic activity 2.1.1 Primary screening Preliminary screening for antibacterial activity was done by the cross-streak method [11], on four readymade media, potato dextrose agar (PDA), trypticase soy agar (TSA), nutrient agar (NA) and Muller Hinton agar (MHA) (HIMEDIA, India), using phosphate buffer to maintain the pH 7. Purified fungi isolates from transport swab media were streaked across one-third of the plates then incubated at 27°C for 10 days. Test pathogenic bacteria (Staphylococcus aureus, Streptococcus pyogenes, Morganella morganii, E.coli and Pseudomonas aeruginosa), were streaked perpendicular to the fungus growth, and the plates were further incubated at 37°C for 24 h. The inhibitory effect was determined by the failure of the test bacteria to grow near producing mold. Crawford method was followed for primary screening of antifungal activity [12]. On the PDA, the purified molds isolates from transport swab media were streaked onto one side of the plates then incubated at 30°C for 72 h, or when the colonies are visible. Then, an agar plug from 10 day old culture of each test pathogenic mold (Microsporum canis and Trichophyton mentagrophytes) was transferred onto the opposite side of growth. Mold plugs were also placed on uninoculated PDA plates separately as a control. Plates

were incubated at 30°C for 5 days. The inhibitory effect was measured by calculating the difference between the radius of pathogenic fungus growth (y) in the test plate and the radius in the control plates (y0), where ∆y= y0 – y. 2.1.2 Secondary screening

The best antimicrobial producing mold isolate (P1ROR) was selected and appeared belongs to the genus Penicillium based on the growth color and light microscopy. Based on the diameter of inhibition zone, secondary antimicrobial screening was done under submerged fermentation conditions by agar well diffusion assay.grown in four liquid media (Table 1) with pH 8 at 30°C for 7 days. The infusion was prepared by adding 200g of potato or bran to 500ml of distilled water then boiled for 30 min then filtered used double layer of gauze. The volume was completed to 500ml with distilled water then autoclaved. Millipore filtered sugar solution was added to 1% final concentration. Potato infusion and wheat bran are very common in industrial production of antibiotics by mods [13]. In order to obtain the cell-free filtrate, the culture broth was centrifuged at 8000xg for 10 min then millipore filtered (0.22µm). On the MHA, the test microorganisms were streaked then wells (8.0 mm diameter, 2.0 cm apart) were cut using a sterile cork borer and 100 µl of the filtrate were loaded into each well. The plates were pre-incubated at 4°C for 2 h to allow uniform diffusion into the agar. After pre-incubation, the plates were incubated at 37°C for 24h for bacteria and at 30°C for 72 h for fungi. The antimicrobial activity was evaluated by measuring of inhibition zone diameter.

Table 1: Liquid media used in secondary screening.

Media Composition A 1% Table sugar + potato infusion B 1% Glucose + potato infusion C 1% Table sugar + bran infusion D 1% Glucose + bran infusion

2.2 Optimization of pH, temperature and duration of antibiotic production One representative microorganism of the sensitive bacteria and molds were chosen for this experiment. The pH levels of production media were adjusted from 6 to 9, by using phosphate buffer for pH (6, 6.5,7, 7.5 and 8) and glycine buffer for pH (8.5, 9, 9.5 and 10) to study the impact of pH. Similarly, the optimum temperature for bioactive metabolite yield was measured ‎by incubating the production medium at temperatures ranging from 10°C to 50°C. While ‎maintaining all other conditions at optimum levels, production media were inoculated with the selected mold producer and ‎assayed for antibiotic production daily, for 14 days.‎

2.3 Molecular Identification of the selected active isolate 2.3.1 Genomic DNA extraction The P1ROR isolate was cultured on Luria Bertani (LB) agar (Sigma-Aldrich, USA) for a week at 30ºC. Power Soil™ DNA isolation Kit (Mo Bio Laboratories, Inc.) found more effective and it was used for DNA extraction and purification utilizing the beads power, that was indicated to be very effective at lysing mold cells [14]. FastPrep FP120 (Bio101 Savant Instruments, Inc., Holbrook, NY) device was used at speed 5 for 30 seconds for disruption of cell membrane in the presence of SDS and PCR inhibitors removals. The extraction procedure was followed according to the manufacturer instructions. The concentration of DNA and purity were measured using the nanodrop ND-



1000 spectrophotometer (Fermentas scientific, Inc.). The extracted DNA was kept at -20ºC in aliquots. 2.3.2 Polymerase Chain Reaction (PCR) PCR reactions were conducted using iCycler Thermal Cycler (Bio-Rad, USA Laboratories, Inc.). ITS rRNA genes were amplified using primers ITS1 and ITS4 (Sentromer DNA Technologies LTD., Istanbul, Turkey) (Table 2), as described previously by [15]. An optimized recipe was used in the PCR reaction (Table 3). About 500-800 bp of the internal transcribed spacer

(ITS) region of fungal rRNA genes was amplified using the fungal universal primers ITS1 as a forward primer and ITS4 as a reverse primer. The cycle conditions, pre-denaturation at 95ºC for 10 min.; 35 cycles of (denaturation at 94 ºC for 1 min, annealing at 50ºC for 2 min and extension at 72ºC for 2 min); final extension at 72ºC for 10 min followed by holding at 4ºC. A 10µl portion of the amplicon was electrophoresed through a 1% agarose gel to check the band size.

Table 2: Primers used in this study.

Primer name Sequence Tm (ºC)

ITS1 5` TCCGTAGGTGAACCTGCGG 3` 61

ITS4 5` TCCTCCGCTTATTGATATGC 3` 55.3

Table 3: Components of a single 25µl PCR master mix.

Reagent Volume (µl) Final concentration Water (sterile, nuclease free) 12.925

10X PCR buffer (Fermentas) 2.5 1X MgCl2 (25 mM) (Fermentas) 1 1 mM dNTP mixture (25 mM each) (Fermentas) 0.2 0.2 mM Primer E8F (10 mM) 0.5 0.2 mM Primer E939R (10 mM) 0.5 0.2 mM Taq DNA polymerase (recombinant) (5U/ml) (Fermentas) 0.125 0.03 U/ml Betaine (12.5 M) (Sigma-Aldrich, USA)a 2 1 M BSA (10 mg/ml) (Sigma-Aldrich, USA)b 0.25 0.1 mg/ml DNA template (20-40 ng/ml) 5 0.8-1.6 Total 25

2.4 Sequencing The purified PCR product of the mold isolate was subjected to the sequencing reaction following the manufacturer’s recommendation using the BigDye® Terminator v3.1 sequencing reaction Kit (Applied Biosystems, Foster City, CA, USA). The reaction mix was set up in 10μl final reaction (Table 4). ITS4 primer was used for partial ITS region sequencing of the selected mold isolate. The reaction tubes then transferred to the BioRad C1000 thermal cycler (BioRad Laboratories, Inc.). The sequencing reaction and cycle conditions were optimized and as the following: Pre-denaturation at 98ºC for 5min; 30 cycles of (denaturation at 96ºC for 20sec., annealing at 56ºC for10 sec., extension at 60ºC for 4min.); final extension at 60ºC for 5min then hold at 4ºC. The BigDye terminator ready reaction mix was added after the pre-denaturation step. The sequencing product was purified using Sephadex G-50 (Sigma-Aldrich, USA) with a spin column. The collected DNA was transferred to the ABI prism 3130XL genetic analyzer (Applied Biosystems, Foster City, CA, USA) for sequence recording.

Sequencing results were analyzed for chimeras using Bellerophon program [16]. Sequence similarity was accomplished through sequence alignment to the existing relevant sequences available in the database at National Center for Biotechnology Information (NCBl) using the BLAST (Basic Local Alignment Search Tool) program: BLASTN 2.2.27+ [17] Biotechnology Information (www.ncbi.nlm.nih.gov) online gene database to determine taxonomic classification. A Phylogenetic neighbor-joining tree was constructed by MEGA version 5 software [18] using the method of Saitou and Nei [19].

3. RESULTS AND DISCUSSION 3.1 Antibacterial primary screening The results showed that S. aureus and S. pyogenes were inhibited on PDA by the isolate ‎P1ROR, whilst other media (TSA, NA and MHA) did not prompt the isolate to produce antibiotics (Figure 1) which agrees with what previously found that PDA is the best medium for mold antibiotic primary screening [20]. In contrast, the isolate did not show any antagonistic activity against the rest of pathogenic bacteria (M. morganii, E. coli and P. aeruginosa) on all four media.

Table 4: BigDye terminator Cycle Sequencing Reaction Sequencing components.

Reagent Volume (µl)

Purified PCR product (~25 ng) 4 Primer (3.2 pmol/µl) 1 (5X) BigDye Sequencing Buffer 1 BigDye Terminator v3.1 ready reaction mix 4 Total 10



Figure 1: The primary screening of the isolate ‎P1ROR against S. aureus (left) and‎ S. pyogenes (right). A: The isolate ‎P1ROR with

the pathogenic bacteria. B: Control (without producer).

Figure 2: The secondary screening of the isolate ‎P1ROR against M. canis (left) and T. mentagrophytes (right). A: The isolate

‎P1ROR with the pathogenic fungi. B: Control (without producer).

3.2 Antifungal primary screening Antifungal primary screening assays revealed that M. canis and T. mentagrophytes strongly inhibited by the isolate ‎P1ROR on PDA (Figure 2), the inhibition zone (∆y) value of pathogenic fungi was more than 2 cm. 3.3 Antibacterial secondary screening The results showed that filtered supernatant of media had no antagonistic activity against M. morganii, E. coli and P. aeruginosa. While other tested microorganisms showed variable sensitivity (Figure 3). The pathogenic

molds, M canis. and T. mentagrophytes, were inhibited only by filtered supernatant of media A (table sugar + potato infusion) with inhibition zone 2.5 cm for both (Figure 4). At the same time, the media A gave the highest antimicrobial activity against S. aureus and S. pyogenes with inhibition zone 3.3 and 2.8 cm respectively (Figure 5). This medium is more economic than potato dextrose broth that was used for antibiotics production by (15). In contrast, the lowest antimicrobial activity value against all pathogenic microorganisms was obtained at the media type D.

A B

A B



Figure 3: Antimicrobial secondary screening test for ‎P1ROR isolate.

Figure 4: The antifungal activity of medium A extract. A: M canis. B: T. mentagrophytes.

Figure 5: The effect of medium A extract on A: S. aureus and B: S. pyogenes.

3.4 Optimization of production period There was no production on the first two days but the antibiotic was produced on the third day with moderate antimicrobial activity. On the fifth day of

fermentation, the highest antimicrobial activity was achieved with inhibition zone diameter of 3.3 cm for S. aureus and 2.5 for M. canis and this continued till the fourteenth day (Figure 6).

Figure 6: Antibiotic production at different incubation time.

3.5 Optimization of temperature The lowest activity of antibiotic was recorded at 40°C, while the optimum activity was determined at 30°C where the inhibition zone diameter was 3.3 cm for S.

aureus and 2.5 for M. canis. while there was no production at 10°C and 50°C (Figure 7). 3.6 Optimization of pH The antimicrobial activity ranged from pH 6-8 and the highest activity was recorded at pH 6.5 with inhibition

A B

A B



zone 3.5cm for S. aureus and 2.8cm for M. canis, but the activity decreased with high neutral conditions and no

activity was found with alkaline conditions (Figure 8).

Figure 7: Antibiotic production at different temperatures.

Figure 8: Antibiotic production at different pH.

3.7 Molecular Identification of the P1ROR isolate A 418 bp of a good sequence was obtained for internal transcribed spacer 1 (partial sequence, 5.8S ribosomal RNA gene (complete sequence) and internal transcribed spacer 2 (partial sequence) of the P1ROR isolate that aligned to get the nearest relative with the highest similarity and the Neighbor-joining (NJ) tree was generated (Figure 9).‎ No chimeric sequences detected. Sequence have been deposited and registered in the GenBank database under the accession number KC702801.1. The P1ROR isolate was identified as Penicillium sp. and showed 99% similarity with the nearest neighbor Penicillium chrysogenum. Add to that, the NJ tree

showed that the P1ROR isolate appeared in a separate cluster (dark dot) which indicates that it is a novel strain.

4. CONCLUSION The results revealed that this novel mold is very active in antibiotic(s) production on a very economic medium and under moderate conditions which are very valuable industrially. The produced antibiotic(s) need further prospective purification and characterization studies in order to be put in practice. Add to that, more productive microbes worth to be mined.



Figure 9: Neighbor-joining tree of the P1ROR isolate. The species from which strains were isolated, strain number and GenBank

accession numbers are mentioned.

5. REFERENCES 1. Bérdy J (2005). Bioactive Microbial Metabolites. J. Antibiot.

58(1): 1–26. 2. Schlegel HG. (2003). General Microbiology, 7th ed. Cambridge

University Press, Cambridge, pp. 370. 3. Dutta AC (2005). Botany for Degree Students 18th ed. Oxford

University Press, New York, pp. 448-449. 4. Dobashi K, Matsuda N, Hamada M, et. al. (1998). Novel

antifungal antibiotics octacosamicins A and B: Taxonomy,

fermentation and isolation, physicochemical properties and biological activities. J. Antibiotics. 41: 1525-1532,

5. Rifkind D, Freeman G (2005). The Nobel Prize Winning Discoveries in Infectious Diseases. London, UK: Academic Press. pp. 43–46.

6. De Carli L, Larizza L (1988). Griseofulvin. Mutation research 195(2): 91–126.

7. Nicoletti R, Buommino E, De Filippis A et. al. (2009). Bioprospecting for antagonistic Penicillium strains as a



© 2015; AIZEON Publishers; All Rights Reserved

This is an Open Access article distributed under the terms of the Creative Commons Attribution License which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

resource of new antitumor compounds". World Journal of Microbiology. 24 (2): 185–95.

8. Torzilli AP, Sikaroodi M, Chalkley D, Gillevet PM (2006). A ‎comparison of fungal communities from four salt marsh plants using ‎automated ribosomal intergenic spacer analysis (ARISA). Mycologia, 98: ‎‎690-698.‎

9. Midgley DJ, Saleeba J A; Stewart MI et. al (2007). Molecular diversity of soil basidiomycete communities in northern-central New South Wales, Australia. Myco. Res., 111: 370-378.

10. Iwai Y and Omura S (1982). Culture conditions for screening of new antibiotics. J Antibiot (Tokyo). 35(2):123-41,

11. Madigan MT, Martinko JM, Stahl DA, Clark DP (2012). Commercial Products and Biotechnology. In Brock biology of microorganisms. 13th ed. Benjamin cumings.pp. 415-416,

12. Crawford DL, Lynch JM, Whipps JM, Ousley MA (1993). Isolation and characterization of actinomycete antagonists of a fungal root pathogen. Appl Environ Microbiol., 59:3899–3905

13. Jain P, Pundir RK (2011). Effect of fermentation medium, pH and temperature variations on antibacterial soil fungal metabolite production. J. of Agri. Tech., 2011 Vol. 7(2): 247-269.

14. Schloss PD, Hay GA, Wilson DB et. al. (2005). Quantifying bacterial population dynamics in compost using 16S rRNA gene probes. Appl. Microbiol. Biotechnol., 66: 457-463.

15. White TJ, Bruns T; Lee S, Taylor JW (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for

phylogenetics. In: PCR Protocols: A Guide to Methods and Applications, eds. Innis, M. A.; Gelfand, D. H.; Sninsky, J. J. and White, T. J. Academic Press Inc., New York. pp. 315-322.

16. Huber T, Faulkner G, Hugenholtz P (2004). Bellerophon: a program to detect chimeric sequences in multiple sequence alignments, Bioinformatics., 20: 2317-2319.

17. Zheng Z, Scott S, Lukas W, Webb M (2000). A greedy algorithm for aligning DNA sequences. J. Comput., Biol., 7(1-2): 203-214.

18. Tamura K, Peterson D, Peterson N et. al. (2011). MEGA5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Mol. Biol. Evol., 28: 2731-2739.

19. Saitou N, Nei M (1987). The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol., 4: 406-425.‎

20. Pereira E, Santos A, Reis F et. al. (2013). A new effective assay to detect antimicrobial activity of filamentous fungi. Microbiol Res.; 168(1):1-5.

*****

Production of antimicrobial metabolite from a local Penicillium sp. novel strain

Documents

Transcript of Production of antimicrobial metabolite from a local Penicillium sp. novel strain